>Feature sequence1 1 77 gene locus_tag LOCUS_t00010 1 77 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1658 237 gene locus_tag LOCUS_00010 1658 237 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_00010 2012 1725 gene locus_tag LOCUS_00020 2012 1725 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392891.1 protein_id gnl|my_center|LOCUS_00020 3229 2963 gene locus_tag LOCUS_00030 3229 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3365 3595 gene locus_tag LOCUS_00040 3365 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4032 3826 gene locus_tag LOCUS_00050 4032 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4131 4511 gene locus_tag LOCUS_00060 4131 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4808 5251 gene locus_tag LOCUS_00070 4808 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5545 6990 gene locus_tag LOCUS_00080 5545 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7109 7867 gene locus_tag LOCUS_00090 7109 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00090 7843 8088 gene locus_tag LOCUS_00100 7843 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00100 8358 11327 gene locus_tag LOCUS_00110 gene secA 8358 11327 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895216.1 protein_id gnl|my_center|LOCUS_00110 11327 12514 gene locus_tag LOCUS_00120 gene prfB 11327 12514 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_00120 12501 13664 gene locus_tag LOCUS_00130 12501 13664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14941 14117 gene locus_tag LOCUS_00140 gene thiD 14941 14117 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055440.1 protein_id gnl|my_center|LOCUS_00140 15652 14987 gene locus_tag LOCUS_00150 gene thiE 15652 14987 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006557.1 protein_id gnl|my_center|LOCUS_00150 16512 15679 gene locus_tag LOCUS_00160 gene thiM 16512 15679 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_00160 18099 16729 gene locus_tag LOCUS_00170 gene thiC 18099 16729 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015816.1 protein_id gnl|my_center|LOCUS_00170 18824 18324 gene locus_tag LOCUS_00180 18824 18324 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068552.1 protein_id gnl|my_center|LOCUS_00180 19718 18909 gene locus_tag LOCUS_00190 gene yaaA 19718 18909 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458998.1 protein_id gnl|my_center|LOCUS_00190 21228 19813 gene locus_tag LOCUS_00200 21228 19813 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_00200 21388 21987 gene locus_tag LOCUS_00210 21388 21987 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887442.1 protein_id gnl|my_center|LOCUS_00210 22091 24859 gene locus_tag LOCUS_00220 22091 24859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25818 24985 gene locus_tag LOCUS_00230 25818 24985 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662288.1 protein_id gnl|my_center|LOCUS_00230 26358 27689 gene locus_tag LOCUS_00240 26358 27689 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031921.1 protein_id gnl|my_center|LOCUS_00240 27765 27938 gene locus_tag LOCUS_00250 27765 27938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 28013 29434 gene locus_tag LOCUS_00260 gene argH 28013 29434 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_00260 29689 30099 gene locus_tag LOCUS_00270 gene ndk 29689 30099 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_00270 30913 30176 gene locus_tag LOCUS_00280 30913 30176 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584037.1 protein_id gnl|my_center|LOCUS_00280 31241 32359 gene locus_tag LOCUS_00290 31241 32359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32493 33182 gene locus_tag LOCUS_00300 32493 33182 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_00300 33213 34643 gene locus_tag LOCUS_00310 33213 34643 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537832.1 protein_id gnl|my_center|LOCUS_00310 34717 35901 gene locus_tag LOCUS_00320 34717 35901 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020479.1 protein_id gnl|my_center|LOCUS_00320 36804 35920 gene locus_tag LOCUS_00330 36804 35920 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458966.1 protein_id gnl|my_center|LOCUS_00330 37158 37236 gene locus_tag LOCUS_t00020 37158 37236 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 37262 37338 gene locus_tag LOCUS_t00030 37262 37338 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 37676 37419 gene locus_tag LOCUS_00340 37676 37419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 39146 37722 gene locus_tag LOCUS_00350 39146 37722 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821099.1 protein_id gnl|my_center|LOCUS_00350 39327 40649 gene locus_tag LOCUS_00360 39327 40649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 42024 40789 gene locus_tag LOCUS_00370 42024 40789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_00370 42779 42021 gene locus_tag LOCUS_00380 42779 42021 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_00380 44154 42784 gene locus_tag LOCUS_00390 44154 42784 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071114.1 protein_id gnl|my_center|LOCUS_00390 44683 46341 gene locus_tag LOCUS_00400 44683 46341 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_00400 46531 47571 gene locus_tag LOCUS_00410 46531 47571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113014.1 protein_id gnl|my_center|LOCUS_00410 47587 48543 gene locus_tag LOCUS_00420 47587 48543 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583498.1 protein_id gnl|my_center|LOCUS_00420 48548 49678 gene locus_tag LOCUS_00430 48548 49678 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_00430 49680 50708 gene locus_tag LOCUS_00440 49680 50708 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_00440 51317 51406 gene locus_tag LOCUS_t00040 51317 51406 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51500 53860 gene locus_tag LOCUS_00450 51500 53860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 52910 52985 gene locus_tag LOCUS_t00050 52910 52985 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 53872 54609 gene locus_tag LOCUS_00460 53872 54609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 54802 54596 gene locus_tag LOCUS_00470 54802 54596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 56118 54859 gene locus_tag LOCUS_00480 56118 54859 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861090.1 protein_id gnl|my_center|LOCUS_00480 56330 58822 gene locus_tag LOCUS_00490 56330 58822 CDS product DUF3656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020587.1 protein_id gnl|my_center|LOCUS_00490 58822 59562 gene locus_tag LOCUS_00500 58822 59562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 59643 60356 gene locus_tag LOCUS_00510 59643 60356 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000232924.1 protein_id gnl|my_center|LOCUS_00510 60399 62015 gene locus_tag LOCUS_00520 60399 62015 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_00520 62017 62817 gene locus_tag LOCUS_00530 62017 62817 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_00530 62814 64007 gene locus_tag LOCUS_00540 62814 64007 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_00540 64432 64088 gene locus_tag LOCUS_00550 gene azlD 64432 64088 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_00550 64591 65346 gene locus_tag LOCUS_00560 64591 65346 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195907.1 protein_id gnl|my_center|LOCUS_00560 66306 65377 gene locus_tag LOCUS_00570 66306 65377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 66454 70200 gene locus_tag LOCUS_00580 66454 70200 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_00580 70268 70888 gene locus_tag LOCUS_00590 70268 70888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 71094 71717 gene locus_tag LOCUS_00600 71094 71717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 71720 72556 gene locus_tag LOCUS_00610 71720 72556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 72795 72574 gene locus_tag LOCUS_00620 72795 72574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72927 73490 gene locus_tag LOCUS_00630 72927 73490 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767342.1 protein_id gnl|my_center|LOCUS_00630 73828 74049 gene locus_tag LOCUS_00640 73828 74049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 74176 74889 gene locus_tag LOCUS_00650 74176 74889 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070540.1 protein_id gnl|my_center|LOCUS_00650 75179 79756 gene locus_tag LOCUS_00660 gene gltB 75179 79756 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_00660 79758 81260 gene locus_tag LOCUS_00670 79758 81260 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807932.1 protein_id gnl|my_center|LOCUS_00670 81635 82345 gene locus_tag LOCUS_00680 81635 82345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 82529 83668 gene locus_tag LOCUS_00690 gene tgt 82529 83668 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_00690 84017 84244 gene locus_tag LOCUS_00700 84017 84244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 86205 85228 gene locus_tag LOCUS_00710 86205 85228 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058916821.1 protein_id gnl|my_center|LOCUS_00710 86416 86748 gene locus_tag LOCUS_00720 86416 86748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 87077 88387 gene locus_tag LOCUS_00730 87077 88387 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_00730 88580 90709 gene locus_tag LOCUS_00740 gene rnr 88580 90709 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829677.1 protein_id gnl|my_center|LOCUS_00740 90812 91747 gene locus_tag LOCUS_00750 90812 91747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 91750 92223 gene locus_tag LOCUS_00760 gene smpB 91750 92223 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583706.1 protein_id gnl|my_center|LOCUS_00760 92274 92777 gene locus_tag LOCUS_00770 gene feR 92274 92777 CDS product ferric-chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878333.1 protein_id gnl|my_center|LOCUS_00770 92928 93071 gene locus_tag LOCUS_00780 92928 93071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 93321 93878 gene locus_tag LOCUS_00790 93321 93878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 93871 94242 gene locus_tag LOCUS_00800 93871 94242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 94300 95334 gene locus_tag LOCUS_00810 94300 95334 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_00810 95327 96061 gene locus_tag LOCUS_00820 95327 96061 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_00820 96054 96902 gene locus_tag LOCUS_00830 96054 96902 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_00830 98013 97009 gene locus_tag LOCUS_00840 98013 97009 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143212.1 protein_id gnl|my_center|LOCUS_00840 98438 102250 gene locus_tag LOCUS_00850 98438 102250 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_00850 102718 103734 gene locus_tag LOCUS_00860 102718 103734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 103721 104647 gene locus_tag LOCUS_00870 gene ftsX 103721 104647 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_00870 104773 106509 gene locus_tag LOCUS_00880 104773 106509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 106553 107665 gene locus_tag LOCUS_00890 106553 107665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 107672 108334 gene locus_tag LOCUS_00900 107672 108334 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_00900 108523 109683 gene locus_tag LOCUS_00910 gene fucO 108523 109683 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783906.1 protein_id gnl|my_center|LOCUS_00910 110016 109792 gene locus_tag LOCUS_00920 110016 109792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 110106 110588 gene locus_tag LOCUS_00930 gene rnhA 110106 110588 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368126.1 protein_id gnl|my_center|LOCUS_00930 110616 111719 gene locus_tag LOCUS_00940 gene iolU 110616 111719 CDS product scyllo-inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228926.1 protein_id gnl|my_center|LOCUS_00940 111727 112203 gene locus_tag LOCUS_00950 111727 112203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 112238 112747 gene locus_tag LOCUS_00960 gene ybaK 112238 112747 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_00960 112870 114084 gene locus_tag LOCUS_00970 112870 114084 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674723.1 protein_id gnl|my_center|LOCUS_00970 114181 116139 gene locus_tag LOCUS_00980 gene murJ 114181 116139 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806275.1 protein_id gnl|my_center|LOCUS_00980 116136 118277 gene locus_tag LOCUS_00990 gene uvrC 116136 118277 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_00990 118696 119643 gene locus_tag LOCUS_01000 118696 119643 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167205.1 protein_id gnl|my_center|LOCUS_01000 119647 120549 gene locus_tag LOCUS_01010 gene pstC 119647 120549 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922359.1 protein_id gnl|my_center|LOCUS_01010 120542 121555 gene locus_tag LOCUS_01020 gene pstA 120542 121555 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722630.1 protein_id gnl|my_center|LOCUS_01020 121557 122396 gene locus_tag LOCUS_01030 gene pstB 121557 122396 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_01030 122530 124347 gene locus_tag LOCUS_01040 122530 124347 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_01040 124431 124763 gene locus_tag LOCUS_01050 124431 124763 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_01050 125914 125063 gene locus_tag LOCUS_01060 125914 125063 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_01060 127013 125964 gene locus_tag LOCUS_01070 gene trpS 127013 125964 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004573597.1 protein_id gnl|my_center|LOCUS_01070 128349 127063 gene locus_tag LOCUS_01080 128349 127063 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_01080 129171 129096 gene locus_tag LOCUS_t00060 129171 129096 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 130204 129242 gene locus_tag LOCUS_01090 130204 129242 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_01090 132826 130292 gene locus_tag LOCUS_01100 132826 130292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618669.1 protein_id gnl|my_center|LOCUS_01100 133306 134016 gene locus_tag LOCUS_01110 133306 134016 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_01110 134026 134373 gene locus_tag LOCUS_01120 134026 134373 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985167.1 protein_id gnl|my_center|LOCUS_01120 134604 135674 gene locus_tag LOCUS_01130 134604 135674 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_01130 135879 138587 gene locus_tag LOCUS_01140 135879 138587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 139860 138634 gene locus_tag LOCUS_01150 139860 138634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 140447 139833 gene locus_tag LOCUS_01160 140447 139833 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601187.1 protein_id gnl|my_center|LOCUS_01160 140630 141430 gene locus_tag LOCUS_01170 140630 141430 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_01170 141446 142279 gene locus_tag LOCUS_01180 141446 142279 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021650009.1 protein_id gnl|my_center|LOCUS_01180 142315 143847 gene locus_tag LOCUS_01190 142315 143847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 143961 145997 gene locus_tag LOCUS_01200 143961 145997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 146167 148467 gene locus_tag LOCUS_01210 146167 148467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 149257 148511 gene locus_tag LOCUS_01220 149257 148511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 149369 149581 gene locus_tag LOCUS_01230 149369 149581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 150568 152199 gene locus_tag LOCUS_01240 150568 152199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 152787 152413 gene locus_tag LOCUS_01250 152787 152413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 153257 152727 gene locus_tag LOCUS_01260 153257 152727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 153368 154534 gene locus_tag LOCUS_01270 153368 154534 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_01270 154679 155629 gene locus_tag LOCUS_01280 154679 155629 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_01280 155735 156739 gene locus_tag LOCUS_01290 155735 156739 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387246.1 protein_id gnl|my_center|LOCUS_01290 156925 157347 gene locus_tag LOCUS_01300 156925 157347 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_01300 157925 158473 gene locus_tag LOCUS_01310 157925 158473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 158501 158920 gene locus_tag LOCUS_01320 158501 158920 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813583.1 protein_id gnl|my_center|LOCUS_01320 159017 160303 gene locus_tag LOCUS_01330 159017 160303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 160683 162083 gene locus_tag LOCUS_01340 160683 162083 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_01340 162253 163215 gene locus_tag LOCUS_01350 gene dapA 162253 163215 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286879.1 protein_id gnl|my_center|LOCUS_01350 163208 163957 gene locus_tag LOCUS_01360 gene dapB 163208 163957 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_01360 164041 164757 gene locus_tag LOCUS_01370 gene dapD 164041 164757 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905478.1 protein_id gnl|my_center|LOCUS_01370 164826 166082 gene locus_tag LOCUS_01380 164826 166082 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286870.1 protein_id gnl|my_center|LOCUS_01380 167504 166437 gene locus_tag LOCUS_01390 167504 166437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 168367 167735 gene locus_tag LOCUS_01400 168367 167735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 168539 169420 gene locus_tag LOCUS_01410 168539 169420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 169900 169472 gene locus_tag LOCUS_01420 169900 169472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 170770 171492 gene locus_tag LOCUS_01430 170770 171492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 171489 172676 gene locus_tag LOCUS_01440 171489 172676 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108800.1 protein_id gnl|my_center|LOCUS_01440 172693 173607 gene locus_tag LOCUS_01450 gene rfbB 172693 173607 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868293.1 protein_id gnl|my_center|LOCUS_01450 173604 174542 gene locus_tag LOCUS_01460 173604 174542 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579813.1 protein_id gnl|my_center|LOCUS_01460 174549 175349 gene locus_tag LOCUS_01470 174549 175349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 175351 176007 gene locus_tag LOCUS_01480 175351 176007 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_01480 177313 178155 gene locus_tag LOCUS_01490 177313 178155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 178180 179328 gene locus_tag LOCUS_01500 gene rffA 178180 179328 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176203.1 protein_id gnl|my_center|LOCUS_01500 181001 181483 gene locus_tag LOCUS_01510 181001 181483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 181523 182272 gene locus_tag LOCUS_01520 181523 182272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 182309 183325 gene locus_tag LOCUS_01530 182309 183325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 183325 184443 gene locus_tag LOCUS_01540 183325 184443 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_01540 184440 185534 gene locus_tag LOCUS_01550 184440 185534 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526112.1 protein_id gnl|my_center|LOCUS_01550 185538 186584 gene locus_tag LOCUS_01560 185538 186584 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922332.1 protein_id gnl|my_center|LOCUS_01560 186578 189073 gene locus_tag LOCUS_01570 186578 189073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 189063 190487 gene locus_tag LOCUS_01580 189063 190487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 190554 192263 gene locus_tag LOCUS_01590 190554 192263 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965634.1 protein_id gnl|my_center|LOCUS_01590 192263 193597 gene locus_tag LOCUS_01600 192263 193597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 193743 194057 gene locus_tag LOCUS_01610 193743 194057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 194047 194367 gene locus_tag LOCUS_01620 194047 194367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 195153 194575 gene locus_tag LOCUS_01630 195153 194575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 196663 195167 gene locus_tag LOCUS_01640 196663 195167 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_01640 196932 197363 gene locus_tag LOCUS_01650 196932 197363 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01650 197510 199276 gene locus_tag LOCUS_01660 gene thrS 197510 199276 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_01660 199796 199410 gene locus_tag LOCUS_01670 199796 199410 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_01670 199907 200029 gene locus_tag LOCUS_01680 199907 200029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 200695 200270 gene locus_tag LOCUS_01690 200695 200270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 200851 201534 gene locus_tag LOCUS_01700 200851 201534 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_01700 201583 202008 gene locus_tag LOCUS_01710 201583 202008 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_01710 202353 202012 gene locus_tag LOCUS_01720 202353 202012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 203773 202346 gene locus_tag LOCUS_01730 203773 202346 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_01730 203918 204619 gene locus_tag LOCUS_01740 203918 204619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 204723 206411 gene locus_tag LOCUS_01750 gene pgi 204723 206411 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 protein_id gnl|my_center|LOCUS_01750 206884 206645 gene locus_tag LOCUS_01760 206884 206645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 206965 207963 gene locus_tag LOCUS_01770 206965 207963 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140402.1 protein_id gnl|my_center|LOCUS_01770 208066 208335 gene locus_tag LOCUS_01780 208066 208335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 208351 209772 gene locus_tag LOCUS_01790 208351 209772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 210291 209962 gene locus_tag LOCUS_01800 210291 209962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 210429 211940 gene locus_tag LOCUS_01810 210429 211940 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_01810 211970 214534 gene locus_tag LOCUS_01820 gene leuS 211970 214534 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460890.1 protein_id gnl|my_center|LOCUS_01820 214899 216584 gene locus_tag LOCUS_01830 214899 216584 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460381.1 protein_id gnl|my_center|LOCUS_01830 216586 219312 gene locus_tag LOCUS_01840 216586 219312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 219312 220730 gene locus_tag LOCUS_01850 219312 220730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 220795 221292 gene locus_tag LOCUS_01860 220795 221292 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_01860 221309 222652 gene locus_tag LOCUS_01870 gene rimO 221309 222652 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_01870 222660 223268 gene locus_tag LOCUS_01880 gene pgsA 222660 223268 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025093.1 protein_id gnl|my_center|LOCUS_01880 223451 226141 gene locus_tag LOCUS_01890 223451 226141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 226324 226809 gene locus_tag LOCUS_01900 226324 226809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 227040 228185 gene locus_tag LOCUS_01910 gene recA 227040 228185 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052644.1 protein_id gnl|my_center|LOCUS_01910 228192 228866 gene locus_tag LOCUS_01920 228192 228866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 229093 230643 gene locus_tag LOCUS_01930 gene rny 229093 230643 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_01930 230650 231732 gene locus_tag LOCUS_01940 230650 231732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 231807 232127 gene locus_tag LOCUS_01950 231807 232127 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362540.1 protein_id gnl|my_center|LOCUS_01950 232131 233489 gene locus_tag LOCUS_01960 gene miaB 232131 233489 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_01960 233486 234427 gene locus_tag LOCUS_01970 gene miaA 233486 234427 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224257.1 protein_id gnl|my_center|LOCUS_01970 234431 235720 gene locus_tag LOCUS_01980 gene hflX 234431 235720 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_01980 235769 235954 gene locus_tag LOCUS_01990 235769 235954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 236749 236006 gene locus_tag LOCUS_02000 236749 236006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 237400 236762 gene locus_tag LOCUS_02010 gene lexA 237400 236762 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_02010 237573 238013 gene locus_tag LOCUS_02020 237573 238013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 238089 238532 gene locus_tag LOCUS_02030 gene nrdR 238089 238532 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699785.1 protein_id gnl|my_center|LOCUS_02030 238539 238982 gene locus_tag LOCUS_02040 gene dut 238539 238982 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_02040 240353 239106 gene locus_tag LOCUS_02050 240353 239106 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256548.1 protein_id gnl|my_center|LOCUS_02050 240466 241404 gene locus_tag LOCUS_02060 gene trxB 240466 241404 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_02060 241554 244214 gene locus_tag LOCUS_02070 gene alaS 241554 244214 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_02070 244238 244723 gene locus_tag LOCUS_02080 gene ruvX 244238 244723 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_02080 