>Feature sequence01 857 144 gene locus_tag LOCUS_00010 857 144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869391.1 protein_id gnl|my_center|LOCUS_00010 1692 850 gene locus_tag LOCUS_00020 1692 850 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_00020 3058 1685 gene locus_tag LOCUS_00030 3058 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3941 3063 gene locus_tag LOCUS_00040 3941 3063 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_00040 5355 4138 gene locus_tag LOCUS_00050 5355 4138 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_00050 7661 5820 gene locus_tag LOCUS_00060 gene ftsH 7661 5820 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_00060 8248 7697 gene locus_tag LOCUS_00070 gene hpt 8248 7697 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_00070 9570 8245 gene locus_tag LOCUS_00080 gene tilS 9570 8245 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_00080 10930 9575 gene locus_tag LOCUS_00090 gene dnaB 10930 9575 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_00090 11233 10970 gene locus_tag LOCUS_00100 11233 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11728 11282 gene locus_tag LOCUS_00110 gene rplI 11728 11282 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_00110 13757 11772 gene locus_tag LOCUS_00120 13757 11772 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_00120 14297 15955 gene locus_tag LOCUS_00130 14297 15955 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_00130 16114 16656 gene locus_tag LOCUS_00140 gene spoVT 16114 16656 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_00140 17625 16738 gene locus_tag LOCUS_00150 17625 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17843 18196 gene locus_tag LOCUS_00160 17843 18196 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072849092.1 protein_id gnl|my_center|LOCUS_00160 18198 18554 gene locus_tag LOCUS_00170 18198 18554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18896 18651 gene locus_tag LOCUS_00180 18896 18651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19345 18890 gene locus_tag LOCUS_00190 19345 18890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19979 19368 gene locus_tag LOCUS_00200 19979 19368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 21106 20069 gene locus_tag LOCUS_00210 21106 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23019 21121 gene locus_tag LOCUS_00220 gene flgK 23019 21121 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965510.1 protein_id gnl|my_center|LOCUS_00220 23529 23050 gene locus_tag LOCUS_00230 23529 23050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23840 23526 gene locus_tag LOCUS_00240 23840 23526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25412 24339 gene locus_tag LOCUS_00250 gene cheB 25412 24339 CDS product protein-glutamate O-methylesterase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970952.1 protein_id gnl|my_center|LOCUS_00250 26312 25461 gene locus_tag LOCUS_00260 26312 25461 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_00260 26716 26315 gene locus_tag LOCUS_00270 26716 26315 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439100.1 protein_id gnl|my_center|LOCUS_00270 28949 26814 gene locus_tag LOCUS_00280 28949 26814 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_00280 29210 30670 gene locus_tag LOCUS_00290 29210 30670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 30657 31001 gene locus_tag LOCUS_00300 30657 31001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 31001 31591 gene locus_tag LOCUS_00310 31001 31591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 31639 36513 gene locus_tag LOCUS_00320 31639 36513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36550 39912 gene locus_tag LOCUS_00330 36550 39912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 39954 40667 gene locus_tag LOCUS_00340 39954 40667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41066 41680 gene locus_tag LOCUS_00350 41066 41680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42577 41753 gene locus_tag LOCUS_00360 gene rlmA 42577 41753 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096129.1 protein_id gnl|my_center|LOCUS_00360 43970 42582 gene locus_tag LOCUS_00370 43970 42582 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_00370 45158 44025 gene locus_tag LOCUS_00380 45158 44025 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965532.1 protein_id gnl|my_center|LOCUS_00380 45321 46616 gene locus_tag LOCUS_00390 gene mtaB 45321 46616 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048000.1 protein_id gnl|my_center|LOCUS_00390 46613 47188 gene locus_tag LOCUS_00400 gene yfbR 46613 47188 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813854.1 protein_id gnl|my_center|LOCUS_00400 47492 47358 gene locus_tag LOCUS_00410 47492 47358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 49723 47528 gene locus_tag LOCUS_00420 gene feoB 49723 47528 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_00420 50048 49827 gene locus_tag LOCUS_00430 50048 49827 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_00430 50278 50066 gene locus_tag LOCUS_00440 50278 50066 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_00440 51047 50697 gene locus_tag LOCUS_00450 51047 50697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 51734 51261 gene locus_tag LOCUS_00460 51734 51261 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228021.1 protein_id gnl|my_center|LOCUS_00460 52623 51808 gene locus_tag LOCUS_00470 52623 51808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_00470 53312 52617 gene locus_tag LOCUS_00480 53312 52617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_00480 53685 53293 gene locus_tag LOCUS_00490 53685 53293 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816592.1 protein_id gnl|my_center|LOCUS_00490 54729 53884 gene locus_tag LOCUS_00500 54729 53884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56084 54768 gene locus_tag LOCUS_00510 56084 54768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 56941 56081 gene locus_tag LOCUS_00520 56941 56081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 57156 58292 gene locus_tag LOCUS_00530 57156 58292 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_00530 60542 58470 gene locus_tag LOCUS_00540 gene fusA 60542 58470 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_00540 62858 60762 gene locus_tag LOCUS_00550 62858 60762 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966093.1 protein_id gnl|my_center|LOCUS_00550 64140 62938 gene locus_tag LOCUS_00560 64140 62938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 64967 64137 gene locus_tag LOCUS_00570 64967 64137 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_00570 65115 65198 gene locus_tag LOCUS_t00010 65115 65198 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 66207 65788 gene locus_tag LOCUS_00580 66207 65788 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_00580 67696 66227 gene locus_tag LOCUS_00590 67696 66227 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919362.1 protein_id gnl|my_center|LOCUS_00590 69174 67693 gene locus_tag LOCUS_00600 69174 67693 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964014.1 protein_id gnl|my_center|LOCUS_00600 70366 69176 gene locus_tag LOCUS_00610 70366 69176 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_00610 71800 70379 gene locus_tag LOCUS_00620 gene uxaC 71800 70379 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964011.1 protein_id gnl|my_center|LOCUS_00620 72936 71869 gene locus_tag LOCUS_00630 72936 71869 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_00630 73964 72942 gene locus_tag LOCUS_00640 73964 72942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 74953 73994 gene locus_tag LOCUS_00650 74953 73994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 75630 75091 gene locus_tag LOCUS_00660 75630 75091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 76073 77131 gene locus_tag LOCUS_00670 76073 77131 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_00670 77241 77789 gene locus_tag LOCUS_00680 77241 77789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 77789 79102 gene locus_tag LOCUS_00690 77789 79102 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898268.1 protein_id gnl|my_center|LOCUS_00690 79131 80213 gene locus_tag LOCUS_00700 gene uxuA 79131 80213 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391968.1 protein_id gnl|my_center|LOCUS_00700 80227 81843 gene locus_tag LOCUS_00710 80227 81843 CDS product mannitol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054937112.1 protein_id gnl|my_center|LOCUS_00710 81919 82593 gene locus_tag LOCUS_00720 81919 82593 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083214.1 protein_id gnl|my_center|LOCUS_00720 82658 83002 gene locus_tag LOCUS_00730 82658 83002 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467181.1 protein_id gnl|my_center|LOCUS_00730 83025 83867 gene locus_tag LOCUS_00740 gene kduI 83025 83867 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210829.1 protein_id gnl|my_center|LOCUS_00740 83882 84682 gene locus_tag LOCUS_00750 83882 84682 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185874.1 protein_id gnl|my_center|LOCUS_00750 87035 84816 gene locus_tag LOCUS_00760 87035 84816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 87238 87963 gene locus_tag LOCUS_00770 87238 87963 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_00770 87956 88618 gene locus_tag LOCUS_00780 87956 88618 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_00780 88669 89343 gene locus_tag LOCUS_00790 88669 89343 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_00790 89340 90818 gene locus_tag LOCUS_00800 89340 90818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 92838 90874 gene locus_tag LOCUS_00810 92838 90874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 95009 92835 gene locus_tag LOCUS_00820 95009 92835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 95752 95021 gene locus_tag LOCUS_00830 95752 95021 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_00830 96712 95897 gene locus_tag LOCUS_00840 96712 95897 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805101.1 protein_id gnl|my_center|LOCUS_00840 97247 96849 gene locus_tag LOCUS_00850 97247 96849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 97407 98321 gene locus_tag LOCUS_00860 97407 98321 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068301.1 protein_id gnl|my_center|LOCUS_00860 98400 99041 gene locus_tag LOCUS_00870 98400 99041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 99034 99261 gene locus_tag LOCUS_00880 99034 99261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 100411 99749 gene locus_tag LOCUS_00890 100411 99749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 100674 100408 gene locus_tag LOCUS_00900 100674 100408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 101060 100725 gene locus_tag LOCUS_00910 101060 100725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 101413 101111 gene locus_tag LOCUS_00920 101413 101111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 101728 102639 gene locus_tag LOCUS_00930 101728 102639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 109999 102698 gene locus_tag LOCUS_00940 109999 102698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 112644 111175 gene locus_tag LOCUS_00950 112644 111175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 113040 112648 gene locus_tag LOCUS_00960 113040 112648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 114590 113040 gene locus_tag LOCUS_00970 114590 113040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 114939 114592 gene locus_tag LOCUS_00980 114939 114592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 115118 114939 gene locus_tag LOCUS_00990 115118 114939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 115405 115118 gene locus_tag LOCUS_01000 115405 115118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 117459 115408 gene locus_tag LOCUS_01010 117459 115408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 118067 117585 gene locus_tag LOCUS_01020 118067 117585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 119170 118094 gene locus_tag LOCUS_01030 119170 118094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 120196 119213 gene locus_tag LOCUS_01040 120196 119213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 120699 120406 gene locus_tag LOCUS_01050 120699 120406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 122696 120696 gene locus_tag LOCUS_01060 122696 120696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 <123505 122711 gene locus_tag LOCUS_01070 <123505 122711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920595.1:terminase family protein >Feature sequence02 <1 563 gene locus_tag LOCUS_01080 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810165.1:elongation factor Tu 2083 1037 gene locus_tag LOCUS_01090 2083 1037 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861504.1 protein_id gnl|my_center|LOCUS_01090 2894 2088 gene locus_tag LOCUS_01100 2894 2088 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_01100 4213 3041 gene locus_tag LOCUS_01110 4213 3041 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_01110 4630 4232 gene locus_tag LOCUS_01120 4630 4232 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869046.1 protein_id gnl|my_center|LOCUS_01120 4979 4686 gene locus_tag LOCUS_01130 4979 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 6801 5032 gene locus_tag LOCUS_01140 6801 5032 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902654.1 protein_id gnl|my_center|LOCUS_01140 8036 6894 gene locus_tag LOCUS_01150 8036 6894 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902650.1 protein_id gnl|my_center|LOCUS_01150 9478 8033 gene locus_tag LOCUS_01160 9478 8033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 10320 9529 gene locus_tag LOCUS_01170 10320 9529 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902652.1 protein_id gnl|my_center|LOCUS_01170 11656 10688 gene locus_tag LOCUS_01180 11656 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 12808 11957 gene locus_tag LOCUS_01190 12808 11957 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_01190 13000 14100 gene locus_tag LOCUS_01200 gene gctA 13000 14100 CDS product glutaconate CoA-transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902658.1 protein_id gnl|my_center|LOCUS_01200 14116 14922 gene locus_tag LOCUS_01210 gene gctB 14116 14922 CDS product glutaconate CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_01210 15027 15902 gene locus_tag LOCUS_01220 15027 15902 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_01220 16512 15994 gene locus_tag LOCUS_01230 gene nrdG 16512 15994 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_01230 18762 16585 gene locus_tag LOCUS_01240 gene nrdD 18762 16585 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_01240 20267 18876 gene locus_tag LOCUS_01250 20267 18876 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_01250 22919 20364 gene locus_tag LOCUS_01260 22919 20364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 23477 22941 gene locus_tag LOCUS_01270 23477 22941 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_01270 24066 24989 gene locus_tag LOCUS_01280 24066 24989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 25109 25990 gene locus_tag LOCUS_01290 25109 25990 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_01290 25992 26732 gene locus_tag LOCUS_01300 25992 26732 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294240.1 protein_id gnl|my_center|LOCUS_01300 27871 26780 gene locus_tag LOCUS_01310 gene spoIID 27871 26780 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672663.1 protein_id gnl|my_center|LOCUS_01310 28059 28889 gene locus_tag LOCUS_01320 28059 28889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 29113 30258 gene locus_tag LOCUS_01330 29113 30258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 30295 31224 gene locus_tag LOCUS_01340 30295 31224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 31508 33406 gene locus_tag LOCUS_01350 31508 33406 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128975638.1 protein_id gnl|my_center|LOCUS_01350 33403 33921 gene locus_tag LOCUS_01360 33403 33921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 35941 34016 gene locus_tag LOCUS_01370 gene uvrC 35941 34016 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_01370 36321 36058 gene locus_tag LOCUS_01380 36321 36058 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_01380 36643 37116 gene locus_tag LOCUS_01390 36643 37116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 38083 37259 gene locus_tag LOCUS_01400 38083 37259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 38715 38080 gene locus_tag LOCUS_01410 gene hisIE 38715 38080 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_01410 39489 38734 gene locus_tag LOCUS_01420 gene hisF 39489 38734 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_01420 40254 39502 gene locus_tag LOCUS_01430 gene hisA 40254 39502 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436675.1 protein_id gnl|my_center|LOCUS_01430 40918 40307 gene locus_tag LOCUS_01440 gene hisH 40918 40307 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_01440 41507 40920 gene locus_tag LOCUS_01450 gene hisB 41507 40920 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_01450 42575 41511 gene locus_tag LOCUS_01460 gene hisC 42575 41511 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208421.1 protein_id gnl|my_center|LOCUS_01460 43840 42572 gene locus_tag LOCUS_01470 gene hisD 43840 42572 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402931.1 protein_id gnl|my_center|LOCUS_01470 45453 43864 gene locus_tag LOCUS_01480 45453 43864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 46622 45672 gene locus_tag LOCUS_01490 46622 45672 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022960.1 protein_id gnl|my_center|LOCUS_01490 47863 46736 gene locus_tag LOCUS_01500 47863 46736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 47992 48174 gene locus_tag LOCUS_01510 47992 48174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 48786 48214 gene locus_tag LOCUS_01520 48786 48214 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_01520 49481 48783 gene locus_tag LOCUS_01530 49481 48783 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_01530 50625 49534 gene locus_tag LOCUS_01540 50625 49534 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_01540 50917 50645 gene locus_tag LOCUS_01550 50917 50645 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_01550 52628 51153 gene locus_tag LOCUS_01560 gene malQ 52628 51153 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_01560 54278 52764 gene locus_tag LOCUS_01570 54278 52764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 56119 54308 gene locus_tag LOCUS_01580 56119 54308 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_01580 58593 56134 gene locus_tag LOCUS_01590 58593 56134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 60041 58590 gene locus_tag LOCUS_01600 60041 58590 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836895.1 protein_id gnl|my_center|LOCUS_01600 60847 60038 gene locus_tag LOCUS_01610 60847 60038 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389564.1 protein_id gnl|my_center|LOCUS_01610 62026 61043 gene locus_tag LOCUS_01620 gene argF 62026 61043 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_01620 63223 62045 gene locus_tag LOCUS_01630 63223 62045 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_01630 64087 63227 gene locus_tag LOCUS_01640 gene argB 64087 63227 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459300.1 protein_id gnl|my_center|LOCUS_01640 65385 64162 gene locus_tag LOCUS_01650 gene argJ 65385 64162 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393772.1 protein_id gnl|my_center|LOCUS_01650 66333 65398 gene locus_tag LOCUS_01660 gene argC 66333 65398 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_01660 67733 66339 gene locus_tag LOCUS_01670 gene argH 67733 66339 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_01670 67230 67314 gene locus_tag LOCUS_t00020 67230 67314 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 69052 67829 gene locus_tag LOCUS_01680 69052 67829 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_01680 70042 69320 gene locus_tag LOCUS_01690 gene deoD 70042 69320 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_01690 71182 70115 gene locus_tag LOCUS_01700 gene mtnA 71182 70115 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948892.1 protein_id gnl|my_center|LOCUS_01700 71723 71193 gene locus_tag LOCUS_01710 71723 71193 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_01710 73872 71797 gene locus_tag LOCUS_01720 73872 71797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 74408 73989 gene locus_tag LOCUS_01730 74408 73989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 76581 74419 gene locus_tag LOCUS_01740 76581 74419 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_01740 78085 76601 gene locus_tag LOCUS_01750 78085 76601 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_01750 78372 79646 gene locus_tag LOCUS_01760 78372 79646 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262728.1 protein_id gnl|my_center|LOCUS_01760 79711 81129 gene locus_tag LOCUS_01770 gene purB 79711 81129 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_01770 81659 83239 gene locus_tag LOCUS_01780 gene asnB 81659 83239 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_01780 83306 85396 gene locus_tag LOCUS_01790 83306 85396 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_01790 85563 85638 gene locus_tag LOCUS_t00030 85563 85638 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 85944 85684 gene locus_tag LOCUS_01800 85944 85684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 86866 85907 gene locus_tag LOCUS_01810 86866 85907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 87449 87171 gene locus_tag LOCUS_01820 87449 87171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 87736 89067 gene locus_tag LOCUS_01830 87736 89067 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015963.1 protein_id gnl|my_center|LOCUS_01830 89600 89103 gene locus_tag LOCUS_01840 89600 89103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 90184 89636 gene locus_tag LOCUS_01850 90184 89636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 90174 90311 gene locus_tag LOCUS_01860 90174 90311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 91067 90324 gene locus_tag LOCUS_01870 91067 90324 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222603.1 protein_id gnl|my_center|LOCUS_01870 92368 91025 gene locus_tag LOCUS_01880 92368 91025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 92594 93718 gene locus_tag LOCUS_01890 gene prfB 92594 93718 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_01890 93886 95265 gene locus_tag LOCUS_01900 93886 95265 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_01900 96283 95417 gene locus_tag LOCUS_01910 96283 95417 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_01910 97127 96399 gene locus_tag LOCUS_01920 97127 96399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 98776 97256 gene locus_tag LOCUS_01930 gene gpmI 98776 97256 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_01930 99598 98825 gene locus_tag LOCUS_01940 gene tpiA 99598 98825 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_01940 100906 99713 gene locus_tag LOCUS_01950 100906 99713 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_01950 101491 101000 gene locus_tag LOCUS_01960 gene trmL 101491 101000 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_01960 101850 102959 gene locus_tag LOCUS_01970 101850 102959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 103026 103985 gene locus_tag LOCUS_01980 103026 103985 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_01980 104149 104748 gene locus_tag LOCUS_01990 gene pth 104149 104748 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_01990 104821 108348 gene locus_tag LOCUS_02000 gene mfd 104821 108348 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_02000 108341 108970 gene locus_tag LOCUS_02010 108341 108970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 109008 110000 gene locus_tag LOCUS_02020 109008 110000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence03 54 809 gene locus_tag LOCUS_02030 54 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 830 1423 gene locus_tag LOCUS_02040 830 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2592 1555 gene locus_tag LOCUS_02050 2592 1555 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_02050 2752 3726 gene locus_tag LOCUS_02060 2752 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 3834 4460 gene locus_tag LOCUS_02070 3834 4460 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_02070 4523 5080 gene locus_tag LOCUS_02080 4523 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 5811 5176 gene locus_tag LOCUS_02090 5811 5176 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027706.1 protein_id gnl|my_center|LOCUS_02090 7104 5821 gene locus_tag LOCUS_02100 gene hflX 7104 5821 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_02100 7456 7253 gene locus_tag LOCUS_02110 gene rpmE 7456 7253 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_02110 7800 8381 gene locus_tag LOCUS_02120 7800 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 8564 10120 gene locus_tag LOCUS_02130 8564 10120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 11448 10558 gene locus_tag LOCUS_02140 11448 10558 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925420.1 protein_id gnl|my_center|LOCUS_02140 11724 12062 gene locus_tag LOCUS_02150 11724 12062 CDS product DUF3870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804044.1 protein_id gnl|my_center|LOCUS_02150 12953 12144 gene locus_tag LOCUS_02160 gene thiD 12953 12144 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_02160 13730 13092 gene locus_tag LOCUS_02170 gene thiE 13730 13092 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_02170 14371 14892 gene locus_tag LOCUS_02180 gene thiW 14371 14892 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_02180 14897 15703 gene locus_tag LOCUS_02190 gene thiM 14897 15703 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989417.1 protein_id gnl|my_center|LOCUS_02190 16324 15794 gene locus_tag LOCUS_02200 16324 15794 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108270.1 protein_id gnl|my_center|LOCUS_02200 17126 16374 gene locus_tag LOCUS_02210 17126 16374 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922507.1 protein_id gnl|my_center|LOCUS_02210 18805 17120 gene locus_tag LOCUS_02220 18805 17120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 19824 18802 gene locus_tag LOCUS_02230 19824 18802 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902589.1 protein_id gnl|my_center|LOCUS_02230 20489 19857 gene locus_tag LOCUS_02240 gene pgmB 20489 19857 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965902.1 protein_id gnl|my_center|LOCUS_02240 21301 20477 gene locus_tag LOCUS_02250 21301 20477 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963843.1 protein_id gnl|my_center|LOCUS_02250 23047 21401 gene locus_tag LOCUS_02260 23047 21401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681065.1 protein_id gnl|my_center|LOCUS_02260 24880 23051 gene locus_tag LOCUS_02270 24880 23051 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681067.1 protein_id gnl|my_center|LOCUS_02270 26461 25070 gene locus_tag LOCUS_02280 26461 25070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681074.1 protein_id gnl|my_center|LOCUS_02280 26952 28814 gene locus_tag LOCUS_02290 26952 28814 CDS product DUF4914 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583124.1 protein_id gnl|my_center|LOCUS_02290 30337 28922 gene locus_tag LOCUS_02300 30337 28922 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930859.1 protein_id gnl|my_center|LOCUS_02300 32422 30590 gene locus_tag LOCUS_02310 32422 30590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 33960 32899 gene locus_tag LOCUS_02320 33960 32899 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963600.1 protein_id gnl|my_center|LOCUS_02320 35069 34209 gene locus_tag LOCUS_02330 35069 34209 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_02330 34213 34296 gene locus_tag LOCUS_t00040 34213 34296 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35290 35592 gene locus_tag LOCUS_02340 35290 35592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 35647 36546 gene locus_tag LOCUS_02350 35647 36546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 36623 36871 gene locus_tag LOCUS_02360 36623 36871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 37204 38244 gene locus_tag LOCUS_02370 37204 38244 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947942.1 protein_id gnl|my_center|LOCUS_02370 38499 39386 gene locus_tag LOCUS_02380 gene rsmA 38499 39386 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_02380 40152 39391 gene locus_tag LOCUS_02390 40152 39391 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887675.1 protein_id gnl|my_center|LOCUS_02390 42187 40241 gene locus_tag LOCUS_02400 42187 40241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 43686 42202 gene locus_tag LOCUS_02410 43686 42202 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_02410 45151 43706 gene locus_tag LOCUS_02420 45151 43706 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967807.1 protein_id gnl|my_center|LOCUS_02420 46709 45195 gene locus_tag LOCUS_02430 46709 45195 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_02430 47083 46709 gene locus_tag LOCUS_02440 47083 46709 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902377.1 protein_id gnl|my_center|LOCUS_02440 47976 47083 gene locus_tag LOCUS_02450 47976 47083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 48220 47969 gene locus_tag LOCUS_02460 48220 47969 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080102.1 protein_id gnl|my_center|LOCUS_02460 48540 48217 gene locus_tag LOCUS_02470 48540 48217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 48853 48530 gene locus_tag LOCUS_02480 48853 48530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 49314 48850 gene locus_tag LOCUS_02490 49314 48850 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_02490 50235 49330 gene locus_tag LOCUS_02500 50235 49330 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_02500 50517 51791 gene locus_tag LOCUS_02510 50517 51791 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247133.1 protein_id gnl|my_center|LOCUS_02510 52277 51897 gene locus_tag LOCUS_02520 52277 51897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 52419 53450 gene locus_tag LOCUS_02530 52419 53450 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_02530 53468 53908 gene locus_tag LOCUS_02540 53468 53908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 54221 54673 gene locus_tag LOCUS_02550 54221 54673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 54670 55914 gene locus_tag LOCUS_02560 54670 55914 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_02560 55927 57078 gene locus_tag LOCUS_02570 55927 57078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 57106 58026 gene locus_tag LOCUS_02580 57106 58026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 58086 58433 gene locus_tag LOCUS_02590 58086 58433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 58447 59478 gene locus_tag LOCUS_02600 58447 59478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 59502 59852 gene locus_tag LOCUS_02610 59502 