244821 245936 gene locus_tag LOCUS_02090 gene mltG 244821 245936 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_02090 245933 246430 gene locus_tag LOCUS_02100 245933 246430 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888598.1 protein_id gnl|my_center|LOCUS_02100 246436 247002 gene locus_tag LOCUS_02110 gene aroK 246436 247002 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 protein_id gnl|my_center|LOCUS_02110 246999 248093 gene locus_tag LOCUS_02120 246999 248093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 248353 249483 gene locus_tag LOCUS_02130 248353 249483 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393048.1 protein_id gnl|my_center|LOCUS_02130 250766 250395 gene locus_tag LOCUS_02140 250766 250395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 250725 251183 gene locus_tag LOCUS_02150 250725 251183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 251198 251668 gene locus_tag LOCUS_02160 251198 251668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 251805 252368 gene locus_tag LOCUS_02170 gene efp 251805 252368 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810907.1 protein_id gnl|my_center|LOCUS_02170 252417 252776 gene locus_tag LOCUS_02180 252417 252776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 252780 253454 gene locus_tag LOCUS_02190 252780 253454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 253456 253740 gene locus_tag LOCUS_02200 253456 253740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 253743 254546 gene locus_tag LOCUS_02210 253743 254546 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_02210 254543 255421 gene locus_tag LOCUS_02220 254543 255421 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 protein_id gnl|my_center|LOCUS_02220 255411 257042 gene locus_tag LOCUS_02230 gene recN 255411 257042 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325905.1 protein_id gnl|my_center|LOCUS_02230 257097 257543 gene locus_tag LOCUS_02240 gene aroQ 257097 257543 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_02240 258866 257613 gene locus_tag LOCUS_02250 258866 257613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 260077 258932 gene locus_tag LOCUS_02260 gene pheA 260077 258932 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_02260 261264 260092 gene locus_tag LOCUS_02270 gene aroC 261264 260092 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_02270 262589 261249 gene locus_tag LOCUS_02280 gene aroA 262589 261249 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_02280 263688 262591 gene locus_tag LOCUS_02290 gene aroB 263688 262591 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775572.1 protein_id gnl|my_center|LOCUS_02290 264640 263729 gene locus_tag LOCUS_02300 264640 263729 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_02300 265661 264642 gene locus_tag LOCUS_02310 gene aroF 265661 264642 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_02310 266208 266471 gene locus_tag LOCUS_02320 266208 266471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 266730 267260 gene locus_tag LOCUS_02330 266730 267260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 267277 267612 gene locus_tag LOCUS_02340 267277 267612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 267896 267972 gene locus_tag LOCUS_t00070 267896 267972 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 268056 270779 gene locus_tag LOCUS_02350 268056 270779 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_02350 270838 273501 gene locus_tag LOCUS_02360 gene acnA 270838 273501 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_02360 273521 274648 gene locus_tag LOCUS_02370 273521 274648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 274776 275315 gene locus_tag LOCUS_02380 274776 275315 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_02380 275373 276797 gene locus_tag LOCUS_02390 275373 276797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 276826 277869 gene locus_tag LOCUS_02400 276826 277869 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_02400 277884 278939 gene locus_tag LOCUS_02410 277884 278939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 278941 279498 gene locus_tag LOCUS_02420 278941 279498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 279508 281553 gene locus_tag LOCUS_02430 gene mrdA 279508 281553 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388232.1 protein_id gnl|my_center|LOCUS_02430 281566 282753 gene locus_tag LOCUS_02440 gene rodA 281566 282753 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_02440 282811 283734 gene locus_tag LOCUS_02450 282811 283734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 283739 285616 gene locus_tag LOCUS_02460 283739 285616 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460899.1 protein_id gnl|my_center|LOCUS_02460 285613 286428 gene locus_tag LOCUS_02470 285613 286428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 286594 286965 gene locus_tag LOCUS_02480 gene rplU 286594 286965 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412578.1 protein_id gnl|my_center|LOCUS_02480 287009 287266 gene locus_tag LOCUS_02490 gene rpmA 287009 287266 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896001.1 protein_id gnl|my_center|LOCUS_02490 287396 288808 gene locus_tag LOCUS_02500 gene obgE 287396 288808 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460894.1 protein_id gnl|my_center|LOCUS_02500 288810 289496 gene locus_tag LOCUS_02510 gene nadD 288810 289496 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_02510 289493 290128 gene locus_tag LOCUS_02520 gene yqeK 289493 290128 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_02520 290138 290605 gene locus_tag LOCUS_02530 290138 290605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 291901 290609 gene locus_tag LOCUS_02540 gene dinB 291901 290609 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_02540 292156 292494 gene locus_tag LOCUS_02550 292156 292494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 292497 292799 gene locus_tag LOCUS_02560 292497 292799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 292792 293322 gene locus_tag LOCUS_02570 gene rimM 292792 293322 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640383.1 protein_id gnl|my_center|LOCUS_02570 293387 294148 gene locus_tag LOCUS_02580 gene trmD 293387 294148 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_02580 294182 294745 gene locus_tag LOCUS_02590 gene lepB 294182 294745 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460080.1 protein_id gnl|my_center|LOCUS_02590 295047 295970 gene locus_tag LOCUS_02600 gene glyQ 295047 295970 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_02600 295971 298064 gene locus_tag LOCUS_02610 gene glyS 295971 298064 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_02610 298269 298763 gene locus_tag LOCUS_02620 gene rimP 298269 298763 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147148.1 protein_id gnl|my_center|LOCUS_02620 298767 300029 gene locus_tag LOCUS_02630 gene nusA 298767 300029 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_02630 300093 302783 gene locus_tag LOCUS_02640 300093 302783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 302799 303218 gene locus_tag LOCUS_02650 gene rbfA 302799 303218 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707073.1 protein_id gnl|my_center|LOCUS_02650 303235 304371 gene locus_tag LOCUS_02660 303235 304371 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_02660 304471 305442 gene locus_tag LOCUS_02670 gene truB 304471 305442 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296636.1 protein_id gnl|my_center|LOCUS_02670 305439 306482 gene locus_tag LOCUS_02680 305439 306482 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121910865.1 protein_id gnl|my_center|LOCUS_02680 306546 308591 gene locus_tag LOCUS_02690 306546 308591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 308728 310068 gene locus_tag LOCUS_02700 308728 310068 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805037.1 protein_id gnl|my_center|LOCUS_02700 310379 310305 gene locus_tag LOCUS_t00080 310379 310305 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 310535 311107 gene locus_tag LOCUS_02710 310535 311107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 311100 311477 gene locus_tag LOCUS_02720 311100 311477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 311474 312400 gene locus_tag LOCUS_02730 311474 312400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 312397 313770 gene locus_tag LOCUS_02740 312397 313770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 314791 313922 gene locus_tag LOCUS_02750 314791 313922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 314936 315547 gene locus_tag LOCUS_02760 314936 315547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 317057 315651 gene locus_tag LOCUS_02770 gene pepV 317057 315651 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016277.1 protein_id gnl|my_center|LOCUS_02770 317954 317421 gene locus_tag LOCUS_02780 gene apt 317954 317421 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127356.1 protein_id gnl|my_center|LOCUS_02780 318859 317975 gene locus_tag LOCUS_02790 318859 317975 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467185.1 protein_id gnl|my_center|LOCUS_02790 319281 318862 gene locus_tag LOCUS_02800 319281 318862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 320039 319317 gene locus_tag LOCUS_02810 320039 319317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 320233 320309 gene locus_tag LOCUS_t00090 320233 320309 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 321643 320435 gene locus_tag LOCUS_02820 gene coaBC 321643 320435 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 protein_id gnl|my_center|LOCUS_02820 322396 321647 gene locus_tag LOCUS_02830 322396 321647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 323202 322393 gene locus_tag LOCUS_02840 323202 322393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 324399 323242 gene locus_tag LOCUS_02850 324399 323242 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_02850 325082 324405 gene locus_tag LOCUS_02860 gene rpe 325082 324405 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_02860 326129 325125 gene locus_tag LOCUS_02870 326129 325125 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776760.1 protein_id gnl|my_center|LOCUS_02870 326825 326175 gene locus_tag LOCUS_02880 gene plsY 326825 326175 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644419.1 protein_id gnl|my_center|LOCUS_02880 328179 326833 gene locus_tag LOCUS_02890 gene der 328179 326833 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_02890 329606 328203 gene locus_tag LOCUS_02900 329606 328203 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_02900 330450 329614 gene locus_tag LOCUS_02910 gene ispH 330450 329614 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_02910 331178 330453 gene locus_tag LOCUS_02920 331178 330453 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_02920 331864 331181 gene locus_tag LOCUS_02930 gene cmk 331864 331181 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_02930 332848 332081 gene locus_tag LOCUS_02940 332848 332081 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_02940 333569 332862 gene locus_tag LOCUS_02950 333569 332862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 334374 333574 gene locus_tag LOCUS_02960 334374 333574 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088258909.1 protein_id gnl|my_center|LOCUS_02960 335113 334427 gene locus_tag LOCUS_02970 335113 334427 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389529.1 protein_id gnl|my_center|LOCUS_02970 335419 335123 gene locus_tag LOCUS_02980 335419 335123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 337433 335406 gene locus_tag LOCUS_02990 337433 335406 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_02990 337562 337488 gene locus_tag LOCUS_t00100 337562 337488 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 338809 337682 gene locus_tag LOCUS_03000 338809 337682 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_03000 339826 338921 gene locus_tag LOCUS_03010 339826 338921 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222593.1 protein_id gnl|my_center|LOCUS_03010 340297 340222 gene locus_tag LOCUS_t00110 340297 340222 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 340419 340344 gene locus_tag LOCUS_t00120 340419 340344 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 340505 340430 gene locus_tag LOCUS_t00130 340505 340430 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 342342 340609 gene locus_tag LOCUS_03020 342342 340609 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_03020 343693 342632 gene locus_tag LOCUS_03030 gene ispG 343693 342632 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_03030 345127 343763 gene locus_tag LOCUS_03040 gene rseP 345127 343763 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565798.1 protein_id gnl|my_center|LOCUS_03040 346306 345140 gene locus_tag LOCUS_03050 346306 345140 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_03050 347181 346303 gene locus_tag LOCUS_03060 347181 346303 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392553.1 protein_id gnl|my_center|LOCUS_03060 348015 347221 gene locus_tag LOCUS_03070 348015 347221 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_03070 348548 348018 gene locus_tag LOCUS_03080 gene frr 348548 348018 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392549.1 protein_id gnl|my_center|LOCUS_03080 349274 348552 gene locus_tag LOCUS_03090 gene pyrH 349274 348552 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_03090 350264 349395 gene locus_tag LOCUS_03100 gene tsf 350264 349395 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_03100 351146 350373 gene locus_tag LOCUS_03110 gene rpsB 351146 350373 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268484.1 protein_id gnl|my_center|LOCUS_03110 352290 351334 gene locus_tag LOCUS_03120 gene xerD 352290 351334 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_03120 353659 352310 gene locus_tag LOCUS_03130 gene trmFO 353659 352310 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943183.1 protein_id gnl|my_center|LOCUS_03130 354614 353673 gene locus_tag LOCUS_03140 gene dprA 354614 353673 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082954.1 protein_id gnl|my_center|LOCUS_03140 356142 354607 gene locus_tag LOCUS_03150 356142 354607 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_03150 356672 356139 gene locus_tag LOCUS_03160 356672 356139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 357625 356840 gene locus_tag LOCUS_03170 357625 356840 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922313.1 protein_id gnl|my_center|LOCUS_03170 358047 357706 gene locus_tag LOCUS_03180 gene rplS 358047 357706 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_03180 360468 358210 gene locus_tag LOCUS_03190 gene pnp 360468 358210 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076690.1 protein_id gnl|my_center|LOCUS_03190 361940 361011 gene locus_tag LOCUS_03200 361940 361011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 362334 361942 gene locus_tag LOCUS_03210 362334 361942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 363721 362468 gene locus_tag LOCUS_03220 363721 362468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 364159 363779 gene locus_tag LOCUS_03230 364159 363779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 364337 364146 gene locus_tag LOCUS_03240 364337 364146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 366352 364355 gene locus_tag LOCUS_03250 366352 364355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 367158 366364 gene locus_tag LOCUS_03260 367158 366364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 370557 367159 gene locus_tag LOCUS_03270 370557 367159 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003271441.1 protein_id gnl|my_center|LOCUS_03270 370770 370579 gene locus_tag LOCUS_03280 370770 370579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 371318 370938 gene locus_tag LOCUS_03290 371318 370938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 372067 371447 gene locus_tag LOCUS_03300 372067 371447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 372513 372100 gene locus_tag LOCUS_03310 372513 372100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 372801 372514 gene locus_tag LOCUS_03320 372801 372514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 373163 372801 gene locus_tag LOCUS_03330 373163 372801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 373690 373160 gene locus_tag LOCUS_03340 373690 373160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 375040 373724 gene locus_tag LOCUS_03350 375040 373724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 375738 375052 gene locus_tag LOCUS_03360 375738 375052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 377068 375743 gene locus_tag LOCUS_03370 377068 375743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 378662 377079 gene locus_tag LOCUS_03380 378662 377079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 379000 378662 gene locus_tag LOCUS_03390 379000 378662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 379481 379170 gene locus_tag LOCUS_03400 379481 379170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 379951 379502 gene locus_tag LOCUS_03410 379951 379502 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_03410 382655 380346 gene locus_tag LOCUS_03420 382655 380346 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922066.1 protein_id gnl|my_center|LOCUS_03420 383674 382658 gene locus_tag LOCUS_03430 383674 382658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 383940 383680 gene locus_tag LOCUS_03440 383940 383680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 384241 383963 gene locus_tag LOCUS_03450 384241 383963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 384528 384208 gene locus_tag LOCUS_03460 384528 384208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 384808 384560 gene locus_tag LOCUS_03470 384808 384560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 385436 384978 gene locus_tag LOCUS_03480 gene dut 385436 384978 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942240.1 protein_id gnl|my_center|LOCUS_03480 385736 385437 gene locus_tag LOCUS_03490 385736 385437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 386084 385785 gene locus_tag LOCUS_03500 386084 385785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 386406 386077 gene locus_tag LOCUS_03510 386406 386077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 386759 386403 gene locus_tag LOCUS_03520 386759 386403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 386974 386756 gene locus_tag LOCUS_03530 386974 386756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 387186 386971 gene locus_tag LOCUS_03540 387186 386971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 387443 387186 gene locus_tag LOCUS_03550 387443 387186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 387838 387443 gene locus_tag LOCUS_03560 387838 387443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 388245 387835 gene locus_tag LOCUS_03570 388245 387835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 389854 388247 gene locus_tag LOCUS_03580 389854 388247 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_03580 390397 389858 gene locus_tag LOCUS_03590 390397 389858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 391462 390401 gene locus_tag LOCUS_03600 391462 390401 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_03600 392880 391462 gene locus_tag LOCUS_03610 392880 391462 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_03610 393217 392819 gene locus_tag LOCUS_03620 393217 392819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 393540 393334 gene locus_tag LOCUS_03630 393540 393334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 393699 393550 gene locus_tag LOCUS_03640 393699 393550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 394018 393689 gene locus_tag LOCUS_03650 394018 393689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 394995 394858 gene locus_tag LOCUS_03660 394995 394858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 395302 395129 gene locus_tag LOCUS_03670 395302 395129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 395550 395338 gene locus_tag LOCUS_03680 395550 395338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 395692 395925 gene locus_tag LOCUS_03690 395692 395925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 395928 396197 gene locus_tag LOCUS_03700 395928 396197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 396310 397437 gene locus_tag LOCUS_03710 396310 397437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 397794 397516 gene locus_tag LOCUS_03720 gene rpsO 397794 397516 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852579.1 protein_id gnl|my_center|LOCUS_03720 398723 397965 gene locus_tag LOCUS_03730 gene recO 398723 397965 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 protein_id gnl|my_center|LOCUS_03730 399814 398777 gene locus_tag LOCUS_03740 gene era 399814 398777 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831081.1 protein_id gnl|my_center|LOCUS_03740 400255 399878 gene locus_tag LOCUS_03750 400255 399878 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228397.1 protein_id gnl|my_center|LOCUS_03750 400807 400280 gene locus_tag LOCUS_03760 gene ybeY 400807 400280 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230039.1 protein_id gnl|my_center|LOCUS_03760 401769 400804 gene locus_tag LOCUS_03770 401769 400804 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775755.1 protein_id gnl|my_center|LOCUS_03770 403058 401790 gene locus_tag LOCUS_03780 gene mtaB 403058 401790 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_03780 404213 403068 gene locus_tag LOCUS_03790 gene dnaJ 404213 403068 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876908.1 protein_id gnl|my_center|LOCUS_03790 405482 404376 gene locus_tag LOCUS_03800 405482 404376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 406868 405660 gene locus_tag LOCUS_03810 gene hemW 406868 405660 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_03810 407910 406870 gene locus_tag LOCUS_03820 gene dusB 407910 406870 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_03820 409720 407903 gene locus_tag LOCUS_03830 gene lepA 409720 407903 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288355.1 protein_id gnl|my_center|LOCUS_03830 410182 409919 gene locus_tag LOCUS_03840 gene rpsT 410182 409919 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775769.1 protein_id gnl|my_center|LOCUS_03840 411315 410338 gene locus_tag LOCUS_03850 411315 410338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 413694 411373 gene locus_tag LOCUS_03860 413694 411373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 414395 413685 gene locus_tag LOCUS_03870 414395 413685 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836677.1 protein_id gnl|my_center|LOCUS_03870 415910 414663 gene locus_tag LOCUS_03880 gene thiI 415910 414663 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_03880 416198 415914 gene locus_tag LOCUS_03890 416198 415914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 416762 416202 gene locus_tag LOCUS_03900 gene gmk 416762 416202 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_03900 417077 416769 gene locus_tag LOCUS_03910 gene mihF 417077 416769 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_03910 418036 417305 gene locus_tag LOCUS_03920 gene pyrF 418036 417305 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_03920 418953 418030 gene locus_tag LOCUS_03930 418953 418030 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_03930 419747 418953 gene locus_tag LOCUS_03940 419747 418953 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_03940 421107 419815 gene locus_tag LOCUS_03950 421107 419815 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_03950 422035 421091 gene locus_tag LOCUS_03960 422035 421091 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_03960 422623 422039 gene locus_tag LOCUS_03970 gene pyrR 422623 422039 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_03970 422950 422669 gene locus_tag LOCUS_03980 422950 422669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 423654 423953 gene locus_tag LOCUS_03990 423654 423953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 424896 424627 gene locus_tag LOCUS_04000 424896 424627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 425288 425641 gene locus_tag LOCUS_04010 425288 425641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 426906 426475 gene locus_tag LOCUS_04020 426906 426475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 427286 426936 gene locus_tag LOCUS_04030 427286 426936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 428012 427335 gene locus_tag LOCUS_04040 428012 427335 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538625.1 protein_id gnl|my_center|LOCUS_04040 429156 427999 gene locus_tag LOCUS_04050 429156 427999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 430006 429296 gene locus_tag LOCUS_04060 430006 429296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 430674 430000 gene locus_tag LOCUS_04070 430674 430000 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_04070 431414 430701 gene locus_tag LOCUS_04080 431414 430701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 431767 431411 gene locus_tag LOCUS_04090 431767 431411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 431996 432175 gene locus_tag LOCUS_04100 431996 432175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 432185 432352 gene locus_tag LOCUS_04110 432185 432352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 432551 434074 gene locus_tag LOCUS_04120 432551 434074 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957284.1 protein_id gnl|my_center|LOCUS_04120 434067 435449 gene locus_tag LOCUS_04130 434067 435449 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_04130 435455 435856 gene locus_tag LOCUS_04140 435455 435856 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_04140 437007 435853 gene locus_tag LOCUS_04150 437007 435853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 438488 437139 gene locus_tag LOCUS_04160 438488 437139 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804613.1 protein_id gnl|my_center|LOCUS_04160 439089 438508 gene locus_tag LOCUS_04170 439089 438508 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393630.1 protein_id gnl|my_center|LOCUS_04170 441824 439119 gene locus_tag LOCUS_04180 441824 439119 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_04180 443542 441986 gene locus_tag LOCUS_04190 gene clpX 443542 441986 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028457.1 protein_id gnl|my_center|LOCUS_04190 444169 443546 gene locus_tag LOCUS_04200 gene clpP 444169 443546 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564255.1 protein_id gnl|my_center|LOCUS_04200 445611 444304 gene locus_tag LOCUS_04210 gene tig 445611 444304 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567596.1 protein_id gnl|my_center|LOCUS_04210 445769 445686 gene locus_tag LOCUS_t00140 445769 445686 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 448612 445985 gene locus_tag LOCUS_04220 448612 445985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 450275 448920 gene locus_tag LOCUS_04230 gene gdhA 450275 448920 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_04230 450663 451922 gene locus_tag LOCUS_04240 450663 451922 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_04240 452970 452035 gene locus_tag LOCUS_04250 452970 452035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 453305 453063 gene locus_tag LOCUS_04260 453305 453063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 453767 453318 gene locus_tag LOCUS_04270 453767 453318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 453935 454138 gene locus_tag LOCUS_04280 453935 454138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 455509 454475 gene locus_tag LOCUS_04290 455509 454475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 455739 455509 gene locus_tag LOCUS_04300 455739 455509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 456720 455752 gene locus_tag LOCUS_04310 456720 455752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 457550 456705 gene locus_tag LOCUS_04320 457550 456705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 459834 457543 gene locus_tag LOCUS_04330 459834 457543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922453.1 protein_id gnl|my_center|LOCUS_04330 460163 459834 gene locus_tag LOCUS_04340 460163 459834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 460468 460178 gene locus_tag LOCUS_04350 460468 460178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 461037 460471 gene locus_tag LOCUS_04360 461037 460471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 461332 461045 gene locus_tag LOCUS_04370 461332 461045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 461697 461329 gene locus_tag LOCUS_04380 461697 461329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 461870 461700 gene locus_tag LOCUS_04390 461870 461700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 462766 461873 gene locus_tag LOCUS_04400 462766 461873 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841023.1 protein_id gnl|my_center|LOCUS_04400 463242 462802 gene locus_tag LOCUS_04410 463242 462802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 463428 463355 gene locus_tag LOCUS_t00150 463428 463355 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 464785 463484 gene locus_tag LOCUS_04420 464785 463484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 466281 464782 gene locus_tag LOCUS_04430 466281 464782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 467651 466278 gene locus_tag LOCUS_04440 467651 466278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 468132 467686 gene locus_tag LOCUS_04450 468132 467686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 468535 468239 gene locus_tag LOCUS_04460 468535 468239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 468735 468532 gene locus_tag LOCUS_04470 468735 468532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 469523 469077 gene locus_tag LOCUS_04480 469523 469077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 469749 469579 gene locus_tag LOCUS_04490 469749 469579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 470297 469836 gene locus_tag LOCUS_04500 470297 469836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 471676 470414 gene locus_tag LOCUS_04510 471676 470414 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_04510 472139 471837 gene locus_tag LOCUS_04520 472139 471837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 472366 472187 gene locus_tag LOCUS_04530 472366 472187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 472629 472363 gene locus_tag LOCUS_04540 472629 472363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 472937 472626 gene locus_tag LOCUS_04550 472937 472626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 473173 472934 gene locus_tag LOCUS_04560 473173 472934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 473439 473173 gene locus_tag LOCUS_04570 473439 473173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 474337 473573 gene locus_tag LOCUS_04580 474337 473573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 474780 474346 gene locus_tag LOCUS_04590 474780 474346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 475173 474895 gene locus_tag LOCUS_04600 475173 474895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 475973 475173 gene locus_tag LOCUS_04610 475973 475173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 476296 475976 gene locus_tag LOCUS_04620 476296 475976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 476491 476306 gene locus_tag LOCUS_04630 476491 476306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 476625 476550 gene locus_tag LOCUS_t00160 476625 476550 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 477055 476819 gene locus_tag LOCUS_04640 477055 476819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 477791 477126 gene locus_tag LOCUS_04650 477791 477126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 478112 477792 gene locus_tag LOCUS_04660 478112 477792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 478356 478144 gene locus_tag LOCUS_04670 478356 478144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 478472 479101 gene locus_tag LOCUS_04680 478472 479101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 479226 480236 gene locus_tag LOCUS_04690 479226 480236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 480399 480614 gene locus_tag LOCUS_04700 480399 480614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 480845 480772 gene locus_tag LOCUS_t00170 480845 480772 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 480927 480851 gene locus_tag LOCUS_t00180 480927 480851 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 482108 481029 gene locus_tag LOCUS_04710 482108 481029 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_04710 483656 482112 gene locus_tag LOCUS_04720 483656 482112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 484630 483758 gene locus_tag LOCUS_04730 gene modA 484630 483758 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949046.1 protein_id gnl|my_center|LOCUS_04730 485452 484769 gene locus_tag LOCUS_04740 485452 484769 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356156.1 protein_id gnl|my_center|LOCUS_04740 486659 485457 gene locus_tag LOCUS_04750 486659 485457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 487353 486886 gene locus_tag LOCUS_04760 487353 486886 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_04760 488663 487404 gene locus_tag LOCUS_04770 488663 487404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 488835 490199 gene locus_tag LOCUS_04780 488835 490199 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205413.1 protein_id gnl|my_center|LOCUS_04780 490526 491476 gene locus_tag LOCUS_04790 490526 491476 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_04790 492838 491504 gene locus_tag LOCUS_04800 492838 491504 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_04800 494128 492881 gene locus_tag LOCUS_04810 494128 492881 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_04810 494752 494180 gene locus_tag LOCUS_04820 494752 494180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 495174 494695 gene locus_tag LOCUS_04830 495174 494695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 496827 495412 gene locus_tag LOCUS_04840 496827 495412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 496966 497313 gene locus_tag LOCUS_04850 496966 497313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 498624 497350 gene locus_tag LOCUS_04860 498624 497350 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_04860 499799 498789 gene locus_tag LOCUS_04870 499799 498789 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_04870 500465 499854 gene locus_tag LOCUS_04880 500465 499854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 501611 500607 gene locus_tag LOCUS_04890 501611 500607 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966891.1 protein_id gnl|my_center|LOCUS_04890 502740 501589 gene locus_tag LOCUS_04900 502740 501589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966892.1 protein_id gnl|my_center|LOCUS_04900 503730 502744 gene locus_tag LOCUS_04910 503730 502744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048146.1 protein_id gnl|my_center|LOCUS_04910 504688 503744 gene locus_tag LOCUS_04920 504688 503744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566243.1 protein_id gnl|my_center|LOCUS_04920 506630 504885 gene locus_tag LOCUS_04930 506630 504885 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595071.1 protein_id gnl|my_center|LOCUS_04930 509628 506845 gene locus_tag LOCUS_04940 gene ileS 509628 506845 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939213.1 protein_id gnl|my_center|LOCUS_04940 510412 509936 gene locus_tag LOCUS_04950 510412 509936 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809665.1 protein_id gnl|my_center|LOCUS_04950 511294 510458 gene locus_tag LOCUS_04960 511294 510458 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_04960 513310 511373 gene locus_tag LOCUS_04970 gene ftsH 513310 511373 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_04970 513674 514144 gene locus_tag LOCUS_04980 513674 514144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 515055 514120 gene locus_tag LOCUS_04990 515055 514120 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 protein_id gnl|my_center|LOCUS_04990 515649 515065 gene locus_tag LOCUS_05000 515649 515065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 516195 515683 gene locus_tag LOCUS_05010 516195 515683 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_05010 517104 516256 gene locus_tag LOCUS_05020 517104 516256 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_05020 518341 517379 gene locus_tag LOCUS_05030 518341 517379 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143212.1 protein_id gnl|my_center|LOCUS_05030 520113 518614 gene locus_tag LOCUS_05040 gene ffh 520113 518614 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_05040 521234 520323 gene locus_tag LOCUS_05050 521234 520323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 524831 521298 gene locus_tag LOCUS_05060 gene smc 524831 521298 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728333.1 protein_id gnl|my_center|LOCUS_05060 525560 524835 gene locus_tag LOCUS_05070 gene rnc 525560 524835 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087822.1 protein_id gnl|my_center|LOCUS_05070 525809 525567 gene locus_tag LOCUS_05080 gene acpP 525809 525567 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547899.1 protein_id gnl|my_center|LOCUS_05080 526916 525885 gene locus_tag LOCUS_05090 gene plsX 526916 525885 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387382.1 protein_id gnl|my_center|LOCUS_05090 527201 527022 gene locus_tag LOCUS_05100 gene rpmF 527201 527022 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082761.1 protein_id gnl|my_center|LOCUS_05100 527456 527827 gene locus_tag LOCUS_05110 527456 527827 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813907.1 protein_id gnl|my_center|LOCUS_05110 527878 528117 gene locus_tag LOCUS_05120 527878 528117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 528165 529265 gene locus_tag LOCUS_05130 528165 529265 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_05130 529277 529459 gene locus_tag LOCUS_05140 529277 529459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015423.1 protein_id gnl|my_center|LOCUS_05140 529512 529991 gene locus_tag LOCUS_05150 gene rlmH 529512 529991 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027000.1 protein_id gnl|my_center|LOCUS_05150 530014 530460 gene locus_tag LOCUS_05160 530014 530460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 530470 531651 gene locus_tag LOCUS_05170 530470 531651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 531742 532041 gene locus_tag LOCUS_05180 531742 532041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 532277 534775 gene locus_tag LOCUS_05190 532277 534775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 535179 534979 gene locus_tag LOCUS_05200 535179 534979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 535114 535476 gene locus_tag LOCUS_05210 535114 535476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 536425 535502 gene locus_tag LOCUS_05220 536425 535502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_05220 537267 536464 gene locus_tag LOCUS_05230 537267 536464 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_05230 538010 537369 gene locus_tag LOCUS_05240 538010 537369 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 protein_id gnl|my_center|LOCUS_05240 538221 538559 gene locus_tag LOCUS_05250 538221 538559 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_05250 538696 538529 gene locus_tag LOCUS_05260 538696 538529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05260 540356 539124 gene locus_tag LOCUS_05270 540356 539124 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019197495.1 protein_id gnl|my_center|LOCUS_05270 540655 540356 gene locus_tag LOCUS_05280 540655 540356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 541379 541924 gene locus_tag LOCUS_05290 541379 541924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 542186 541872 gene locus_tag LOCUS_05300 542186 541872 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836781.1 protein_id gnl|my_center|LOCUS_05300 543489 542488 gene locus_tag LOCUS_05310 543489 542488 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 protein_id gnl|my_center|LOCUS_05310 543783 543959 gene locus_tag LOCUS_05320 543783 543959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 544029 545450 gene locus_tag LOCUS_05330 gene lacG 544029 545450 CDS product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027020.1 protein_id gnl|my_center|LOCUS_05330 547551 545857 gene locus_tag LOCUS_05340 547551 545857 CDS product PTS lactose transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288634.1 protein_id gnl|my_center|LOCUS_05340 547907 548827 gene locus_tag LOCUS_05350 547907 548827 CDS product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298736.1 protein_id gnl|my_center|LOCUS_05350 548901 549620 gene locus_tag LOCUS_05360 548901 549620 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437811.1 protein_id gnl|my_center|LOCUS_05360 550075 549842 gene locus_tag LOCUS_05370 550075 549842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 550074 550394 gene locus_tag LOCUS_05380 550074 550394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 556302 550321 gene locus_tag LOCUS_05390 556302 550321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 558681 556348 gene locus_tag LOCUS_05400 558681 556348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 559450 558851 gene locus_tag LOCUS_05410 559450 558851 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068494.1 protein_id gnl|my_center|LOCUS_05410 559763 560485 gene locus_tag LOCUS_05420 559763 560485 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906362.1 protein_id gnl|my_center|LOCUS_05420 561733 560684 gene locus_tag LOCUS_05430 561733 560684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 562381 561809 gene locus_tag LOCUS_05440 562381 561809 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728328.1 protein_id gnl|my_center|LOCUS_05440 562884 562381 gene locus_tag LOCUS_05450 562884 562381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 563435 562944 gene locus_tag LOCUS_05460 gene coaD 563435 562944 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_05460 564088 563507 gene locus_tag LOCUS_05470 gene rsmD 564088 563507 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918116.1 protein_id gnl|my_center|LOCUS_05470 566268 564085 gene locus_tag LOCUS_05480 gene recG 566268 564085 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_05480 567951 566284 gene locus_tag LOCUS_05490 567951 566284 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001868429.1 protein_id gnl|my_center|LOCUS_05490 568355 568002 gene locus_tag LOCUS_05500 568355 568002 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171418.1 protein_id gnl|my_center|LOCUS_05500 568922 568482 gene locus_tag LOCUS_05510 568922 568482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 569781 568966 gene locus_tag LOCUS_05520 569781 568966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933420.1 protein_id gnl|my_center|LOCUS_05520 570878 569781 gene locus_tag LOCUS_05530 570878 569781 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965290.1 protein_id gnl|my_center|LOCUS_05530 572230 570899 gene locus_tag LOCUS_05540 572230 570899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 573500 572319 gene locus_tag LOCUS_05550 573500 572319 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279122.1 protein_id gnl|my_center|LOCUS_05550 574351 573716 gene locus_tag LOCUS_05560 574351 573716 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 protein_id gnl|my_center|LOCUS_05560 575269 574835 gene locus_tag LOCUS_05570 575269 574835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 576116 575493 gene locus_tag LOCUS_05580 576116 575493 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068188.1 protein_id gnl|my_center|LOCUS_05580 577207 576158 gene locus_tag LOCUS_05590 577207 576158 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_05590 578082 577396 gene locus_tag LOCUS_05600 578082 577396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 578397 578134 gene locus_tag LOCUS_05610 578397 578134 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 protein_id gnl|my_center|LOCUS_05610 579147 578413 gene locus_tag LOCUS_05620 579147 578413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 579975 579217 gene locus_tag LOCUS_05630 579975 579217 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_05630 580882 580085 gene locus_tag LOCUS_05640 gene pgeF 580882 580085 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_05640 582183 581026 gene locus_tag LOCUS_05650 gene ftsZ 582183 581026 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_05650 583741 582440 gene locus_tag LOCUS_05660 583741 582440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 584609 583698 gene locus_tag LOCUS_05670 gene murB 584609 583698 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_05670 586037 584616 gene locus_tag LOCUS_05680 gene murC 586037 584616 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939773.1 protein_id gnl|my_center|LOCUS_05680 588490 586634 gene locus_tag LOCUS_05690 588490 586634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_05690 590831 588492 gene locus_tag LOCUS_05700 590831 588492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_05700 591343 590828 gene locus_tag LOCUS_05710 591343 590828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 593052 591472 gene locus_tag LOCUS_05720 593052 591472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 593434 593246 gene locus_tag LOCUS_05730 gene rpmB 593434 593246 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056915.1 protein_id gnl|my_center|LOCUS_05730 595074 593569 gene locus_tag LOCUS_05740 595074 593569 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389978.1 protein_id gnl|my_center|LOCUS_05740 596138 595377 gene locus_tag LOCUS_05750 596138 595377 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242836.1 protein_id gnl|my_center|LOCUS_05750 598851 596209 gene locus_tag LOCUS_05760 gene adhE 598851 596209 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_05760 600092 599442 gene locus_tag LOCUS_05770 600092 599442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 600812 600096 gene locus_tag LOCUS_05780 600812 600096 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056362.1 protein_id gnl|my_center|LOCUS_05780 601194 603419 gene locus_tag LOCUS_05790 gene glgB 601194 603419 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272358.1 protein_id gnl|my_center|LOCUS_05790 603506 605932 gene locus_tag LOCUS_05800 603506 605932 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272357.1 protein_id gnl|my_center|LOCUS_05800 606065 607156 gene locus_tag LOCUS_05810 gene glgC 606065 607156 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_05810 607161 608279 gene locus_tag LOCUS_05820 gene glgD 607161 608279 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_05820 608367 610778 gene locus_tag LOCUS_05830 608367 610778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 612248 611103 gene locus_tag LOCUS_05840 gene murG 612248 611103 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_05840 613908 612232 gene locus_tag LOCUS_05850 613908 612232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 615295 613895 gene locus_tag LOCUS_05860 gene murD 615295 613895 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_05860 616336 615302 gene locus_tag LOCUS_05870 gene mraY 616336 615302 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817007.1 protein_id gnl|my_center|LOCUS_05870 617775 616333 gene locus_tag LOCUS_05880 617775 616333 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457113.1 protein_id gnl|my_center|LOCUS_05880 619767 617935 gene locus_tag LOCUS_05890 619767 617935 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_05890 620309 619773 gene locus_tag LOCUS_05900 620309 619773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 621354 620344 gene locus_tag LOCUS_05910 gene rsmH 621354 620344 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_05910 621803 621372 gene locus_tag LOCUS_05920 gene mraZ 621803 621372 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874670.1 protein_id gnl|my_center|LOCUS_05920 623163 622222 gene locus_tag LOCUS_05930 gene xerD 623163 622222 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068014.1 protein_id gnl|my_center|LOCUS_05930 623813 623364 gene locus_tag LOCUS_05940 623813 623364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 626318 624657 gene locus_tag LOCUS_05950 626318 624657 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_05950 627299 626673 gene locus_tag LOCUS_05960 627299 626673 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272311.1 protein_id gnl|my_center|LOCUS_05960 628359 627289 gene locus_tag LOCUS_05970 628359 627289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459690.1 protein_id gnl|my_center|LOCUS_05970 629290 628373 gene locus_tag LOCUS_05980 629290 628373 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461187.1 protein_id gnl|my_center|LOCUS_05980 630402 629287 gene locus_tag LOCUS_05990 630402 629287 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461571.1 protein_id gnl|my_center|LOCUS_05990 632052 630406 gene locus_tag LOCUS_06000 632052 630406 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461189.1 protein_id gnl|my_center|LOCUS_06000 633643 632222 gene locus_tag LOCUS_06010 633643 632222 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_06010 635118 633769 gene locus_tag LOCUS_06020 635118 633769 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 protein_id gnl|my_center|LOCUS_06020 636444 635512 gene locus_tag LOCUS_06030 636444 635512 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891391.1 protein_id gnl|my_center|LOCUS_06030 637430 636507 gene locus_tag LOCUS_06040 637430 636507 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891391.1 protein_id gnl|my_center|LOCUS_06040 639227 637524 gene locus_tag LOCUS_06050 gene ptsP 639227 637524 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475729.1 protein_id gnl|my_center|LOCUS_06050 639611 639348 gene locus_tag LOCUS_06060 639611 639348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 641891 639864 gene locus_tag LOCUS_06070 641891 639864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 642158 642082 gene locus_tag LOCUS_t00190 642158 642082 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 642461 642204 gene locus_tag LOCUS_06080 642461 642204 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667146.1 protein_id gnl|my_center|LOCUS_06080 645963 642568 gene locus_tag LOCUS_06090 645963 642568 CDS product bifunctional glycogen debranching protein GlgX/4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460009.1 protein_id gnl|my_center|LOCUS_06090 647642 646068 gene locus_tag LOCUS_06100 647642 646068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 648565 647639 gene locus_tag LOCUS_06110 gene fmt 648565 647639 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285161.1 protein_id gnl|my_center|LOCUS_06110 649132 648596 gene locus_tag LOCUS_06120 gene def 649132 648596 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114101.1 protein_id gnl|my_center|LOCUS_06120 651634 649181 gene locus_tag LOCUS_06130 gene priA 651634 649181 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_06130 653479 651755 gene locus_tag LOCUS_06140 653479 651755 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_06140 653612 654439 gene locus_tag LOCUS_06150 653612 654439 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence2 548 189 gene locus_tag LOCUS_06160 gene rplT 548 189 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005058700.1 protein_id gnl|my_center|LOCUS_06160 791 594 gene locus_tag LOCUS_06170 gene rpmI 791 594 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895238.1 protein_id gnl|my_center|LOCUS_06170 1214 816 gene locus_tag LOCUS_06180 1214 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1730 1645 gene locus_tag LOCUS_t00200 1730 1645 