59852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 59849 60157 gene locus_tag LOCUS_02620 59849 60157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 60118 60645 gene locus_tag LOCUS_02630 60118 60645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 60648 61700 gene locus_tag LOCUS_02640 60648 61700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 61768 62157 gene locus_tag LOCUS_02650 61768 62157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 62154 62468 gene locus_tag LOCUS_02660 62154 62468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 62465 63064 gene locus_tag LOCUS_02670 62465 63064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 63085 63654 gene locus_tag LOCUS_02680 63085 63654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 63651 64595 gene locus_tag LOCUS_02690 63651 64595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 64610 65020 gene locus_tag LOCUS_02700 64610 65020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 65032 65370 gene locus_tag LOCUS_02710 65032 65370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 65384 66442 gene locus_tag LOCUS_02720 65384 66442 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939995.1 protein_id gnl|my_center|LOCUS_02720 66444 67010 gene locus_tag LOCUS_02730 66444 67010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 67013 67309 gene locus_tag LOCUS_02740 67013 67309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 67306 67575 gene locus_tag LOCUS_02750 67306 67575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 67588 67845 gene locus_tag LOCUS_02760 67588 67845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 67832 68527 gene locus_tag LOCUS_02770 67832 68527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 68911 68615 gene locus_tag LOCUS_02780 68911 68615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 69661 69017 gene locus_tag LOCUS_02790 69661 69017 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165444156.1 protein_id gnl|my_center|LOCUS_02790 69836 70012 gene locus_tag LOCUS_02800 69836 70012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 70321 70076 gene locus_tag LOCUS_02810 70321 70076 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_02810 73117 70418 gene locus_tag LOCUS_02820 73117 70418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 74161 73136 gene locus_tag LOCUS_02830 gene pheS 74161 73136 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_02830 75633 74512 gene locus_tag LOCUS_02840 75633 74512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 75838 76707 gene locus_tag LOCUS_02850 75838 76707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 76724 77350 gene locus_tag LOCUS_02860 76724 77350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 77367 78539 gene locus_tag LOCUS_02870 gene alr 77367 78539 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_02870 78699 79070 gene locus_tag LOCUS_02880 78699 79070 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_02880 79161 79616 gene locus_tag LOCUS_02890 79161 79616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 79704 80345 gene locus_tag LOCUS_02900 79704 80345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 80477 80932 gene locus_tag LOCUS_02910 gene nrdR 80477 80932 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_02910 81088 82671 gene locus_tag LOCUS_02920 81088 82671 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_02920 82787 83827 gene locus_tag LOCUS_02930 gene selD 82787 83827 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957237.1 protein_id gnl|my_center|LOCUS_02930 83952 84686 gene locus_tag LOCUS_02940 83952 84686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 85021 85662 gene locus_tag LOCUS_02950 85021 85662 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721367.1 protein_id gnl|my_center|LOCUS_02950 85997 86995 gene locus_tag LOCUS_02960 85997 86995 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252663.1 protein_id gnl|my_center|LOCUS_02960 86992 87966 gene locus_tag LOCUS_02970 86992 87966 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_02970 87978 88472 gene locus_tag LOCUS_02980 87978 88472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 89206 88490 gene locus_tag LOCUS_02990 89206 88490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 89616 90128 gene locus_tag LOCUS_03000 89616 90128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 90128 91438 gene locus_tag LOCUS_03010 90128 91438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 91521 92588 gene locus_tag LOCUS_03020 91521 92588 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_03020 92781 93773 gene locus_tag LOCUS_03030 92781 93773 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897599.1 protein_id gnl|my_center|LOCUS_03030 93794 94768 gene locus_tag LOCUS_03040 93794 94768 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390045.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence04 492 166 gene locus_tag LOCUS_03050 492 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 947 1312 gene locus_tag LOCUS_03060 947 1312 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_03060 1316 3340 gene locus_tag LOCUS_03070 1316 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 4950 3574 gene locus_tag LOCUS_03080 4950 3574 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_03080 5512 5135 gene locus_tag LOCUS_03090 5512 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 6332 5709 gene locus_tag LOCUS_03100 6332 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 6722 6387 gene locus_tag LOCUS_03110 6722 6387 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075358.1 protein_id gnl|my_center|LOCUS_03110 7772 6735 gene locus_tag LOCUS_03120 gene rsmH 7772 6735 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_03120 8545 7805 gene locus_tag LOCUS_03130 8545 7805 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_03130 9276 8539 gene locus_tag LOCUS_03140 9276 8539 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_03140 10940 9372 gene locus_tag LOCUS_03150 10940 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 12078 11254 gene locus_tag LOCUS_03160 12078 11254 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_03160 13051 12107 gene locus_tag LOCUS_03170 13051 12107 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896290.1 protein_id gnl|my_center|LOCUS_03170 13785 13048 gene locus_tag LOCUS_03180 gene pxpB 13785 13048 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 protein_id gnl|my_center|LOCUS_03180 14576 13809 gene locus_tag LOCUS_03190 14576 13809 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896287.1 protein_id gnl|my_center|LOCUS_03190 16757 14967 gene locus_tag LOCUS_03200 16757 14967 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081682.1 protein_id gnl|my_center|LOCUS_03200 17014 17739 gene locus_tag LOCUS_03210 17014 17739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 18367 17804 gene locus_tag LOCUS_03220 18367 17804 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358515.1 protein_id gnl|my_center|LOCUS_03220 18867 18388 gene locus_tag LOCUS_03230 18867 18388 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 protein_id gnl|my_center|LOCUS_03230 18999 19676 gene locus_tag LOCUS_03240 18999 19676 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202734.1 protein_id gnl|my_center|LOCUS_03240 19695 20126 gene locus_tag LOCUS_03250 19695 20126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 20147 20479 gene locus_tag LOCUS_03260 20147 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 20476 21345 gene locus_tag LOCUS_03270 20476 21345 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132680.1 protein_id gnl|my_center|LOCUS_03270 21432 22535 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatccacgcgccccgtgaggggcgcgac 22938 24407 gene locus_tag LOCUS_03280 22938 24407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 24446 25870 gene locus_tag LOCUS_03290 24446 25870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 25915 26589 gene locus_tag LOCUS_03300 25915 26589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 27166 26765 gene locus_tag LOCUS_03310 27166 26765 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889232.1 protein_id gnl|my_center|LOCUS_03310 28411 27335 gene locus_tag LOCUS_03320 28411 27335 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_03320 29338 28481 gene locus_tag LOCUS_03330 29338 28481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_03330 30180 29335 gene locus_tag LOCUS_03340 30180 29335 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_03340 31366 30170 gene locus_tag LOCUS_03350 31366 30170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_03350 32445 31486 gene locus_tag LOCUS_03360 32445 31486 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_03360 32580 33086 gene locus_tag LOCUS_03370 32580 33086 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094714.1 protein_id gnl|my_center|LOCUS_03370 33135 33347 gene locus_tag LOCUS_03380 gene rpmF 33135 33347 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_03380 33507 34832 gene locus_tag LOCUS_03390 gene der 33507 34832 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_03390 34835 35521 gene locus_tag LOCUS_03400 gene plsY 34835 35521 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_03400 35552 36553 gene locus_tag LOCUS_03410 35552 36553 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392833.1 protein_id gnl|my_center|LOCUS_03410 37078 36890 gene locus_tag LOCUS_03420 gene rpmB 37078 36890 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_03420 37382 38302 gene locus_tag LOCUS_03430 gene hprK 37382 38302 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_03430 38321 39268 gene locus_tag LOCUS_03440 38321 39268 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_03440 39289 40209 gene locus_tag LOCUS_03450 gene murB 39289 40209 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_03450 40243 41103 gene locus_tag LOCUS_03460 gene rapZ 40243 41103 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_03460 41123 42193 gene locus_tag LOCUS_03470 41123 42193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 42248 43174 gene locus_tag LOCUS_03480 gene whiA 42248 43174 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_03480 43171 43791 gene locus_tag LOCUS_03490 43171 43791 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963558.1 protein_id gnl|my_center|LOCUS_03490 43826 44269 gene locus_tag LOCUS_03500 43826 44269 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932326.1 protein_id gnl|my_center|LOCUS_03500 44301 47792 gene locus_tag LOCUS_03510 44301 47792 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_03510 48049 47867 gene locus_tag LOCUS_03520 48049 47867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 49354 48413 gene locus_tag LOCUS_03530 gene metA 49354 48413 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_03530 50681 49392 gene locus_tag LOCUS_03540 50681 49392 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_03540 51176 52039 gene locus_tag LOCUS_03550 51176 52039 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_03550 52036 52905 gene locus_tag LOCUS_03560 52036 52905 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_03560 52927 53793 gene locus_tag LOCUS_03570 52927 53793 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_03570 53787 54590 gene locus_tag LOCUS_03580 53787 54590 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_03580 54676 55431 gene locus_tag LOCUS_03590 gene truA 54676 55431 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_03590 55424 56605 gene locus_tag LOCUS_03600 55424 56605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 56674 57417 gene locus_tag LOCUS_03610 56674 57417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 57479 59794 gene locus_tag LOCUS_03620 57479 59794 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_03620 59820 60029 gene locus_tag LOCUS_03630 59820 60029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 60074 60895 gene locus_tag LOCUS_03640 60074 60895 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_03640 61049 62131 gene locus_tag LOCUS_03650 61049 62131 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392810.1 protein_id gnl|my_center|LOCUS_03650 62207 62893 gene locus_tag LOCUS_03660 gene tsaA 62207 62893 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_03660 63368 65125 gene locus_tag LOCUS_03670 gene thrS 63368 65125 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_03670 65381 68794 gene locus_tag LOCUS_03680 65381 68794 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965948.1 protein_id gnl|my_center|LOCUS_03680 69052 70104 gene locus_tag LOCUS_03690 69052 70104 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869565.1 protein_id gnl|my_center|LOCUS_03690 70298 72283 gene locus_tag LOCUS_03700 70298 72283 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_03700 72634 74316 gene locus_tag LOCUS_03710 72634 74316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 74321 75016 gene locus_tag LOCUS_03720 74321 75016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481692.1 protein_id gnl|my_center|LOCUS_03720 75013 76287 gene locus_tag LOCUS_03730 75013 76287 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_03730 76304 78634 gene locus_tag LOCUS_03740 76304 78634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 78940 80571 gene locus_tag LOCUS_03750 78940 80571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 82135 80888 gene locus_tag LOCUS_03760 82135 80888 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965562.1 protein_id gnl|my_center|LOCUS_03760 82659 83243 gene locus_tag LOCUS_03770 82659 83243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence05 483 1523 gene locus_tag LOCUS_03780 483 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2452 2003 gene locus_tag LOCUS_03790 2452 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2629 3354 gene locus_tag LOCUS_03800 gene cwlD 2629 3354 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_03800 3358 4752 gene locus_tag LOCUS_03810 gene radA 3358 4752 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_03810 5974 6981 gene locus_tag LOCUS_03820 5974 6981 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_03820 7750 7247 gene locus_tag LOCUS_03830 7750 7247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 8826 7858 gene locus_tag LOCUS_03840 gene fba 8826 7858 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_03840 9081 10319 gene locus_tag LOCUS_03850 9081 10319 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_03850 11154 10384 gene locus_tag LOCUS_03860 11154 10384 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_03860 12776 11301 gene locus_tag LOCUS_03870 gene spoIVA 12776 11301 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944577.1 protein_id gnl|my_center|LOCUS_03870 13037 13927 gene locus_tag LOCUS_03880 13037 13927 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_03880 14004 14735 gene locus_tag LOCUS_03890 14004 14735 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120401.1 protein_id gnl|my_center|LOCUS_03890 14749 15507 gene locus_tag LOCUS_03900 14749 15507 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_03900 17165 15627 gene locus_tag LOCUS_03910 17165 15627 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898760.1 protein_id gnl|my_center|LOCUS_03910 17492 17334 gene locus_tag LOCUS_03920 17492 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 18689 17805 gene locus_tag LOCUS_03930 gene rsgA 18689 17805 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392430.1 protein_id gnl|my_center|LOCUS_03930 20685 18682 gene locus_tag LOCUS_03940 gene pknB 20685 18682 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_03940 21442 20687 gene locus_tag LOCUS_03950 21442 20687 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_03950 22479 21448 gene locus_tag LOCUS_03960 gene rlmN 22479 21448 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_03960 23811 22492 gene locus_tag LOCUS_03970 gene rsmB 23811 22492 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392419.1 protein_id gnl|my_center|LOCUS_03970 24539 23808 gene locus_tag LOCUS_03980 24539 23808 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_03980 25476 24556 gene locus_tag LOCUS_03990 gene fmt 25476 24556 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_03990 26002 25481 gene locus_tag LOCUS_04000 gene def 26002 25481 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_04000 28493 26031 gene locus_tag LOCUS_04010 gene priA 28493 26031 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_04010 28778 28515 gene locus_tag LOCUS_04020 28778 28515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 29417 28821 gene locus_tag LOCUS_04030 gene gmk 29417 28821 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633187.1 protein_id gnl|my_center|LOCUS_04030 29676 29419 gene locus_tag LOCUS_04040 29676 29419 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_04040 30559 29681 gene locus_tag LOCUS_04050 30559 29681 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_04050 31270 30590 gene locus_tag LOCUS_04060 31270 30590 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963967.1 protein_id gnl|my_center|LOCUS_04060 32163 31267 gene locus_tag LOCUS_04070 32163 31267 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_04070 32577 32170 gene locus_tag LOCUS_04080 32577 32170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 33904 32597 gene locus_tag LOCUS_04090 33904 32597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 34775 33891 gene locus_tag LOCUS_04100 gene cdaA 34775 33891 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_04100 36147 35011 gene locus_tag LOCUS_04110 36147 35011 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_04110 36462 36211 gene locus_tag LOCUS_04120 36462 36211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 37070 36588 gene locus_tag LOCUS_04130 gene ispF 37070 36588 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_04130 37714 37067 gene locus_tag LOCUS_04140 gene ispD 37714 37067 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_04140 39316 37970 gene locus_tag LOCUS_04150 39316 37970 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_04150 41631 39676 gene locus_tag LOCUS_04160 41631 39676 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_04160 42278 41628 gene locus_tag LOCUS_04170 42278 41628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 42949 42275 gene locus_tag LOCUS_04180 gene cmk 42949 42275 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254302.1 protein_id gnl|my_center|LOCUS_04180 44208 42961 gene locus_tag LOCUS_04190 44208 42961 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_04190 45067 44201 gene locus_tag LOCUS_04200 45067 44201 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_04200 46003 45296 gene locus_tag LOCUS_04210 46003 45296 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_04210 47132 46020 gene locus_tag LOCUS_04220 gene dacB 47132 46020 CDS product D-alanyl-D-alanine carboxypeptidase DacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252638.1 protein_id gnl|my_center|LOCUS_04220 47573 47175 gene locus_tag LOCUS_04230 gene ytfJ 47573 47175 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965359.1 protein_id gnl|my_center|LOCUS_04230 48305 47607 gene locus_tag LOCUS_04240 48305 47607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 48953 48342 gene locus_tag LOCUS_04250 gene scpB 48953 48342 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_04250 49748 48963 gene locus_tag LOCUS_04260 49748 48963 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404131.1 protein_id gnl|my_center|LOCUS_04260 50417 49761 gene locus_tag LOCUS_04270 50417 49761 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_04270 54067 50504 gene locus_tag LOCUS_04280 gene addA 54067 50504 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_04280 57377 54060 gene locus_tag LOCUS_04290 gene addB 57377 54060 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_04290 57524 58135 gene locus_tag LOCUS_04300 57524 58135 CDS product DUF1643 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_04300 58273 58530 gene locus_tag LOCUS_04310 58273 58530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 58552 59007 gene locus_tag LOCUS_04320 58552 59007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 59011 59406 gene locus_tag LOCUS_04330 59011 59406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 60215 59460 gene locus_tag LOCUS_04340 60215 59460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 61391 60240 gene locus_tag LOCUS_04350 gene wecB 61391 60240 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966158.1 protein_id gnl|my_center|LOCUS_04350 62558 61392 gene locus_tag LOCUS_04360 62558 61392 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_04360 63593 62586 gene locus_tag LOCUS_04370 gene trpS 63593 62586 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817343.1 protein_id gnl|my_center|LOCUS_04370 63791 65290 gene locus_tag LOCUS_04380 gene gltX 63791 65290 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_04380 65318 66325 gene locus_tag LOCUS_04390 gene asnA 65318 66325 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_04390 67984 66575 gene locus_tag LOCUS_04400 67984 66575 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_04400 69644 67971 gene locus_tag LOCUS_04410 69644 67971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 70745 69684 gene locus_tag LOCUS_04420 gene prfA 70745 69684 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_04420 71285 70785 gene locus_tag LOCUS_04430 71285 70785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 72048 71299 gene locus_tag LOCUS_04440 72048 71299 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272204.1 protein_id gnl|my_center|LOCUS_04440 73943 72045 gene locus_tag LOCUS_04450 gene abc-f 73943 72045 CDS product ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150916.1 protein_id gnl|my_center|LOCUS_04450 75335 73953 gene locus_tag LOCUS_04460 75335 73953 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_04460 76387 75323 gene locus_tag LOCUS_04470 76387 75323 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114722.1 protein_id gnl|my_center|LOCUS_04470 77567 76578 gene locus_tag LOCUS_04480 77567 76578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 78089 77655 gene locus_tag LOCUS_04490 78089 77655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 78979 78266 gene locus_tag LOCUS_04500 78979 78266 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence06 1470 847 gene locus_tag LOCUS_04510 1470 847 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_04510 1910 2425 gene locus_tag LOCUS_04520 1910 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 2422 3300 gene locus_tag LOCUS_04530 gene ispE 2422 3300 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_04530 3394 4041 gene locus_tag LOCUS_04540 gene spoIIR 3394 4041 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947973.1 protein_id gnl|my_center|LOCUS_04540 6680 4581 gene locus_tag LOCUS_04550 6680 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 7123 6944 gene locus_tag LOCUS_04560 7123 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 7733 7302 gene locus_tag LOCUS_04570 7733 7302 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_04570 8346 7777 gene locus_tag LOCUS_04580 8346 7777 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_04580 8639 9472 gene locus_tag LOCUS_04590 gene coaW 8639 9472 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002440556.1 protein_id gnl|my_center|LOCUS_04590 9761 9582 gene locus_tag LOCUS_04600 9761 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 10754 9804 gene locus_tag LOCUS_04610 10754 9804 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_04610 11227 10754 gene locus_tag LOCUS_04620 11227 10754 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_04620 11479 11919 gene locus_tag LOCUS_04630 11479 11919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 11945 12952 gene locus_tag LOCUS_04640 11945 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 13890 13045 gene locus_tag LOCUS_04650 13890 13045 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_04650 14437 15447 gene locus_tag LOCUS_04660 gene metN 14437 15447 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047863666.1 protein_id gnl|my_center|LOCUS_04660 15440 16123 gene locus_tag LOCUS_04670 15440 16123 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_04670 16270 17127 gene locus_tag LOCUS_04680 16270 17127 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_04680 17492 17292 gene locus_tag LOCUS_04690 17492 17292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 17950 17459 gene locus_tag LOCUS_04700 17950 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 18247 17990 gene locus_tag LOCUS_04710 gene cdd1 18247 17990 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_04710 19134 18499 gene locus_tag LOCUS_04720 19134 18499 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 protein_id gnl|my_center|LOCUS_04720 19250 20209 gene locus_tag LOCUS_04730 19250 20209 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948563.1 protein_id gnl|my_center|LOCUS_04730 20581 20225 gene locus_tag LOCUS_04740 20581 20225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04740 21566 21198 gene locus_tag LOCUS_04750 21566 21198 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812106.1 protein_id gnl|my_center|LOCUS_04750 23370 21625 gene locus_tag LOCUS_04760 23370 21625 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671107.1 protein_id gnl|my_center|LOCUS_04760 25202 23364 gene locus_tag LOCUS_04770 25202 23364 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679271.1 protein_id gnl|my_center|LOCUS_04770 25533 26459 gene locus_tag LOCUS_04780 25533 26459 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_04780 26459 28177 gene locus_tag LOCUS_04790 26459 28177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 28421 29275 gene locus_tag LOCUS_04800 28421 29275 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_04800 30441 29335 gene locus_tag LOCUS_04810 30441 29335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 30771 30580 gene locus_tag LOCUS_04820 30771 30580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 30984 33329 gene locus_tag LOCUS_04830 30984 33329 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183138.1 protein_id gnl|my_center|LOCUS_04830 34873 33488 gene locus_tag LOCUS_04840 gene gltA 34873 33488 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_04840 35719 34877 gene locus_tag LOCUS_04850 35719 34877 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_04850 36656 35997 gene locus_tag LOCUS_04860 36656 35997 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964202.1 protein_id gnl|my_center|LOCUS_04860 36800 37249 gene locus_tag LOCUS_04870 36800 37249 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_04870 39069 37291 gene locus_tag LOCUS_04880 39069 37291 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460031.1 protein_id gnl|my_center|LOCUS_04880 39184 40071 gene locus_tag LOCUS_04890 39184 40071 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_04890 41077 40085 gene locus_tag LOCUS_04900 41077 40085 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_04900 42380 41223 gene locus_tag LOCUS_04910 gene rodA 42380 41223 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_04910 42525 42953 gene locus_tag LOCUS_04920 gene tsaE 42525 42953 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_04920 42950 43663 gene locus_tag LOCUS_04930 gene tsaB 42950 43663 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817443.1 protein_id gnl|my_center|LOCUS_04930 43660 44292 gene locus_tag LOCUS_04940 gene upp 43660 44292 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_04940 45596 44376 gene locus_tag LOCUS_04950 45596 44376 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964048.1 protein_id gnl|my_center|LOCUS_04950 46087 45605 gene locus_tag LOCUS_04960 46087 45605 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 protein_id gnl|my_center|LOCUS_04960 47326 46100 gene locus_tag LOCUS_04970 47326 46100 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_04970 47773 47462 gene locus_tag LOCUS_04980 47773 47462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 49634 48117 gene locus_tag LOCUS_04990 49634 48117 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437129.1 protein_id gnl|my_center|LOCUS_04990 50272 49631 gene locus_tag LOCUS_05000 50272 49631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355744.1 protein_id gnl|my_center|LOCUS_05000 51387 50269 gene locus_tag LOCUS_05010 51387 50269 CDS product betaine/proline/choline family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393190.1 protein_id gnl|my_center|LOCUS_05010 52071 51391 gene locus_tag LOCUS_05020 52071 51391 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966135.1 protein_id gnl|my_center|LOCUS_05020 54164 52269 gene locus_tag LOCUS_05030 54164 52269 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_05030 55893 54157 gene locus_tag LOCUS_05040 55893 54157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389612.1 protein_id gnl|my_center|LOCUS_05040 56327 55887 gene locus_tag LOCUS_05050 56327 55887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 56961 56776 gene locus_tag LOCUS_05060 56961 56776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 57399 57136 gene locus_tag LOCUS_05070 57399 57136 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788104.1 protein_id gnl|my_center|LOCUS_05070 58230 57472 gene locus_tag LOCUS_05080 gene spo0A 58230 57472 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_05080 59430 58414 gene locus_tag LOCUS_05090 gene spoIVB 59430 58414 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_05090 60875 59730 gene locus_tag LOCUS_05100 gene ftsZ 60875 59730 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_05100 61809 61045 gene locus_tag LOCUS_05110 61809 61045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 63098 61830 gene locus_tag LOCUS_05120 gene murA 63098 61830 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_05120 64295 63165 gene locus_tag LOCUS_05130 gene murG 64295 63165 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_05130 65588 64320 gene locus_tag LOCUS_05140 gene spoVE 65588 64320 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_05140 66611 65628 gene locus_tag LOCUS_05150 gene mraY 66611 65628 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965426.1 protein_id gnl|my_center|LOCUS_05150 68169 66712 gene locus_tag LOCUS_05160 68169 66712 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_05160 70669 68276 gene locus_tag LOCUS_05170 70669 68276 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_05170 71326 70763 gene locus_tag LOCUS_05180 71326 70763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 71569 71402 gene locus_tag LOCUS_05190 71569 71402 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_05190 72542 71607 gene locus_tag LOCUS_05200 gene rsmH 72542 71607 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_05200 72960 72544 gene locus_tag LOCUS_05210 gene mraZ 72960 72544 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_05210 73862 73317 gene locus_tag LOCUS_05220 73862 73317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 74371 73868 gene locus_tag LOCUS_05230 gene coaD 74371 73868 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_05230 74886 74368 gene locus_tag LOCUS_05240 gene rsmD 74886 74368 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_05240 76084 74975 gene locus_tag LOCUS_05250 gene ychF 76084 74975 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence07 812 213 gene locus_tag LOCUS_05260 gene recR 812 213 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_05260 1820 846 gene locus_tag LOCUS_05270 1820 846 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_05270 2475 1831 gene locus_tag LOCUS_05280 gene rpe 2475 1831 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480039.1 protein_id gnl|my_center|LOCUS_05280 3365 2718 gene locus_tag LOCUS_05290 3365 2718 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926557.1 protein_id gnl|my_center|LOCUS_05290 4435 3383 gene locus_tag LOCUS_05300 4435 3383 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017134.1 protein_id gnl|my_center|LOCUS_05300 5651 4452 gene locus_tag LOCUS_05310 gene mtnK 5651 4452 CDS product S-methyl-5-thioribose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017133.1 protein_id gnl|my_center|LOCUS_05310 6502 5804 gene locus_tag LOCUS_05320 6502 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 6767 7507 gene locus_tag LOCUS_05330 6767 7507 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_05330 7504 8430 gene locus_tag LOCUS_05340 7504 8430 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_05340 9085 8603 gene locus_tag LOCUS_05350 9085 8603 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_05350 11962 9134 gene locus_tag LOCUS_05360 gene uvrA 11962 9134 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401468.1 protein_id gnl|my_center|LOCUS_05360 12551 12000 gene locus_tag LOCUS_05370 gene ybaK 12551 12000 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710889.1 protein_id gnl|my_center|LOCUS_05370 14521 12548 gene locus_tag LOCUS_05380 gene uvrB 14521 12548 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441064.1 protein_id gnl|my_center|LOCUS_05380 15248 14574 gene locus_tag LOCUS_05390 gene radC 15248 14574 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_05390 15749 17140 gene locus_tag LOCUS_05400 gene mgtE 15749 17140 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_05400 19839 17257 gene locus_tag LOCUS_05410 19839 17257 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_05410 17429 17342 gene locus_tag LOCUS_t00050 17429 17342 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20973 20104 gene locus_tag LOCUS_05420 20973 20104 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965718.1 protein_id gnl|my_center|LOCUS_05420 22247 20970 gene locus_tag LOCUS_05430 22247 20970 CDS product aspartate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222431737.1 protein_id gnl|my_center|LOCUS_05430 22745 22380 gene locus_tag LOCUS_05440 22745 22380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 22903 23418 gene locus_tag LOCUS_05450 22903 23418 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_05450 23444 24148 gene locus_tag LOCUS_05460 23444 24148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 24918 24199 gene locus_tag LOCUS_05470 24918 24199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 25377 26546 gene locus_tag LOCUS_05480 25377 26546 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804836.1 protein_id gnl|my_center|LOCUS_05480 26531 27133 gene locus_tag LOCUS_05490 26531 27133 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262004.1 protein_id gnl|my_center|LOCUS_05490 27224 28294 gene locus_tag LOCUS_05500 27224 28294 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804834.1 protein_id gnl|my_center|LOCUS_05500 28370 28546 gene locus_tag LOCUS_05510 28370 28546 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944059.1 protein_id gnl|my_center|LOCUS_05510 28754 29599 gene locus_tag LOCUS_05520 gene dapF 28754 29599 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_05520 29625 30905 gene locus_tag LOCUS_05530 29625 30905 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 protein_id gnl|my_center|LOCUS_05530 32461 31220 gene locus_tag LOCUS_05540 32461 31220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 32673 32464 gene locus_tag LOCUS_05550 32673 32464 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939394.1 protein_id gnl|my_center|LOCUS_05550 32900 32685 gene locus_tag LOCUS_05560 32900 32685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 33707 32910 gene locus_tag LOCUS_05570 33707 32910 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232140.1 protein_id gnl|my_center|LOCUS_05570 35451 33700 gene locus_tag LOCUS_05580 35451 33700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_05580 35921 35556 gene locus_tag LOCUS_05590 35921 35556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 36920 35994 gene locus_tag LOCUS_05600 36920 35994 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_05600 38087 37005 gene locus_tag LOCUS_05610 38087 37005 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_05610 38380 39516 gene locus_tag LOCUS_05620 38380 39516 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_05620 39591 40433 gene locus_tag LOCUS_05630 39591 40433 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964020.1 protein_id gnl|my_center|LOCUS_05630 41603 40515 gene locus_tag LOCUS_05640 41603 40515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 43167 41809 gene locus_tag LOCUS_05650 43167 41809 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_05650 43403 43969 gene locus_tag LOCUS_05660 43403 43969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 44283 45296 gene locus_tag LOCUS_05670 gene aroF 44283 45296 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_05670 45301 46137 gene locus_tag LOCUS_05680 45301 46137 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_05680 46168 47238 gene locus_tag LOCUS_05690 gene aroB 46168 47238 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382321.1 protein_id gnl|my_center|LOCUS_05690 47238 48461 gene locus_tag LOCUS_05700 gene aroA 47238 48461 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_05700 48451 49557 gene locus_tag LOCUS_05710 gene aroC 48451 49557 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_05710 49544 50680 gene locus_tag LOCUS_05720 gene pheA 49544 50680 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417818.1 protein_id gnl|my_center|LOCUS_05720 50685 51935 gene locus_tag LOCUS_05730 50685 51935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 51907 52332 gene locus_tag LOCUS_05740 gene aroQ 51907 52332 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_05740 52638 59147 gene locus_tag LOCUS_05750 52638 59147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 59489 59301 gene locus_tag LOCUS_05760 59489 59301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 61572 59851 gene locus_tag LOCUS_05770 61572 59851 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_05770 62111 61593 gene locus_tag LOCUS_05780 62111 61593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 63210 62527 gene locus_tag LOCUS_05790 63210 62527 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113632.1 protein_id gnl|my_center|LOCUS_05790 63410 64099 gene locus_tag LOCUS_05800 63410 64099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_05800 64138 64359 gene locus_tag LOCUS_05810 64138 64359 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_05810 64379 65452 gene locus_tag LOCUS_05820 64379 65452 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_05820 65454 66203 gene locus_tag LOCUS_05830 65454 66203 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_05830 66205 66741 gene locus_tag LOCUS_05840 66205 66741 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420711.1 protein_id gnl|my_center|LOCUS_05840 67211 68287 gene locus_tag LOCUS_05850 67211 68287 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_05850 69132 68395 gene locus_tag LOCUS_05860 69132 68395 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_05860 69498 69574 gene locus_tag LOCUS_t00060 69498 69574 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 71634 70090 gene locus_tag LOCUS_05870 71634 70090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 71813 73117 gene locus_tag LOCUS_05880 71813 73117 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388389.1 protein_id gnl|my_center|LOCUS_05880 73288 73674 gene locus_tag LOCUS_05890 73288 73674 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05890 >Feature sequence08 93 3 gene locus_tag LOCUS_t00070 93 3 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 388 1302 gene locus_tag LOCUS_05900 388 1302 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_05900 1307 3058 gene locus_tag LOCUS_05910 1307 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860733.1 protein_id gnl|my_center|LOCUS_05910 3238 4737 gene locus_tag LOCUS_05920 3238 4737 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666927.1 protein_id gnl|my_center|LOCUS_05920 4826 5839 gene locus_tag LOCUS_05930 4826 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 6352 5966 gene locus_tag LOCUS_05940 6352 5966 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_05940 7931 6396 gene locus_tag LOCUS_05950 gene guaA 7931 6396 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679432.1 protein_id gnl|my_center|LOCUS_05950 8511 7933 gene locus_tag LOCUS_05960 8511 7933 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_05960 9560 8739 gene locus_tag LOCUS_05970 9560 8739 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_05970 11874 9628 gene locus_tag LOCUS_05980 11874 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 12318 12061 gene locus_tag LOCUS_05990 12318 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 12501 12671 gene locus_tag LOCUS_06000 12501 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 14046 12766 gene locus_tag LOCUS_06010 14046 12766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 14331 14255 gene locus_tag LOCUS_t00080 14331 14255 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14697 15275 gene locus_tag LOCUS_06020 14697 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 15358 16701 gene locus_tag LOCUS_06030 15358 16701 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036400.1 protein_id gnl|my_center|LOCUS_06030 16698 17471 gene locus_tag LOCUS_06040 16698 17471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 19064 17583 gene locus_tag LOCUS_06050 19064 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 21230 19098 gene locus_tag LOCUS_06060 21230 19098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 22028 21261 gene locus_tag LOCUS_06070 gene rlmB 22028 21261 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_06070 22275 24596 gene locus_tag LOCUS_06080 22275 24596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 26418 25042 gene locus_tag LOCUS_06090 26418 25042 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047962.1 protein_id gnl|my_center|LOCUS_06090 26972 26887 gene locus_tag LOCUS_t00090 26972 26887 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28222 27161 gene locus_tag LOCUS_06100 28222 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 28683 28246 gene locus_tag LOCUS_06110 gene rpiB 28683 28246 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_06110 29605 28784 gene locus_tag LOCUS_06120 29605 28784 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_06120 30738 29602 gene locus_tag LOCUS_06130 gene dnaJ 30738 29602 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_06130 32760 30895 gene locus_tag LOCUS_06140 gene dnaK 32760 30895 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_06140 33412 32807 gene locus_tag LOCUS_06150 33412 32807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 34461 33409 gene locus_tag LOCUS_06160 gene hrcA 34461 33409 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_06160 35645 34746 gene locus_tag LOCUS_06170 35645 34746 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_06170 36245 35658 gene locus_tag LOCUS_06180 gene rsxA 36245 35658 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_06180 36877 36245 gene locus_tag LOCUS_06190 36877 36245 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_06190 37514 36894 gene locus_tag LOCUS_06200 37514 36894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 38530 37511 gene locus_tag LOCUS_06210 38530 37511 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_06210 39910 38534 gene locus_tag LOCUS_06220 gene rsxC 39910 38534 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_06220 40204 41007 gene locus_tag LOCUS_06230 40204 41007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 42230 41196 gene locus_tag LOCUS_06240 42230 41196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 45400 42380 gene locus_tag LOCUS_06250 45400 42380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 47179 45659 gene locus_tag LOCUS_06260 47179 45659 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895925.1 protein_id gnl|my_center|LOCUS_06260 47630 48691 gene locus_tag LOCUS_06270 47630 48691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_06270 48688 49554 gene locus_tag LOCUS_06280 48688 49554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 49570 51006 gene locus_tag LOCUS_06290 49570 51006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 51025 52056 gene locus_tag LOCUS_06300 51025 52056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 52140 52826 gene locus_tag LOCUS_06310 52140 52826 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461203.1 protein_id gnl|my_center|LOCUS_06310 52823 54046 gene locus_tag LOCUS_06320 52823 54046 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_06320 54195 54632 gene locus_tag LOCUS_06330 gene spoVAC 54195 54632 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_06330 55083 57068 gene locus_tag LOCUS_06340 gene gyrB 55083 57068 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_06340 57118 59358 gene locus_tag LOCUS_06350 gene gyrA 57118 59358 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_06350 59439 60032 gene locus_tag LOCUS_06360 59439 60032 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_06360 60070 60957 gene locus_tag LOCUS_06370 60070 60957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 61369 61444 gene locus_tag LOCUS_t00100 61369 61444 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61976 62542 gene locus_tag LOCUS_06380 61976 62542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 62653 63114 gene locus_tag LOCUS_06390 62653 63114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 65195 63282 gene locus_tag LOCUS_06400 65195 63282 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06400 65503 65285 gene locus_tag LOCUS_06410 65503 65285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 65930 65568 gene locus_tag LOCUS_06420 65930 65568 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_06420 66108 66512 gene locus_tag LOCUS_06430 66108 66512 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966793.1 protein_id gnl|my_center|LOCUS_06430 66509 67738 gene locus_tag LOCUS_06440 gene hemW 66509 67738 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_06440 69125 67959 gene locus_tag LOCUS_06450 69125 67959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 69909 69286 gene locus_tag LOCUS_06460 69909 69286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence09 3405 2128 gene locus_tag LOCUS_06470 gene purD 3405 2128 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_06470 4054 3461 gene locus_tag LOCUS_06480 gene purN 4054 3461 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_06480 5082 4048 gene locus_tag LOCUS_06490 gene purM 5082 4048 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_06490 6517 5075 gene locus_tag LOCUS_06500 gene purF 6517 5075 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_06500 7235 6519 gene locus_tag LOCUS_06510 7235 6519 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_06510 7793 7293 gene locus_tag LOCUS_06520 gene purE 7793 7293 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_06520 8408 9709 gene locus_tag LOCUS_06530 8408 9709 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053653.1 protein_id gnl|my_center|LOCUS_06530 10066 10746 gene locus_tag LOCUS_06540 10066 10746 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272759.1 protein_id gnl|my_center|LOCUS_06540 10727 11401 gene locus_tag LOCUS_06550 10727 11401 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_06550 11408 12175 gene locus_tag LOCUS_06560 11408 12175 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815845.1 protein_id gnl|my_center|LOCUS_06560 12240 13130 gene locus_tag LOCUS_06570 12240 13130 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_06570 13241 13969 gene locus_tag LOCUS_06580 13241 13969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 14080 14985 gene locus_tag LOCUS_06590 gene spoIIIAA 14080 14985 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393045.1 protein_id gnl|my_center|LOCUS_06590 14982 15476 gene locus_tag LOCUS_06600 14982 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 15501 15695 gene locus_tag LOCUS_06610 15501 15695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 15695 16084 gene locus_tag LOCUS_06620 15695 16084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 16081 17151 gene locus_tag LOCUS_06630 16081 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 17163 17639 gene locus_tag LOCUS_06640 17163 17639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 17626 18144 gene locus_tag LOCUS_06650 17626 18144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 18168 18752 gene locus_tag LOCUS_06660 18168 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 18864 19238 gene locus_tag LOCUS_06670 18864 19238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 19258 19710 gene locus_tag LOCUS_06680 gene nusB 19258 19710 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728771.1 protein_id gnl|my_center|LOCUS_06680 19789 20988 gene locus_tag LOCUS_06690 gene xseA 19789 20988 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_06690 20988 21248 gene locus_tag LOCUS_06700 20988 21248 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938643.1 protein_id gnl|my_center|LOCUS_06700 21241 22119 gene locus_tag LOCUS_06710 21241 22119 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810943.1 protein_id gnl|my_center|LOCUS_06710 22919 23479 gene locus_tag LOCUS_06720 22919 23479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 23501 25351 gene locus_tag LOCUS_06730 gene dxs 23501 25351 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_06730 25377 26201 gene locus_tag LOCUS_06740 25377 26201 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810950.1 protein_id gnl|my_center|LOCUS_06740 26198 27079 gene locus_tag LOCUS_06750 26198 27079 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_06750 27076 27531 gene locus_tag LOCUS_06760 gene argR 27076 27531 CDS product arginine repressor ArgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230265.1 protein_id gnl|my_center|LOCUS_06760 27580 29262 gene locus_tag LOCUS_06770 gene recN 27580 29262 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_06770 29365 29976 gene locus_tag LOCUS_06780 29365 29976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 30014 31183 gene locus_tag LOCUS_06790 30014 31183 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_06790 31571 32791 gene locus_tag LOCUS_06800 gene tyrS 31571 32791 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_06800 32845 34473 gene locus_tag LOCUS_06810 32845 34473 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_06810 35942 34851 gene locus_tag LOCUS_06820 gene asd 35942 34851 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_06820 36123 37649 gene locus_tag LOCUS_06830 36123 37649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 37712 38737 gene locus_tag LOCUS_06840 gene queA 37712 38737 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_06840 38834 39094 gene locus_tag LOCUS_06850 38834 39094 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948437.1 protein_id gnl|my_center|LOCUS_06850 39105 40238 gene locus_tag LOCUS_06860 gene tgt 39105 40238 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_06860 40319 40690 gene locus_tag LOCUS_06870 40319 40690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 40761 41192 gene locus_tag LOCUS_06880 40761 41192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 41612 42253 gene locus_tag LOCUS_06890 41612 42253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 42298 43185 gene locus_tag LOCUS_06900 gene xerD 42298 43185 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390088.1 protein_id gnl|my_center|LOCUS_06900 43293 43766 gene locus_tag LOCUS_06910 43293 43766 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814454.1 protein_id gnl|my_center|LOCUS_06910 43763 45163 gene locus_tag LOCUS_06920 43763 45163 CDS product DUF4179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459558.1 protein_id gnl|my_center|LOCUS_06920 45267 45776 gene locus_tag LOCUS_06930 gene ruvC 45267 45776 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_06930 45804 46406 gene locus_tag LOCUS_06940 gene ruvA 45804 46406 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_06940 46431 46763 gene locus_tag LOCUS_06950 46431 46763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 46821 47873 gene locus_tag LOCUS_06960 gene ruvB 46821 47873 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_06960 47900 49255 gene locus_tag LOCUS_06970 gene glmM 47900 49255 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393729.1 protein_id gnl|my_center|LOCUS_06970 49356 49997 gene locus_tag LOCUS_06980 49356 49997 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_06980 50036 50317 gene locus_tag LOCUS_06990 50036 50317 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_06990 50821 51030 gene locus_tag LOCUS_07000 50821 51030 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519083.1 protein_id gnl|my_center|LOCUS_07000 51117 51830 gene locus_tag LOCUS_07010 51117 51830 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917062.1 protein_id gnl|my_center|LOCUS_07010 51814 52623 gene locus_tag LOCUS_07020 51814 52623 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028263.1 protein_id gnl|my_center|LOCUS_07020 52607 53341 gene locus_tag LOCUS_07030 52607 53341 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_07030 53982 54488 gene locus_tag LOCUS_07040 53982 54488 CDS product YgjV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074508.1 protein_id gnl|my_center|LOCUS_07040 55244 56620 gene locus_tag LOCUS_07050 gene murD 55244 56620 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_07050 56675 57370 gene locus_tag LOCUS_07060 gene yunB 56675 57370 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_07060 57413 59389 gene locus_tag LOCUS_07070 gene ligA 57413 59389 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393509.1 protein_id gnl|my_center|LOCUS_07070 59537 59767 gene locus_tag LOCUS_07080 59537 59767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 60075 61121 gene locus_tag LOCUS_07090 60075 61121 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750893.1 protein_id gnl|my_center|LOCUS_07090 61109 61903 gene locus_tag LOCUS_07100 61109 61903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 61900 63495 gene locus_tag LOCUS_07110 61900 63495 CDS product putative 2-aminoethylphosphonate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425420.1 protein_id gnl|my_center|LOCUS_07110 64279 66441 gene locus_tag LOCUS_07120 64279 66441 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_07120 66725 67387 gene locus_tag LOCUS_07130 gene cas5c 66725 67387 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388584.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence10 881 108 gene locus_tag LOCUS_07140 881 108 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_07140 1167 871 gene locus_tag LOCUS_07150 1167 871 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285944.1 protein_id gnl|my_center|LOCUS_07150 3250 1271 gene locus_tag LOCUS_07160 gene metG 3250 1271 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_07160 4293 3460 gene locus_tag LOCUS_07170 4293 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5469 4309 gene locus_tag LOCUS_07180 5469 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 5714 5505 gene locus_tag LOCUS_07190 gene yidD 5714 5505 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457867.1 protein_id gnl|my_center|LOCUS_07190 6058 5711 gene locus_tag LOCUS_07200 6058 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 6336 6196 gene locus_tag LOCUS_07210 gene rpmH 6336 6196 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549412.1 protein_id gnl|my_center|LOCUS_07210 6715 8028 gene locus_tag LOCUS_07220 gene dnaA 6715 8028 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428021.1 protein_id gnl|my_center|LOCUS_07220 8315 9427 gene locus_tag LOCUS_07230 gene dnaN 8315 9427 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_07230 9429 9644 gene locus_tag LOCUS_07240 9429 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 9634 10743 gene locus_tag LOCUS_07250 gene recF 9634 10743 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_07250 10826 11092 gene locus_tag LOCUS_07260 10826 11092 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_07260 11206 13158 gene locus_tag LOCUS_07270 gene gyrB 11206 13158 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435993.1 protein_id gnl|my_center|LOCUS_07270 13209 15713 gene locus_tag LOCUS_07280 gene gyrA 13209 15713 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641633.1 protein_id gnl|my_center|LOCUS_07280 15710 16147 gene locus_tag LOCUS_07290 gene rnhA 15710 16147 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974731.1 protein_id gnl|my_center|LOCUS_07290 18344 16431 gene locus_tag LOCUS_07300 18344 16431 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_07300 18950 18687 gene locus_tag LOCUS_07310 gene rpsT 18950 18687 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726526.1 protein_id gnl|my_center|LOCUS_07310 19144 20040 gene locus_tag LOCUS_07320 gene gpr 19144 20040 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_07320 20173 21537 gene locus_tag LOCUS_07330 20173 21537 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_07330 21902 23323 gene locus_tag LOCUS_07340 21902 23323 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_07340 23386 25320 gene locus_tag LOCUS_07350 23386 25320 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128975638.1 protein_id gnl|my_center|LOCUS_07350 26583 25426 gene locus_tag LOCUS_07360 26583 25426 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258870.1 protein_id gnl|my_center|LOCUS_07360 27525 26602 gene locus_tag LOCUS_07370 27525 26602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 28590 27559 gene locus_tag LOCUS_07380 28590 27559 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476434.1 protein_id gnl|my_center|LOCUS_07380 28544 28843 gene locus_tag LOCUS_07390 28544 28843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 29082 28894 gene locus_tag LOCUS_07400 29082 28894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 29186 29431 gene locus_tag LOCUS_07410 29186 29431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 31248 29473 gene locus_tag LOCUS_07420 gene aspS 31248 29473 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_07420 32491 31289 gene locus_tag LOCUS_07430 32491 31289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 33915 32539 gene locus_tag LOCUS_07440 gene hisS 33915 32539 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_07440 34659 34243 gene locus_tag LOCUS_07450 gene mgsA 34659 34243 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_07450 35418 34675 gene locus_tag LOCUS_07460 gene minD 35418 34675 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503309.1 protein_id gnl|my_center|LOCUS_07460 36218 35523 gene locus_tag LOCUS_07470 gene rsmG 36218 35523 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_07470 36639 36220 gene locus_tag LOCUS_07480 gene mscL 36639 36220 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258546.1 protein_id gnl|my_center|LOCUS_07480 38155 36851 gene locus_tag LOCUS_07490 gene serS 38155 36851 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_07490 38773 38240 gene locus_tag LOCUS_07500 38773 38240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 39671 38787 gene locus_tag LOCUS_07510 39671 38787 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_07510 40445 39690 gene locus_tag LOCUS_07520 40445 39690 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_07520 40732 40911 gene locus_tag LOCUS_07530 40732 40911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 43250 41379 gene locus_tag LOCUS_07540 43250 41379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 45435 43342 gene locus_tag LOCUS_07550 45435 43342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 45974 45450 gene locus_tag LOCUS_07560 45974 45450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 46848 46006 gene locus_tag LOCUS_07570 46848 46006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 47469 46891 gene locus_tag LOCUS_07580 47469 46891 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_07580 47961 47533 gene locus_tag LOCUS_07590 gene dutA 47961 47533 CDS product dUTP diphosphatase DutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245820.1 protein_id gnl|my_center|LOCUS_07590 50162 48030 gene locus_tag LOCUS_07600 50162 48030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 50509 50162 gene locus_tag LOCUS_07610 50509 50162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 50736 51665 gene locus_tag LOCUS_07620 50736 51665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 51678 52673 gene locus_tag LOCUS_07630 51678 52673 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_07630 52741 53655 gene locus_tag LOCUS_07640 52741 53655 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966760.1 protein_id gnl|my_center|LOCUS_07640 53734 54435 gene locus_tag LOCUS_07650 53734 54435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 54453 55145 gene locus_tag LOCUS_07660 54453 55145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 57011 55218 gene locus_tag LOCUS_07670 57011 55218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 57909 57052 gene locus_tag LOCUS_07680 gene noc 57909 57052 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799028.1 protein_id gnl|my_center|LOCUS_07680 59070 58111 gene locus_tag LOCUS_07690 gene prmA 59070 58111 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816472.1 protein_id gnl|my_center|LOCUS_07690 60028 59156 gene locus_tag LOCUS_07700 60028 59156 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_07700 60606 60028 gene locus_tag LOCUS_07710 60606 60028 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322652.1 protein_id gnl|my_center|LOCUS_07710 62101 60719 gene locus_tag LOCUS_07720 gene mnmE 62101 60719 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258674.1 protein_id gnl|my_center|LOCUS_07720 62901 62257 gene locus_tag LOCUS_07730 62901 62257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence11 211 696 gene locus_tag LOCUS_07740 gene moaC 211 696 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256659.1 protein_id gnl|my_center|LOCUS_07740 689 1132 gene locus_tag LOCUS_07750 689 1132 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 protein_id gnl|my_center|LOCUS_07750 1129 2151 gene locus_tag LOCUS_07760 1129 2151 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 protein_id gnl|my_center|LOCUS_07760 2270 3172 gene locus_tag LOCUS_07770 gene modA 2270 3172 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461081.1 protein_id gnl|my_center|LOCUS_07770 3210 3878 gene locus_tag LOCUS_07780 gene modB 3210 3878 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190258.1 protein_id gnl|my_center|LOCUS_07780 4293 3949 gene