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3151 1793 gene locus_tag LOCUS_06190 3151 1793 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_06190 3574 3167 gene locus_tag LOCUS_06200 3574 3167 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814175.1 protein_id gnl|my_center|LOCUS_06200 4669 3638 gene locus_tag LOCUS_06210 4669 3638 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_06210 5496 4813 gene locus_tag LOCUS_06220 5496 4813 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_06220 7956 5548 gene locus_tag LOCUS_06230 7956 5548 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_06230 11286 7969 gene locus_tag LOCUS_06240 11286 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 11515 12498 gene locus_tag LOCUS_06250 11515 12498 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886390.1 protein_id gnl|my_center|LOCUS_06250 12474 13319 gene locus_tag LOCUS_06260 12474 13319 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172331.1 protein_id gnl|my_center|LOCUS_06260 13291 14082 gene locus_tag LOCUS_06270 13291 14082 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703308.1 protein_id gnl|my_center|LOCUS_06270 15156 14503 gene locus_tag LOCUS_06280 gene upp 15156 14503 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564957.1 protein_id gnl|my_center|LOCUS_06280 15591 15166 gene locus_tag LOCUS_06290 15591 15166 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_06290 15698 16468 gene locus_tag LOCUS_06300 15698 16468 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_06300 16579 16764 gene locus_tag LOCUS_06310 16579 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 17052 17327 gene locus_tag LOCUS_06320 17052 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 18060 17575 gene locus_tag LOCUS_06330 18060 17575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 18570 18076 gene locus_tag LOCUS_06340 18570 18076 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_06340 19146 18589 gene locus_tag LOCUS_06350 gene folE 19146 18589 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896758.1 protein_id gnl|my_center|LOCUS_06350 19765 19205 gene locus_tag LOCUS_06360 gene nrdG 19765 19205 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148220968.1 protein_id gnl|my_center|LOCUS_06360 22000 19775 gene locus_tag LOCUS_06370 gene nrdD 22000 19775 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_06370 22581 22507 gene locus_tag LOCUS_t00210 22581 22507 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22961 23036 gene locus_tag LOCUS_t00220 22961 23036 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23084 23157 gene locus_tag LOCUS_t00230 23084 23157 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 24042 23251 gene locus_tag LOCUS_06380 24042 23251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065769.1 protein_id gnl|my_center|LOCUS_06380 25345 24125 gene locus_tag LOCUS_06390 gene ilvA 25345 24125 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_06390 26553 25558 gene locus_tag LOCUS_06400 gene ilvC 26553 25558 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932303.1 protein_id gnl|my_center|LOCUS_06400 27114 26629 gene locus_tag LOCUS_06410 gene ilvN 27114 26629 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_06410 28993 27116 gene locus_tag LOCUS_06420 28993 27116 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_06420 30657 28993 gene locus_tag LOCUS_06430 gene ilvD 30657 28993 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_06430 31915 31034 gene locus_tag LOCUS_06440 gene thrB 31915 31034 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674786.1 protein_id gnl|my_center|LOCUS_06440 33571 32060 gene locus_tag LOCUS_06450 gene thrC 33571 32060 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068263.1 protein_id gnl|my_center|LOCUS_06450 33669 35078 gene locus_tag LOCUS_06460 33669 35078 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_06460 35134 36162 gene locus_tag LOCUS_06470 35134 36162 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_06470 37029 36220 gene locus_tag LOCUS_06480 37029 36220 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566975.1 protein_id gnl|my_center|LOCUS_06480 38607 37204 gene locus_tag LOCUS_06490 gene asnS 38607 37204 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432161.1 protein_id gnl|my_center|LOCUS_06490 40107 38824 gene locus_tag LOCUS_06500 40107 38824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 41909 40239 gene locus_tag LOCUS_06510 41909 40239 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_06510 45141 42046 gene locus_tag LOCUS_06520 45141 42046 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137656664.1 protein_id gnl|my_center|LOCUS_06520 46676 45225 gene locus_tag LOCUS_06530 46676 45225 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812813.1 protein_id gnl|my_center|LOCUS_06530 47085 46900 gene locus_tag LOCUS_06540 47085 46900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 48131 47487 gene locus_tag LOCUS_06550 48131 47487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 48971 48141 gene locus_tag LOCUS_06560 48971 48141 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390021.1 protein_id gnl|my_center|LOCUS_06560 50242 48968 gene locus_tag LOCUS_06570 50242 48968 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_06570 51409 50423 gene locus_tag LOCUS_06580 51409 50423 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_06580 52980 51412 gene locus_tag LOCUS_06590 52980 51412 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389437.1 protein_id gnl|my_center|LOCUS_06590 54454 53129 gene locus_tag LOCUS_06600 54454 53129 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966853.1 protein_id gnl|my_center|LOCUS_06600 55331 54474 gene locus_tag LOCUS_06610 55331 54474 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_06610 56501 55455 gene locus_tag LOCUS_06620 56501 55455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 57013 56498 gene locus_tag LOCUS_06630 57013 56498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 58086 57151 gene locus_tag LOCUS_06640 58086 57151 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_06640 58347 58147 gene locus_tag LOCUS_06650 58347 58147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 58841 58344 gene locus_tag LOCUS_06660 58841 58344 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_06660 58959 59537 gene locus_tag LOCUS_06670 58959 59537 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_06670 59664 60743 gene locus_tag LOCUS_06680 59664 60743 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_06680 62482 61097 gene locus_tag LOCUS_06690 62482 61097 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_06690 64353 62593 gene locus_tag LOCUS_06700 64353 62593 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890790.1 protein_id gnl|my_center|LOCUS_06700 65466 64516 gene locus_tag LOCUS_06710 65466 64516 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_06710 66929 65637 gene locus_tag LOCUS_06720 66929 65637 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461387.1 protein_id gnl|my_center|LOCUS_06720 68268 67024 gene locus_tag LOCUS_06730 68268 67024 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861827.1 protein_id gnl|my_center|LOCUS_06730 69834 68491 gene locus_tag LOCUS_06740 69834 68491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 70460 69831 gene locus_tag LOCUS_06750 70460 69831 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_06750 71181 70882 gene locus_tag LOCUS_06760 71181 70882 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869726.1 protein_id gnl|my_center|LOCUS_06760 72468 71428 gene locus_tag LOCUS_06770 72468 71428 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_06770 72565 72930 gene locus_tag LOCUS_06780 72565 72930 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053231.1 protein_id gnl|my_center|LOCUS_06780 73364 72945 gene locus_tag LOCUS_06790 73364 72945 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056959.1 protein_id gnl|my_center|LOCUS_06790 73610 74170 gene locus_tag LOCUS_06800 73610 74170 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_06800 75229 74267 gene locus_tag LOCUS_06810 75229 74267 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101815.1 protein_id gnl|my_center|LOCUS_06810 76267 75464 gene locus_tag LOCUS_06820 76267 75464 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102282.1 protein_id gnl|my_center|LOCUS_06820 77417 76581 gene locus_tag LOCUS_06830 77417 76581 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965071.1 protein_id gnl|my_center|LOCUS_06830 79108 77528 gene locus_tag LOCUS_06840 79108 77528 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002646.1 protein_id gnl|my_center|LOCUS_06840 79947 79264 gene locus_tag LOCUS_06850 79947 79264 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689730.1 protein_id gnl|my_center|LOCUS_06850 80555 80100 gene locus_tag LOCUS_06860 80555 80100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 80784 80975 gene locus_tag LOCUS_06870 80784 80975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 82016 81237 gene locus_tag LOCUS_06880 82016 81237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 82705 82010 gene locus_tag LOCUS_06890 82705 82010 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262157.1 protein_id gnl|my_center|LOCUS_06890 83076 82705 gene locus_tag LOCUS_06900 gene stsR 83076 82705 CDS product GntR family transcriptional regulator StsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262158.1 protein_id gnl|my_center|LOCUS_06900 83477 83764 gene locus_tag LOCUS_06910 83477 83764 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265672.1 protein_id gnl|my_center|LOCUS_06910 83748 84032 gene locus_tag LOCUS_06920 83748 84032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 84614 84982 gene locus_tag LOCUS_06930 84614 84982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 85382 85528 gene locus_tag LOCUS_06940 85382 85528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 86895 85630 gene locus_tag LOCUS_06950 86895 85630 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668780.1 protein_id gnl|my_center|LOCUS_06950 88277 87321 gene locus_tag LOCUS_06960 88277 87321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 88401 88267 gene locus_tag LOCUS_06970 88401 88267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 88621 88394 gene locus_tag LOCUS_06980 88621 88394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 88839 88675 gene locus_tag LOCUS_06990 88839 88675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 89081 89401 gene locus_tag LOCUS_07000 89081 89401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 89413 90000 gene locus_tag LOCUS_07010 89413 90000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 90148 90798 gene locus_tag LOCUS_07020 90148 90798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 90799 91290 gene locus_tag LOCUS_07030 90799 91290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 91287 91616 gene locus_tag LOCUS_07040 91287 91616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 93145 91769 gene locus_tag LOCUS_07050 93145 91769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 93624 93145 gene locus_tag LOCUS_07060 93624 93145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 93614 93994 gene locus_tag LOCUS_07070 93614 93994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 93997 95289 gene locus_tag LOCUS_07080 93997 95289 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_07080 96064 95825 gene locus_tag LOCUS_07090 96064 95825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 96097 96276 gene locus_tag LOCUS_07100 96097 96276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 97244 96405 gene locus_tag LOCUS_07110 97244 96405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 97576 97241 gene locus_tag LOCUS_07120 97576 97241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 97905 97723 gene locus_tag LOCUS_07130 97905 97723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 99064 97928 gene locus_tag LOCUS_07140 99064 97928 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263163.1 protein_id gnl|my_center|LOCUS_07140 99194 99757 gene locus_tag LOCUS_07150 99194 99757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 100134 100053 gene locus_tag LOCUS_t00240 100134 100053 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 101919 100633 gene locus_tag LOCUS_07160 101919 100633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 102599 101916 gene locus_tag LOCUS_07170 102599 101916 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_07170 102761 103900 gene locus_tag LOCUS_07180 102761 103900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07180 103902 104708 gene locus_tag LOCUS_07190 103902 104708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_07190 104705 105913 gene locus_tag LOCUS_07200 104705 105913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812525.1 protein_id gnl|my_center|LOCUS_07200 106000 106254 gene locus_tag LOCUS_07210 106000 106254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 108028 106745 gene locus_tag LOCUS_07220 108028 106745 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_07220 108341 109072 gene locus_tag LOCUS_07230 108341 109072 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975187.1 protein_id gnl|my_center|LOCUS_07230 109065 110474 gene locus_tag LOCUS_07240 109065 110474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 110552 110863 gene locus_tag LOCUS_07250 110552 110863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 110931 111794 gene locus_tag LOCUS_07260 110931 111794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 111791 112483 gene locus_tag LOCUS_07270 111791 112483 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_07270 113391 112669 gene locus_tag LOCUS_07280 113391 112669 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975298.1 protein_id gnl|my_center|LOCUS_07280 114541 113378 gene locus_tag LOCUS_07290 114541 113378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 114462 114779 gene locus_tag LOCUS_07300 114462 114779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 115450 114710 gene locus_tag LOCUS_07310 115450 114710 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460545.1 protein_id gnl|my_center|LOCUS_07310 116251 115463 gene locus_tag LOCUS_07320 116251 115463 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272457.1 protein_id gnl|my_center|LOCUS_07320 117388 116411 gene locus_tag LOCUS_07330 117388 116411 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460543.1 protein_id gnl|my_center|LOCUS_07330 117814 118137 gene locus_tag LOCUS_07340 117814 118137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 118625 118329 gene locus_tag LOCUS_07350 118625 118329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 118879 118628 gene locus_tag LOCUS_07360 118879 118628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 120065 119055 gene locus_tag LOCUS_07370 120065 119055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 120748 120062 gene locus_tag LOCUS_07380 120748 120062 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405372.1 protein_id gnl|my_center|LOCUS_07380 121700 120861 gene locus_tag LOCUS_07390 121700 120861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 122533 121700 gene locus_tag LOCUS_07400 122533 121700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 123255 122530 gene locus_tag LOCUS_07410 123255 122530 CDS product lantibiotic protection ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261887.1 protein_id gnl|my_center|LOCUS_07410 124405 123449 gene locus_tag LOCUS_07420 gene bsh 124405 123449 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389832.1 protein_id gnl|my_center|LOCUS_07420 125792 124644 gene locus_tag LOCUS_07430 125792 124644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 126463 125789 gene locus_tag LOCUS_07440 126463 125789 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_07440 126580 127698 gene locus_tag LOCUS_07450 gene msrB 126580 127698 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108316.1 protein_id gnl|my_center|LOCUS_07450 127746 127892 gene locus_tag LOCUS_07460 127746 127892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 127885 128790 gene locus_tag LOCUS_07470 127885 128790 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_07470 128840 129811 gene locus_tag LOCUS_07480 128840 129811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 130232 130062 gene locus_tag LOCUS_07490 130232 130062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 130606 131223 gene locus_tag LOCUS_07500 130606 131223 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402394.1 protein_id gnl|my_center|LOCUS_07500 131368 133032 gene locus_tag LOCUS_07510 131368 133032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 133090 134472 gene locus_tag LOCUS_07520 133090 134472 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868417.1 protein_id gnl|my_center|LOCUS_07520 134530 134727 gene locus_tag LOCUS_07530 134530 134727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 134836 136080 gene locus_tag LOCUS_07540 134836 136080 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_07540 137339 136620 gene locus_tag LOCUS_07550 137339 136620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 138244 137339 gene locus_tag LOCUS_07560 138244 137339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897173.1 protein_id gnl|my_center|LOCUS_07560 138652 138284 gene locus_tag LOCUS_07570 138652 138284 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_07570 138956 139123 gene locus_tag LOCUS_07580 138956 139123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 139309 139521 gene locus_tag LOCUS_07590 139309 139521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 140532 139633 gene locus_tag LOCUS_07600 140532 139633 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966723.1 protein_id gnl|my_center|LOCUS_07600 141513 140743 gene locus_tag LOCUS_07610 gene fecE 141513 140743 CDS product Fe(3+) dicitrate ABC transporter ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477430.1 protein_id gnl|my_center|LOCUS_07610 142516 141500 gene locus_tag LOCUS_07620 142516 141500 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018304962.1 protein_id gnl|my_center|LOCUS_07620 143542 142526 gene locus_tag LOCUS_07630 143542 142526 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723333.1 protein_id gnl|my_center|LOCUS_07630 144591 143590 gene locus_tag LOCUS_07640 gene nirJ2 144591 143590 CDS product putative heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460177.1 protein_id gnl|my_center|LOCUS_07640 145470 144694 gene locus_tag LOCUS_07650 145470 144694 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459537.1 protein_id gnl|my_center|LOCUS_07650 146315 146833 gene locus_tag LOCUS_07660 146315 146833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 146959 147531 gene locus_tag LOCUS_07670 146959 147531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 147548 149590 gene locus_tag LOCUS_07680 147548 149590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 150291 150827 gene locus_tag LOCUS_07690 150291 150827 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_07690 150820 151605 gene locus_tag LOCUS_07700 150820 151605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 151654 152601 gene locus_tag LOCUS_07710 151654 152601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_07710 152594 153847 gene locus_tag LOCUS_07720 152594 153847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 155024 154389 gene locus_tag LOCUS_07730 155024 154389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 155297 155524 gene locus_tag LOCUS_07740 155297 155524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 156380 155556 gene locus_tag LOCUS_07750 156380 155556 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_07750 157829 156819 gene locus_tag LOCUS_07760 157829 156819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 158007 159827 gene locus_tag LOCUS_07770 158007 159827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461147.1 protein_id gnl|my_center|LOCUS_07770 159828 161561 gene locus_tag LOCUS_07780 159828 161561 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772887.1 protein_id gnl|my_center|LOCUS_07780 162490 162158 gene locus_tag LOCUS_07790 162490 162158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 162450 163400 gene locus_tag LOCUS_07800 gene bsh 162450 163400 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052221.1 protein_id gnl|my_center|LOCUS_07800 165967 163499 gene locus_tag LOCUS_07810 165967 163499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 166451 166314 gene locus_tag LOCUS_07820 166451 166314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 166627 166469 gene locus_tag LOCUS_07830 166627 166469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 167346 166642 gene locus_tag LOCUS_07840 167346 166642 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289461.1 protein_id gnl|my_center|LOCUS_07840 168445 167519 gene locus_tag LOCUS_07850 168445 167519 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133037023.1 protein_id gnl|my_center|LOCUS_07850 169224 168433 gene locus_tag LOCUS_07860 169224 168433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 169620 170354 gene locus_tag LOCUS_07870 169620 170354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 170390 170725 gene locus_tag LOCUS_07880 170390 170725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 171326 170742 gene locus_tag LOCUS_07890 171326 170742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 173103 171355 gene locus_tag LOCUS_07900 173103 171355 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932195.1 protein_id gnl|my_center|LOCUS_07900 174064 173120 gene locus_tag LOCUS_07910 174064 173120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 174760 176916 gene locus_tag LOCUS_07920 174760 176916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 178596 177391 gene locus_tag LOCUS_07930 178596 177391 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_07930 178803 178675 gene locus_tag LOCUS_07940 178803 178675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 178868 179287 gene locus_tag LOCUS_07950 178868 179287 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_07950 180928 179651 gene locus_tag LOCUS_07960 180928 179651 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015512063.1 protein_id gnl|my_center|LOCUS_07960 181788 181069 gene locus_tag LOCUS_07970 181788 181069 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389464.1 protein_id gnl|my_center|LOCUS_07970 181924 182139 gene locus_tag LOCUS_07980 181924 182139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 182136 182402 gene locus_tag LOCUS_07990 182136 182402 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367773.1 protein_id gnl|my_center|LOCUS_07990 183890 182676 gene locus_tag LOCUS_08000 183890 182676 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_08000 186066 184360 gene locus_tag LOCUS_08010 186066 184360 CDS product ATP-dependent DNA helicase UvrD2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804758.1 protein_id gnl|my_center|LOCUS_08010 186532 186056 gene locus_tag LOCUS_08020 186532 186056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 186882 186622 gene locus_tag LOCUS_08030 186882 186622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 188204 187284 gene locus_tag LOCUS_08040 188204 187284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 188588 188352 gene locus_tag LOCUS_08050 188588 188352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 188890 188582 gene locus_tag LOCUS_08060 188890 188582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 189409 189140 gene locus_tag LOCUS_08070 189409 189140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 189795 189634 gene locus_tag LOCUS_08080 189795 189634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 190294 189986 gene locus_tag LOCUS_08090 gene rpsJ 190294 189986 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_08090 192450 190342 gene locus_tag LOCUS_08100 gene fusA 192450 190342 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_08100 192945 192472 gene locus_tag LOCUS_08110 gene rpsG 192945 192472 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055588.1 protein_id gnl|my_center|LOCUS_08110 193364 192993 gene locus_tag LOCUS_08120 gene rpsL 193364 192993 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_08120 193672 193992 gene locus_tag LOCUS_08130 193672 193992 CDS product putative heavy metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051681.1 protein_id gnl|my_center|LOCUS_08130 194489 194043 gene locus_tag LOCUS_08140 194489 194043 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_08140 194764 194522 gene locus_tag LOCUS_08150 194764 194522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 195213 196217 gene locus_tag LOCUS_08160 gene lacD 195213 196217 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371479.1 protein_id gnl|my_center|LOCUS_08160 200808 196327 gene locus_tag LOCUS_08170 200808 196327 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051319.1 protein_id gnl|my_center|LOCUS_08170 204318 200809 gene locus_tag LOCUS_08180 gene rpoB 204318 200809 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272205.1 protein_id gnl|my_center|LOCUS_08180 205472 204513 gene locus_tag LOCUS_08190 gene galU 205472 204513 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_08190 206058 205681 gene locus_tag LOCUS_08200 gene rplL 206058 205681 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_08200 206673 206140 gene locus_tag LOCUS_08210 gene rplJ 206673 206140 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356426.1 protein_id gnl|my_center|LOCUS_08210 207228 208625 gene locus_tag LOCUS_08220 207228 208625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 208915 208712 gene locus_tag LOCUS_08230 208915 208712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 209771 208977 gene locus_tag LOCUS_08240 209771 208977 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_08240 210687 209764 gene locus_tag LOCUS_08250 210687 209764 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549276.1 protein_id gnl|my_center|LOCUS_08250 211833 210847 gene locus_tag LOCUS_08260 211833 210847 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_08260 212910 211891 gene locus_tag LOCUS_08270 