locus_tag LOCUS_07790 4293 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4689 4510 gene locus_tag LOCUS_07800 4689 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 4896 5942 gene locus_tag LOCUS_07810 4896 5942 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_07810 6009 6509 gene locus_tag LOCUS_07820 6009 6509 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_07820 7211 6621 gene locus_tag LOCUS_07830 7211 6621 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_07830 7304 7825 gene locus_tag LOCUS_07840 7304 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 8767 7829 gene locus_tag LOCUS_07850 8767 7829 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_07850 8867 10378 gene locus_tag LOCUS_07860 gene glpK 8867 10378 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_07860 10557 10937 gene locus_tag LOCUS_07870 10557 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 11675 11013 gene locus_tag LOCUS_07880 11675 11013 CDS product chloramphenicol acetyltransferase CAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890745.1 protein_id gnl|my_center|LOCUS_07880 12569 11778 gene locus_tag LOCUS_07890 12569 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 13463 12633 gene locus_tag LOCUS_07900 13463 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 14910 14149 gene locus_tag LOCUS_07910 14910 14149 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681078.1 protein_id gnl|my_center|LOCUS_07910 16433 14907 gene locus_tag LOCUS_07920 16433 14907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 17466 16450 gene locus_tag LOCUS_07930 17466 16450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 18184 17519 gene locus_tag LOCUS_07940 18184 17519 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_07940 18857 18186 gene locus_tag LOCUS_07950 18857 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 20201 19014 gene locus_tag LOCUS_07960 gene metK 20201 19014 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_07960 20584 21462 gene locus_tag LOCUS_07970 20584 21462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 21703 26526 gene locus_tag LOCUS_07980 21703 26526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_07980 26549 27793 gene locus_tag LOCUS_07990 26549 27793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986915.1 protein_id gnl|my_center|LOCUS_07990 27804 28844 gene locus_tag LOCUS_08000 27804 28844 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 protein_id gnl|my_center|LOCUS_08000 29157 28984 gene locus_tag LOCUS_08010 29157 28984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08010 29579 29154 gene locus_tag LOCUS_08020 29579 29154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 30492 29605 gene locus_tag LOCUS_08030 30492 29605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 31709 30507 gene locus_tag LOCUS_08040 31709 30507 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_08040 31881 33080 gene locus_tag LOCUS_08050 31881 33080 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_08050 33198 33881 gene locus_tag LOCUS_08060 33198 33881 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360701.1 protein_id gnl|my_center|LOCUS_08060 34058 34369 gene locus_tag LOCUS_08070 gene rplU 34058 34369 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_08070 34372 34701 gene locus_tag LOCUS_08080 34372 34701 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016913.1 protein_id gnl|my_center|LOCUS_08080 34746 35027 gene locus_tag LOCUS_08090 gene rpmA 34746 35027 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000944958.1 protein_id gnl|my_center|LOCUS_08090 35178 36461 gene locus_tag LOCUS_08100 gene obgE 35178 36461 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_08100 36591 37013 gene locus_tag LOCUS_08110 36591 37013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 37039 37872 gene locus_tag LOCUS_08120 37039 37872 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_08120 38168 39790 gene locus_tag LOCUS_08130 38168 39790 CDS product gamma-glutamyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272455.1 protein_id gnl|my_center|LOCUS_08130 40282 39974 gene locus_tag LOCUS_08140 40282 39974 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209274.1 protein_id gnl|my_center|LOCUS_08140 40756 40412 gene locus_tag LOCUS_08150 gene rplQ 40756 40412 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_08150 41770 40814 gene locus_tag LOCUS_08160 41770 40814 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_08160 42460 41858 gene locus_tag LOCUS_08170 gene rpsD 42460 41858 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_08170 42894 42481 gene locus_tag LOCUS_08180 gene rpsK 42894 42481 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_08180 43275 42910 gene locus_tag LOCUS_08190 gene rpsM 43275 42910 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_08190 43690 43472 gene locus_tag LOCUS_08200 gene infA 43690 43472 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_08200 43978 43694 gene locus_tag LOCUS_08210 43978 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 44741 43989 gene locus_tag LOCUS_08220 gene map 44741 43989 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_08220 45381 44749 gene locus_tag LOCUS_08230 45381 44749 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_08230 46769 45399 gene locus_tag LOCUS_08240 gene secY 46769 45399 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_08240 47211 46771 gene locus_tag LOCUS_08250 gene rplO 47211 46771 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766081.1 protein_id gnl|my_center|LOCUS_08250 47408 47226 gene locus_tag LOCUS_08260 gene rpmD 47408 47226 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_08260 47922 47422 gene locus_tag LOCUS_08270 gene rpsE 47922 47422 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_08270 48300 47941 gene locus_tag LOCUS_08280 gene rplR 48300 47941 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 protein_id gnl|my_center|LOCUS_08280 48860 48315 gene locus_tag LOCUS_08290 gene rplF 48860 48315 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_08290 49274 48876 gene locus_tag LOCUS_08300 gene rpsH 49274 48876 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_08300 49630 49445 gene locus_tag LOCUS_08310 49630 49445 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_08310 50187 49648 gene locus_tag LOCUS_08320 gene rplE 50187 49648 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_08320 50518 50207 gene locus_tag LOCUS_08330 gene rplX 50518 50207 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_08330 50901 50533 gene locus_tag LOCUS_08340 gene rplN 50901 50533 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_08340 51182 50916 gene locus_tag LOCUS_08350 gene rpsQ 51182 50916 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_08350 51397 51197 gene locus_tag LOCUS_08360 gene rpmC 51397 51197 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_08360 51836 51399 gene locus_tag LOCUS_08370 gene rplP 51836 51399 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_08370 52771 51836 gene locus_tag LOCUS_08380 52771 51836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 53134 52790 gene locus_tag LOCUS_08390 gene rplV 53134 52790 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_08390 53418 53155 gene locus_tag LOCUS_08400 gene rpsS 53418 53155 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_08400 54268 53435 gene locus_tag LOCUS_08410 gene rplB 54268 53435 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_08410 54600 54304 gene locus_tag LOCUS_08420 gene rplW 54600 54304 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_08420 55223 54600 gene locus_tag LOCUS_08430 gene rplD 55223 54600 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_08430 55961 55242 gene locus_tag LOCUS_08440 gene rplC 55961 55242 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_08440 56406 56095 gene locus_tag LOCUS_08450 gene rpsJ 56406 56095 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118667.1 protein_id gnl|my_center|LOCUS_08450 57062 58678 gene locus_tag LOCUS_08460 57062 58678 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_08460 61493 59151 gene locus_tag LOCUS_08470 61493 59151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 61886 61509 gene locus_tag LOCUS_08480 61886 61509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence12 2 77 gene locus_tag LOCUS_t00110 2 77 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 87 171 gene locus_tag LOCUS_t00120 87 171 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 628 1383 gene locus_tag LOCUS_08490 628 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1394 2263 gene locus_tag LOCUS_08500 1394 2263 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966758.1 protein_id gnl|my_center|LOCUS_08500 2386 3273 gene locus_tag LOCUS_08510 2386 3273 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026644807.1 protein_id gnl|my_center|LOCUS_08510 3835 3760 gene locus_tag LOCUS_t00130 3835 3760 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3944 3870 gene locus_tag LOCUS_t00140 3944 3870 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4075 4000 gene locus_tag LOCUS_t00150 4075 4000 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4202 4126 gene locus_tag LOCUS_t00160 4202 4126 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4284 4210 gene locus_tag LOCUS_t00170 4284 4210 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4561 4388 gene locus_tag LOCUS_08520 4561 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4723 5481 gene locus_tag LOCUS_08530 4723 5481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_08530 5474 6289 gene locus_tag LOCUS_08540 5474 6289 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_08540 6286 7296 gene locus_tag LOCUS_08550 6286 7296 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_08550 8196 7378 gene locus_tag LOCUS_08560 8196 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9441 8230 gene locus_tag LOCUS_08570 9441 8230 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810182.1 protein_id gnl|my_center|LOCUS_08570 11565 9472 gene locus_tag LOCUS_08580 11565 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 13576 11633 gene locus_tag LOCUS_08590 13576 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 14374 13628 gene locus_tag LOCUS_08600 gene ftsE 14374 13628 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292768.1 protein_id gnl|my_center|LOCUS_08600 14549 15433 gene locus_tag LOCUS_08610 14549 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 15932 15522 gene locus_tag LOCUS_08620 15932 15522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 16315 15938 gene locus_tag LOCUS_08630 16315 15938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 18844 16352 gene locus_tag LOCUS_08640 18844 16352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 19037 19813 gene locus_tag LOCUS_08650 19037 19813 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101106.1 protein_id gnl|my_center|LOCUS_08650 19835 20599 gene locus_tag LOCUS_08660 19835 20599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 22165 20903 gene locus_tag LOCUS_08670 22165 20903 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459079.1 protein_id gnl|my_center|LOCUS_08670 23120 22182 gene locus_tag LOCUS_08680 23120 22182 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721810.1 protein_id gnl|my_center|LOCUS_08680 23683 23204 gene locus_tag LOCUS_08690 23683 23204 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425085.1 protein_id gnl|my_center|LOCUS_08690 24302 23676 gene locus_tag LOCUS_08700 24302 23676 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_08700 25086 24322 gene locus_tag LOCUS_08710 gene flgG 25086 24322 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405355.1 protein_id gnl|my_center|LOCUS_08710 25860 25105 gene locus_tag LOCUS_08720 gene flgF 25860 25105 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_08720 26735 25860 gene locus_tag LOCUS_08730 gene whiG 26735 25860 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_08730 28896 26797 gene locus_tag LOCUS_08740 gene flhA 28896 26797 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_08740 30060 28942 gene locus_tag LOCUS_08750 gene flhB 30060 28942 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816211.1 protein_id gnl|my_center|LOCUS_08750 30868 30098 gene locus_tag LOCUS_08760 gene fliR 30868 30098 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_08760 31139 30885 gene locus_tag LOCUS_08770 31139 30885 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000958542.1 protein_id gnl|my_center|LOCUS_08770 31824 31156 gene locus_tag LOCUS_08780 gene fliP 31824 31156 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359303.1 protein_id gnl|my_center|LOCUS_08780 32198 31821 gene locus_tag LOCUS_08790 32198 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 32567 32202 gene locus_tag LOCUS_08800 32567 32202 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816218.1 protein_id gnl|my_center|LOCUS_08800 34037 32625 gene locus_tag LOCUS_08810 34037 32625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 35052 34027 gene locus_tag LOCUS_08820 gene fliM 35052 34027 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870065.1 protein_id gnl|my_center|LOCUS_08820 35938 35105 gene locus_tag LOCUS_08830 35938 35105 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895795.1 protein_id gnl|my_center|LOCUS_08830 36814 35969 gene locus_tag LOCUS_08840 36814 35969 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556880.1 protein_id gnl|my_center|LOCUS_08840 37172 36954 gene locus_tag LOCUS_08850 37172 36954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 38395 37292 gene locus_tag LOCUS_08860 38395 37292 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460740.1 protein_id gnl|my_center|LOCUS_08860 38855 38484 gene locus_tag LOCUS_08870 38855 38484 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405320.1 protein_id gnl|my_center|LOCUS_08870 39380 38886 gene locus_tag LOCUS_08880 39380 38886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 40505 39414 gene locus_tag LOCUS_08890 40505 39414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 41003 40542 gene locus_tag LOCUS_08900 41003 40542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 42337 41036 gene locus_tag LOCUS_08910 gene fliI 42337 41036 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392295.1 protein_id gnl|my_center|LOCUS_08910 43287 42364 gene locus_tag LOCUS_08920 43287 42364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 44407 43280 gene locus_tag LOCUS_08930 gene fliG 44407 43280 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_08930 46034 44397 gene locus_tag LOCUS_08940 46034 44397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 46387 46073 gene locus_tag LOCUS_08950 46387 46073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 46972 46517 gene locus_tag LOCUS_08960 gene flgC 46972 46517 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_08960 47394 47005 gene locus_tag LOCUS_08970 47394 47005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 49019 48138 gene locus_tag LOCUS_08980 gene lsrF 49019 48138 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_08980 50324 49182 gene locus_tag LOCUS_08990 gene lsrB 50324 49182 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823631.1 protein_id gnl|my_center|LOCUS_08990 51410 50379 gene locus_tag LOCUS_09000 51410 50379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878507.1 protein_id gnl|my_center|LOCUS_09000 52423 51407 gene locus_tag LOCUS_09010 52423 51407 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682144.1 protein_id gnl|my_center|LOCUS_09010 53952 52420 gene locus_tag LOCUS_09020 53952 52420 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426491.1 protein_id gnl|my_center|LOCUS_09020 54327 55268 gene locus_tag LOCUS_09030 54327 55268 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192708.1 protein_id gnl|my_center|LOCUS_09030 55325 56887 gene locus_tag LOCUS_09040 gene lsrK 55325 56887 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018815.1 protein_id gnl|my_center|LOCUS_09040 56917 57267 gene locus_tag LOCUS_09050 56917 57267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 57582 57271 gene locus_tag LOCUS_09060 57582 57271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 58273 57800 gene locus_tag LOCUS_09070 58273 57800 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403109.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence13 31 1407 gene locus_tag LOCUS_09080 31 1407 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_09080 2181 1660 gene locus_tag LOCUS_09090 2181 1660 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404491.1 protein_id gnl|my_center|LOCUS_09090 2762 2178 gene locus_tag LOCUS_09100 gene spmA 2762 2178 CDS product spore maturation protein SpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247811.1 protein_id gnl|my_center|LOCUS_09100 3001 3246 gene locus_tag LOCUS_09110 3001 3246 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_09110 4344 3364 gene locus_tag LOCUS_09120 gene lplA2 4344 3364 CDS product lipoate protein ligase LplA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721881.1 protein_id gnl|my_center|LOCUS_09120 5191 4331 gene locus_tag LOCUS_09130 gene lipA 5191 4331 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932756.1 protein_id gnl|my_center|LOCUS_09130 5420 5199 gene locus_tag LOCUS_09140 5420 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 6466 5519 gene locus_tag LOCUS_09150 6466 5519 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875296.1 protein_id gnl|my_center|LOCUS_09150 6834 7577 gene locus_tag LOCUS_09160 6834 7577 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_09160 8145 7714 gene locus_tag LOCUS_09170 8145 7714 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461668.1 protein_id gnl|my_center|LOCUS_09170 8418 9350 gene locus_tag LOCUS_09180 gene cysK 8418 9350 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_09180 11086 9575 gene locus_tag LOCUS_09190 11086 9575 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_09190 12384 11203 gene locus_tag LOCUS_09200 12384 11203 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_09200 13170 12445 gene locus_tag LOCUS_09210 13170 12445 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114182.1 protein_id gnl|my_center|LOCUS_09210 13449 13967 gene locus_tag LOCUS_09220 13449 13967 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_09220 14541 14035 gene locus_tag LOCUS_09230 gene greA 14541 14035 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011182999.1 protein_id gnl|my_center|LOCUS_09230 15447 14554 gene locus_tag LOCUS_09240 15447 14554 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_09240 16014 15589 gene locus_tag LOCUS_09250 16014 15589 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357668.1 protein_id gnl|my_center|LOCUS_09250 16952 16026 gene locus_tag LOCUS_09260 gene pyrB 16952 16026 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_09260 17604 16966 gene locus_tag LOCUS_09270 gene pyrE 17604 16966 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711449.1 protein_id gnl|my_center|LOCUS_09270 18359 17655 gene locus_tag LOCUS_09280 gene pyrF 18359 17655 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922179.1 protein_id gnl|my_center|LOCUS_09280 19269 18352 gene locus_tag LOCUS_09290 gene pyrD 19269 18352 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081049.1 protein_id gnl|my_center|LOCUS_09290 20000 19263 gene locus_tag LOCUS_09300 20000 19263 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989827.1 protein_id gnl|my_center|LOCUS_09300 21016 19997 gene locus_tag LOCUS_09310 21016 19997 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_09310 22944 21496 gene locus_tag LOCUS_09320 22944 21496 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 protein_id gnl|my_center|LOCUS_09320 24316 22958 gene locus_tag LOCUS_09330 gene trkA 24316 22958 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_09330 24532 27180 gene locus_tag LOCUS_09340 24532 27180 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_09340 27403 28149 gene locus_tag LOCUS_09350 27403 28149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 28265 30649 gene locus_tag LOCUS_09360 28265 30649 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_09360 30719 31489 gene locus_tag LOCUS_09370 gene udp 30719 31489 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_09370 31499 32323 gene locus_tag LOCUS_09380 31499 32323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 33463 32474 gene locus_tag LOCUS_09390 33463 32474 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808786.1 protein_id gnl|my_center|LOCUS_09390 34680 33499 gene locus_tag LOCUS_09400 34680 33499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 35202 34687 gene locus_tag LOCUS_09410 35202 34687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 35610 35212 gene locus_tag LOCUS_09420 35610 35212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 36628 35582 gene locus_tag LOCUS_09430 36628 35582 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_09430 36858 37622 gene locus_tag LOCUS_09440 36858 37622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 40181 37884 gene locus_tag LOCUS_09450 40181 37884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 40718 40212 gene locus_tag LOCUS_09460 40718 40212 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355957.1 protein_id gnl|my_center|LOCUS_09460 41775 40774 gene locus_tag LOCUS_09470 41775 40774 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_09470 42943 42002 gene locus_tag LOCUS_09480 42943 42002 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_09480 43389 42940 gene locus_tag LOCUS_09490 43389 42940 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015665.1 protein_id gnl|my_center|LOCUS_09490 43619 44728 gene locus_tag LOCUS_09500 43619 44728 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_09500 45574 44990 gene locus_tag LOCUS_09510 45574 44990 CDS product L-2-amino-thiazoline-4-carboxylic acid hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681208.1 protein_id gnl|my_center|LOCUS_09510 47309 46284 gene locus_tag LOCUS_09520 47309 46284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 47609 47839 gene locus_tag LOCUS_09530 gene acpP 47609 47839 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_09530 47954 48376 gene locus_tag LOCUS_09540 gene accB 47954 48376 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555370.1 protein_id gnl|my_center|LOCUS_09540 48379 49767 gene locus_tag LOCUS_09550 gene accC 48379 49767 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_09550 49764 50624 gene locus_tag LOCUS_09560 gene accD 49764 50624 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942856.1 protein_id gnl|my_center|LOCUS_09560 50617 51429 gene locus_tag LOCUS_09570 gene accA 50617 51429 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229417.1 protein_id gnl|my_center|LOCUS_09570 51426 52373 gene locus_tag LOCUS_09580 51426 52373 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_09580 52420 53352 gene locus_tag LOCUS_09590 gene fabK 52420 53352 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_09590 53349 54287 gene locus_tag LOCUS_09600 gene fabD 53349 54287 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356280.1 protein_id gnl|my_center|LOCUS_09600 54284 55027 gene locus_tag LOCUS_09610 gene fabG 54284 55027 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259260.1 protein_id gnl|my_center|LOCUS_09610 55062 56303 gene locus_tag LOCUS_09620 gene fabF 55062 56303 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_09620 56307 56741 gene locus_tag LOCUS_09630 gene fabZ 56307 56741 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000931959.1 protein_id gnl|my_center|LOCUS_09630 56802 57272 gene locus_tag LOCUS_09640 56802 57272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence14 1048 503 gene locus_tag LOCUS_09650 gene yfcE 1048 503 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_09650 3273 1198 gene locus_tag LOCUS_09660 3273 1198 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_09660 3618 3340 gene locus_tag LOCUS_09670 3618 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 4158 5351 gene locus_tag LOCUS_09680 gene ilvA 4158 5351 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_09680 5666 5827 gene locus_tag LOCUS_09690 5666 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 5827 7425 gene locus_tag LOCUS_09700 5827 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 7422 7886 gene locus_tag LOCUS_09710 7422 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 7954 8316 gene locus_tag LOCUS_09720 7954 8316 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_09720 8980 8396 gene locus_tag LOCUS_09730 8980 8396 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_09730 9737 9051 gene locus_tag LOCUS_09740 9737 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 9898 10692 gene locus_tag LOCUS_09750 9898 10692 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015798.1 protein_id gnl|my_center|LOCUS_09750 10883 13633 gene locus_tag LOCUS_09760 gene secA 10883 13633 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_09760 13716 14525 gene locus_tag LOCUS_09770 gene pgeF 13716 14525 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_09770 14551 16086 gene locus_tag LOCUS_09780 14551 16086 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538266.1 protein_id gnl|my_center|LOCUS_09780 17307 16678 gene locus_tag LOCUS_09790 gene lexA 17307 16678 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112267.1 protein_id gnl|my_center|LOCUS_09790 17564 17791 gene locus_tag LOCUS_09800 gene secG 17564 17791 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_09800 19982 18576 gene locus_tag LOCUS_09810 19982 18576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 20347 22017 gene locus_tag LOCUS_09820 20347 22017 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_09820 22276 22791 gene locus_tag LOCUS_09830 22276 22791 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 protein_id gnl|my_center|LOCUS_09830 22788 24059 gene locus_tag LOCUS_09840 22788 24059 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_09840 25072 24143 gene locus_tag LOCUS_09850 25072 24143 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529592.1 protein_id gnl|my_center|LOCUS_09850 26025 25069 gene locus_tag LOCUS_09860 gene rihA 26025 25069 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001207526.1 protein_id gnl|my_center|LOCUS_09860 27021 26056 gene locus_tag LOCUS_09870 27021 26056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537587.1 protein_id gnl|my_center|LOCUS_09870 28183 27023 gene locus_tag LOCUS_09880 28183 27023 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383862.1 protein_id gnl|my_center|LOCUS_09880 29735 28176 gene locus_tag LOCUS_09890 29735 28176 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383861.1 protein_id gnl|my_center|LOCUS_09890 31047 29911 gene locus_tag LOCUS_09900 31047 29911 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383860.1 protein_id gnl|my_center|LOCUS_09900 31345 31875 gene locus_tag LOCUS_09910 31345 31875 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_09910 31954 33555 gene locus_tag LOCUS_09920 31954 33555 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_09920 33598 34965 gene locus_tag LOCUS_09930 gene rlmD 33598 34965 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_09930 35011 35382 gene locus_tag LOCUS_09940 35011 35382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 35438 37030 gene locus_tag LOCUS_09950 35438 37030 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_09950 37071 38033 gene locus_tag LOCUS_09960 37071 38033 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_09960 39547 38108 gene locus_tag LOCUS_09970 gene proS 39547 38108 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_09970 40613 39648 gene locus_tag LOCUS_09980 40613 39648 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459042.1 protein_id gnl|my_center|LOCUS_09980 41708 40758 gene locus_tag LOCUS_09990 41708 40758 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016957.1 protein_id gnl|my_center|LOCUS_09990 43568 41829 gene locus_tag LOCUS_10000 43568 41829 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626068.1 protein_id gnl|my_center|LOCUS_10000 43932 43660 gene locus_tag LOCUS_10010 43932 43660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 44298 46022 gene locus_tag LOCUS_10020 gene ade 44298 46022 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_10020 46114 46656 gene locus_tag LOCUS_10030 46114 46656 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223119.1 protein_id gnl|my_center|LOCUS_10030 46704 47237 gene locus_tag LOCUS_10040 46704 47237 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_10040 47444 47800 gene locus_tag LOCUS_10050 47444 47800 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459447.1 protein_id gnl|my_center|LOCUS_10050 47766 48449 gene locus_tag LOCUS_10060 47766 48449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 49086 48622 gene locus_tag LOCUS_10070 49086 48622 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_10070 49592 49518 gene locus_tag LOCUS_t00180 49592 49518 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence15 1287 2804 gene locus_tag LOCUS_10080 1287 2804 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_10080 2858 4045 gene locus_tag LOCUS_10090 gene thiI 2858 4045 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_10090 4065 5333 gene locus_tag LOCUS_10100 4065 5333 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_10100 5406 7088 gene locus_tag LOCUS_10110 5406 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 7920 7162 gene locus_tag LOCUS_10120 7920 7162 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404186.1 protein_id gnl|my_center|LOCUS_10120 7844 8131 gene locus_tag LOCUS_10130 7844 8131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 8265 9515 gene locus_tag LOCUS_10140 8265 9515 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963605.1 protein_id gnl|my_center|LOCUS_10140 11209 9728 gene locus_tag LOCUS_10150 11209 9728 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890565.1 protein_id gnl|my_center|LOCUS_10150 12172 11465 gene locus_tag LOCUS_10160 12172 11465 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722035.1 protein_id gnl|my_center|LOCUS_10160 13251 12169 gene locus_tag LOCUS_10170 13251 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 13458 13700 gene locus_tag LOCUS_10180 13458 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 13954 13610 gene locus_tag LOCUS_10190 13954 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 14204 15427 gene locus_tag LOCUS_10200 gene arcA 14204 15427 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870198.1 protein_id gnl|my_center|LOCUS_10200 15471 16472 gene locus_tag LOCUS_10210 gene argF 15471 16472 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861433.1 protein_id gnl|my_center|LOCUS_10210 16486 17871 gene locus_tag LOCUS_10220 16486 17871 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706444.1 protein_id gnl|my_center|LOCUS_10220 19590 17947 gene locus_tag LOCUS_10230 19590 17947 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396652.1 protein_id gnl|my_center|LOCUS_10230 20618 19779 gene locus_tag LOCUS_10240 20618 19779 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938910.1 protein_id gnl|my_center|LOCUS_10240 20846 21502 gene locus_tag LOCUS_10250 20846 21502 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386325.1 protein_id gnl|my_center|LOCUS_10250 21735 23411 gene locus_tag LOCUS_10260 21735 23411 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_10260 23558 24664 gene locus_tag LOCUS_10270 23558 24664 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286870.1 protein_id gnl|my_center|LOCUS_10270 25658 24750 gene locus_tag LOCUS_10280 25658 24750 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_10280 26532 25666 gene locus_tag LOCUS_10290 gene truB 26532 25666 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_10290 27530 26571 gene locus_tag LOCUS_10300 27530 26571 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220194564.1 protein_id gnl|my_center|LOCUS_10300 27895 27527 gene locus_tag LOCUS_10310 gene rbfA 27895 27527 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_10310 30433 28025 gene locus_tag LOCUS_10320 30433 28025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 31446 30616 gene locus_tag LOCUS_10330 31446 30616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 31717 31439 gene locus_tag LOCUS_10340 31717 31439 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460394.1 protein_id gnl|my_center|LOCUS_10340 32908 31739 gene locus_tag LOCUS_10350 gene nusA 32908 31739 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_10350 33427 32963 gene locus_tag LOCUS_10360 33427 32963 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_10360 34564 33680 gene locus_tag LOCUS_10370 gene rsiV 34564 33680 CDS product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 protein_id gnl|my_center|LOCUS_10370 35048 34554 gene locus_tag LOCUS_10380 gene sigV 35048 34554 CDS product RNA polymerase sigma factor SigV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398891.1 protein_id gnl|my_center|LOCUS_10380 35983 35165 gene locus_tag LOCUS_10390 35983 35165 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_10390 36696 35983 gene locus_tag LOCUS_10400 36696 35983 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_10400 37105 36683 gene locus_tag LOCUS_10410 37105 36683 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_10410 37299 38216 gene locus_tag LOCUS_10420 37299 38216 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_10420 38179 38637 gene locus_tag LOCUS_10430 38179 38637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 38742 40031 gene locus_tag LOCUS_10440 38742 40031 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460406.1 protein_id gnl|my_center|LOCUS_10440 40890 40177 gene locus_tag LOCUS_10450 40890 40177 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815292.1 protein_id gnl|my_center|LOCUS_10450 41198 40887 gene locus_tag LOCUS_10460 41198 40887 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_10460 41910 41260 gene locus_tag LOCUS_10470 41910 41260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 42099 43190 gene locus_tag LOCUS_10480 gene mutY 42099 43190 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_10480 43240 43722 gene locus_tag LOCUS_10490 43240 43722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 43747 44298 gene locus_tag LOCUS_10500 43747 44298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 44330 44917 gene locus_tag LOCUS_10510 44330 44917 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188471799.1 protein_id gnl|my_center|LOCUS_10510 44914 45783 gene locus_tag LOCUS_10520 44914 45783 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_10520 47267 45909 gene locus_tag LOCUS_10530 gene fumC 47267 45909 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 protein_id gnl|my_center|LOCUS_10530 47450 48265 gene locus_tag LOCUS_10540 47450 48265 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_10540 48267 49193 gene locus_tag LOCUS_10550 48267 49193 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence16 212 904 gene locus_tag LOCUS_10560 212 904 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_10560 922 1920 gene locus_tag LOCUS_10570 922 1920 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_10570 2166 2633 gene locus_tag LOCUS_10580 2166 2633 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_10580 2630 3580 gene locus_tag LOCUS_10590 gene gluQRS 2630 3580 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 protein_id gnl|my_center|LOCUS_10590 3639 4232 gene locus_tag LOCUS_10600 3639 4232 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_10600 5470 4304 gene locus_tag LOCUS_10610 5470 4304 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_10610 5862 7685 gene locus_tag LOCUS_10620 gene typA 5862 7685 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_10620 8114 7758 gene locus_tag LOCUS_10630 8114 7758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 8303 9469 gene locus_tag LOCUS_10640 8303 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 9935 9600 gene locus_tag LOCUS_10650 gene azlD 9935 9600 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_10650 10558 9926 gene locus_tag LOCUS_10660 10558 9926 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_10660 10924 10643 gene locus_tag LOCUS_10670 10924 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816325.1 protein_id gnl|my_center|LOCUS_10670 12773 11028 gene locus_tag LOCUS_10680 gene argS 12773 11028 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_10680 13287 12823 gene locus_tag LOCUS_10690 13287 12823 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393888.1 protein_id gnl|my_center|LOCUS_10690 14068 13253 gene locus_tag LOCUS_10700 gene murI 14068 13253 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_10700 14271 14684 gene locus_tag LOCUS_10710 14271 14684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 14728 15846 gene locus_tag LOCUS_10720 14728 15846 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_10720 18252 15982 gene locus_tag LOCUS_10730 18252 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10730 18986 18249 gene locus_tag LOCUS_10740 18986 18249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_10740 20632 18983 gene locus_tag LOCUS_10750 20632 18983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 22841 21093 gene locus_tag LOCUS_10760 22841 21093 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_10760 24944 23007 gene locus_tag LOCUS_10770 24944 23007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 27062 25056 gene locus_tag LOCUS_10780 27062 25056 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682151.1 protein_id gnl|my_center|LOCUS_10780 28002 27322 gene locus_tag LOCUS_10790 28002 27322 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_10790 28195 28782 gene locus_tag LOCUS_10800 28195 28782 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986737.1 protein_id gnl|my_center|LOCUS_10800 28905 29450 gene locus_tag LOCUS_10810 28905 29450 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889371.1 protein_id gnl|my_center|LOCUS_10810 29750 29941 gene locus_tag LOCUS_10820 29750 29941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 30001 30351 gene locus_tag LOCUS_10830 30001 30351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 30348 30731 gene locus_tag LOCUS_10840 30348 30731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 32252 30780 gene locus_tag LOCUS_10850 32252 30780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 33702 32263 gene locus_tag LOCUS_10860 33702 32263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 34409 33699 gene locus_tag LOCUS_10870 34409 33699 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_10870 35648 34551 gene locus_tag LOCUS_10880 35648 34551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 35850 36863 gene locus_tag LOCUS_10890 35850 36863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 36884 38344 gene locus_tag LOCUS_10900 36884 38344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 38466 38879 gene locus_tag LOCUS_10910 38466 38879 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_10910 39866 39027 gene locus_tag LOCUS_10920 gene rsmI 39866 39027 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391594.1 protein_id gnl|my_center|LOCUS_10920 40597 39863 gene locus_tag LOCUS_10930 40597 39863 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869942.1 protein_id gnl|my_center|LOCUS_10930 40892 40719 gene locus_tag LOCUS_10940 40892 40719 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963626.1 protein_id gnl|my_center|LOCUS_10940 41180 41635 gene locus_tag LOCUS_10950 gene ctsR 41180 41635 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225724.1 protein_id gnl|my_center|LOCUS_10950 41701 42198 gene locus_tag LOCUS_10960 41701 42198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence17 2059 242 gene locus_tag LOCUS_10970 2059 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2953 2075 gene locus_tag LOCUS_10980 2953 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3970 3053 gene locus_tag LOCUS_10990 3970 3053 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814607.1 protein_id gnl|my_center|LOCUS_10990 4416 3967 gene locus_tag LOCUS_11000 4416 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 6064 4409 gene locus_tag LOCUS_11010 6064 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 8124 6061 gene locus_tag LOCUS_11020 8124 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 9869 8121 gene locus_tag LOCUS_11030 9869 8121 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966569.1 protein_id gnl|my_center|LOCUS_11030 10187 9891 gene locus_tag LOCUS_11040 10187 9891 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_11040 12367 10184 gene locus_tag LOCUS_11050 12367 10184 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_11050 12769 12392 gene locus_tag LOCUS_11060 12769 12392 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_11060 13511 12786 gene locus_tag LOCUS_11070 13511 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 14098 13508 gene locus_tag LOCUS_11080 14098 13508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 16547 14124 gene locus_tag LOCUS_11090 16547 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 19241 16620 gene locus_tag LOCUS_11100 19241 16620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 19978 19238 gene locus_tag LOCUS_11110 19978 19238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 21789 20017 gene locus_tag LOCUS_11120 21789 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 22885 21782 gene locus_tag LOCUS_11130 22885 21782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 24980 22902 gene locus_tag LOCUS_11140 24980 22902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 27953 25035 gene locus_tag LOCUS_11150 27953 25035 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941653.1 protein_id gnl|my_center|LOCUS_11150 28369 27950 gene locus_tag LOCUS_11160 28369 27950 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226665.1 protein_id gnl|my_center|LOCUS_11160 29180 28395 gene locus_tag LOCUS_11170 29180 28395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 30274 29180 gene locus_tag LOCUS_11180 30274 29180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 31033 30305 gene locus_tag LOCUS_11190 31033 30305 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_11190 34498 31061 gene locus_tag LOCUS_11200 34498 31061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 34927 34499 gene locus_tag LOCUS_11210 34927 34499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 35449 34961 gene locus_tag LOCUS_11220 35449 34961 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_11220 35691 35467 gene locus_tag LOCUS_11230 35691 35467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 36143 35784 gene locus_tag LOCUS_11240 36143 35784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_11240 36704 36225 gene locus_tag LOCUS_11250 36704 36225 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_11250 38492 36744 gene locus_tag LOCUS_11260 38492 36744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 39069 38650 gene locus_tag LOCUS_11270 39069 38650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 39487 39086 gene locus_tag LOCUS_11280 39487 39086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 40430 39405 gene locus_tag LOCUS_11290 40430 39405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 40789 40427 gene locus_tag LOCUS_11300 40789 40427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 41694 41002 gene locus_tag LOCUS_11310 41694 41002 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902966.1 protein_id gnl|my_center|LOCUS_11310 41864 42445 gene locus_tag LOCUS_11320 41864 42445 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861911.1 protein_id gnl|my_center|LOCUS_11320 42566 43213 gene locus_tag LOCUS_11330 42566 43213 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964759.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11330 43380 43159 gene locus_tag LOCUS_11340 43380 43159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 43585 43352 gene locus_tag LOCUS_11350 43585 43352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 44099 43686 gene locus_tag LOCUS_11360 44099 43686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence18 829 398 gene locus_tag LOCUS_11370 gene rplM 829 398 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_11370 1349 1086 gene locus_tag LOCUS_11380 1349 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1597 1340 gene locus_tag LOCUS_11390 1597 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1681 2151 gene locus_tag LOCUS_11400 gene tadA 1681 2151 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_11400 2641 2393 gene locus_tag LOCUS_11410 2641 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2949 2674 gene locus_tag LOCUS_11420 2949 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 3255 3001 gene locus_tag LOCUS_11430 gene spoIIID 3255 3001 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_11430 3543 5039 gene locus_tag LOCUS_11440 gene fliC 3543 5039 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112503.1 protein_id gnl|my_center|LOCUS_11440 6100 5513 gene locus_tag LOCUS_11450 6100 5513 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966691.1 protein_id gnl|my_center|LOCUS_11450 6506 7837 gene locus_tag LOCUS_11460 gene glnA 6506 7837 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392808.1 protein_id gnl|my_center|LOCUS_11460 7882 8430 gene locus_tag LOCUS_11470 7882 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 9397 8819 gene locus_tag LOCUS_11480 9397 8819 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393845.1 protein_id gnl|my_center|LOCUS_11480 12518 9381 gene locus_tag LOCUS_11490 12518 9381 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_11490 13726 12515 gene locus_tag LOCUS_11500 13726 12515 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943303.1 protein_id gnl|my_center|LOCUS_11500 15127 13763 gene locus_tag LOCUS_11510 15127 13763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 17986 15560 gene locus_tag LOCUS_11520 17986 15560 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_11520 19839 17983 gene locus_tag LOCUS_11530 19839 17983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 21062 19947 gene locus_tag LOCUS_11540 gene glgD 21062 19947 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_11540 22267 21059 gene locus_tag LOCUS_11550 gene glgC 22267 21059 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_11550 24256 22280 gene locus_tag LOCUS_11560 gene glgB 24256 22280 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_11560 24967 24539 gene locus_tag LOCUS_11570 24967 24539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 25230 27122 gene locus_tag LOCUS_11580 gene htpG 25230 27122 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_11580 27249 28244 gene locus_tag LOCUS_11590 27249 28244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 28858 28337 gene locus_tag LOCUS_11600 gene pgsA 28858 28337 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365382.1 protein_id gnl|my_center|LOCUS_11600 30184 28865 gene locus_tag LOCUS_11610 gene rimO 30184 28865 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_11610 30835 30215 gene locus_tag LOCUS_11620 30835 30215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 31946 30825 gene locus_tag LOCUS_11630 gene recA 31946 30825 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_11630 32879 32013 gene locus_tag LOCUS_11640 gene prmC 32879 32013 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_11640 33873 32908 gene locus_tag LOCUS_11650 33873 32908 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_11650 35382 33943 gene locus_tag LOCUS_11660 35382 33943 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_11660 36113 35427 gene locus_tag LOCUS_11670 36113 35427 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896932.1 protein_id gnl|my_center|LOCUS_11670 37483 36134 gene locus_tag LOCUS_11680 37483 36134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 37981 38057 gene locus_tag LOCUS_t00190 37981 38057 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 39735 38101 gene locus_tag LOCUS_11690 39735 38101 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393070.1 protein_id gnl|my_center|LOCUS_11690 40024 39854 gene locus_tag LOCUS_11700 40024 39854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 40766 40395 gene locus_tag LOCUS_11710 40766 40395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 41824 41222 gene locus_tag LOCUS_11720 41824 41222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence19 1795 1529 gene locus_tag LOCUS_11730 gene rpsO 1795 1529 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_11730 2058 2420 gene locus_tag LOCUS_11740 2058 2420 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_11740 2417 3313 gene locus_tag LOCUS_11750 2417 3313 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_11750 3288 5333 gene locus_tag LOCUS_11760 3288 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5337 5999 gene locus_tag LOCUS_11770 5337 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6122 6289 gene locus_tag LOCUS_11780 6122 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 6709 9522 gene locus_tag LOCUS_11790 gene ileS 6709 9522 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_11790 9828 9610 gene locus_tag LOCUS_11800 9828 9610 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_11800 9921 10097 gene locus_tag LOCUS_11810 9921 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 10207 10428 gene locus_tag LOCUS_11820 10207 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 11412 10492 gene locus_tag LOCUS_11830 11412 10492 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_11830 11875 11381 gene locus_tag LOCUS_11840 gene lspA 11875 11381 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_11840 12032 13444 gene locus_tag LOCUS_11850 gene miaB 12032 13444 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_11850 13513 16116 gene locus_tag LOCUS_11860 gene mutS 13513 16116 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_11860 16142 16852 gene locus_tag LOCUS_11870 16142 16852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 16880 18928 gene locus_tag LOCUS_11880 gene mutL 16880 18928 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_11880 18957 19901 gene locus_tag LOCUS_11890 gene miaA 18957 19901 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_11890 19960 20184 gene locus_tag LOCUS_11900 gene hfq 19960 20184 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392630.1 protein_id gnl|my_center|LOCUS_11900 20241 21530 gene locus_tag LOCUS_11910 20241 21530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 21551 22267 gene locus_tag LOCUS_11920 21551 22267 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_11920 22264 22704 gene locus_tag LOCUS_11930 gene sepF 22264 22704 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416162.1 protein_id gnl|my_center|LOCUS_11930 22723 23487 gene locus_tag LOCUS_11940 22723 23487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 23530 24414 gene locus_tag LOCUS_11950 23530 24414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 24505 25185 gene locus_tag LOCUS_11960 24505 25185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 25189 26598 gene locus_tag LOCUS_11970 25189 26598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 26609 27652 gene locus_tag LOCUS_11980 26609 27652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083206.1 protein_id gnl|my_center|LOCUS_11980 27749 29560 gene locus_tag LOCUS_11990 gene lepA 27749 29560 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229999.1 protein_id gnl|my_center|LOCUS_11990 29916 30980 gene locus_tag LOCUS_12000 gene carA 29916 30980 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_12000 30980 35020 gene locus_tag LOCUS_12010 gene carB 30980 35020 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_12010 35088 35762 gene locus_tag LOCUS_12020 35088 35762 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_12020 35925 36722 gene locus_tag LOCUS_12030 35925 36722 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963754.1 protein_id gnl|my_center|LOCUS_12030 39728 37095 gene locus_tag LOCUS_12040 gene ppdK 39728 37095 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence20 4935 1201 gene locus_tag LOCUS_12050 gene rpoB 4935 1201 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_12050 5742 5422 gene locus_tag LOCUS_12060 5742 5422 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_12060 6218 5889 gene locus_tag LOCUS_12070 6218 5889 CDS product DUF3870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367287.1 protein_id gnl|my_center|LOCUS_12070 6664 8040 gene locus_tag LOCUS_12080 gene pepV 6664 8040 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_12080 8057 9151 gene locus_tag LOCUS_12090 8057 9151 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_12090 9248 10432 gene locus_tag LOCUS_12100 9248 10432 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015685.1 protein_id gnl|my_center|LOCUS_12100 10567 11913 gene locus_tag LOCUS_12110 10567 11913 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_12110 12849 12001 gene locus_tag LOCUS_12120 12849 12001 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814219.1 protein_id gnl|my_center|LOCUS_12120 13480 12836 gene locus_tag LOCUS_12130 13480 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12130 14172 13477 gene locus_tag LOCUS_12140 14172 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12140 15096 14320 gene locus_tag LOCUS_12150 gene trmD 15096 14320 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256255.1 protein_id gnl|my_center|LOCUS_12150 15592 15086 gene locus_tag LOCUS_12160 gene rimM 15592 15086 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575298.1 protein_id gnl|my_center|LOCUS_12160 15917 15687 gene locus_tag LOCUS_12170 15917 15687 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_12170 16172 15933 gene locus_tag LOCUS_12180 gene rpsP 16172 15933 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_12180 17597 16245 gene locus_tag LOCUS_12190 gene ffh 17597 16245 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_12190 17966 17601 gene locus_tag LOCUS_12200 17966 17601 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419333.1 protein_id gnl|my_center|LOCUS_12200 18366 19316 gene locus_tag LOCUS_12210 18366 19316 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_12210 19433 20701 gene locus_tag LOCUS_12220 19433 20701 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_12220 20698 21963 gene locus_tag LOCUS_12230 20698 21963 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244823.1 protein_id gnl|my_center|LOCUS_12230 21983 23086 gene locus_tag LOCUS_12240 21983 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 24944 23202 gene locus_tag LOCUS_12250 gene pyk 24944 23202 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_12250 25371 25150 gene locus_tag LOCUS_12260 25371 25150 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_12260 25589 26869 gene locus_tag LOCUS_12270 25589 26869 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_12270 26921 27289 gene locus_tag LOCUS_12280 26921 27289 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_12280 28157 27354 gene locus_tag LOCUS_12290 28157 27354 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000133827.1 protein_id gnl|my_center|LOCUS_12290 28771 28154 gene locus_tag LOCUS_12300 28771 28154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 29708 29196 gene locus_tag LOCUS_12310 29708 29196 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948907.1 protein_id gnl|my_center|LOCUS_12310 30589 29708 gene locus_tag LOCUS_12320 gene xdhB 30589 29708 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_12320 32899 30605 gene locus_tag LOCUS_12330 gene xdhA 32899 30605 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_12330 32998 33591 gene locus_tag LOCUS_12340 32998 33591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 36189 33640 gene locus_tag LOCUS_12350 gene xdh 36189 33640 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_12350 36970 36341 gene locus_tag LOCUS_12360 36970 36341 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_12360 37335 37910 gene locus_tag LOCUS_12370 37335 37910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 38180 38007 gene locus_tag LOCUS_12380 38180 38007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 38621 38265 gene locus_tag LOCUS_12390 gene spoVAE 38621 38265 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_12390 39104 38670 gene locus_tag LOCUS_12400 39104 38670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 <40043 39091 gene locus_tag LOCUS_12410 <40043 39091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002324544.1:site-specific resolvase TndX >Feature sequence21 1071 157 gene locus_tag LOCUS_12420 1071 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2450 1068 gene locus_tag LOCUS_12430 2450 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3177 2500 gene locus_tag LOCUS_12440 3177 2500 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_12440 3579 3199 gene locus_tag LOCUS_12450 3579 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3695 5062 gene locus_tag LOCUS_12460 gene dacF 3695 5062 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_12460 5659 5123 gene locus_tag LOCUS_12470 5659 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5796 6224 gene locus_tag LOCUS_12480 5796 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6689 6483 gene locus_tag LOCUS_12490 6689 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 8562 6880 gene locus_tag LOCUS_12500 8562 6880 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_12500 8934 8584 gene locus_tag LOCUS_12510 8934 8584 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206139.1 protein_id gnl|my_center|LOCUS_12510 12599 9159 gene locus_tag LOCUS_12520 12599 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 14367 12871 gene locus_tag LOCUS_12530 14367 12871 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067976.1 protein_id gnl|my_center|LOCUS_12530 15323 14364 gene locus_tag LOCUS_12540 15323 14364 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383769.1 protein_id gnl|my_center|LOCUS_12540 14741 14649 gene locus_tag LOCUS_t00200 14741 14649 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 16813 15320 gene locus_tag LOCUS_12550 gene rbsA 16813 15320 CDS product ribose ABC transporter ATP-binding protein RbsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368992.1 protein_id gnl|my_center|LOCUS_12550 17822 16839 gene locus_tag LOCUS_12560 17822 16839 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383771.1 protein_id gnl|my_center|LOCUS_12560 18640 17864 gene locus_tag LOCUS_12570 gene trpA 18640 17864 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_12570 19823 18633 gene locus_tag LOCUS_12580 gene trpB 19823 18633 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101492.1 protein_id gnl|my_center|LOCUS_12580 20985 20275 gene locus_tag LOCUS_12590 20985 20275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_12590 21823 20990 gene locus_tag LOCUS_12600 21823 20990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_12600 22880 21825 gene locus_tag LOCUS_12610 22880 21825 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_12610 23781 22891 gene locus_tag LOCUS_12620 23781 22891 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_12620 25122 23929 gene locus_tag LOCUS_12630 25122 23929 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_12630 25539 25273 gene locus_tag LOCUS_12640 25539 25273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 27200 25782 gene locus_tag LOCUS_12650 27200 25782 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970007.1 protein_id gnl|my_center|LOCUS_12650 28186 27401 gene locus_tag LOCUS_12660 28186 27401 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774590.1 protein_id gnl|my_center|LOCUS_12660 29064 28183 gene locus_tag LOCUS_12670 29064 28183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 30054 29146 gene locus_tag LOCUS_12680 30054 29146 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130810.1 protein_id gnl|my_center|LOCUS_12680 33361 30353 gene locus_tag LOCUS_12690 33361 30353 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895801.1 protein_id gnl|my_center|LOCUS_12690 34822 33395 gene locus_tag LOCUS_12700 34822 33395 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_12700 35399 35082 gene locus_tag LOCUS_12710 35399 35082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 36243 35425 gene locus_tag LOCUS_12720 36243 35425 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966363.1 protein_id gnl|my_center|LOCUS_12720 37811 36363 gene locus_tag LOCUS_12730 37811 36363 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_12730 38483 37815 gene locus_tag LOCUS_12740 gene cysE 38483 37815 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_12740 <39679 38873 gene locus_tag LOCUS_12750 <39679 38873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003640679.1:GTPase Era >Feature sequence22 2254 1373 gene locus_tag LOCUS_12760 gene garR 2254 1373 CDS product 2-hydroxy-3-oxopropionate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861698.1 protein_id gnl|my_center|LOCUS_12760 3279 2287 gene locus_tag LOCUS_12770 3279 2287 CDS product 2-keto-3-deoxygluconate permease 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022089.1 protein_id gnl|my_center|LOCUS_12770 3589 4527 gene locus_tag LOCUS_12780 gene cynR 3589 4527 CDS product transcriptional regulator CynR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114874.1 protein_id gnl|my_center|LOCUS_12780 4543 5289 gene locus_tag LOCUS_12790 4543 5289 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815081.1 protein_id gnl|my_center|LOCUS_12790 5717 5496 gene locus_tag LOCUS_12800 5717 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 6611 5742 gene locus_tag LOCUS_12810 6611 5742 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 protein_id gnl|my_center|LOCUS_12810 7053 6706 gene locus_tag LOCUS_12820 7053 6706 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_12820 8202 7150 gene locus_tag LOCUS_12830 8202 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 8764 9315 gene locus_tag LOCUS_12840 8764 9315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 9364 9594 gene locus_tag LOCUS_12850 9364 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 9591 11582 gene locus_tag LOCUS_12860 gene feoB 9591 11582 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_12860 11582 11740 gene locus_tag LOCUS_12870 11582 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 12035 12982 gene locus_tag LOCUS_12880 12035 12982 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_12880 13118 13468 gene locus_tag LOCUS_12890 13118 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 13627 15411 gene locus_tag LOCUS_12900 13627 