212910 211891 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_08270 213186 214010 gene locus_tag LOCUS_08280 213186 214010 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993921.1 protein_id gnl|my_center|LOCUS_08280 214098 214742 gene locus_tag LOCUS_08290 gene yihA 214098 214742 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262817.1 protein_id gnl|my_center|LOCUS_08290 216737 214800 gene locus_tag LOCUS_08300 216737 214800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068826.1 protein_id gnl|my_center|LOCUS_08300 218478 216730 gene locus_tag LOCUS_08310 218478 216730 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_08310 219075 218536 gene locus_tag LOCUS_08320 219075 218536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 221408 219219 gene locus_tag LOCUS_08330 gene ligA 221408 219219 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_08330 221709 221554 gene locus_tag LOCUS_08340 221709 221554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 222325 221723 gene locus_tag LOCUS_08350 222325 221723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 222990 222325 gene locus_tag LOCUS_08360 222990 222325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 223603 222992 gene locus_tag LOCUS_08370 223603 222992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 224522 223590 gene locus_tag LOCUS_08380 224522 223590 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_08380 225862 224528 gene locus_tag LOCUS_08390 gene rsxC 225862 224528 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869095.1 protein_id gnl|my_center|LOCUS_08390 228623 226116 gene locus_tag LOCUS_08400 228623 226116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 229003 230445 gene locus_tag LOCUS_08410 229003 230445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 231261 230599 gene locus_tag LOCUS_08420 231261 230599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 232716 231373 gene locus_tag LOCUS_08430 gene glnA 232716 231373 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052524.1 protein_id gnl|my_center|LOCUS_08430 233084 232878 gene locus_tag LOCUS_08440 233084 232878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 235490 233250 gene locus_tag LOCUS_08450 gene feoB 235490 233250 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_08450 235798 235577 gene locus_tag LOCUS_08460 235798 235577 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_08460 236106 235867 gene locus_tag LOCUS_08470 236106 235867 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811001.1 protein_id gnl|my_center|LOCUS_08470 236901 236383 gene locus_tag LOCUS_08480 236901 236383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 237816 236968 gene locus_tag LOCUS_08490 237816 236968 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_08490 238141 237764 gene locus_tag LOCUS_08500 238141 237764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 239582 238398 gene locus_tag LOCUS_08510 239582 238398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 240585 239965 gene locus_tag LOCUS_08520 240585 239965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 241802 240627 gene locus_tag LOCUS_08530 241802 240627 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963530.1 protein_id gnl|my_center|LOCUS_08530 244779 241939 gene locus_tag LOCUS_08540 244779 241939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 246949 245177 gene locus_tag LOCUS_08550 gene aspS 246949 245177 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_08550 247656 247156 gene locus_tag LOCUS_08560 247656 247156 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_08560 248943 247687 gene locus_tag LOCUS_08570 248943 247687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 250054 248933 gene locus_tag LOCUS_08580 250054 248933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 251170 250112 gene locus_tag LOCUS_08590 gene moaA 251170 250112 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_08590 251988 251170 gene locus_tag LOCUS_08600 gene pflA 251988 251170 CDS product pyruvate formate lyase 1-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456250.1 protein_id gnl|my_center|LOCUS_08600 253367 252018 gene locus_tag LOCUS_08610 gene brnQ 253367 252018 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389948.1 protein_id gnl|my_center|LOCUS_08610 255585 253471 gene locus_tag LOCUS_08620 255585 253471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 258315 255790 gene locus_tag LOCUS_08630 258315 255790 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804532.1 protein_id gnl|my_center|LOCUS_08630 259774 258461 gene locus_tag LOCUS_08640 gene hisS 259774 258461 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_08640 260887 259901 gene locus_tag LOCUS_08650 260887 259901 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816259.1 protein_id gnl|my_center|LOCUS_08650 262118 260964 gene locus_tag LOCUS_08660 262118 260964 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475604.1 protein_id gnl|my_center|LOCUS_08660 263430 262579 gene locus_tag LOCUS_08670 263430 262579 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_08670 264200 263751 gene locus_tag LOCUS_08680 264200 263751 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_08680 265474 264200 gene locus_tag LOCUS_08690 265474 264200 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_08690 267556 265493 gene locus_tag LOCUS_08700 267556 265493 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966642.1 protein_id gnl|my_center|LOCUS_08700 268756 267566 gene locus_tag LOCUS_08710 268756 267566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 269455 268874 gene locus_tag LOCUS_08720 269455 268874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 270737 269937 gene locus_tag LOCUS_08730 270737 269937 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014467026.1 protein_id gnl|my_center|LOCUS_08730 271702 271406 gene locus_tag LOCUS_08740 271702 271406 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990063.1 protein_id gnl|my_center|LOCUS_08740 273591 271936 gene locus_tag LOCUS_08750 273591 271936 CDS product galactoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680065.1 protein_id gnl|my_center|LOCUS_08750 275117 273609 gene locus_tag LOCUS_08760 275117 273609 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_08760 276598 275324 gene locus_tag LOCUS_08770 276598 275324 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_08770 277818 276799 gene locus_tag LOCUS_08780 277818 276799 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 protein_id gnl|my_center|LOCUS_08780 279558 277897 gene locus_tag LOCUS_08790 gene galT 279558 277897 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288451.1 protein_id gnl|my_center|LOCUS_08790 280766 279549 gene locus_tag LOCUS_08800 gene galK 280766 279549 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_08800 281918 280845 gene locus_tag LOCUS_08810 281918 280845 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_08810 282201 283106 gene locus_tag LOCUS_08820 282201 283106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08820 283137 283784 gene locus_tag LOCUS_08830 gene artQ 283137 283784 CDS product arginine ABC transporter permease ArtQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230340.1 protein_id gnl|my_center|LOCUS_08830 283882 284817 gene locus_tag LOCUS_08840 283882 284817 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931519.1 protein_id gnl|my_center|LOCUS_08840 284993 286162 gene locus_tag LOCUS_08850 284993 286162 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068707.1 protein_id gnl|my_center|LOCUS_08850 286430 287824 gene locus_tag LOCUS_08860 286430 287824 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_08860 289132 288062 gene locus_tag LOCUS_08870 289132 288062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 290921 289350 gene locus_tag LOCUS_08880 290921 289350 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812931.1 protein_id gnl|my_center|LOCUS_08880 292072 291131 gene locus_tag LOCUS_08890 gene lacC 292072 291131 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262465.1 protein_id gnl|my_center|LOCUS_08890 293397 292231 gene locus_tag LOCUS_08900 gene nagA 293397 292231 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289803.1 protein_id gnl|my_center|LOCUS_08900 294680 293514 gene locus_tag LOCUS_08910 294680 293514 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357242.1 protein_id gnl|my_center|LOCUS_08910 295592 294864 gene locus_tag LOCUS_08920 295592 294864 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360115.1 protein_id gnl|my_center|LOCUS_08920 296868 295768 gene locus_tag LOCUS_08930 296868 295768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 297655 296858 gene locus_tag LOCUS_08940 gene agaW 297655 296858 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387359.1 protein_id gnl|my_center|LOCUS_08940 298225 297743 gene locus_tag LOCUS_08950 gene agaV 298225 297743 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_08950 298600 298319 gene locus_tag LOCUS_08960 298600 298319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 299040 298600 gene locus_tag LOCUS_08970 299040 298600 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 protein_id gnl|my_center|LOCUS_08970 299564 299489 gene locus_tag LOCUS_t00250 299564 299489 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 300767 299634 gene locus_tag LOCUS_08980 300767 299634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 302209 301115 gene locus_tag LOCUS_08990 302209 301115 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_08990 302915 302220 gene locus_tag LOCUS_09000 302915 302220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 303334 302918 gene locus_tag LOCUS_09010 303334 302918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 304323 303340 gene locus_tag LOCUS_09020 304323 303340 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_09020 305335 304379 gene locus_tag LOCUS_09030 305335 304379 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288377.1 protein_id gnl|my_center|LOCUS_09030 305997 305410 gene locus_tag LOCUS_09040 gene raiA 305997 305410 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_09040 307165 306161 gene locus_tag LOCUS_09050 307165 306161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 307360 307512 gene locus_tag LOCUS_09060 307360 307512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 308329 307598 gene locus_tag LOCUS_09070 308329 307598 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807412.1 protein_id gnl|my_center|LOCUS_09070 310066 308402 gene locus_tag LOCUS_09080 310066 308402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 311193 310057 gene locus_tag LOCUS_09090 gene holB 311193 310057 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_09090 311840 311196 gene locus_tag LOCUS_09100 gene tmk 311840 311196 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_09100 312047 313411 gene locus_tag LOCUS_09110 312047 313411 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_09110 313809 314477 gene locus_tag LOCUS_09120 313809 314477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 316222 314822 gene locus_tag LOCUS_09130 316222 314822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 317258 316554 gene locus_tag LOCUS_09140 gene vanR 317258 316554 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_09140 318745 317396 gene locus_tag LOCUS_09150 318745 317396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 319842 318847 gene locus_tag LOCUS_09160 319842 318847 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294001.1 protein_id gnl|my_center|LOCUS_09160 320725 319862 gene locus_tag LOCUS_09170 gene rsmA 320725 319862 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013966.1 protein_id gnl|my_center|LOCUS_09170 321109 320735 gene locus_tag LOCUS_09180 321109 320735 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790381.1 protein_id gnl|my_center|LOCUS_09180 321739 321161 gene locus_tag LOCUS_09190 321739 321161 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893583.1 protein_id gnl|my_center|LOCUS_09190 322159 321785 gene locus_tag LOCUS_09200 322159 321785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 323830 322226 gene locus_tag LOCUS_09210 gene metG 323830 322226 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391596.1 protein_id gnl|my_center|LOCUS_09210 324842 323931 gene locus_tag LOCUS_09220 gene rsmI 324842 323931 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391440.1 protein_id gnl|my_center|LOCUS_09220 326006 324876 gene locus_tag LOCUS_09230 326006 324876 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901552.1 protein_id gnl|my_center|LOCUS_09230 326149 326073 gene locus_tag LOCUS_t00260 326149 326073 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 326616 326200 gene locus_tag LOCUS_09240 326616 326200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 327122 326613 gene locus_tag LOCUS_09250 327122 326613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 329143 327122 gene locus_tag LOCUS_09260 329143 327122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 329621 329178 gene locus_tag LOCUS_09270 329621 329178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 329910 329686 gene locus_tag LOCUS_09280 329910 329686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 330158 329907 gene locus_tag LOCUS_09290 330158 329907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 330670 330467 gene locus_tag LOCUS_09300 330670 330467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 331336 330680 gene locus_tag LOCUS_09310 331336 330680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 332298 331336 gene locus_tag LOCUS_09320 332298 331336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 333602 332265 gene locus_tag LOCUS_09330 333602 332265 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294683.1 protein_id gnl|my_center|LOCUS_09330 335053 333599 gene locus_tag LOCUS_09340 335053 333599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 335700 335050 gene locus_tag LOCUS_09350 335700 335050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 337098 335941 gene locus_tag LOCUS_09360 gene rsgA 337098 335941 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030687.1 protein_id gnl|my_center|LOCUS_09360 339908 337221 gene locus_tag LOCUS_09370 339908 337221 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909521.1 protein_id gnl|my_center|LOCUS_09370 341668 340208 gene locus_tag LOCUS_09380 gene pyk 341668 340208 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_09380 342102 341920 gene locus_tag LOCUS_09390 342102 341920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 342026 343066 gene locus_tag LOCUS_09400 342026 343066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 344083 343256 gene locus_tag LOCUS_09410 344083 343256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 346621 344156 gene locus_tag LOCUS_09420 gene pheT 346621 344156 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_09420 347710 346634 gene locus_tag LOCUS_09430 gene pheS 347710 346634 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_09430 348527 348081 gene locus_tag LOCUS_09440 348527 348081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 349763 348849 gene locus_tag LOCUS_09450 349763 348849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 349974 351506 gene locus_tag LOCUS_09460 gene ypwA 349974 351506 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215104.1 protein_id gnl|my_center|LOCUS_09460 352324 351581 gene locus_tag LOCUS_09470 352324 351581 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861599.1 protein_id gnl|my_center|LOCUS_09470 353738 352458 gene locus_tag LOCUS_09480 353738 352458 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897756.1 protein_id gnl|my_center|LOCUS_09480 354052 353765 gene locus_tag LOCUS_09490 354052 353765 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454867.1 protein_id gnl|my_center|LOCUS_09490 354563 354129 gene locus_tag LOCUS_09500 354563 354129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 356551 354575 gene locus_tag LOCUS_09510 356551 354575 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903255.1 protein_id gnl|my_center|LOCUS_09510 359935 356921 gene locus_tag LOCUS_09520 359935 356921 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966288.1 protein_id gnl|my_center|LOCUS_09520 360179 361213 gene locus_tag LOCUS_09530 360179 361213 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_09530 362251 361301 gene locus_tag LOCUS_09540 gene murB 362251 361301 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_09540 362477 363043 gene locus_tag LOCUS_09550 362477 363043 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053234.1 protein_id gnl|my_center|LOCUS_09550 363096 364901 gene locus_tag LOCUS_09560 363096 364901 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460552.1 protein_id gnl|my_center|LOCUS_09560 364885 365688 gene locus_tag LOCUS_09570 364885 365688 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_09570 366955 365807 gene locus_tag LOCUS_09580 366955 365807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 367227 368282 gene locus_tag LOCUS_09590 gene galE 367227 368282 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068768.1 protein_id gnl|my_center|LOCUS_09590 368394 369407 gene locus_tag LOCUS_09600 gene idsA 368394 369407 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_09600 369600 370487 gene locus_tag LOCUS_09610 369600 370487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 370510 370583 gene locus_tag LOCUS_t00270 370510 370583 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 371543 371701 gene locus_tag LOCUS_09620 371543 371701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 372904 372011 gene locus_tag LOCUS_09630 372904 372011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 373050 373325 gene locus_tag LOCUS_09640 373050 373325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 373289 373555 gene locus_tag LOCUS_09650 373289 373555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 373815 373612 gene locus_tag LOCUS_09660 373815 373612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 374114 373812 gene locus_tag LOCUS_09670 374114 373812 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_09670 374304 374651 gene locus_tag LOCUS_09680 374304 374651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 376723 374876 gene locus_tag LOCUS_09690 376723 374876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 378067 377366 gene locus_tag LOCUS_09700 378067 377366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 380034 378319 gene locus_tag LOCUS_09710 gene purH 380034 378319 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070798.1 protein_id gnl|my_center|LOCUS_09710 382578 380653 gene locus_tag LOCUS_09720 382578 380653 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475500.1 protein_id gnl|my_center|LOCUS_09720 384567 382684 gene locus_tag LOCUS_09730 384567 382684 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475500.1 protein_id gnl|my_center|LOCUS_09730 385497 384604 gene locus_tag LOCUS_09740 385497 384604 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053096.1 protein_id gnl|my_center|LOCUS_09740 386184 385666 gene locus_tag LOCUS_09750 386184 385666 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_09750 386452 386376 gene locus_tag LOCUS_t00280 386452 386376 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 386596 389067 gene locus_tag LOCUS_09760 386596 389067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 389144 389234 gene locus_tag LOCUS_t00290 389144 389234 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence3 452 81 gene locus_tag LOCUS_09770 452 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1664 522 gene locus_tag LOCUS_09780 1664 522 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945122.1 protein_id gnl|my_center|LOCUS_09780 2082 1732 gene locus_tag LOCUS_09790 2082 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3283 2228 gene locus_tag LOCUS_09800 3283 2228 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364446.1 protein_id gnl|my_center|LOCUS_09800 4816 3380 gene locus_tag LOCUS_09810 4816 3380 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775345.1 protein_id gnl|my_center|LOCUS_09810 5800 4904 gene locus_tag LOCUS_09820 gene murQ 5800 4904 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 protein_id gnl|my_center|LOCUS_09820 8316 5860 gene locus_tag LOCUS_09830 8316 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 8756 9664 gene locus_tag LOCUS_09840 8756 9664 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296639.1 protein_id gnl|my_center|LOCUS_09840 10642 9695 gene locus_tag LOCUS_09850 10642 9695 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280060.1 protein_id gnl|my_center|LOCUS_09850 11241 11729 gene locus_tag LOCUS_09860 11241 11729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 11974 12906 gene locus_tag LOCUS_09870 11974 12906 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_09870 13073 13732 gene locus_tag LOCUS_09880 13073 13732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 15091 13808 gene locus_tag LOCUS_09890 gene serS 15091 13808 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_09890 15198 15371 gene locus_tag LOCUS_09900 15198 15371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 16472 15393 gene locus_tag LOCUS_09910 16472 15393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 17536 16571 gene locus_tag LOCUS_09920 17536 16571 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390137.1 protein_id gnl|my_center|LOCUS_09920 18896 17646 gene locus_tag LOCUS_09930 gene glyA 18896 17646 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110494.1 protein_id gnl|my_center|LOCUS_09930 19130 19044 gene locus_tag LOCUS_t00300 19130 19044 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19708 19232 gene locus_tag LOCUS_09940 19708 19232 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531476.1 protein_id gnl|my_center|LOCUS_09940 20085 19801 gene locus_tag LOCUS_09950 20085 19801 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722354.1 protein_id gnl|my_center|LOCUS_09950 20232 20316 gene locus_tag LOCUS_t00310 20232 20316 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21123 20392 gene locus_tag LOCUS_09960 21123 20392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 22395 21421 gene locus_tag LOCUS_09970 22395 21421 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_09970 22827 22528 gene locus_tag LOCUS_09980 22827 22528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 25422 23314 gene locus_tag LOCUS_09990 25422 23314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 26931 25642 gene locus_tag LOCUS_10000 gene eno 26931 25642 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_10000 28316 27066 gene locus_tag LOCUS_10010 gene larC 28316 27066 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_10010 29143 28364 gene locus_tag LOCUS_10020 gene larB 29143 28364 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_10020 30052 29180 gene locus_tag LOCUS_10030 30052 29180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 30852 30100 gene locus_tag LOCUS_10040 30852 30100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 31435 30866 gene locus_tag LOCUS_10050 gene yfcE 31435 30866 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772458.1 protein_id gnl|my_center|LOCUS_10050 31864 31490 gene locus_tag LOCUS_10060 31864 31490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 32045 32398 gene locus_tag LOCUS_10070 32045 32398 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459318.1 protein_id gnl|my_center|LOCUS_10070 32566 32432 gene locus_tag LOCUS_10080 32566 32432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 32813 32556 gene locus_tag LOCUS_10090 32813 32556 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_10090 32883 33788 gene locus_tag LOCUS_10100 32883 33788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 34133 33816 gene locus_tag LOCUS_10110 34133 33816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10110 34514 34176 gene locus_tag LOCUS_10120 gene hisI 34514 34176 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397763.1 protein_id gnl|my_center|LOCUS_10120 35466 34684 gene locus_tag LOCUS_10130 gene hisF 35466 34684 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_10130 36220 35429 gene locus_tag LOCUS_10140 gene hisA 36220 35429 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_10140 36948 36217 gene locus_tag LOCUS_10150 gene hisH 36948 36217 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_10150 37688 37125 gene locus_tag LOCUS_10160 37688 37125 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_10160 38599 37808 gene locus_tag LOCUS_10170 38599 37808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 40508 38670 gene locus_tag LOCUS_10180 40508 38670 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143234.1 protein_id gnl|my_center|LOCUS_10180 41502 40912 gene locus_tag LOCUS_10190 gene hisB 41502 40912 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_10190 42660 41569 gene locus_tag LOCUS_10200 42660 41569 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976762.1 protein_id gnl|my_center|LOCUS_10200 44224 42665 gene locus_tag LOCUS_10210 gene hisD 44224 42665 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404855.1 protein_id gnl|my_center|LOCUS_10210 46006 44288 gene locus_tag LOCUS_10220 46006 44288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 46158 46715 gene locus_tag LOCUS_10230 46158 46715 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817206.1 protein_id gnl|my_center|LOCUS_10230 46750 47790 gene locus_tag LOCUS_10240 46750 47790 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775309.1 protein_id gnl|my_center|LOCUS_10240 50082 47896 gene locus_tag LOCUS_10250 50082 47896 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_10250 50444 50163 gene locus_tag LOCUS_10260 50444 50163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 51728 50805 gene locus_tag LOCUS_10270 gene metA 51728 50805 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_10270 53882 51831 gene locus_tag LOCUS_10280 gene recQ 53882 51831 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058493.1 protein_id gnl|my_center|LOCUS_10280 54122 53979 gene locus_tag LOCUS_10290 54122 53979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 