15411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 15802 16986 gene locus_tag LOCUS_12910 15802 16986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 16983 17735 gene locus_tag LOCUS_12920 16983 17735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 18278 17889 gene locus_tag LOCUS_12930 18278 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 18560 18285 gene locus_tag LOCUS_12940 18560 18285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 19851 18781 gene locus_tag LOCUS_12950 19851 18781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 20032 20301 gene locus_tag LOCUS_12960 20032 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 20294 20572 gene locus_tag LOCUS_12970 20294 20572 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916506.1 protein_id gnl|my_center|LOCUS_12970 21032 20622 gene locus_tag LOCUS_12980 21032 20622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 21109 21357 gene locus_tag LOCUS_12990 21109 21357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 22135 21710 gene locus_tag LOCUS_13000 22135 21710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 23482 22151 gene locus_tag LOCUS_13010 23482 22151 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_13010 28896 23743 gene locus_tag LOCUS_13020 28896 23743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 29556 29299 gene locus_tag LOCUS_13030 29556 29299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 29778 29569 gene locus_tag LOCUS_13040 29778 29569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 30783 30436 gene locus_tag LOCUS_13050 30783 30436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 32213 30984 gene locus_tag LOCUS_13060 32213 30984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 32499 32254 gene locus_tag LOCUS_13070 32499 32254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 33161 33940 gene locus_tag LOCUS_13080 33161 33940 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_13080 33988 34125 gene locus_tag LOCUS_13090 33988 34125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 35331 34579 gene locus_tag LOCUS_13100 35331 34579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 36481 35345 gene locus_tag LOCUS_13110 36481 35345 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966712.1 protein_id gnl|my_center|LOCUS_13110 37963 36590 gene locus_tag LOCUS_13120 37963 36590 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence23 11421 931 gene locus_tag LOCUS_13130 11421 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 11849 11436 gene locus_tag LOCUS_13140 11849 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 12217 11846 gene locus_tag LOCUS_13150 12217 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 13825 12506 gene locus_tag LOCUS_13160 13825 12506 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090934236.1 protein_id gnl|my_center|LOCUS_13160 15646 14069 gene locus_tag LOCUS_13170 gene hcp 15646 14069 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_13170 16220 15699 gene locus_tag LOCUS_13180 16220 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 17110 16232 gene locus_tag LOCUS_13190 17110 16232 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_13190 17226 18581 gene locus_tag LOCUS_13200 17226 18581 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966626.1 protein_id gnl|my_center|LOCUS_13200 19013 18714 gene locus_tag LOCUS_13210 19013 18714 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_13210 19227 19314 gene locus_tag LOCUS_t00210 19227 19314 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19353 19446 gene locus_tag LOCUS_t00220 19353 19446 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19594 19752 gene locus_tag LOCUS_13220 19594 19752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 21099 19951 gene locus_tag LOCUS_13230 21099 19951 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680415.1 protein_id gnl|my_center|LOCUS_13230 21201 22124 gene locus_tag LOCUS_13240 21201 22124 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943159.1 protein_id gnl|my_center|LOCUS_13240 22228 23322 gene locus_tag LOCUS_13250 gene yedE 22228 23322 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_13250 23319 23522 gene locus_tag LOCUS_13260 23319 23522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 23519 23761 gene locus_tag LOCUS_13270 23519 23761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 26192 23814 gene locus_tag LOCUS_13280 26192 23814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 27781 26600 gene locus_tag LOCUS_13290 27781 26600 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087297.1 protein_id gnl|my_center|LOCUS_13290 28153 28890 gene locus_tag LOCUS_13300 28153 28890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 28949 29182 gene locus_tag LOCUS_13310 28949 29182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 29179 29826 gene locus_tag LOCUS_13320 29179 29826 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_13320 29772 29927 gene locus_tag LOCUS_13330 29772 29927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 29954 30223 gene locus_tag LOCUS_13340 29954 30223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 30691 30287 gene locus_tag LOCUS_13350 30691 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 31865 30885 gene locus_tag LOCUS_13360 31865 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 32564 32908 gene locus_tag LOCUS_13370 32564 32908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13370 32883 33323 gene locus_tag LOCUS_13380 32883 33323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13380 33341 33805 gene locus_tag LOCUS_13390 33341 33805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 33802 33969 gene locus_tag LOCUS_13400 33802 33969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 34075 33905 gene locus_tag LOCUS_13410 34075 33905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 34257 34063 gene locus_tag LOCUS_13420 34257 34063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence24 <1 1311 gene locus_tag LOCUS_13430 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000811825.1:alanine--tRNA ligase 1356 1529 gene locus_tag LOCUS_13440 1356 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 1565 1903 gene locus_tag LOCUS_13450 1565 1903 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_13450 2199 2834 gene locus_tag LOCUS_13460 2199 2834 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263256.1 protein_id gnl|my_center|LOCUS_13460 2834 3403 gene locus_tag LOCUS_13470 2834 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3400 3801 gene locus_tag LOCUS_13480 3400 3801 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966052.1 protein_id gnl|my_center|LOCUS_13480 3931 4389 gene locus_tag LOCUS_13490 3931 4389 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_13490 6267 4435 gene locus_tag LOCUS_13500 6267 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 7576 6404 gene locus_tag LOCUS_13510 7576 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 8556 7573 gene locus_tag LOCUS_13520 8556 7573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9283 8678 gene locus_tag LOCUS_13530 9283 8678 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_13530 9419 10582 gene locus_tag LOCUS_13540 9419 10582 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_13540 11632 10652 gene locus_tag LOCUS_13550 11632 10652 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_13550 12745 11645 gene locus_tag LOCUS_13560 12745 11645 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_13560 14319 12742 gene locus_tag LOCUS_13570 14319 12742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_13570 15888 14644 gene locus_tag LOCUS_13580 15888 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 17124 16192 gene locus_tag LOCUS_13590 gene arcC 17124 16192 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366905.1 protein_id gnl|my_center|LOCUS_13590 18436 17243 gene locus_tag LOCUS_13600 gene ygeW 18436 17243 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_13600 19843 18476 gene locus_tag LOCUS_13610 19843 18476 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362247.1 protein_id gnl|my_center|LOCUS_13610 20167 19865 gene locus_tag LOCUS_13620 20167 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 20087 20713 gene locus_tag LOCUS_13630 20087 20713 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_13630 20710 22185 gene locus_tag LOCUS_13640 20710 22185 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_13640 22377 23618 gene locus_tag LOCUS_13650 22377 23618 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_13650 23756 24094 gene locus_tag LOCUS_13660 23756 24094 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724743.1 protein_id gnl|my_center|LOCUS_13660 24064 25230 gene locus_tag LOCUS_13670 24064 25230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 25746 25327 gene locus_tag LOCUS_13680 gene ruvX 25746 25327 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_13680 26027 26176 gene locus_tag LOCUS_13690 gene rpmG 26027 26176 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_13690 26210 26419 gene locus_tag LOCUS_13700 26210 26419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 26430 26957 gene locus_tag LOCUS_13710 gene nusG 26430 26957 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_13710 27060 27485 gene locus_tag LOCUS_13720 gene rplK 27060 27485 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_13720 27570 28262 gene locus_tag LOCUS_13730 gene rplA 27570 28262 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_13730 28523 29044 gene locus_tag LOCUS_13740 gene rplJ 28523 29044 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_13740 29089 29463 gene locus_tag LOCUS_13750 gene rplL 29089 29463 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_13750 30514 29633 gene locus_tag LOCUS_13760 30514 29633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 30795 31904 gene locus_tag LOCUS_13770 30795 31904 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_13770 31938 32366 gene locus_tag LOCUS_13780 31938 32366 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339312.1 protein_id gnl|my_center|LOCUS_13780 32406 33473 gene locus_tag LOCUS_13790 32406 33473 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064572.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence25 423 965 gene locus_tag LOCUS_13800 423 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13800 1604 2884 gene locus_tag LOCUS_13810 1604 2884 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_13810 2983 3537 gene locus_tag LOCUS_13820 2983 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 4118 4255 gene locus_tag LOCUS_13830 4118 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 4269 4484 gene locus_tag LOCUS_13840 4269 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 5624 5169 gene locus_tag LOCUS_13850 5624 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13850 6165 6365 gene locus_tag LOCUS_13860 6165 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 6801 7190 gene locus_tag LOCUS_13870 6801 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 7203 7364 gene locus_tag LOCUS_13880 7203 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 7526 8764 gene locus_tag LOCUS_13890 7526 8764 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_13890 9266 8934 gene locus_tag LOCUS_13900 9266 8934 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 protein_id gnl|my_center|LOCUS_13900 10455 9475 gene locus_tag LOCUS_13910 10455 9475 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929922.1 protein_id gnl|my_center|LOCUS_13910 11440 10469 gene locus_tag LOCUS_13920 11440 10469 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390046.1 protein_id gnl|my_center|LOCUS_13920 12632 11580 gene locus_tag LOCUS_13930 12632 11580 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_13930 14593 12665 gene locus_tag LOCUS_13940 14593 12665 CDS product TRAP transporter fused permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271912.1 protein_id gnl|my_center|LOCUS_13940 15397 14639 gene locus_tag LOCUS_13950 15397 14639 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391964.1 protein_id gnl|my_center|LOCUS_13950 15697 16395 gene locus_tag LOCUS_13960 15697 16395 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_13960 17814 16579 gene locus_tag LOCUS_13970 17814 16579 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_13970 18159 17851 gene locus_tag LOCUS_13980 18159 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 18418 18152 gene locus_tag LOCUS_13990 18418 18152 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272532.1 protein_id gnl|my_center|LOCUS_13990 19437 18883 gene locus_tag LOCUS_14000 19437 18883 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_14000 20195 19440 gene locus_tag LOCUS_14010 20195 19440 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948565.1 protein_id gnl|my_center|LOCUS_14010 20553 20843 gene locus_tag LOCUS_14020 20553 20843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 20831 21715 gene locus_tag LOCUS_14030 20831 21715 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681790.1 protein_id gnl|my_center|LOCUS_14030 21708 22676 gene locus_tag LOCUS_14040 21708 22676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 22744 23088 gene locus_tag LOCUS_14050 22744 23088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 23443 24786 gene locus_tag LOCUS_14060 23443 24786 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490912.1 protein_id gnl|my_center|LOCUS_14060 25631 27076 gene locus_tag LOCUS_14070 25631 27076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 27629 27144 gene locus_tag LOCUS_14080 27629 27144 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence26 611 357 gene locus_tag LOCUS_14090 gene rpsR 611 357 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_14090 1106 651 gene locus_tag LOCUS_14100 gene ssb 1106 651 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391677.1 protein_id gnl|my_center|LOCUS_14100 1415 1119 gene locus_tag LOCUS_14110 gene rpsF 1415 1119 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420522.1 protein_id gnl|my_center|LOCUS_14110 2094 1579 gene locus_tag LOCUS_14120 2094 1579 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583841.1 protein_id gnl|my_center|LOCUS_14120 3154 2330 gene locus_tag LOCUS_14130 3154 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3758 3156 gene locus_tag LOCUS_14140 3758 3156 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_14140 4723 3755 gene locus_tag LOCUS_14150 gene dusB 4723 3755 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_14150 4905 6932 gene locus_tag LOCUS_14160 4905 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7048 7314 gene locus_tag LOCUS_14170 7048 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 8555 7377 gene locus_tag LOCUS_14180 8555 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 8806 9789 gene locus_tag LOCUS_14190 8806 9789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 9979 10962 gene locus_tag LOCUS_14200 9979 10962 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456304.1 protein_id gnl|my_center|LOCUS_14200 10967 11290 gene locus_tag LOCUS_14210 10967 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 11287 11790 gene locus_tag LOCUS_14220 11287 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11787 12236 gene locus_tag LOCUS_14230 11787 12236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 12223 12642 gene locus_tag LOCUS_14240 12223 12642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 12676 13737 gene locus_tag LOCUS_14250 12676 13737 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_14250 13746 14552 gene locus_tag LOCUS_14260 13746 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 15112 14648 gene locus_tag LOCUS_14270 15112 14648 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_14270 22537 15584 gene locus_tag LOCUS_14280 22537 15584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 23525 22842 gene locus_tag LOCUS_14290 23525 22842 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_14290 25057 23537 gene locus_tag LOCUS_14300 25057 23537 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_14300 26265 25195 gene locus_tag LOCUS_14310 gene tdh 26265 25195 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_14310 26573 28567 gene locus_tag LOCUS_14320 26573 28567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 30255 29566 gene locus_tag LOCUS_14330 30255 29566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 31384 30242 gene locus_tag LOCUS_14340 31384 30242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence27 1252 359 gene locus_tag LOCUS_14350 1252 359 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_14350 1423 1794 gene locus_tag LOCUS_14360 1423 1794 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948844.1 protein_id gnl|my_center|LOCUS_14360 1784 2638 gene locus_tag LOCUS_14370 1784 2638 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948845.1 protein_id gnl|my_center|LOCUS_14370 2635 3345 gene locus_tag LOCUS_14380 2635 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3384 3752 gene locus_tag LOCUS_14390 3384 3752 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101537.1 protein_id gnl|my_center|LOCUS_14390 3860 4282 gene locus_tag LOCUS_14400 3860 4282 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890858.1 protein_id gnl|my_center|LOCUS_14400 4992 4369 gene locus_tag LOCUS_14410 gene udk 4992 4369 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648617.1 protein_id gnl|my_center|LOCUS_14410 5240 6217 gene locus_tag LOCUS_14420 5240 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6549 7127 gene locus_tag LOCUS_14430 6549 7127 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_14430 7124 7432 gene locus_tag LOCUS_14440 7124 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 7448 8626 gene locus_tag LOCUS_14450 7448 8626 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_14450 8642 9574 gene locus_tag LOCUS_14460 8642 9574 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_14460 9756 10385 gene locus_tag LOCUS_14470 9756 10385 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948818.1 protein_id gnl|my_center|LOCUS_14470 10398 11258 gene locus_tag LOCUS_14480 10398 11258 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_14480 11435 12295 gene locus_tag LOCUS_14490 11435 12295 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_14490 12384 13346 gene locus_tag LOCUS_14500 gene pstC 12384 13346 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462956.1 protein_id gnl|my_center|LOCUS_14500 13350 14198 gene locus_tag LOCUS_14510 gene pstA 13350 14198 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_14510 14228 14983 gene locus_tag LOCUS_14520 gene pstB 14228 14983 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391662.1 protein_id gnl|my_center|LOCUS_14520 14999 15646 gene locus_tag LOCUS_14530 gene phoU 14999 15646 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_14530 15686 16354 gene locus_tag LOCUS_14540 15686 16354 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_14540 16378 18027 gene locus_tag LOCUS_14550 16378 18027 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_14550 20247 18199 gene locus_tag LOCUS_14560 gene recG 20247 18199 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_14560 20807 20313 gene locus_tag LOCUS_14570 20807 20313 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084430.1 protein_id gnl|my_center|LOCUS_14570 21662 20832 gene locus_tag LOCUS_14580 21662 20832 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_14580 21862 22749 gene locus_tag LOCUS_14590 21862 22749 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_14590 24381 22846 gene locus_tag LOCUS_14600 24381 22846 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_14600 24583 25986 gene locus_tag LOCUS_14610 24583 25986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 27367 26228 gene locus_tag LOCUS_14620 27367 26228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 27587 29005 gene locus_tag LOCUS_14630 27587 29005 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_14630 29135 30043 gene locus_tag LOCUS_14640 29135 30043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056248.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence28 2546 87 gene locus_tag LOCUS_14650 2546 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 5498 2784 gene locus_tag LOCUS_14660 5498 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 5958 5755 gene locus_tag LOCUS_14670 5958 5755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 6941 5961 gene locus_tag LOCUS_14680 6941 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 7236 8369 gene locus_tag LOCUS_14690 7236 8369 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461018.1 protein_id gnl|my_center|LOCUS_14690 9470 8484 gene locus_tag LOCUS_14700 gene galE 9470 8484 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016045.1 protein_id gnl|my_center|LOCUS_14700 9653 9578 gene locus_tag LOCUS_t00230 9653 9578 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9766 9680 gene locus_tag LOCUS_t00240 9766 9680 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11130 10054 gene locus_tag LOCUS_14710 gene mnmA 11130 10054 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_14710 11982 11161 gene locus_tag LOCUS_14720 11982 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 12374 13396 gene locus_tag LOCUS_14730 gene gapA 12374 13396 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224141.1 protein_id gnl|my_center|LOCUS_14730 15013 13439 gene locus_tag LOCUS_14740 15013 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 15731 15189 gene locus_tag LOCUS_14750 gene raiA 15731 15189 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_14750 17793 15916 gene locus_tag LOCUS_14760 17793 15916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 18170 19150 gene locus_tag LOCUS_14770 gene pta 18170 19150 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130342.1 protein_id gnl|my_center|LOCUS_14770 19314 19108 gene locus_tag LOCUS_14780 19314 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 20384 19311 gene locus_tag LOCUS_14790 20384 19311 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_14790 22091 20484 gene locus_tag LOCUS_14800 22091 20484 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_14800 22741 23763 gene locus_tag LOCUS_14810 22741 23763 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_14810 23899 24879 gene locus_tag LOCUS_14820 23899 24879 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_14820 24866 25666 gene locus_tag LOCUS_14830 24866 25666 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856990.1 protein_id gnl|my_center|LOCUS_14830 26170 27180 gene locus_tag LOCUS_14840 26170 27180 CDS product CD0873 family tyrosine ABC transporter substrate-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860976.1 protein_id gnl|my_center|LOCUS_14840 27295 28179 gene locus_tag LOCUS_14850 27295 28179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948810.1 protein_id gnl|my_center|LOCUS_14850 28172 28945 gene locus_tag LOCUS_14860 28172 28945 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_14860 28956 29246 gene locus_tag LOCUS_14870 28956 29246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 29835 29512 gene locus_tag LOCUS_14880 29835 29512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence29 350 481 gene locus_tag LOCUS_14890 350 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 615 1610 gene locus_tag LOCUS_14900 615 1610 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048201.1 protein_id gnl|my_center|LOCUS_14900 3546 1813 gene locus_tag LOCUS_14910 3546 1813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680643.1 protein_id gnl|my_center|LOCUS_14910 5299 3539 gene locus_tag LOCUS_14920 5299 3539 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680646.1 protein_id gnl|my_center|LOCUS_14920 5509 6480 gene locus_tag LOCUS_14930 5509 6480 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943652.1 protein_id gnl|my_center|LOCUS_14930 6814 7443 gene locus_tag LOCUS_14940 6814 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 7552 8073 gene locus_tag LOCUS_14950 7552 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 8070 8288 gene locus_tag LOCUS_14960 8070 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 8309 8554 gene locus_tag LOCUS_14970 8309 8554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 8536 8853 gene locus_tag LOCUS_14980 8536 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 8850 9554 gene locus_tag LOCUS_14990 8850 9554 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948613.1 protein_id gnl|my_center|LOCUS_14990 9650 10285 gene locus_tag LOCUS_15000 9650 10285 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108273.1 protein_id gnl|my_center|LOCUS_15000 10410 11033 gene locus_tag LOCUS_15010 10410 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 11324 11749 gene locus_tag LOCUS_15020 11324 11749 CDS product RNHCP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436247.1 protein_id gnl|my_center|LOCUS_15020 11821 12297 gene locus_tag LOCUS_15030 11821 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 13674 12478 gene locus_tag LOCUS_15040 13674 12478 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_15040 16527 13894 gene locus_tag LOCUS_15050 16527 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 17408 16563 gene locus_tag LOCUS_15060 17408 16563 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546705.1 protein_id gnl|my_center|LOCUS_15060 18272 17592 gene locus_tag LOCUS_15070 gene rnc 18272 17592 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_15070 18573 18325 gene locus_tag LOCUS_15080 gene acpP 18573 18325 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_15080 19675 18653 gene locus_tag LOCUS_15090 gene plsX 19675 18653 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_15090 21008 19701 gene locus_tag LOCUS_15100 gene trmFO 21008 19701 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_15100 23494 21038 gene locus_tag LOCUS_15110 gene topA 23494 21038 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_15110 24709 23531 gene locus_tag LOCUS_15120 gene dprA 24709 23531 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_15120 25490 24729 gene locus_tag LOCUS_15130 25490 24729 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 protein_id gnl|my_center|LOCUS_15130 26376 25624 gene locus_tag LOCUS_15140 26376 25624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 27707 26481 gene locus_tag LOCUS_15150 27707 26481 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_15150 28616 27729 gene locus_tag LOCUS_15160 gene ftsX 28616 27729 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_15160 29301 28603 gene locus_tag LOCUS_15170 gene ftsE 29301 28603 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence30 478 110 gene locus_tag LOCUS_15180 478 110 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_15180 2464 554 gene locus_tag LOCUS_15190 2464 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3673 2723 gene locus_tag LOCUS_15200 3673 2723 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106518184.1 protein_id gnl|my_center|LOCUS_15200 3828 5120 gene locus_tag LOCUS_15210 3828 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_15210 5122 5826 gene locus_tag LOCUS_15220 5122 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 7546 5924 gene locus_tag LOCUS_15230 7546 5924 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_15230 8292 7837 gene locus_tag LOCUS_15240 8292 7837 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083256.1 protein_id gnl|my_center|LOCUS_15240 8666 8280 gene locus_tag LOCUS_15250 8666 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 9625 8663 gene locus_tag LOCUS_15260 9625 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 11137 9788 gene locus_tag LOCUS_15270 11137 9788 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_15270 11406 11122 gene locus_tag LOCUS_15280 11406 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 12501 11467 gene locus_tag LOCUS_15290 12501 11467 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_15290 13314 12640 gene locus_tag LOCUS_15300 13314 12640 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_15300 13586 13311 gene locus_tag LOCUS_15310 13586 13311 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_15310 13837 13583 gene locus_tag LOCUS_15320 13837 13583 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_15320 14843 13935 gene locus_tag LOCUS_15330 14843 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460508.1 protein_id gnl|my_center|LOCUS_15330 14949 15242 gene locus_tag LOCUS_15340 14949 15242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 15235 16425 gene locus_tag LOCUS_15350 gene yqfD 15235 16425 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792478.1 protein_id gnl|my_center|LOCUS_15350 16487 17470 gene locus_tag LOCUS_15360 16487 17470 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_15360 17467 17970 gene locus_tag LOCUS_15370 gene ybeY 17467 17970 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_15370 17967 18281 gene locus_tag LOCUS_15380 17967 18281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 18339 18665 gene locus_tag LOCUS_15390 18339 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 18714 20918 gene locus_tag LOCUS_15400 18714 20918 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_15400 22103 21162 gene locus_tag LOCUS_15410 22103 21162 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_15410 23260 22103 gene locus_tag LOCUS_15420 23260 22103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_15420 24795 23257 gene locus_tag LOCUS_15430 24795 23257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459549.1 protein_id gnl|my_center|LOCUS_15430 26331 25048 gene locus_tag LOCUS_15440 26331 25048 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_15440 27200 26484 gene locus_tag LOCUS_15450 gene deoD 27200 26484 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_15450 27945 27289 gene locus_tag LOCUS_15460 gene deoC 27945 27289 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453154.1 protein_id gnl|my_center|LOCUS_15460 28176 29459 gene locus_tag LOCUS_15470 28176 29459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence31 <1 867 gene locus_tag LOCUS_15480 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014498593.1:PDDEXK nuclease domain-containing protein 1329 1628 gene locus_tag LOCUS_15490 1329 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1967 1788 gene locus_tag LOCUS_15500 1967 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 2062 2286 gene locus_tag LOCUS_15510 2062 2286 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_15510 2543 2244 gene locus_tag LOCUS_15520 2543 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3711 2554 gene locus_tag LOCUS_15530 3711 2554 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379231.1 protein_id gnl|my_center|LOCUS_15530 3862 4269 gene locus_tag LOCUS_15540 3862 4269 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005691542.1 protein_id gnl|my_center|LOCUS_15540 4780 4448 gene locus_tag LOCUS_15550 4780 4448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4770 4946 gene locus_tag LOCUS_15560 4770 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5813 4980 gene locus_tag LOCUS_15570 5813 4980 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055294105.1 protein_id gnl|my_center|LOCUS_15570 5920 6345 gene locus_tag LOCUS_15580 5920 6345 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 protein_id gnl|my_center|LOCUS_15580 6422 7150 gene locus_tag LOCUS_15590 6422 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 7533 9737 gene locus_tag LOCUS_15600 7533 9737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 9789 12644 gene locus_tag LOCUS_15610 9789 12644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 13038 12859 gene locus_tag LOCUS_15620 13038 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 13139 13306 gene locus_tag LOCUS_15630 13139 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 14143 13565 gene locus_tag LOCUS_15640 14143 13565 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_15640 14316 14140 gene locus_tag LOCUS_15650 14316 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 15352 16668 gene locus_tag LOCUS_15660 15352 16668 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388389.1 protein_id gnl|my_center|LOCUS_15660 16794 17417 gene locus_tag LOCUS_15670 16794 17417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 17474 18526 gene locus_tag LOCUS_15680 17474 18526 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861334.1 protein_id gnl|my_center|LOCUS_15680 18563 18967 gene locus_tag LOCUS_15690 18563 18967 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032497467.1 protein_id gnl|my_center|LOCUS_15690 19180 19641 gene locus_tag LOCUS_15700 19180 19641 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860652.1 protein_id gnl|my_center|LOCUS_15700 19638 20738 gene locus_tag LOCUS_15710 19638 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 21006 20743 gene locus_tag LOCUS_15720 21006 20743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 21098 21307 gene locus_tag LOCUS_15730 21098 21307 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286251.1 protein_id gnl|my_center|LOCUS_15730 22681 21713 gene locus_tag LOCUS_15740 22681 21713 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289074.1 protein_id gnl|my_center|LOCUS_15740 23570 22902 gene locus_tag LOCUS_15750 23570 22902 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_15750 23731 24429 gene locus_tag LOCUS_15760 23731 24429 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_15760 25606 24431 gene locus_tag LOCUS_15770 25606 24431 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_15770 25901 27340 gene locus_tag LOCUS_15780 25901 27340 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_15780 27997 27407 gene locus_tag LOCUS_15790 27997 27407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 28895 28026 gene locus_tag LOCUS_15800 28895 28026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 29088 29163 gene locus_tag LOCUS_t00250 29088 29163 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 1351 992 gene locus_tag LOCUS_15810 1351 992 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459275.1 protein_id gnl|my_center|LOCUS_15810 1525 2793 gene locus_tag LOCUS_15820 1525 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 4102 2918 gene locus_tag LOCUS_15830 4102 2918 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_15830 4356 5072 gene locus_tag LOCUS_15840 gene pyrH 4356 5072 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_15840 5078 5635 gene locus_tag LOCUS_15850 gene frr 5078 5635 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159519.1 protein_id gnl|my_center|LOCUS_15850 5635 6384 gene locus_tag LOCUS_15860 5635 6384 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_15860 6413 7279 gene locus_tag LOCUS_15870 6413 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 7292 8434 gene locus_tag LOCUS_15880 7292 8434 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460412.1 protein_id gnl|my_center|LOCUS_15880 8487 9557 gene locus_tag LOCUS_15890 gene rseP 8487 9557 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_15890 9570 10607 gene locus_tag LOCUS_15900 gene ispG 9570 10607 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_15900 10627 14619 gene locus_tag LOCUS_15910 10627 14619 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_15910 15426 14749 gene locus_tag LOCUS_15920 gene nth 15426 14749 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013539.1 protein_id gnl|my_center|LOCUS_15920 16114 15734 gene locus_tag LOCUS_15930 16114 15734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 16794 16111 gene locus_tag LOCUS_15940 16794 16111 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_15940 17227 19065 gene locus_tag LOCUS_15950 gene glmS 17227 19065 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_15950 19201 19689 gene locus_tag LOCUS_15960 19201 19689 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_15960 20702 19758 gene locus_tag LOCUS_15970 20702 19758 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898612.1 protein_id gnl|my_center|LOCUS_15970 20967 21347 gene locus_tag LOCUS_15980 20967 21347 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_15980 22472 21555 gene locus_tag LOCUS_15990 gene tsf 22472 21555 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_15990 23262 22525 gene locus_tag LOCUS_16000 gene rpsB 23262 22525 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_16000 23756 23493 gene locus_tag LOCUS_16010 23756 23493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 23934 24713 gene locus_tag LOCUS_16020 gene sigG 23934 24713 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_16020 25350 24781 gene locus_tag LOCUS_16030 25350 24781 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941742.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence33 283 208 gene locus_tag LOCUS_t00260 283 208 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2160 1153 gene locus_tag LOCUS_16040 gene tsaD 2160 1153 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_16040 2779 2186 gene locus_tag LOCUS_16050 2779 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3236 2733 gene locus_tag LOCUS_16060 gene rimI 3236 2733 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_16060 5913 3259 gene locus_tag LOCUS_16070 gene polA 5913 3259 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_16070 6274 7533 gene locus_tag LOCUS_16080 6274 7533 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055677.1 protein_id gnl|my_center|LOCUS_16080 7639 8535 gene locus_tag LOCUS_16090 7639 8535 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052441.1 protein_id gnl|my_center|LOCUS_16090 8532 9683 gene locus_tag LOCUS_16100 8532 9683 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053882.1 protein_id gnl|my_center|LOCUS_16100 9703 10455 gene locus_tag LOCUS_16110 9703 10455 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052443.1 protein_id gnl|my_center|LOCUS_16110 10470 11174 gene locus_tag LOCUS_16120 10470 11174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_16120 11195 11818 gene locus_tag LOCUS_16130 11195 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 12335 11919 gene locus_tag LOCUS_16140 12335 11919 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964881.1 protein_id gnl|my_center|LOCUS_16140 13071 12481 gene locus_tag LOCUS_16150 gene yihA 13071 12481 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045119.1 protein_id gnl|my_center|LOCUS_16150 15550 13109 gene locus_tag LOCUS_16160 gene lon 15550 13109 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_16160 16943 15627 gene locus_tag LOCUS_16170 gene clpX 16943 15627 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_16170 17564 16983 gene locus_tag LOCUS_16180 gene clpP 17564 16983 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965928.1 protein_id gnl|my_center|LOCUS_16180 19187 17709 gene locus_tag LOCUS_16190 gene tig 19187 17709 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_16190 19963 19277 gene locus_tag LOCUS_16200 19963 19277 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_16200 21488 20001 gene locus_tag LOCUS_16210 gene thrC 21488 20001 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101905.1 protein_id gnl|my_center|LOCUS_16210 21884 21531 gene locus_tag LOCUS_16220 21884 21531 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057574.1 protein_id gnl|my_center|LOCUS_16220 22513 21881 gene locus_tag LOCUS_16230 gene rnhB 22513 21881 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_16230 23387 22506 gene locus_tag LOCUS_16240 gene ylqF 23387 22506 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_16240 24012 23413 gene locus_tag LOCUS_16250 gene lepB 24012 23413 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_16250 24665 24324 gene locus_tag LOCUS_16260 gene rplS 24665 24324 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_16260 26333 24831 gene locus_tag LOCUS_16270 gene lysS 26333 24831 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_16270 26820 26344 gene locus_tag LOCUS_16280 gene greA 26820 26344 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548292.1 protein_id gnl|my_center|LOCUS_16280 <27999 26992 gene locus_tag LOCUS_16290 <27999 26992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001830785.1:leucine--tRNA ligase >Feature sequence34 886 221 gene locus_tag LOCUS_16300 886 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 831 1043 gene locus_tag LOCUS_16310 831 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1804 1004 gene locus_tag LOCUS_16320 1804 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3110 1836 gene locus_tag LOCUS_16330 3110 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4932 3127 gene locus_tag LOCUS_16340 4932 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 5699 4983 gene locus_tag LOCUS_16350 gene yycF 5699 4983 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288850.1 protein_id gnl|my_center|LOCUS_16350 6272 5730 gene locus_tag LOCUS_16360 6272 5730 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_16360 6409 6924 gene locus_tag LOCUS_16370 gene smpB 6409 6924 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_16370 6927 7466 gene locus_tag LOCUS_16380 6927 7466 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_16380 7503 8258 gene locus_tag LOCUS_16390 7503 8258 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_16390 9513 9163 gene locus_tag LOCUS_16400 9513 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 9573 9695 gene locus_tag LOCUS_16410 9573 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 9979 11163 gene locus_tag LOCUS_16420 9979 11163 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383734.1 protein_id gnl|my_center|LOCUS_16420 11166 11537 gene locus_tag LOCUS_16430 11166 11537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 11805 12926 gene locus_tag LOCUS_16440 11805 12926 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830860.1 protein_id gnl|my_center|LOCUS_16440 12923 13543 gene locus_tag LOCUS_16450 12923 13543 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_16450 13558 14394 gene locus_tag LOCUS_16460 13558 14394 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_16460 14634 14885 gene locus_tag LOCUS_16470 14634 14885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 15918 14968 gene locus_tag LOCUS_16480 gene arcC 15918 14968 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869022.1 protein_id gnl|my_center|LOCUS_16480 16329 15994 gene locus_tag LOCUS_16490 16329 15994 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_16490 16378 17097 gene locus_tag LOCUS_16500 16378 17097 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_16500 17299 18675 gene locus_tag LOCUS_16510 17299 18675 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_16510 18892 19014 gene locus_tag LOCUS_16520 18892 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 19693 19082 gene locus_tag LOCUS_16530 19693 19082 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373863.1 protein_id gnl|my_center|LOCUS_16530 20747 19752 gene locus_tag LOCUS_16540 gene rbsK 20747 19752 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_16540 21690 20764 gene locus_tag LOCUS_16550 21690 20764 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703939.1 protein_id gnl|my_center|LOCUS_16550 23086 21749 gene locus_tag LOCUS_16560 23086 21749 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538085.1 protein_id gnl|my_center|LOCUS_16560 23690 23091 gene locus_tag LOCUS_16570 23690 23091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 24861 23791 gene locus_tag LOCUS_16580 gene dctP 24861 23791 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382874.1 protein_id gnl|my_center|LOCUS_16580 25717 24944 gene locus_tag LOCUS_16590 25717 24944 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941182.1 protein_id gnl|my_center|LOCUS_16590 26055 26501 gene locus_tag LOCUS_16600 26055 26501 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_16600 26701 26787 gene locus_tag LOCUS_t00270 26701 26787 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26836 26923 gene locus_tag LOCUS_t00280 26836 26923 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence35 123 329 gene locus_tag LOCUS_16610 123 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 584 1594 gene locus_tag LOCUS_16620 584 1594 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16620 1722 1629 gene locus_tag LOCUS_t00290 1722 1629 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2323 2607 gene locus_tag LOCUS_16630 2323 2607 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_16630 2649 4274 gene locus_tag LOCUS_16640 gene groL 2649 4274 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_16640 4796 4371 gene locus_tag LOCUS_16650 4796 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16650 5100 6104 gene locus_tag LOCUS_16660 5100 6104 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768282.1 protein_id gnl|my_center|LOCUS_16660 6155 6697 gene locus_tag LOCUS_16670 6155 6697 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_16670 6694 7284 gene locus_tag LOCUS_16680 6694 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 7975 7358 gene locus_tag LOCUS_16690 7975 7358 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_16690 8586 7972 gene locus_tag LOCUS_16700 8586 7972 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_16700 8776 9081 gene locus_tag LOCUS_16710 8776 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 9140 11758 gene locus_tag LOCUS_16720 9140 11758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 11745 14984 gene locus_tag LOCUS_16730 11745 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 16998 15451 gene locus_tag LOCUS_16740 gene rny 16998 15451 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_16740 17909 17169 gene locus_tag LOCUS_16750 17909 17169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 18015 19244 gene locus_tag LOCUS_16760 18015 19244 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_16760 19335 20729 gene locus_tag LOCUS_16770 gene asnS 19335 20729 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_16770 21243 20854 gene locus_tag LOCUS_16780 21243 20854 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000526762.1 protein_id gnl|my_center|LOCUS_16780 22524 21265 gene locus_tag LOCUS_16790 22524 21265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 22934 24124 gene locus_tag LOCUS_16800 gene nifS 22934 24124 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_16800 24146 24583 gene locus_tag LOCUS_16810 gene nifU 24146 24583 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_16810 24750 25043 gene locus_tag LOCUS_16820 24750 25043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 25323 25748 gene locus_tag LOCUS_16830 25323 25748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence36 1029 103 gene locus_tag LOCUS_16840 1029 103 CDS product auxin efflux carrier inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582699.1 protein_id gnl|my_center|LOCUS_16840 1347 1271 gene locus_tag LOCUS_t00300 1347 1271 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1477 1403 gene locus_tag LOCUS_t00310 1477 1403 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1602 1526 gene locus_tag LOCUS_t00320 1602 1526 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1836 2711 gene locus_tag LOCUS_16850 1836 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 2888 5098 gene locus_tag LOCUS_16860 2888 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 6278 5169 gene locus_tag LOCUS_16870 6278 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 7005 6283 gene locus_tag LOCUS_16880 7005 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16880 7863 7078 gene locus_tag LOCUS_16890 7863 7078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 8683 7856 gene locus_tag LOCUS_16900 8683 7856 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_16900 9624 8680 gene locus_tag LOCUS_16910 9624 8680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531217.1 protein_id gnl|my_center|LOCUS_16910 11209 9662 gene locus_tag LOCUS_16920 11209 9662 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017097.1 protein_id gnl|my_center|LOCUS_16920 12612 11386 gene locus_tag LOCUS_16930 12612 11386 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_16930 12798 13697 gene locus_tag LOCUS_16940 12798 13697 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_16940 13694 14317 gene locus_tag LOCUS_16950 13694 14317 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949003.1 protein_id gnl|my_center|LOCUS_16950 15181 14444 gene locus_tag LOCUS_16960 15181 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 16517 15183 gene locus_tag LOCUS_16970 16517 15183 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_16970 17185 16514 gene locus_tag LOCUS_16980 17185 16514 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_16980 19110 17245 gene locus_tag LOCUS_16990 gene mnmG 19110 17245 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_16990 19990 19142 gene locus_tag LOCUS_17000 19990 19142 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721880.1 protein_id gnl|my_center|LOCUS_17000 20946 21623 gene locus_tag LOCUS_17010 20946 21623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 21830 23950 gene locus_tag LOCUS_17020 21830 23950 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence37 4304 573 gene locus_tag LOCUS_17030 4304 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 7171 4301 gene locus_tag LOCUS_17040 7171 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 7338 7189 gene locus_tag LOCUS_17050 7338 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 8022 7342 gene locus_tag LOCUS_17060 8022 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 8928 8062 gene locus_tag LOCUS_17070 8928 8062 CDS product serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963364.1 protein_id gnl|my_center|LOCUS_17070 10322 8940 gene locus_tag LOCUS_17080 10322 8940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 11039 10362 gene locus_tag LOCUS_17090 11039 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 13760 11040 gene locus_tag LOCUS_17100 13760 11040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 14416 13772 gene locus_tag LOCUS_17110 14416 13772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 15780 14443 gene locus_tag LOCUS_17120 15780 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 16441 15806 gene locus_tag LOCUS_17130 16441 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 16732 16523 gene locus_tag LOCUS_17140 16732 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 17680 16805 gene locus_tag LOCUS_17150 17680 16805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 18560 17685 gene locus_tag LOCUS_17160 18560 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 19834 18584 gene locus_tag LOCUS_17170 19834 18584 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_17170 19694 19618 gene locus_tag LOCUS_t00330 19694 19618 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 20923 19853 gene locus_tag LOCUS_17180 20923 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 21396 20947 gene locus_tag LOCUS_17190 21396 20947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence38 74 1 gene locus_tag LOCUS_t00340 74 1 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 252 177 gene locus_tag LOCUS_t00350 252 177 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 331 256 gene locus_tag LOCUS_t00360 331 256 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 441 365 gene locus_tag LOCUS_t00370 441 365 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 547 471 gene locus_tag LOCUS_t00380 547 471 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1551 667 gene locus_tag LOCUS_17200 gene hslO 1551 667 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_17200 2318 1548 gene locus_tag LOCUS_17210 2318 1548 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_17210 2605 2315 gene locus_tag LOCUS_17220 2605 2315 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 protein_id gnl|my_center|LOCUS_17220 2861 3556 gene locus_tag LOCUS_17230 2861 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3601 4233 gene locus_tag LOCUS_17240 3601 4233 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_17240 4241 4801 gene locus_tag LOCUS_17250 4241 4801 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_17250 4914 5573 gene locus_tag LOCUS_17260 4914 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 8733 5725 gene locus_tag LOCUS_17270 8733 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 9487 8828 gene locus_tag LOCUS_17280 9487 8828 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436685.1 protein_id gnl|my_center|LOCUS_17280 9837 11180 gene locus_tag LOCUS_17290 gene ssnA 9837 11180 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_17290 11272 14217 gene locus_tag LOCUS_17300 gene ygfK 11272 14217 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_17300 14689 15735 gene locus_tag LOCUS_17310 14689 15735 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296186.1 protein_id gnl|my_center|LOCUS_17310 15716 16396 gene locus_tag LOCUS_17320 15716 16396 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359998.1 protein_id gnl|my_center|LOCUS_17320 16463 17332 gene locus_tag LOCUS_17330 16463 17332 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383735.1 protein_id gnl|my_center|LOCUS_17330 17344 18708 gene locus_tag LOCUS_17340 17344 18708 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948690.1 protein_id gnl|my_center|LOCUS_17340 18721 19884 gene locus_tag LOCUS_17350 18721 19884 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257764.1 protein_id gnl|my_center|LOCUS_17350 20067 20309 gene locus_tag LOCUS_17360 20067 20309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 20411 20827 gene locus_tag LOCUS_17370 gene rpsL 20411 20827 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142341.1 protein_id gnl|my_center|LOCUS_17370 20956 21426 gene locus_tag LOCUS_17380 gene rpsG 20956 21426 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence39 311 1237 gene locus_tag LOCUS_17390 311 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2684 1332 gene locus_tag LOCUS_17400 gene gdhA 2684 1332 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_17400 3005 3571 gene locus_tag LOCUS_17410 3005 3571 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_17410 3801 4286 gene locus_tag LOCUS_17420 3801 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 4356 5750 gene locus_tag LOCUS_17430 4356 5750 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_17430 5765 6880 gene locus_tag LOCUS_17440 5765 6880 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_17440 7533 6958 gene locus_tag LOCUS_17450 7533 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 7683 8774 gene locus_tag LOCUS_17460 7683 8774 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258677.1 protein_id gnl|my_center|LOCUS_17460 8785 9006 gene locus_tag LOCUS_17470 8785 9006 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_17470 9054 11243 gene locus_tag LOCUS_17480 9054 11243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 11253 12308 gene locus_tag LOCUS_17490 gene holA 11253 12308 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_17490 12323 12913 gene locus_tag LOCUS_17500 12323 12913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 13166 13444 gene locus_tag LOCUS_17510 13166 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 13563 15260 gene locus_tag LOCUS_17520 gene glnS 13563 15260 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287115.1 protein_id gnl|my_center|LOCUS_17520 15440 15318 gene locus_tag LOCUS_17530 15440 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 15867 16307 gene locus_tag LOCUS_17540 gene infC 15867 16307 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_17540 16343 16540 gene locus_tag LOCUS_17550 gene rpmI 16343 16540 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_17550 16575 16928 gene locus_tag LOCUS_17560 gene rplT 16575 16928 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138362.1 protein_id gnl|my_center|LOCUS_17560 17911 17186 gene locus_tag LOCUS_17570 gene trmB 17911 17186 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_17570 18233 19009 gene locus_tag LOCUS_17580 18233 19009 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901833.1 protein_id gnl|my_center|LOCUS_17580 19066 19902 gene locus_tag LOCUS_17590 19066 19902 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901831.1 protein_id gnl|my_center|LOCUS_17590 19927 21069 gene locus_tag LOCUS_17600 19927 21069 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_17600 21088 21888 gene locus_tag LOCUS_17610 gene etfB 21088 21888 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986693.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence40 274 1200 gene locus_tag LOCUS_17620 274 1200 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896738.1 protein_id gnl|my_center|LOCUS_17620 1340 2062 gene locus_tag LOCUS_17630 1340 2062 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702613.1 protein_id gnl|my_center|LOCUS_17630 2059 2724 gene locus_tag LOCUS_17640 2059 2724 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_17640 2955 2788 gene locus_tag LOCUS_17650 2955 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3069 4235 gene locus_tag LOCUS_17660 gene mltG 3069 4235 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944665.1 protein_id gnl|my_center|LOCUS_17660 4282 5448 gene locus_tag LOCUS_17670 4282 5448 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_17670 5495 6892 gene locus_tag LOCUS_17680 5495 6892 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_17680 7153 8016 gene locus_tag LOCUS_17690 7153 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 8052 8756 gene locus_tag LOCUS_17700 gene sigE 8052 8756 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811355.1 protein_id gnl|my_center|LOCUS_17700 9363 9070 gene locus_tag LOCUS_17710 9363 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 9658 12327 gene locus_tag LOCUS_17720 9658 12327 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_17720 12543 12983 gene locus_tag LOCUS_17730 12543 12983 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_17730 13004 14197 gene locus_tag LOCUS_17740 13004 14197 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_17740 14217 15428 gene locus_tag LOCUS_17750 14217 15428 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_17750 15515 16015 gene locus_tag LOCUS_17760 15515 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 16090 16359 gene locus_tag LOCUS_17770 16090 16359 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_17770 16372 17730 gene locus_tag LOCUS_17780 16372 17730 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861617.1 protein_id gnl|my_center|LOCUS_17780 18008 17835 gene locus_tag LOCUS_17790 18008 17835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 19153 18086 gene locus_tag LOCUS_17800 19153 18086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 19817 19188 gene locus_tag LOCUS_17810 19817 19188 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357537.1 protein_id gnl|my_center|LOCUS_17810 20183 20259 gene locus_tag LOCUS_t00390 20183 20259 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence41 1159 530 gene locus_tag LOCUS_17820 1159 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 1353 1700 gene locus_tag LOCUS_17830 1353 1700 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943036.1 protein_id gnl|my_center|LOCUS_17830 1760 2527 gene locus_tag LOCUS_17840 1760 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2808 4907 gene locus_tag LOCUS_17850 2808 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 5889 5272 gene locus_tag LOCUS_17860 5889 5272 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701817.1 protein_id gnl|my_center|LOCUS_17860 6177 5911 gene locus_tag LOCUS_17870 6177 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 7170 6268 gene locus_tag LOCUS_17880 7170 6268 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081620.1 protein_id gnl|my_center|LOCUS_17880 7320 7715 gene locus_tag LOCUS_17890 7320 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 8425 7679 gene locus_tag LOCUS_17900 8425 7679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 9293 8628 gene locus_tag LOCUS_17910 9293 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 9841 10878 gene locus_tag LOCUS_17920 9841 10878 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_17920 11024 11521 gene locus_tag LOCUS_17930 11024 11521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 11525 12802 gene locus_tag LOCUS_17940 11525 12802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 12876 13841 gene locus_tag LOCUS_17950 gene pdhA 12876 13841 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949161.1 protein_id gnl|my_center|LOCUS_17950 14488 15459 gene locus_tag LOCUS_17960 14488 15459 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949162.1 protein_id gnl|my_center|LOCUS_17960 15566 17023 gene locus_tag LOCUS_17970 15566 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 17131 18528 gene locus_tag LOCUS_17980 gene lpdA 17131 18528 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence42 2250 2804 gene locus_tag LOCUS_17990 2250 2804 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531188.1 protein_id gnl|my_center|LOCUS_17990 2791 3111 gene locus_tag LOCUS_18000 2791 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 3104 3727 gene locus_tag LOCUS_18010 3104 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 3724 4365 gene locus_tag LOCUS_18020 3724 4365 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461842.1 protein_id gnl|my_center|LOCUS_18020 4473 4820 gene locus_tag LOCUS_18030 4473 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4892 5227 gene locus_tag LOCUS_18040 4892 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6188 5331 gene locus_tag LOCUS_18050 6188 5331 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744680.1 protein_id gnl|my_center|LOCUS_18050 6275 6493 gene locus_tag LOCUS_18060 6275 6493 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_18060 6496 7338 gene locus_tag LOCUS_18070 6496 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 7711 7379 gene locus_tag LOCUS_18080 7711 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 10282 8282 gene locus_tag LOCUS_18090 10282 8282 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837281.1 protein_id gnl|my_center|LOCUS_18090 11042 10275 gene locus_tag LOCUS_18100 11042 10275 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_18100 12142 11159 gene locus_tag LOCUS_18110 12142 11159 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_18110 12829 12146 gene locus_tag LOCUS_18120 12829 12146 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_18120 13257 12826 gene locus_tag LOCUS_18130 13257 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 13281 14168 gene locus_tag LOCUS_18140 gene dapA 13281 14168 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286879.1 protein_id gnl|my_center|LOCUS_18140 14165 