54138 54503 gene locus_tag LOCUS_10300 54138 54503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 55177 56385 gene locus_tag LOCUS_10310 55177 56385 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_10310 56749 56585 gene locus_tag LOCUS_10320 56749 56585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 58117 56753 gene locus_tag LOCUS_10330 58117 56753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 59647 58121 gene locus_tag LOCUS_10340 59647 58121 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681540.1 protein_id gnl|my_center|LOCUS_10340 59546 59935 gene locus_tag LOCUS_10350 59546 59935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 60566 60021 gene locus_tag LOCUS_10360 60566 60021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 61340 60645 gene locus_tag LOCUS_10370 61340 60645 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113937.1 protein_id gnl|my_center|LOCUS_10370 61843 61418 gene locus_tag LOCUS_10380 61843 61418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 63412 62051 gene locus_tag LOCUS_10390 63412 62051 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000477450.1 protein_id gnl|my_center|LOCUS_10390 63577 63428 gene locus_tag LOCUS_10400 63577 63428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10400 64617 65858 gene locus_tag LOCUS_10410 64617 65858 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813597.1 protein_id gnl|my_center|LOCUS_10410 66092 66589 gene locus_tag LOCUS_10420 66092 66589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 66905 67291 gene locus_tag LOCUS_10430 66905 67291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 68535 67333 gene locus_tag LOCUS_10440 68535 67333 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068831.1 protein_id gnl|my_center|LOCUS_10440 69472 69005 gene locus_tag LOCUS_10450 69472 69005 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531476.1 protein_id gnl|my_center|LOCUS_10450 71068 69584 gene locus_tag LOCUS_10460 71068 69584 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001309819.1 protein_id gnl|my_center|LOCUS_10460 72550 71174 gene locus_tag LOCUS_10470 72550 71174 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001304938.1 protein_id gnl|my_center|LOCUS_10470 72977 72693 gene locus_tag LOCUS_10480 72977 72693 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084025.1 protein_id gnl|my_center|LOCUS_10480 73868 73026 gene locus_tag LOCUS_10490 73868 73026 CDS product class II aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131785.1 protein_id gnl|my_center|LOCUS_10490 74617 73886 gene locus_tag LOCUS_10500 74617 73886 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301676.1 protein_id gnl|my_center|LOCUS_10500 79083 75508 gene locus_tag LOCUS_10510 gene mfd 79083 75508 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068255.1 protein_id gnl|my_center|LOCUS_10510 79792 79361 gene locus_tag LOCUS_10520 79792 79361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 81073 80207 gene locus_tag LOCUS_10530 81073 80207 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432375.1 protein_id gnl|my_center|LOCUS_10530 81881 81075 gene locus_tag LOCUS_10540 81881 81075 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453987.1 protein_id gnl|my_center|LOCUS_10540 82403 81909 gene locus_tag LOCUS_10550 82403 81909 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732004.1 protein_id gnl|my_center|LOCUS_10550 83513 82413 gene locus_tag LOCUS_10560 83513 82413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 83741 84457 gene locus_tag LOCUS_10570 83741 84457 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014894892.1 protein_id gnl|my_center|LOCUS_10570 84520 84801 gene locus_tag LOCUS_10580 84520 84801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 84935 84732 gene locus_tag LOCUS_10590 84935 84732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 85229 85867 gene locus_tag LOCUS_10600 85229 85867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10600 86273 85914 gene locus_tag LOCUS_10610 86273 85914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 86945 86634 gene locus_tag LOCUS_10620 86945 86634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 87204 86938 gene locus_tag LOCUS_10630 87204 86938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 88055 87399 gene locus_tag LOCUS_10640 gene nth 88055 87399 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546206.1 protein_id gnl|my_center|LOCUS_10640 89389 88058 gene locus_tag LOCUS_10650 89389 88058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 90037 89447 gene locus_tag LOCUS_10660 90037 89447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 90342 90046 gene locus_tag LOCUS_10670 90342 90046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 90797 90375 gene locus_tag LOCUS_10680 90797 90375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 91379 90891 gene locus_tag LOCUS_10690 91379 90891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 92509 91784 gene locus_tag LOCUS_10700 gene cybH 92509 91784 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811610.1 protein_id gnl|my_center|LOCUS_10700 94174 92510 gene locus_tag LOCUS_10710 94174 92510 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941450.1 protein_id gnl|my_center|LOCUS_10710 95556 94174 gene locus_tag LOCUS_10720 95556 94174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 96379 95828 gene locus_tag LOCUS_10730 96379 95828 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_10730 97470 96574 gene locus_tag LOCUS_10740 97470 96574 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942258.1 protein_id gnl|my_center|LOCUS_10740 97998 97510 gene locus_tag LOCUS_10750 gene iscR 97998 97510 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213178.1 protein_id gnl|my_center|LOCUS_10750 98344 98268 gene locus_tag LOCUS_t00320 98344 98268 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 99009 98536 gene locus_tag LOCUS_10760 99009 98536 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762812.1 protein_id gnl|my_center|LOCUS_10760 99725 99006 gene locus_tag LOCUS_10770 99725 99006 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_10770 101169 99814 gene locus_tag LOCUS_10780 101169 99814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 102353 101166 gene locus_tag LOCUS_10790 102353 101166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 102988 102428 gene locus_tag LOCUS_10800 102988 102428 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869013.1 protein_id gnl|my_center|LOCUS_10800 103268 104512 gene locus_tag LOCUS_10810 103268 104512 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068433.1 protein_id gnl|my_center|LOCUS_10810 104634 105578 gene locus_tag LOCUS_10820 104634 105578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 105799 106473 gene locus_tag LOCUS_10830 105799 106473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 107375 106680 gene locus_tag LOCUS_10840 107375 106680 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113937.1 protein_id gnl|my_center|LOCUS_10840 108149 107496 gene locus_tag LOCUS_10850 108149 107496 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267815.1 protein_id gnl|my_center|LOCUS_10850 109660 108158 gene locus_tag LOCUS_10860 109660 108158 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_10860 110460 109657 gene locus_tag LOCUS_10870 110460 109657 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922570.1 protein_id gnl|my_center|LOCUS_10870 111936 110623 gene locus_tag LOCUS_10880 111936 110623 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721657.1 protein_id gnl|my_center|LOCUS_10880 112264 111929 gene locus_tag LOCUS_10890 112264 111929 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774627.1 protein_id gnl|my_center|LOCUS_10890 112556 112257 gene locus_tag LOCUS_10900 112556 112257 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003741107.1 protein_id gnl|my_center|LOCUS_10900 114511 112553 gene locus_tag LOCUS_10910 gene licR 114511 112553 CDS product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 protein_id gnl|my_center|LOCUS_10910 114973 117069 gene locus_tag LOCUS_10920 114973 117069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 118169 117204 gene locus_tag LOCUS_10930 gene arcC 118169 117204 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002363186.1 protein_id gnl|my_center|LOCUS_10930 118062 118322 gene locus_tag LOCUS_10940 118062 118322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 118623 119978 gene locus_tag LOCUS_10950 118623 119978 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_10950 119997 120746 gene locus_tag LOCUS_10960 119997 120746 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_10960 120746 121825 gene locus_tag LOCUS_10970 gene orr 120746 121825 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_10970 125498 121962 gene locus_tag LOCUS_10980 gene nifJ 125498 121962 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_10980 126077 125883 gene locus_tag LOCUS_10990 126077 125883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 129332 126162 gene locus_tag LOCUS_11000 129332 126162 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088592653.1 protein_id gnl|my_center|LOCUS_11000 129405 129662 gene locus_tag LOCUS_11010 129405 129662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 129652 129990 gene locus_tag LOCUS_11020 129652 129990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 131952 130048 gene locus_tag LOCUS_11030 131952 130048 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197693007.1 protein_id gnl|my_center|LOCUS_11030 132670 132023 gene locus_tag LOCUS_11040 132670 132023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 133619 133023 gene locus_tag LOCUS_11050 gene recR 133619 133023 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_11050 134103 133789 gene locus_tag LOCUS_11060 134103 133789 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_11060 134351 134533 gene locus_tag LOCUS_11070 134351 134533 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024079.1 protein_id gnl|my_center|LOCUS_11070 134681 135835 gene locus_tag LOCUS_11080 134681 135835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 135935 136078 gene locus_tag LOCUS_11090 135935 136078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 137158 136196 gene locus_tag LOCUS_11100 gene arcC 137158 136196 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074342.1 protein_id gnl|my_center|LOCUS_11100 138292 137240 gene locus_tag LOCUS_11110 gene allD 138292 137240 CDS product ureidoglycolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000703940.1 protein_id gnl|my_center|LOCUS_11110 139675 138404 gene locus_tag LOCUS_11120 139675 138404 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358375.1 protein_id gnl|my_center|LOCUS_11120 141248 139956 gene locus_tag LOCUS_11130 141248 139956 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358375.1 protein_id gnl|my_center|LOCUS_11130 142193 141291 gene locus_tag LOCUS_11140 142193 141291 CDS product DUF2877 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355250.1 protein_id gnl|my_center|LOCUS_11140 145214 142209 gene locus_tag LOCUS_11150 145214 142209 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706747.1 protein_id gnl|my_center|LOCUS_11150 145431 147062 gene locus_tag LOCUS_11160 145431 147062 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355248.1 protein_id gnl|my_center|LOCUS_11160 147115 147960 gene locus_tag LOCUS_11170 147115 147960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819165.1 protein_id gnl|my_center|LOCUS_11170 150030 148120 gene locus_tag LOCUS_11180 150030 148120 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861843.1 protein_id gnl|my_center|LOCUS_11180 151491 150055 gene locus_tag LOCUS_11190 151491 150055 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098239.1 protein_id gnl|my_center|LOCUS_11190 152625 151744 gene locus_tag LOCUS_11200 152625 151744 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254203.1 protein_id gnl|my_center|LOCUS_11200 154748 152841 gene locus_tag LOCUS_11210 154748 152841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_11210 156507 154741 gene locus_tag LOCUS_11220 156507 154741 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389612.1 protein_id gnl|my_center|LOCUS_11220 156958 156479 gene locus_tag LOCUS_11230 156958 156479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 158535 157147 gene locus_tag LOCUS_11240 158535 157147 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358211.1 protein_id gnl|my_center|LOCUS_11240 158991 158716 gene locus_tag LOCUS_11250 158991 158716 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361919.1 protein_id gnl|my_center|LOCUS_11250 159540 159094 gene locus_tag LOCUS_11260 159540 159094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 160296 159592 gene locus_tag LOCUS_11270 160296 159592 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986655.1 protein_id gnl|my_center|LOCUS_11270 160558 161388 gene locus_tag LOCUS_11280 160558 161388 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392220.1 protein_id gnl|my_center|LOCUS_11280 161379 162194 gene locus_tag LOCUS_11290 161379 162194 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256693.1 protein_id gnl|my_center|LOCUS_11290 163115 162249 gene locus_tag LOCUS_11300 163115 162249 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223846944.1 protein_id gnl|my_center|LOCUS_11300 163270 164406 gene locus_tag LOCUS_11310 163270 164406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 166837 164501 gene locus_tag LOCUS_11320 166837 164501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 167873 167010 gene locus_tag LOCUS_11330 167873 167010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 168952 168050 gene locus_tag LOCUS_11340 168952 168050 CDS product ketose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722257.1 protein_id gnl|my_center|LOCUS_11340 169873 169013 gene locus_tag LOCUS_11350 169873 169013 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989903.1 protein_id gnl|my_center|LOCUS_11350 171068 169968 gene locus_tag LOCUS_11360 171068 169968 CDS product PTS fructose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727867.1 protein_id gnl|my_center|LOCUS_11360 171429 171121 gene locus_tag LOCUS_11370 171429 171121 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722260.1 protein_id gnl|my_center|LOCUS_11370 172126 171632 gene locus_tag LOCUS_11380 172126 171632 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930923.1 protein_id gnl|my_center|LOCUS_11380 172606 173496 gene locus_tag LOCUS_11390 172606 173496 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726366.1 protein_id gnl|my_center|LOCUS_11390 174130 173615 gene locus_tag LOCUS_11400 174130 173615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 174411 174148 gene locus_tag LOCUS_11410 174411 174148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 175316 174390 gene locus_tag LOCUS_11420 175316 174390 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904266.1 protein_id gnl|my_center|LOCUS_11420 176845 175397 gene locus_tag LOCUS_11430 176845 175397 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021368039.1 protein_id gnl|my_center|LOCUS_11430 177307 176933 gene locus_tag LOCUS_11440 177307 176933 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439961.1 protein_id gnl|my_center|LOCUS_11440 178739 177468 gene locus_tag LOCUS_11450 178739 177468 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861808.1 protein_id gnl|my_center|LOCUS_11450 179073 178753 gene locus_tag LOCUS_11460 179073 178753 CDS product PTS lactose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732400.1 protein_id gnl|my_center|LOCUS_11460 179276 181213 gene locus_tag LOCUS_11470 179276 181213 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860951.1 protein_id gnl|my_center|LOCUS_11470 181466 181236 gene locus_tag LOCUS_11480 181466 181236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 181513 182931 gene locus_tag LOCUS_11490 181513 182931 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090422545.1 protein_id gnl|my_center|LOCUS_11490 184466 182928 gene locus_tag LOCUS_11500 184466 182928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 184979 184473 gene locus_tag LOCUS_11510 184979 184473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 185677 185168 gene locus_tag LOCUS_11520 185677 185168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 187635 185776 gene locus_tag LOCUS_11530 187635 185776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_11530 189431 187635 gene locus_tag LOCUS_11540 189431 187635 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 protein_id gnl|my_center|LOCUS_11540 191553 189808 gene locus_tag LOCUS_11550 191553 189808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 191723 191634 gene locus_tag LOCUS_t00330 191723 191634 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 193773 191827 gene locus_tag LOCUS_11560 193773 191827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 194456 193893 gene locus_tag LOCUS_11570 194456 193893 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_11570 194710 194561 gene locus_tag LOCUS_11580 194710 194561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 196297 195056 gene locus_tag LOCUS_11590 196297 195056 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_11590 198184 196310 gene locus_tag LOCUS_11600 198184 196310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 199910 198714 gene locus_tag LOCUS_11610 199910 198714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 201587 200136 gene locus_tag LOCUS_11620 201587 200136 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545147.1 protein_id gnl|my_center|LOCUS_11620 202412 201657 gene locus_tag LOCUS_11630 202412 201657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 202817 202413 gene locus_tag LOCUS_11640 202817 202413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 203591 202968 gene locus_tag LOCUS_11650 203591 202968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 205008 203644 gene locus_tag LOCUS_11660 205008 203644 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295395.1 protein_id gnl|my_center|LOCUS_11660 205944 205102 gene locus_tag LOCUS_11670 205944 205102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 207326 206115 gene locus_tag LOCUS_11680 207326 206115 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_11680 208235 207705 gene locus_tag LOCUS_11690 208235 207705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 209333 208242 gene locus_tag LOCUS_11700 209333 208242 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937737.1 protein_id gnl|my_center|LOCUS_11700 210077 209337 gene locus_tag LOCUS_11710 210077 209337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 210713 210078 gene locus_tag LOCUS_11720 210713 210078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 213602 210726 gene locus_tag LOCUS_11730 213602 210726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 214980 213796 gene locus_tag LOCUS_11740 214980 213796 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_11740 215510 215121 gene locus_tag LOCUS_11750 215510 215121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 217868 215808 gene locus_tag LOCUS_11760 gene fusA 217868 215808 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_11760 220977 218305 gene locus_tag LOCUS_11770 220977 218305 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263553.1 protein_id gnl|my_center|LOCUS_11770 221402 225952 gene locus_tag LOCUS_11780 221402 225952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 227231 226062 gene locus_tag LOCUS_11790 gene rlmD 227231 226062 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_11790 228242 227370 gene locus_tag LOCUS_11800 228242 227370 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963831.1 protein_id gnl|my_center|LOCUS_11800 229440 228259 gene locus_tag LOCUS_11810 229440 228259 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806343.1 protein_id gnl|my_center|LOCUS_11810 232996 229550 gene locus_tag LOCUS_11820 232996 229550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 235423 233174 gene locus_tag LOCUS_11830 gene ftsH 235423 233174 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_11830 235973 235425 gene locus_tag LOCUS_11840 gene hpt 235973 235425 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966479.1 protein_id gnl|my_center|LOCUS_11840 237559 236060 gene locus_tag LOCUS_11850 gene tilS 237559 236060 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_11850 238152 237718 gene locus_tag LOCUS_11860 238152 237718 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100898.1 protein_id gnl|my_center|LOCUS_11860 238450 238989 gene locus_tag LOCUS_11870 238450 238989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 239054 240283 gene locus_tag LOCUS_11880 gene nifS 239054 240283 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_11880 240462 240331 gene locus_tag LOCUS_11890 240462 240331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 242363 240669 gene locus_tag LOCUS_11900 242363 240669 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_11900 243277 242537 gene locus_tag LOCUS_11910 243277 242537 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964091.1 protein_id gnl|my_center|LOCUS_11910 244144 243287 gene locus_tag LOCUS_11920 244144 243287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 245308 244238 gene locus_tag LOCUS_11930 gene cbiM 245308 244238 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393363.1 protein_id gnl|my_center|LOCUS_11930 245589 245664 gene locus_tag LOCUS_t00340 245589 245664 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 247032 245749 gene locus_tag LOCUS_11940 247032 245749 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987074.1 protein_id gnl|my_center|LOCUS_11940 247800 247174 gene locus_tag LOCUS_11950 247800 247174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 248689 247805 gene locus_tag LOCUS_11960 248689 247805 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_11960 250534 248861 gene locus_tag LOCUS_11970 250534 248861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 251266 250541 gene locus_tag LOCUS_11980 251266 250541 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_11980 252591 251368 gene locus_tag LOCUS_11990 252591 251368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 252863 252588 gene locus_tag LOCUS_12000 252863 252588 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939908.1 protein_id gnl|my_center|LOCUS_12000 253823 253326 gene locus_tag LOCUS_12010 253823 253326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 253749 254090 gene locus_tag LOCUS_12020 253749 254090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 254961 254296 gene locus_tag LOCUS_12030 254961 254296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 257229 254983 gene locus_tag LOCUS_12040 257229 254983 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273527.1 protein_id gnl|my_center|LOCUS_12040 257966 257244 gene locus_tag LOCUS_12050 257966 257244 CDS product ferredoxin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070227.1 protein_id gnl|my_center|LOCUS_12050 258232 259581 gene locus_tag LOCUS_12060 258232 259581 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_12060 260292 259702 gene locus_tag LOCUS_12070 260292 259702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 261210 260383 gene locus_tag LOCUS_12080 261210 260383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 261333 262949 gene locus_tag LOCUS_12090 261333 262949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 262960 263325 gene locus_tag LOCUS_12100 262960 263325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 263824 263213 gene locus_tag LOCUS_12110 263824 263213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 263996 264157 gene locus_tag LOCUS_12120 263996 264157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 266096 264753 gene locus_tag LOCUS_12130 gene purB 266096 264753 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567237.1 protein_id gnl|my_center|LOCUS_12130 266513 266439 gene locus_tag LOCUS_t00350 266513 266439 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 266884 272202 gene locus_tag LOCUS_12140 266884 272202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 272542 272309 gene locus_tag LOCUS_12150 272542 272309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 275821 272705 gene locus_tag LOCUS_12160 275821 272705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 276020 277024 gene locus_tag LOCUS_12170 276020 277024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 277011 277922 gene locus_tag LOCUS_12180 277011 277922 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729396.1 protein_id gnl|my_center|LOCUS_12180 280826 277947 gene locus_tag LOCUS_12190 280826 277947 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392668.1 protein_id gnl|my_center|LOCUS_12190 281791 280826 gene locus_tag LOCUS_12200 281791 280826 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_12200 281894 282949 gene locus_tag LOCUS_12210 gene rlmN 281894 282949 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_12210 283354 283106 gene locus_tag LOCUS_12220 283354 283106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 284238 283351 gene locus_tag LOCUS_12230 gene spo0J 284238 283351 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_12230 285031 284231 gene locus_tag LOCUS_12240 gene soj 285031 284231 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_12240 285904 285143 gene locus_tag LOCUS_12250 gene rsmG 285904 285143 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_12250 286616 286008 gene locus_tag LOCUS_12260 286616 286008 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_12260 287451 286678 gene locus_tag LOCUS_12270 287451 286678 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_12270 288044 287709 gene locus_tag LOCUS_12280 288044 287709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 288196 288050 gene locus_tag LOCUS_12290 gene rpmH 288196 288050 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888783.1 protein_id gnl|my_center|LOCUS_12290 288536 289765 gene locus_tag LOCUS_12300 288536 289765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 289819 291570 gene locus_tag LOCUS_12310 289819 291570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 