14881 gene locus_tag LOCUS_18150 gene dapB 14165 14881 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286877.1 protein_id gnl|my_center|LOCUS_18150 14885 15595 gene locus_tag LOCUS_18160 gene dapD 14885 15595 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286875.1 protein_id gnl|my_center|LOCUS_18160 15740 17269 gene locus_tag LOCUS_18170 15740 17269 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_18170 17416 17895 gene locus_tag LOCUS_18180 17416 17895 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence43 1395 34 gene locus_tag LOCUS_18190 1395 34 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_18190 1582 2970 gene locus_tag LOCUS_18200 gene murC 1582 2970 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966501.1 protein_id gnl|my_center|LOCUS_18200 3043 3582 gene locus_tag LOCUS_18210 3043 3582 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_18210 4209 3610 gene locus_tag LOCUS_18220 4209 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 4433 6238 gene locus_tag LOCUS_18230 gene dnaG 4433 6238 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896376.1 protein_id gnl|my_center|LOCUS_18230 6231 7700 gene locus_tag LOCUS_18240 gene rpoD 6231 7700 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_18240 7940 7713 gene locus_tag LOCUS_18250 7940 7713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 8249 8013 gene locus_tag LOCUS_18260 8249 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 9993 8266 gene locus_tag LOCUS_18270 9993 8266 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_18270 10318 10007 gene locus_tag LOCUS_18280 10318 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 10843 10361 gene locus_tag LOCUS_18290 gene rlmH 10843 10361 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811533.1 protein_id gnl|my_center|LOCUS_18290 11616 10831 gene locus_tag LOCUS_18300 11616 10831 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357943.1 protein_id gnl|my_center|LOCUS_18300 11597 11734 gene locus_tag LOCUS_18310 11597 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 13041 11743 gene locus_tag LOCUS_18320 13041 11743 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_18320 14355 13366 gene locus_tag LOCUS_18330 gene dmpG 14355 13366 CDS product 4-hydroxy-2-oxovalerate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393276.1 protein_id gnl|my_center|LOCUS_18330 15220 14378 gene locus_tag LOCUS_18340 15220 14378 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439904.1 protein_id gnl|my_center|LOCUS_18340 16550 15354 gene locus_tag LOCUS_18350 16550 15354 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_18350 17826 16591 gene locus_tag LOCUS_18360 17826 16591 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901956.1 protein_id gnl|my_center|LOCUS_18360 18436 17882 gene locus_tag LOCUS_18370 18436 17882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 19030 19182 gene locus_tag LOCUS_18380 19030 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence44 31 900 gene locus_tag LOCUS_18390 31 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1927 1184 gene locus_tag LOCUS_18400 1927 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2652 1924 gene locus_tag LOCUS_18410 2652 1924 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_18410 3370 2624 gene locus_tag LOCUS_18420 3370 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 4723 3548 gene locus_tag LOCUS_18430 4723 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 4543 4620 gene locus_tag LOCUS_t00400 4543 4620 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4971 5705 gene locus_tag LOCUS_18440 4971 5705 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_18440 5702 6976 gene locus_tag LOCUS_18450 5702 6976 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007785170.1 protein_id gnl|my_center|LOCUS_18450 7100 7432 gene locus_tag LOCUS_18460 7100 7432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 7802 7718 gene locus_tag LOCUS_t00410 7802 7718 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 8155 9123 gene locus_tag LOCUS_18470 8155 9123 CDS product DUF4428 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459959.1 protein_id gnl|my_center|LOCUS_18470 9138 11090 gene locus_tag LOCUS_18480 9138 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 11947 11159 gene locus_tag LOCUS_18490 11947 11159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 12295 12083 gene locus_tag LOCUS_18500 12295 12083 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982695.1 protein_id gnl|my_center|LOCUS_18500 12813 12292 gene locus_tag LOCUS_18510 12813 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 13071 13208 gene locus_tag LOCUS_18520 13071 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 15976 13343 gene locus_tag LOCUS_18530 15976 13343 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814229.1 protein_id gnl|my_center|LOCUS_18530 16655 15990 gene locus_tag LOCUS_18540 16655 15990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_18540 17810 16779 gene locus_tag LOCUS_18550 17810 16779 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_18550 18490 17807 gene locus_tag LOCUS_18560 18490 17807 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence45 553 77 gene locus_tag LOCUS_18570 553 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 1162 569 gene locus_tag LOCUS_18580 1162 569 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_18580 1278 3503 gene locus_tag LOCUS_18590 1278 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 4110 3595 gene locus_tag LOCUS_18600 4110 3595 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_18600 4782 4198 gene locus_tag LOCUS_18610 4782 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 5325 4885 gene locus_tag LOCUS_18620 5325 4885 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047979.1 protein_id gnl|my_center|LOCUS_18620 5669 5496 gene locus_tag LOCUS_18630 5669 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5924 7180 gene locus_tag LOCUS_18640 5924 7180 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_18640 7563 7261 gene locus_tag LOCUS_18650 7563 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 8959 7589 gene locus_tag LOCUS_18660 8959 7589 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776672.1 protein_id gnl|my_center|LOCUS_18660 10757 8946 gene locus_tag LOCUS_18670 10757 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 10973 11863 gene locus_tag LOCUS_18680 10973 11863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 11928 12845 gene locus_tag LOCUS_18690 11928 12845 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_18690 13738 12941 gene locus_tag LOCUS_18700 gene yqeB 13738 12941 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_18700 14414 13755 gene locus_tag LOCUS_18710 gene yqeC 14414 13755 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_18710 14570 15514 gene locus_tag LOCUS_18720 gene moaA 14570 15514 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943757.1 protein_id gnl|my_center|LOCUS_18720 >Feature sequence46 1200 472 gene locus_tag LOCUS_18730 1200 472 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_18730 1339 2139 gene locus_tag LOCUS_18740 gene proB 1339 2139 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_18740 2153 3403 gene locus_tag LOCUS_18750 2153 3403 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_18750 3464 4267 gene locus_tag LOCUS_18760 gene proC 3464 4267 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689692.1 protein_id gnl|my_center|LOCUS_18760 4413 4598 gene locus_tag LOCUS_18770 gene rpsU 4413 4598 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_18770 4978 5865 gene locus_tag LOCUS_18780 4978 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 6707 5940 gene locus_tag LOCUS_18790 6707 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 6812 7330 gene locus_tag LOCUS_18800 6812 7330 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_18800 7481 8050 gene locus_tag LOCUS_18810 gene efp 7481 8050 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_18810 8172 8609 gene locus_tag LOCUS_18820 8172 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359049.1 protein_id gnl|my_center|LOCUS_18820 9261 9188 gene locus_tag LOCUS_t00420 9261 9188 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9510 9764 gene locus_tag LOCUS_18830 9510 9764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 9801 10580 gene locus_tag LOCUS_18840 9801 10580 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_18840 10770 11471 gene locus_tag LOCUS_18850 10770 11471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 11504 12685 gene locus_tag LOCUS_18860 11504 12685 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454642.1 protein_id gnl|my_center|LOCUS_18860 12851 12666 gene locus_tag LOCUS_18870 12851 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 12790 13881 gene locus_tag LOCUS_18880 12790 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 14018 14755 gene locus_tag LOCUS_18890 14018 14755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence47 76 1 gene locus_tag LOCUS_t00430 76 1 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 153 338 gene locus_tag LOCUS_18900 153 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 338 571 gene locus_tag LOCUS_18910 338 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 552 854 gene locus_tag LOCUS_18920 552 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 973 1860 gene locus_tag LOCUS_18930 973 1860 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251336.1 protein_id gnl|my_center|LOCUS_18930 1877 2527 gene locus_tag LOCUS_18940 1877 2527 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920606.1 protein_id gnl|my_center|LOCUS_18940 2616 3239 gene locus_tag LOCUS_18950 2616 3239 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_18950 4496 3975 gene locus_tag LOCUS_18960 4496 3975 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567630.1 protein_id gnl|my_center|LOCUS_18960 4898 4596 gene locus_tag LOCUS_18970 4898 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 5644 5363 gene locus_tag LOCUS_18980 5644 5363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 5965 5714 gene locus_tag LOCUS_18990 5965 5714 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391634.1 protein_id gnl|my_center|LOCUS_18990 6376 6101 gene locus_tag LOCUS_19000 6376 6101 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_19000 7243 6437 gene locus_tag LOCUS_19010 7243 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 8920 7301 gene locus_tag LOCUS_19020 8920 7301 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_19020 9387 8992 gene locus_tag LOCUS_19030 9387 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 10330 9401 gene locus_tag LOCUS_19040 10330 9401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 11852 10380 gene locus_tag LOCUS_19050 11852 10380 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460348.1 protein_id gnl|my_center|LOCUS_19050 12473 11856 gene locus_tag LOCUS_19060 12473 11856 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_19060 12932 12486 gene locus_tag LOCUS_19070 gene dtd 12932 12486 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence48 1203 2042 gene locus_tag LOCUS_19080 1203 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2593 2423 gene locus_tag LOCUS_19090 2593 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 3355 2651 gene locus_tag LOCUS_19100 3355 2651 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459753.1 protein_id gnl|my_center|LOCUS_19100 4727 3411 gene locus_tag LOCUS_19110 4727 3411 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_19110 5581 4724 gene locus_tag LOCUS_19120 5581 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 5898 6986 gene locus_tag LOCUS_19130 gene serC 5898 6986 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_19130 7107 8018 gene locus_tag LOCUS_19140 7107 8018 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437082.1 protein_id gnl|my_center|LOCUS_19140 9487 8111 gene locus_tag LOCUS_19150 gene hydA 9487 8111 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387141.1 protein_id gnl|my_center|LOCUS_19150 9800 11992 gene locus_tag LOCUS_19160 9800 11992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 12489 12292 gene locus_tag LOCUS_19170 12489 12292 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence49 410 3004 gene locus_tag LOCUS_19180 410 3004 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_19180 2994 3257 gene locus_tag LOCUS_19190 2994 3257 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358680.1 protein_id gnl|my_center|LOCUS_19190 4320 3385 gene locus_tag LOCUS_19200 4320 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 5661 4468 gene locus_tag LOCUS_19210 gene gltS 5661 4468 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_19210 7134 6133 gene locus_tag LOCUS_19220 gene ansA 7134 6133 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_19220 8244 7147 gene locus_tag LOCUS_19230 8244 7147 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_19230 8728 8249 gene locus_tag LOCUS_19240 8728 8249 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_19240 9550 8777 gene locus_tag LOCUS_19250 gene ymdB 9550 8777 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_19250 10050 9637 gene locus_tag LOCUS_19260 10050 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 10372 10106 gene locus_tag LOCUS_19270 10372 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 10934 10776 gene locus_tag LOCUS_19280 10934 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 11117 10950 gene locus_tag LOCUS_19290 11117 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 11401 11295 gene locus_tag LOCUS_r00010 11401 11295 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 11678 11604 gene locus_tag LOCUS_t00440 11678 11604 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11790 11715 gene locus_tag LOCUS_t00450 11790 11715 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence50 430 705 gene locus_tag LOCUS_19300 430 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 618 815 gene locus_tag LOCUS_19310 618 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1441 3969 gene locus_tag LOCUS_19320 1441 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4030 4314 gene locus_tag LOCUS_19330 4030 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 4344 9950 gene locus_tag LOCUS_19340 4344 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence51 2308 563 gene locus_tag LOCUS_19350 2308 563 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_19350 2717 2310 gene locus_tag LOCUS_19360 2717 2310 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393960.1 protein_id gnl|my_center|LOCUS_19360 2859 3299 gene locus_tag LOCUS_19370 2859 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 3292 4158 gene locus_tag LOCUS_19380 3292 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 5269 4409 gene locus_tag LOCUS_19390 5269 4409 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272197.1 protein_id gnl|my_center|LOCUS_19390 6291 5413 gene locus_tag LOCUS_19400 6291 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 6409 7368 gene locus_tag LOCUS_19410 6409 7368 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015445493.1 protein_id gnl|my_center|LOCUS_19410 7365 7742 gene locus_tag LOCUS_19420 7365 7742 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268409.1 protein_id gnl|my_center|LOCUS_19420 9291 7930 gene locus_tag LOCUS_19430 9291 7930 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567789.1 protein_id gnl|my_center|LOCUS_19430 10369 9518 gene locus_tag LOCUS_19440 10369 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 11206 11281 gene locus_tag LOCUS_t00460 11206 11281 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence52 1466 858 gene locus_tag LOCUS_19450 1466 858 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291702.1 protein_id gnl|my_center|LOCUS_19450 2819 1911 gene locus_tag LOCUS_19460 2819 1911 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435316.1 protein_id gnl|my_center|LOCUS_19460 3035 3850 gene locus_tag LOCUS_19470 gene atpB 3035 3850 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056285.1 protein_id gnl|my_center|LOCUS_19470 3887 4270 gene locus_tag LOCUS_19480 3887 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 4286 4777 gene locus_tag LOCUS_19490 4286 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 4770 6530 gene locus_tag LOCUS_19500 gene atpA 4770 6530 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_19500 6532 7431 gene locus_tag LOCUS_19510 gene atpG 6532 7431 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_19510 7436 8839 gene locus_tag LOCUS_19520 gene atpD 7436 8839 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815475.1 protein_id gnl|my_center|LOCUS_19520 8839 9255 gene locus_tag LOCUS_19530 8839 9255 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387838.1 protein_id gnl|my_center|LOCUS_19530 9242 9964 gene locus_tag LOCUS_19540 9242 9964 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_19540 10112 10540 gene locus_tag LOCUS_19550 10112 10540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence53 9249 937 gene locus_tag LOCUS_19560 9249 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 9618 10391 gene locus_tag LOCUS_19570 9618 10391 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902960.1 protein_id gnl|my_center|LOCUS_19570 10611 10853 gene locus_tag LOCUS_19580 10611 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence54 712 65 gene locus_tag LOCUS_19590 712 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1293 4859 gene locus_tag LOCUS_19600 gene smc 1293 4859 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460497.1 protein_id gnl|my_center|LOCUS_19600 4901 5779 gene locus_tag LOCUS_19610 4901 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 5831 6088 gene locus_tag LOCUS_19620 5831 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 6102 6818 gene locus_tag LOCUS_19630 6102 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19630 6822 7412 gene locus_tag LOCUS_19640 gene rdgB 6822 7412 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828653.1 protein_id gnl|my_center|LOCUS_19640 7525 7848 gene locus_tag LOCUS_19650 7525 7848 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_19650 7878 9071 gene locus_tag LOCUS_19660 7878 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence55 7790 6543 gene locus_tag LOCUS_19670 7790 6543 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_19670 >Feature sequence56 888 274 gene locus_tag LOCUS_19680 888 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1736 885 gene locus_tag LOCUS_19690 1736 885 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_19690 2119 1733 gene locus_tag LOCUS_19700 2119 1733 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_19700 3431 2424 gene locus_tag LOCUS_19710 3431 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3589 3954 gene locus_tag LOCUS_19720 3589 3954 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814133.1 protein_id gnl|my_center|LOCUS_19720 3951 5828 gene locus_tag LOCUS_19730 3951 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 6500 5943 gene locus_tag LOCUS_19740 6500 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 6833 7996 gene locus_tag LOCUS_19750 6833 7996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 9140 8100 gene locus_tag LOCUS_19760 9140 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence57 1347 658 gene locus_tag LOCUS_19770 1347 658 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356156.1 protein_id gnl|my_center|LOCUS_19770 1707 1351 gene locus_tag LOCUS_19780 1707 1351 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948112.1 protein_id gnl|my_center|LOCUS_19780 2428 1985 gene locus_tag LOCUS_19790 2428 1985 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363085.1 protein_id gnl|my_center|LOCUS_19790 4649 2634 gene locus_tag LOCUS_19800 4649 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 5092 6117 gene locus_tag LOCUS_19810 5092 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 6232 6681 gene locus_tag LOCUS_19820 6232 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 6694 8214 gene locus_tag LOCUS_19830 6694 8214 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903081.1 protein_id gnl|my_center|LOCUS_19830 8252 8941 gene locus_tag LOCUS_19840 8252 8941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence58 2470 695 gene locus_tag LOCUS_19850 2470 695 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_19850 2836 2519 gene locus_tag LOCUS_19860 2836 2519 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_19860 3847 2852 gene locus_tag LOCUS_19870 3847 2852 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_19870 4453 3860 gene locus_tag LOCUS_19880 4453 3860 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986936.1 protein_id gnl|my_center|LOCUS_19880 4970 4479 gene locus_tag LOCUS_19890 4970 4479 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363905.1 protein_id gnl|my_center|LOCUS_19890 6924 4984 gene locus_tag LOCUS_19900 6924 4984 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_19900 7239 6925 gene locus_tag LOCUS_19910 7239 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 7968 7411 gene locus_tag LOCUS_19920 7968 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 8202 8278 gene locus_tag LOCUS_t00470 8202 8278 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9037 8396 gene locus_tag LOCUS_19930 9037 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence59 <1 1294 gene locus_tag LOCUS_19940 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942796.1:InlB B-repeat-containing protein 1522 4911 gene locus_tag LOCUS_19950 1522 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 5805 6212 gene locus_tag LOCUS_19960 5805 6212 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328798.1 protein_id gnl|my_center|LOCUS_19960 6420 8786 gene locus_tag LOCUS_19970 6420 8786 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_19970 >Feature sequence60 2360 129 gene locus_tag LOCUS_19980 2360 129 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_19980 4459 2357 gene locus_tag LOCUS_19990 gene recJ 4459 2357 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_19990 4721 6259 gene locus_tag LOCUS_20000 4721 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 6446 7354 gene locus_tag LOCUS_20010 6446 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 8094 7684 gene locus_tag LOCUS_20020 8094 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_20020 >Feature sequence61 1118 903 gene locus_tag LOCUS_20030 1118 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 2015 1611 gene locus_tag LOCUS_20040 2015 1611 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057828.1 protein_id gnl|my_center|LOCUS_20040 2863 2225 gene locus_tag LOCUS_20050 2863 2225 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_20050 <7175 3009 gene locus_tag LOCUS_20060 <7175 3009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:Ig-like domain-containing protein >Feature sequence62 <1 1494 gene locus_tag LOCUS_20070 <1 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048356.1:DNA-directed RNA polymerase subunit beta' 1872 3134 gene locus_tag LOCUS_20080 1872 3134 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_20080 3149 3991 gene locus_tag LOCUS_20090 3149 3991 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460408.1 protein_id gnl|my_center|LOCUS_20090 4771 4061 gene locus_tag LOCUS_20100 gene sigF 4771 4061 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_20100 5214 4768 gene locus_tag LOCUS_20110 gene spoIIAB 5214 4768 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_20110 5531 5211 gene locus_tag LOCUS_20120 5531 5211 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence63 >Feature sequence64 3639 4994 gene locus_tag LOCUS_20130 3639 4994 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_20130 5300 5181 gene locus_tag LOCUS_20140 5300 5181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 5478 6284 gene locus_tag LOCUS_20150 5478 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence65 1182 2852 gene locus_tag LOCUS_20160 gene lytS 1182 2852 CDS product two-component system sensor histidine kinase LytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229477.1 protein_id gnl|my_center|LOCUS_20160 2867 3583 gene locus_tag LOCUS_20170 2867 3583 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 protein_id gnl|my_center|LOCUS_20170 4747 3866 gene locus_tag LOCUS_20180 gene sdaAA 4747 3866 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_20180 5416 4748 gene locus_tag LOCUS_20190 gene sdaAB 5416 4748 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence66 1365 1598 gene locus_tag LOCUS_20200 1365 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2097 1903 gene locus_tag LOCUS_20210 2097 1903 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_20210 2193 3128 gene locus_tag LOCUS_20220 2193 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 4383 3109 gene locus_tag LOCUS_20230 4383 3109 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_20230 4559 5416 gene locus_tag LOCUS_20240 4559 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence67 1091 48 gene locus_tag LOCUS_20250 1091 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 2584 1088 gene locus_tag LOCUS_20260 2584 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 5115 2740 gene locus_tag LOCUS_20270 5115 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 5492 5112 gene locus_tag LOCUS_20280 5492 5112 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156042.1 protein_id gnl|my_center|LOCUS_20280 >Feature sequence68 1 447 gene locus_tag LOCUS_20290 1 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 1178 510 gene locus_tag LOCUS_20300 1178 510 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359485.1 protein_id gnl|my_center|LOCUS_20300 1315 1851 gene locus_tag LOCUS_20310 1315 1851 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681144.1 protein_id gnl|my_center|LOCUS_20310 2850 1945 gene locus_tag LOCUS_20320 2850 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4233 2953 gene locus_tag LOCUS_20330 4233 2953 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_20330 5712 4381 gene locus_tag LOCUS_20340 5712 4381 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_20340 >Feature sequence69 <1 657 gene locus_tag LOCUS_20350 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966157.1:acetyl-CoA C-acetyltransferase 2162 774 gene locus_tag LOCUS_20360 2162 774 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_20360 2273 2815 gene locus_tag LOCUS_20370 2273 2815 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_20370 3412 2870 gene locus_tag LOCUS_20380 3412 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3668 3595 gene locus_tag LOCUS_t00480 3668 3595 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3790 4908 gene locus_tag LOCUS_20390 gene dacF 3790 4908 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831996.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence70 <1 1845 gene locus_tag LOCUS_20400 <1 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861890.1:valine--tRNA ligase 2053 2964 gene locus_tag LOCUS_20410 2053 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 2979 3185 gene locus_tag LOCUS_20420 2979 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_20420 3346 4557 gene locus_tag LOCUS_20430 3346 4557 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398755.1 protein_id gnl|my_center|LOCUS_20430 4554 5144 gene locus_tag LOCUS_20440 4554 5144 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence71 336 1784 gene locus_tag LOCUS_20450 336 1784 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_20450 1839 3407 gene locus_tag LOCUS_20460 gene cls 1839 3407 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_20460 3435 4277 gene locus_tag LOCUS_20470 3435 4277 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_20470 <5223 4366 gene locus_tag LOCUS_20480 <5223 4366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014636419.1:alkaline phosphatase family protein >Feature sequence72 186 488 gene locus_tag LOCUS_20490 186 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 1038 1721 gene locus_tag LOCUS_20500 1038 1721 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459494.1 protein_id gnl|my_center|LOCUS_20500 1718 2659 gene locus_tag LOCUS_20510 1718 2659 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943877.1 protein_id gnl|my_center|LOCUS_20510 2731 3399 gene locus_tag LOCUS_20520 2731 3399 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence73 255 55 gene locus_tag LOCUS_20530 255 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 395 1834 gene locus_tag LOCUS_20540 395 1834 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861147.1 protein_id gnl|my_center|LOCUS_20540 4188 2170 gene locus_tag LOCUS_20550 4188 2170 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925163.1 protein_id gnl|my_center|LOCUS_20550 4687 4181 gene locus_tag LOCUS_20560 4687 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence74 93 263 gene locus_tag LOCUS_20570 93 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 247 2175 gene locus_tag LOCUS_20580 247 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20580 <4751 2818 gene locus_tag LOCUS_20590 <4751 2818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_119597939.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence75 <1 1071 gene locus_tag LOCUS_20600 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_119597939.1:glycoside hydrolase family 3 N-terminal domain-containing protein 1365 1895 gene locus_tag LOCUS_20610 1365 1895 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_20610 1900 2343 gene locus_tag LOCUS_20620 1900 2343 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816014.1 protein_id gnl|my_center|LOCUS_20620 2531 3079 gene locus_tag LOCUS_20630 2531 3079 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545519.1 protein_id gnl|my_center|LOCUS_20630 3095 3520 gene locus_tag LOCUS_20640 3095 3520 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895547.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence76 <1 575 gene locus_tag LOCUS_20650 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001148816.1:DNA-3-methyladenine glycosylase 578 1219 gene locus_tag LOCUS_20660 578 1219 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence77 >Feature sequence78 886 1245 gene locus_tag LOCUS_20670 gene rsfS 886 1245 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172029.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence79 <2800 24 gene locus_tag LOCUS_20680 <2800 24 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987043.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence80 709 972 gene locus_tag LOCUS_20690 709 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence81 264 998 gene locus_tag LOCUS_20700 264 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 1827 1255 gene locus_tag LOCUS_20710 1827 1255 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_20710 2535 1855 gene locus_tag LOCUS_20720 gene sfsA 2535 1855 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_20720 2718 2551 gene locus_tag LOCUS_20730 2718 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence82 1520 795 gene locus_tag LOCUS_20740 1520 795 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229226.1 protein_id gnl|my_center|LOCUS_20740 1648 2109 gene locus_tag LOCUS_20750 1648 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence83 >Feature sequence84 <1 1392 gene locus_tag LOCUS_20760 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390101.1:phosphoribosylformylglycinamidine synthase