291819 292922 gene locus_tag LOCUS_12320 gene dnaN 291819 292922 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_12320 292947 294074 gene locus_tag LOCUS_12330 gene recF 292947 294074 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_12330 294064 294651 gene locus_tag LOCUS_12340 294064 294651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 294885 296909 gene locus_tag LOCUS_12350 gene gyrB 294885 296909 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288364.1 protein_id gnl|my_center|LOCUS_12350 296922 299699 gene locus_tag LOCUS_12360 gene gyrA 296922 299699 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361457.1 protein_id gnl|my_center|LOCUS_12360 300218 300143 gene locus_tag LOCUS_t00360 300218 300143 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 300360 300284 gene locus_tag LOCUS_t00370 300360 300284 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 300490 301035 gene locus_tag LOCUS_12370 300490 301035 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_12370 301162 301238 gene locus_tag LOCUS_t00380 301162 301238 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 301913 307171 gene locus_tag LOCUS_12380 301913 307171 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389627.1 protein_id gnl|my_center|LOCUS_12380 307277 312106 gene locus_tag LOCUS_12390 307277 312106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 312162 318248 gene locus_tag LOCUS_12400 312162 318248 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390210.1 protein_id gnl|my_center|LOCUS_12400 318542 323599 gene locus_tag LOCUS_12410 318542 323599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 323741 327859 gene locus_tag LOCUS_12420 323741 327859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 328473 328922 gene locus_tag LOCUS_12430 328473 328922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 329040 330878 gene locus_tag LOCUS_12440 gene typA 329040 330878 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_12440 331597 331034 gene locus_tag LOCUS_12450 331597 331034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 332305 337614 gene locus_tag LOCUS_12460 332305 337614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence4 1008 235 gene locus_tag LOCUS_12470 1008 235 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924376.1 protein_id gnl|my_center|LOCUS_12470 1167 1257 gene locus_tag LOCUS_t00390 1167 1257 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1311 1401 gene locus_tag LOCUS_t00400 1311 1401 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1548 2099 gene locus_tag LOCUS_12480 1548 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 2104 3258 gene locus_tag LOCUS_12490 2104 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3611 3907 gene locus_tag LOCUS_12500 gene rpsF 3611 3907 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_12500 3958 4446 gene locus_tag LOCUS_12510 3958 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4493 4765 gene locus_tag LOCUS_12520 gene rpsR 4493 4765 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_12520 4778 5308 gene locus_tag LOCUS_12530 gene rplI 4778 5308 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831811.1 protein_id gnl|my_center|LOCUS_12530 5869 7263 gene locus_tag LOCUS_12540 gene dnaB 5869 7263 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815191.1 protein_id gnl|my_center|LOCUS_12540 7334 8620 gene locus_tag LOCUS_12550 7334 8620 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_12550 8747 10033 gene locus_tag LOCUS_12560 gene purD 8747 10033 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532813.1 protein_id gnl|my_center|LOCUS_12560 10082 10762 gene locus_tag LOCUS_12570 10082 10762 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_12570 10963 12732 gene locus_tag LOCUS_12580 10963 12732 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_12580 12811 13671 gene locus_tag LOCUS_12590 12811 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 13815 14708 gene locus_tag LOCUS_12600 13815 14708 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052069.1 protein_id gnl|my_center|LOCUS_12600 14921 16306 gene locus_tag LOCUS_12610 gene carA 14921 16306 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081322.1 protein_id gnl|my_center|LOCUS_12610 16299 19637 gene locus_tag LOCUS_12620 gene carB 16299 19637 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941931.1 protein_id gnl|my_center|LOCUS_12620 19977 24569 gene locus_tag LOCUS_12630 19977 24569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 24709 31185 gene locus_tag LOCUS_12640 24709 31185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 31406 32455 gene locus_tag LOCUS_12650 31406 32455 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068670.1 protein_id gnl|my_center|LOCUS_12650 32528 32998 gene locus_tag LOCUS_12660 gene purE 32528 32998 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_12660 33083 34216 gene locus_tag LOCUS_12670 33083 34216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 34630 40302 gene locus_tag LOCUS_12680 34630 40302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 40383 40697 gene locus_tag LOCUS_12690 40383 40697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 40808 42106 gene locus_tag LOCUS_12700 40808 42106 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816121.1 protein_id gnl|my_center|LOCUS_12700 42243 43310 gene locus_tag LOCUS_12710 42243 43310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 43521 43715 gene locus_tag LOCUS_12720 43521 43715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 43795 45471 gene locus_tag LOCUS_12730 gene purF 43795 45471 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057521.1 protein_id gnl|my_center|LOCUS_12730 45603 46715 gene locus_tag LOCUS_12740 gene purM 45603 46715 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_12740 47045 47869 gene locus_tag LOCUS_12750 47045 47869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 48035 49348 gene locus_tag LOCUS_12760 48035 49348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 49680 50411 gene locus_tag LOCUS_12770 49680 50411 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853259.1 protein_id gnl|my_center|LOCUS_12770 50523 51374 gene locus_tag LOCUS_12780 50523 51374 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461725.1 protein_id gnl|my_center|LOCUS_12780 51375 52145 gene locus_tag LOCUS_12790 51375 52145 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461724.1 protein_id gnl|my_center|LOCUS_12790 52149 52787 gene locus_tag LOCUS_12800 52149 52787 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853290.1 protein_id gnl|my_center|LOCUS_12800 52848 53567 gene locus_tag LOCUS_12810 52848 53567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 55661 56455 gene locus_tag LOCUS_12820 55661 56455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 56632 57939 gene locus_tag LOCUS_12830 56632 57939 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054178.1 protein_id gnl|my_center|LOCUS_12830 59574 58123 gene locus_tag LOCUS_12840 gene gltA 59574 58123 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_12840 60401 59559 gene locus_tag LOCUS_12850 60401 59559 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082122.1 protein_id gnl|my_center|LOCUS_12850 61459 60830 gene locus_tag LOCUS_12860 gene pth 61459 60830 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_12860 61754 63148 gene locus_tag LOCUS_12870 gene glmU 61754 63148 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_12870 63203 64186 gene locus_tag LOCUS_12880 63203 64186 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_12880 64543 66204 gene locus_tag LOCUS_12890 64543 66204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 66201 67070 gene locus_tag LOCUS_12900 66201 67070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 67067 68530 gene locus_tag LOCUS_12910 67067 68530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 68559 69278 gene locus_tag LOCUS_12920 68559 69278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 69852 71861 gene locus_tag LOCUS_12930 69852 71861 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259283.1 protein_id gnl|my_center|LOCUS_12930 72889 72074 gene locus_tag LOCUS_12940 72889 72074 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_12940 73074 74837 gene locus_tag LOCUS_12950 73074 74837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 75683 74910 gene locus_tag LOCUS_12960 75683 74910 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975453.1 protein_id gnl|my_center|LOCUS_12960 75812 76480 gene locus_tag LOCUS_12970 75812 76480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 76667 78868 gene locus_tag LOCUS_12980 76667 78868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 78953 79132 gene locus_tag LOCUS_12990 78953 79132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 79119 79856 gene locus_tag LOCUS_13000 79119 79856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_13000 79857 80585 gene locus_tag LOCUS_13010 79857 80585 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_13010 80640 81485 gene locus_tag LOCUS_13020 80640 81485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 81489 81674 gene locus_tag LOCUS_13030 81489 81674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 82111 82187 gene locus_tag LOCUS_t00410 82111 82187 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 82628 82293 gene locus_tag LOCUS_13040 82628 82293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 82795 83592 gene locus_tag LOCUS_13050 82795 83592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 83815 84798 gene locus_tag LOCUS_13060 83815 84798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 85220 85573 gene locus_tag LOCUS_13070 85220 85573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 85566 85847 gene locus_tag LOCUS_13080 85566 85847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 88121 86445 gene locus_tag LOCUS_13090 88121 86445 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014586.1 protein_id gnl|my_center|LOCUS_13090 89155 89379 gene locus_tag LOCUS_13100 89155 89379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 89406 90623 gene locus_tag LOCUS_13110 89406 90623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 91117 90920 gene locus_tag LOCUS_13120 91117 90920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 94157 92211 gene locus_tag LOCUS_13130 94157 92211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 94422 94195 gene locus_tag LOCUS_13140 94422 94195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 95545 94751 gene locus_tag LOCUS_13150 gene larE 95545 94751 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_13150 95709 96383 gene locus_tag LOCUS_13160 95709 96383 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_13160 96853 96554 gene locus_tag LOCUS_13170 96853 96554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 96887 97978 gene locus_tag LOCUS_13180 96887 97978 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776801.1 protein_id gnl|my_center|LOCUS_13180 98206 100083 gene locus_tag LOCUS_13190 gene glmS 98206 100083 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_13190 100880 100161 gene locus_tag LOCUS_13200 gene gmuR 100880 100161 CDS product transcriptional regulator GmuR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234096.1 protein_id gnl|my_center|LOCUS_13200 101118 102518 gene locus_tag LOCUS_13210 101118 102518 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293829.1 protein_id gnl|my_center|LOCUS_13210 102629 103993 gene locus_tag LOCUS_13220 102629 103993 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097450.1 protein_id gnl|my_center|LOCUS_13220 104135 104440 gene locus_tag LOCUS_13230 104135 104440 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809626.1 protein_id gnl|my_center|LOCUS_13230 104450 104794 gene locus_tag LOCUS_13240 104450 104794 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134124.1 protein_id gnl|my_center|LOCUS_13240 105520 104990 gene locus_tag LOCUS_13250 105520 104990 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_13250 105644 106480 gene locus_tag LOCUS_13260 105644 106480 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644859.1 protein_id gnl|my_center|LOCUS_13260 106655 107014 gene locus_tag LOCUS_13270 106655 107014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 107164 107544 gene locus_tag LOCUS_13280 107164 107544 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_13280 107726 108262 gene locus_tag LOCUS_13290 107726 108262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 108333 110162 gene locus_tag LOCUS_13300 108333 110162 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814218.1 protein_id gnl|my_center|LOCUS_13300 110155 112041 gene locus_tag LOCUS_13310 110155 112041 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143606.1 protein_id gnl|my_center|LOCUS_13310 112248 113702 gene locus_tag LOCUS_13320 112248 113702 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_13320 113699 114718 gene locus_tag LOCUS_13330 gene cydB 113699 114718 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393586.1 protein_id gnl|my_center|LOCUS_13330 114776 116518 gene locus_tag LOCUS_13340 gene cydD 114776 116518 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378477.1 protein_id gnl|my_center|LOCUS_13340 116511 118316 gene locus_tag LOCUS_13350 gene cydC 116511 118316 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383727.1 protein_id gnl|my_center|LOCUS_13350 119056 118400 gene locus_tag LOCUS_13360 119056 118400 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390357.1 protein_id gnl|my_center|LOCUS_13360 119374 120075 gene locus_tag LOCUS_13370 gene cysE 119374 120075 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_13370 120182 121225 gene locus_tag LOCUS_13380 120182 121225 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_13380 121516 123186 gene locus_tag LOCUS_13390 121516 123186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 123512 124405 gene locus_tag LOCUS_13400 123512 124405 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_13400 124481 125134 gene locus_tag LOCUS_13410 124481 125134 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383057.1 protein_id gnl|my_center|LOCUS_13410 125194 125979 gene locus_tag LOCUS_13420 125194 125979 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090841.1 protein_id gnl|my_center|LOCUS_13420 126394 126029 gene locus_tag LOCUS_13430 126394 126029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 126393 126929 gene locus_tag LOCUS_13440 126393 126929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 127037 127723 gene locus_tag LOCUS_13450 gene pyrE 127037 127723 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_13450 127733 128293 gene locus_tag LOCUS_13460 127733 128293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 128620 128372 gene locus_tag LOCUS_13470 128620 128372 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096753.1 protein_id gnl|my_center|LOCUS_13470 129145 128633 gene locus_tag LOCUS_13480 129145 128633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 129259 129636 gene locus_tag LOCUS_13490 129259 129636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 130357 129689 gene locus_tag LOCUS_13500 130357 129689 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_13500 131448 130429 gene locus_tag LOCUS_13510 gene hypE 131448 130429 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_13510 132648 131527 gene locus_tag LOCUS_13520 gene hypD 132648 131527 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940977.1 protein_id gnl|my_center|LOCUS_13520 132896 132645 gene locus_tag LOCUS_13530 132896 132645 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810715.1 protein_id gnl|my_center|LOCUS_13530 134476 133082 gene locus_tag LOCUS_13540 134476 133082 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_13540 134740 136665 gene locus_tag LOCUS_13550 gene licR 134740 136665 CDS product transcriptional regulator LicR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243034.1 protein_id gnl|my_center|LOCUS_13550 136672 137034 gene locus_tag LOCUS_13560 136672 137034 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895529.1 protein_id gnl|my_center|LOCUS_13560 137111 137416 gene locus_tag LOCUS_13570 137111 137416 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002924730.1 protein_id gnl|my_center|LOCUS_13570 137453 138730 gene locus_tag LOCUS_13580 137453 138730 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892810.1 protein_id gnl|my_center|LOCUS_13580 138842 140257 gene locus_tag LOCUS_13590 138842 140257 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454201.1 protein_id gnl|my_center|LOCUS_13590 140341 140994 gene locus_tag LOCUS_13600 140341 140994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453592.1 protein_id gnl|my_center|LOCUS_13600 141151 141453 gene locus_tag LOCUS_13610 141151 141453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 141515 142459 gene locus_tag LOCUS_13620 gene rihA 141515 142459 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705366.1 protein_id gnl|my_center|LOCUS_13620 142472 143380 gene locus_tag LOCUS_13630 142472 143380 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_13630 146051 143601 gene locus_tag LOCUS_13640 gene hypF 146051 143601 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_13640 146583 146062 gene locus_tag LOCUS_13650 gene nikR 146583 146062 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_13650 146834 146586 gene locus_tag LOCUS_13660 146834 146586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 147384 147064 gene locus_tag LOCUS_13670 gene trxA 147384 147064 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_13670 147585 148211 gene locus_tag LOCUS_13680 147585 148211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 148328 149320 gene locus_tag LOCUS_13690 gene nadA 148328 149320 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016069.1 protein_id gnl|my_center|LOCUS_13690 149307 150641 gene locus_tag LOCUS_13700 149307 150641 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_13700 150739 151605 gene locus_tag LOCUS_13710 gene nadC 150739 151605 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360683.1 protein_id gnl|my_center|LOCUS_13710 151655 152203 gene locus_tag LOCUS_13720 151655 152203 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932755.1 protein_id gnl|my_center|LOCUS_13720 152302 153198 gene locus_tag LOCUS_13730 152302 153198 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775550.1 protein_id gnl|my_center|LOCUS_13730 153365 154303 gene locus_tag LOCUS_13740 153365 154303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 154316 155467 gene locus_tag LOCUS_13750 154316 155467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 155480 156292 gene locus_tag LOCUS_13760 155480 156292 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_13760 156545 157615 gene locus_tag LOCUS_13770 gene prfA 156545 157615 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_13770 157829 159736 gene locus_tag LOCUS_13780 gene dnaK 157829 159736 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_13780 159739 160524 gene locus_tag LOCUS_13790 159739 160524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 160721 161680 gene locus_tag LOCUS_13800 160721 161680 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261738.1 protein_id gnl|my_center|LOCUS_13800 161744 162163 gene locus_tag LOCUS_13810 161744 162163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 162314 163960 gene locus_tag LOCUS_13820 162314 163960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 164379 167009 gene locus_tag LOCUS_13830 gene clpB 164379 167009 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_13830 167345 168475 gene locus_tag LOCUS_13840 167345 168475 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056552.1 protein_id gnl|my_center|LOCUS_13840 168648 169316 gene locus_tag LOCUS_13850 168648 169316 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665989.1 protein_id gnl|my_center|LOCUS_13850 169475 170053 gene locus_tag LOCUS_13860 169475 170053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 170142 174077 gene locus_tag LOCUS_13870 170142 174077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 174156 175343 gene locus_tag LOCUS_13880 174156 175343 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_13880 175340 176578 gene locus_tag LOCUS_13890 175340 176578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 176571 177179 gene locus_tag LOCUS_13900 176571 177179 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_13900 177252 177455 gene locus_tag LOCUS_13910 177252 177455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 177503 181879 gene locus_tag LOCUS_13920 177503 181879 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460558.1 protein_id gnl|my_center|LOCUS_13920 181904 182242 gene locus_tag LOCUS_13930 181904 182242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 182286 182624 gene locus_tag LOCUS_13940 182286 182624 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944869.1 protein_id gnl|my_center|LOCUS_13940 183118 182702 gene locus_tag LOCUS_13950 183118 182702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 183254 183451 gene locus_tag LOCUS_13960 183254 183451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 184583 183573 gene locus_tag LOCUS_13970 184583 183573 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_13970 185288 184653 gene locus_tag LOCUS_13980 185288 184653 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051623.1 protein_id gnl|my_center|LOCUS_13980 185464 188250 gene locus_tag LOCUS_13990 185464 188250 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_13990 188391 188744 gene locus_tag LOCUS_14000 188391 188744 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_14000 191029 188804 gene locus_tag LOCUS_14010 191029 188804 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387003.1 protein_id gnl|my_center|LOCUS_14010 191229 191304 gene locus_tag LOCUS_t00420 191229 191304 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 191535 191714 gene locus_tag LOCUS_14020 191535 191714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 191772 192836 gene locus_tag LOCUS_14030 191772 192836 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_14030 192823 193737 gene locus_tag LOCUS_14040 192823 193737 CDS product DUF4928 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836658.1 protein_id gnl|my_center|LOCUS_14040 194108 194344 gene locus_tag LOCUS_14050 194108 194344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 196969 194984 gene locus_tag LOCUS_14060 gene pknB 196969 194984 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965035.1 protein_id gnl|my_center|LOCUS_14060 199924 197033 gene locus_tag LOCUS_14070 199924 197033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 201420 199921 gene locus_tag LOCUS_14080 201420 199921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 201830 201417 gene locus_tag LOCUS_14090 201830 201417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 202889 201837 gene locus_tag LOCUS_14100 202889 201837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 204784 202880 gene locus_tag LOCUS_14110 204784 202880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 206047 205040 gene locus_tag LOCUS_14120 gene cytR 206047 205040 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815292.1 protein_id gnl|my_center|LOCUS_14120 206421 207467 gene locus_tag LOCUS_14130 206421 207467 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_14130 207528 208448 gene locus_tag LOCUS_14140 207528 208448 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_14140 208597 209700 gene locus_tag LOCUS_14150 208597 209700 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533130.1 protein_id gnl|my_center|LOCUS_14150 209773 210204 gene locus_tag LOCUS_14160 209773 210204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14160 210319 211281 gene locus_tag LOCUS_14170 210319 211281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14170 211278 212399 gene locus_tag LOCUS_14180 gene rbsC 211278 212399 CDS product ribose ABC transporter permease RbsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968282.1 protein_id gnl|my_center|LOCUS_14180 213178 212534 gene locus_tag LOCUS_14190 213178 212534 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943981.1 protein_id gnl|my_center|LOCUS_14190 213407 214183 gene locus_tag LOCUS_14200 213407 214183 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_14200 214194 215756 gene locus_tag LOCUS_14210 gene arcD 214194 215756 CDS product arginine-ornithine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503400.1 protein_id gnl|my_center|LOCUS_14210 215909 218215 gene locus_tag LOCUS_14220 215909 218215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 218440 219555 gene locus_tag LOCUS_14230 218440 219555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 219725 220471 gene locus_tag LOCUS_14240 219725 220471 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406678.1 protein_id gnl|my_center|LOCUS_14240 220480 222021 gene locus_tag LOCUS_14250 gene glpK 220480 222021 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_14250 222157 222645 gene locus_tag LOCUS_14260 gene rpiB 222157 222645 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932728.1 protein_id gnl|my_center|LOCUS_14260 222842 223144 gene locus_tag LOCUS_14270 222842 223144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 223166 223963 gene locus_tag LOCUS_14280 223166 223963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 224055 224249 gene locus_tag LOCUS_14290 224055 224249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 224284 224883 gene locus_tag LOCUS_14300 224284 224883 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030209.1 protein_id gnl|my_center|LOCUS_14300 224876 225355 gene locus_tag LOCUS_14310 224876 225355 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083275.1 protein_id gnl|my_center|LOCUS_14310 225361 226971 gene locus_tag LOCUS_14320 gene atpA 225361 226971 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_14320 226977 227882 gene locus_tag LOCUS_14330 226977 227882 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723463.1 protein_id gnl|my_center|LOCUS_14330 227882 229315 gene locus_tag LOCUS_14340 gene atpD 227882 229315 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966149.1 protein_id gnl|my_center|LOCUS_14340 229319 229729 gene locus_tag LOCUS_14350 229319 229729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 229805 231094 gene locus_tag LOCUS_14360 gene murA 229805 231094 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730199.1 protein_id gnl|my_center|LOCUS_14360 231108 232313 gene locus_tag LOCUS_14370 231108 232313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 233649 232417 gene locus_tag LOCUS_14380 gene pepT 233649 232417 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477102.1 protein_id gnl|my_center|LOCUS_14380 233748 234173 gene locus_tag LOCUS_14390 233748 234173 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673217.1 protein_id gnl|my_center|LOCUS_14390 234182 235111 gene locus_tag LOCUS_14400 234182 235111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 235237 236628 gene locus_tag LOCUS_14410 235237 236628 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence5 1965 286 gene locus_tag LOCUS_14420 gene ettA 1965 286 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068794.1 protein_id gnl|my_center|LOCUS_14420 2848 2144 gene locus_tag LOCUS_14430 2848 2144 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259108.1 protein_id gnl|my_center|LOCUS_14430 3119 2841 gene locus_tag LOCUS_14440 3119 2841 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070523.1 protein_id gnl|my_center|LOCUS_14440 4639 3830 gene locus_tag LOCUS_14450 4639 3830 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 protein_id gnl|my_center|LOCUS_14450 5433 4636 gene locus_tag LOCUS_14460 5433 4636 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398521.1 protein_id gnl|my_center|LOCUS_14460 6327 5485 gene locus_tag LOCUS_14470 6327 5485 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890755.1 protein_id gnl|my_center|LOCUS_14470 7028 6324 gene locus_tag LOCUS_14480 7028 6324 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355232.1 protein_id gnl|my_center|LOCUS_14480 7533 7096 gene locus_tag LOCUS_14490 7533 7096 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_14490 8921 7623 gene locus_tag LOCUS_14500 8921 7623 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723401.1 protein_id gnl|my_center|LOCUS_14500 9567 8923 gene locus_tag LOCUS_14510 9567 8923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964785.1 protein_id gnl|my_center|LOCUS_14510 10348 9569 gene locus_tag LOCUS_14520 10348 9569 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964784.1 protein_id gnl|my_center|LOCUS_14520 11409 10345 gene locus_tag LOCUS_14530 11409 10345 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878191.1 protein_id gnl|my_center|LOCUS_14530 12403 11432 gene locus_tag LOCUS_14540 12403 11432 CDS product glycine betaine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964783.1 protein_id gnl|my_center|LOCUS_14540 13147 12512 gene locus_tag LOCUS_14550 13147 12512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964782.1 protein_id gnl|my_center|LOCUS_14550 13745 13329 gene locus_tag LOCUS_14560 13745 13329 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_14560 15084 13738 gene locus_tag LOCUS_14570 15084 13738 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376739.1 protein_id gnl|my_center|LOCUS_14570 16361 15081 gene locus_tag LOCUS_14580 16361 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 17776 16361 gene locus_tag LOCUS_14590 gene sufB 17776 16361 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_14590 18595 17780 gene locus_tag LOCUS_14600 gene sufC 18595 17780 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_14600 19604 18852 gene locus_tag LOCUS_14610 19604 18852 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_14610 19913 19632 gene locus_tag LOCUS_14620 19913 19632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 20190 19921 gene locus_tag LOCUS_14630 20190 19921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 20413 21147 gene locus_tag LOCUS_14640 20413 21147 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_14640 21166 22170 gene locus_tag LOCUS_14650 21166 22170 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_14650 23481 22300 gene locus_tag LOCUS_14660 23481 22300 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_14660 23447 23653 gene locus_tag LOCUS_14670 23447 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 24966 23602 gene locus_tag LOCUS_14680 24966 23602 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986689.1 protein_id gnl|my_center|LOCUS_14680 25269 25105 gene locus_tag LOCUS_14690 25269 25105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 26338 25577 gene locus_tag LOCUS_14700 26338 25577 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074366.1 protein_id gnl|my_center|LOCUS_14700 26725 27267 gene locus_tag LOCUS_14710 26725 27267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459532.1 protein_id gnl|my_center|LOCUS_14710 27286 28071 gene locus_tag LOCUS_14720 27286 28071 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029472.1 protein_id gnl|my_center|LOCUS_14720 28055 29350 gene locus_tag LOCUS_14730 28055 29350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 29685 30851 gene locus_tag LOCUS_14740 29685 30851 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014066.1 protein_id gnl|my_center|LOCUS_14740 31883 31146 gene locus_tag LOCUS_14750 31883 31146 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_14750 32899 32048 gene locus_tag LOCUS_14760 32899 32048 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723163.1 protein_id gnl|my_center|LOCUS_14760 33671 32889 gene locus_tag LOCUS_14770 33671 32889 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287115.1 protein_id gnl|my_center|LOCUS_14770 34246 33776 gene locus_tag LOCUS_14780 34246 33776 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287114.1 protein_id gnl|my_center|LOCUS_14780 34684 34265 gene locus_tag LOCUS_14790 34684 34265 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585661.1 protein_id gnl|my_center|LOCUS_14790 35741 34707 gene locus_tag LOCUS_14800 35741 34707 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236585662.1 protein_id gnl|my_center|LOCUS_14800 36249 35929 gene locus_tag LOCUS_14810 36249 35929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 36139 36516 gene locus_tag LOCUS_14820 36139 36516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 37159 36992 gene locus_tag LOCUS_14830 37159 36992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 37294 38085 gene locus_tag LOCUS_14840 gene proC 37294 38085 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363628.1 protein_id gnl|my_center|LOCUS_14840 40008 38188 gene locus_tag LOCUS_14850 gene ade 40008 38188 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_14850 40268 41062 gene locus_tag LOCUS_14860 40268 41062 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 protein_id gnl|my_center|LOCUS_14860 42553 41339 gene locus_tag LOCUS_14870 gene tyrS 42553 41339 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_14870 43027 45345 gene locus_tag LOCUS_14880 43027 45345 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_14880 46029 45592 gene locus_tag LOCUS_14890 46029 45592 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408178.1 protein_id gnl|my_center|LOCUS_14890 47278 46202 gene locus_tag LOCUS_14900 47278 46202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 48169 47357 gene locus_tag LOCUS_14910 gene truA 48169 47357 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393903.1 protein_id gnl|my_center|LOCUS_14910 50394 48178 gene locus_tag LOCUS_14920 50394 48178 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054001.1 protein_id gnl|my_center|LOCUS_14920 51252 50458 gene locus_tag LOCUS_14930 51252 50458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 52392 51463 gene locus_tag LOCUS_14940 52392 51463 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_14940 53295 52396 gene locus_tag LOCUS_14950 53295 52396 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904393.1 protein_id gnl|my_center|LOCUS_14950 54741 53476 gene locus_tag LOCUS_14960 54741 53476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 55323 54856 gene locus_tag LOCUS_14970 55323 54856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 55530 56321 gene locus_tag LOCUS_14980 55530 56321 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081708.1 protein_id gnl|my_center|LOCUS_14980 58254 56617 gene locus_tag LOCUS_14990 gene groL 58254 56617 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262148.1 protein_id gnl|my_center|LOCUS_14990 58605 58318 gene locus_tag LOCUS_15000 gene groES 58605 58318 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_15000 60196 58796 gene locus_tag LOCUS_15010 60196 58796 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_15010 61069 60758 gene locus_tag LOCUS_15020 gene rplX 61069 60758 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_15020 61453 61085 gene locus_tag LOCUS_15030 gene rplN 61453 61085 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_15030 61825 61559 gene locus_tag LOCUS_15040 gene rpsQ 61825 61559 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222609.1 protein_id gnl|my_center|LOCUS_15040 62056 61841 gene locus_tag LOCUS_15050 gene rpmC 62056 61841 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403594.1 protein_id gnl|my_center|LOCUS_15050 62488 62057 gene locus_tag LOCUS_15060 gene rplP 62488 62057 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_15060 63207 62488 gene locus_tag LOCUS_15070 gene rpsC 63207 62488 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_15070 63586 63215 gene locus_tag LOCUS_15080 gene rplV 63586 63215 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906302.1 protein_id gnl|my_center|LOCUS_15080 63862 63602 gene locus_tag LOCUS_15090 gene rpsS 63862 63602 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_15090 64723 63890 gene locus_tag LOCUS_15100 gene rplB 64723 63890 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_15100 65159 64872 gene locus_tag LOCUS_15110 gene rplW 65159 64872 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_15110 65786 65160 gene locus_tag LOCUS_15120 gene rplD 65786 65160 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_15120 66525 65806 gene locus_tag LOCUS_15130 gene rplC 66525 65806 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_15130 66724 69099 gene locus_tag LOCUS_15140 66724 69099 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_15140 70778 69165 gene locus_tag LOCUS_15150 gene hcp 70778 69165 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_15150 70923 71663 gene locus_tag LOCUS_15160 70923 71663 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_15160 72628 71618 gene locus_tag LOCUS_15170 72628 71618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 74536 72719 gene locus_tag LOCUS_15180 74536 72719 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240552.1 protein_id gnl|my_center|LOCUS_15180 74597 75391 gene locus_tag LOCUS_15190 74597 75391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 75515 76345 gene locus_tag LOCUS_15200 75515 76345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 77418 76444 gene locus_tag LOCUS_15210 77418 76444 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994499.1 protein_id gnl|my_center|LOCUS_15210 77761 77600 gene locus_tag LOCUS_15220 77761 77600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 77892 80513 gene locus_tag LOCUS_15230 77892 80513 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067921.1 protein_id gnl|my_center|LOCUS_15230 80571 81134 gene locus_tag LOCUS_15240 80571 81134 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789526.1 protein_id gnl|my_center|LOCUS_15240 81212 82957 gene locus_tag LOCUS_15250 81212 82957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 84704 83421 gene locus_tag LOCUS_15260 84704 83421 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232985.1 protein_id gnl|my_center|LOCUS_15260 86095 84824 gene locus_tag LOCUS_15270 gene argJ 86095 84824 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_15270 86643 86290 gene locus_tag LOCUS_15280 86643 86290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 87834 86776 gene locus_tag LOCUS_15290 87834 86776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 88208 88984 gene locus_tag LOCUS_15300 88208 88984 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037662.1 protein_id gnl|my_center|LOCUS_15300 91456 89222 gene locus_tag LOCUS_15310 91456 89222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 93482 91635 gene locus_tag LOCUS_15320 gene argS 93482 91635 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_15320 93801 94304 gene locus_tag LOCUS_15330 93801 94304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 94919 94317 gene locus_tag LOCUS_15340 94919 94317 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_15340 94894 95139 gene locus_tag LOCUS_15350 94894 95139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 95869 95126 gene locus_tag LOCUS_15360 95869 95126 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572570.1 protein_id gnl|my_center|LOCUS_15360 96463 96035 gene locus_tag LOCUS_15370 gene agaF 96463 96035 CDS product PTS galactosamine/N-acetylgalactosamine transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010635027.1 protein_id gnl|my_center|LOCUS_15370 97573 96476 gene locus_tag LOCUS_15380 97573 96476 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432374.1 protein_id gnl|my_center|LOCUS_15380 98108 97632 gene locus_tag LOCUS_15390 98108 97632 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721638.1 protein_id gnl|my_center|LOCUS_15390 98971 98120 gene locus_tag LOCUS_15400 98971 98120 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723163.1 protein_id gnl|my_center|LOCUS_15400 99792 98974 gene locus_tag LOCUS_15410 99792 98974 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453987.1 protein_id gnl|my_center|LOCUS_15410 101361 100027 gene locus_tag LOCUS_15420 101361 100027 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_15420 102349 101375 gene locus_tag LOCUS_15430 102349 101375 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_15430 102558 103511 gene locus_tag LOCUS_15440 102558 103511 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249823.1 protein_id gnl|my_center|LOCUS_15440 103708 103550 gene locus_tag LOCUS_15450 103708 103550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 103908 104975 gene locus_tag LOCUS_15460 103908 104975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 105938 105051 gene locus_tag LOCUS_15470 105938 105051 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_15470 107794 106067 gene locus_tag LOCUS_15480 107794 106067 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618734.1 protein_id gnl|my_center|LOCUS_15480 109975 108140 gene locus_tag LOCUS_15490 109975 108140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 112589 110100 gene locus_tag LOCUS_15500 112589 110100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 114054 112594 gene locus_tag LOCUS_15510 114054 112594 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068371.1 protein_id gnl|my_center|LOCUS_15510 115177 114158 gene locus_tag LOCUS_15520 gene rfbB 115177 114158 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836804.1 protein_id gnl|my_center|LOCUS_15520 116126 115224 gene locus_tag LOCUS_15530 gene rfbA 116126 115224 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_15530 118230 116248 gene locus_tag LOCUS_15540 118230 116248 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_15540 119238 118312 gene locus_tag LOCUS_15550 119238 118312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 120539 119376 gene locus_tag LOCUS_15560 120539 119376 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_15560 121803 120700 gene locus_tag LOCUS_15570 gene serC 121803 120700 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_15570 122544 121951 gene locus_tag LOCUS_15580 122544 121951 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898317.1 protein_id gnl|my_center|LOCUS_15580 124328 122622 gene locus_tag LOCUS_15590 124328 122622 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_15590 125154 124591 gene locus_tag LOCUS_15600 gene ahpC 125154 124591 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_15600 125833 125354 gene locus_tag LOCUS_15610 125833 125354 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_15610 127070 126000 gene locus_tag LOCUS_15620 127070 126000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 127227 128198 gene locus_tag LOCUS_15630 127227 128198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 129316 128471 gene locus_tag LOCUS_15640 129316 128471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 131213 129903 gene locus_tag LOCUS_15650 131213 129903 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966929.1 protein_id gnl|my_center|LOCUS_15650 132563 131289 gene locus_tag LOCUS_15660 132563 131289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 133373 132612 gene locus_tag LOCUS_15670 133373 132612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 134210 133389 gene locus_tag LOCUS_15680 134210 133389 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_15680 136062 134419 gene locus_tag LOCUS_15690 gene pckA 136062 134419 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626187.1 protein_id gnl|my_center|LOCUS_15690 136364 137668 gene locus_tag LOCUS_15700 136364 137668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 137858 138922 gene locus_tag LOCUS_15710 137858 138922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052675.1 protein_id gnl|my_center|LOCUS_15710 139048 140565 gene locus_tag LOCUS_15720 139048 140565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 141850 140678 gene locus_tag LOCUS_15730 141850 140678 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_15730 143085 141910 gene locus_tag LOCUS_15740 143085 141910 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_15740 143598 143245 gene locus_tag LOCUS_15750 143598 143245 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 protein_id gnl|my_center|LOCUS_15750 143855 143601 gene locus_tag LOCUS_15760 143855 143601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 145279 143861 gene locus_tag LOCUS_15770 gene xseA 145279 143861 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_15770 146173 145451 gene locus_tag LOCUS_15780 146173 145451 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499537.1 protein_id gnl|my_center|LOCUS_15780 147385 146252 gene locus_tag LOCUS_15790 gene rnd 147385 146252 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086908.1 protein_id gnl|my_center|LOCUS_15790 147481 148395 gene locus_tag LOCUS_15800 147481 148395 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_15800 149412 148666 gene locus_tag LOCUS_15810 149412 148666 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399515.1 protein_id gnl|my_center|LOCUS_15810 151190 149409 gene locus_tag LOCUS_15820 151190 149409 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574971.1 protein_id gnl|my_center|LOCUS_15820 151899 151321 gene locus_tag LOCUS_15830 151899 151321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399514.1 protein_id gnl|my_center|LOCUS_15830 153888 152467 gene locus_tag LOCUS_15840 153888 152467 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390049.1 protein_id gnl|my_center|LOCUS_15840 154039 154992 gene locus_tag LOCUS_15850 154039 154992 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_15850 156191 155061 gene locus_tag LOCUS_15860 gene proB 156191 155061 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194262.1 protein_id gnl|my_center|LOCUS_15860 157817 156300 gene locus_tag LOCUS_15870 157817 156300 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_15870 158331 157894 gene locus_tag LOCUS_15880 158331 157894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 158574 159335 gene locus_tag LOCUS_15890 gene gpmA 158574 159335 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_15890 159658 159446 gene locus_tag LOCUS_15900 159658 159446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 159871 159659 gene locus_tag LOCUS_15910 159871 159659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 162001 160025 gene locus_tag LOCUS_15920 162001 160025 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_15920 162414 162196 gene locus_tag LOCUS_15930 162414 162196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 162868 162503 gene locus_tag LOCUS_15940 162868 162503 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_15940 163377 163012 gene locus_tag LOCUS_15950 163377 163012 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_15950 164496 163492 gene locus_tag LOCUS_15960 164496 163492 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099471.1 protein_id gnl|my_center|LOCUS_15960 165114 164500 gene locus_tag LOCUS_15970 gene ureG 165114 164500 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238762.1 protein_id gnl|my_center|LOCUS_15970 165865 165254 gene locus_tag LOCUS_15980 165865 165254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15980 166707 165997 gene locus_tag LOCUS_15990 166707 165997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 168535 166814 gene locus_tag LOCUS_16000 gene ureC 168535 166814 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763096.1 protein_id gnl|my_center|LOCUS_16000 169039 168539 gene locus_tag LOCUS_16010 169039 168539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16010 169350 169048 gene locus_tag LOCUS_16020 gene ureA 169350 169048 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694143.1 protein_id gnl|my_center|LOCUS_16020 170657 169410 gene locus_tag LOCUS_16030 170657 169410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706784.1 protein_id gnl|my_center|LOCUS_16030 171917 170844 gene locus_tag LOCUS_16040 gene vanA 171917 170844 CDS product D-alanine--(R)-lactate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230018.1 protein_id gnl|my_center|LOCUS_16040 172184 172044 gene locus_tag LOCUS_16050 172184 172044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 173155 172424 gene locus_tag LOCUS_16060 173155 172424 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_16060 174026 173157 gene locus_tag LOCUS_16070 174026 173157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_16070 175098 174016 gene locus_tag LOCUS_16080 175098 174016 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_16080 175989 175099 gene locus_tag LOCUS_16090 175989 175099 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_16090 177378 176194 gene locus_tag LOCUS_16100 177378 176194 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_16100 177786 179120 gene locus_tag LOCUS_16110 177786 179120 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229542.1 protein_id gnl|my_center|LOCUS_16110 180447 179212 gene locus_tag LOCUS_16120 gene dltD 180447 179212 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227323.1 protein_id gnl|my_center|LOCUS_16120 180709 180536 gene locus_tag LOCUS_16130 180709 180536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 180951 180706 gene locus_tag LOCUS_16140 gene dltC 180951 180706 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288092.1 protein_id gnl|my_center|LOCUS_16140 182155 180944 gene locus_tag LOCUS_16150 gene dltB 182155 180944 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227327.1 protein_id gnl|my_center|LOCUS_16150 183742 182177 gene locus_tag LOCUS_16160 gene dltA 183742 182177 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770518.1 protein_id gnl|my_center|LOCUS_16160 187567 183941 gene locus_tag LOCUS_16170 187567 183941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 190582 187571 gene locus_tag LOCUS_16180 190582 187571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 190917 191063 gene locus_tag LOCUS_16190 190917 191063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 191069 191171 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgctaagcaaacctgccac 192989 191373 gene locus_tag LOCUS_16200 192989 191373 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_16200 193095 193436 gene locus_tag LOCUS_16210 193095 193436 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_16210 193914 193564 gene locus_tag LOCUS_16220 193914 193564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 198551 193935 gene locus_tag LOCUS_16230 198551 193935 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_16230 199262 198552 gene locus_tag LOCUS_16240 199262 198552 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181746.1 protein_id gnl|my_center|LOCUS_16240 199820 199401 gene locus_tag LOCUS_16250 199820 199401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 201781 199880 gene locus_tag LOCUS_16260 201781 199880 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931606.1 protein_id gnl|my_center|LOCUS_16260 201995 202342 gene locus_tag LOCUS_16270 201995 202342 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078309.1 protein_id gnl|my_center|LOCUS_16270 202339 203739 gene locus_tag LOCUS_16280 202339 203739 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989407.1 protein_id gnl|my_center|LOCUS_16280 203745 205061 gene locus_tag LOCUS_16290 203745 205061 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724230.1 protein_id gnl|my_center|LOCUS_16290 205140 205448 gene locus_tag LOCUS_16300 205140 205448 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639490.1 protein_id gnl|my_center|LOCUS_16300 205474 206355 gene locus_tag LOCUS_16310 205474 206355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 206808 206488 gene locus_tag LOCUS_16320 206808 206488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 207092 206808 gene locus_tag LOCUS_16330 207092 206808 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018213496.1 protein_id gnl|my_center|LOCUS_16330 207272 208138 gene locus_tag LOCUS_16340 207272 208138 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593336.1 protein_id gnl|my_center|LOCUS_16340 211851 208291 gene locus_tag LOCUS_16350 211851 208291 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068393.1 protein_id gnl|my_center|LOCUS_16350 215470 212006 gene locus_tag LOCUS_16360 215470 212006 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389423.1 protein_id gnl|my_center|LOCUS_16360 216174 215473 gene locus_tag LOCUS_16370 216174 215473 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_16370 217555 216875 gene locus_tag LOCUS_16380 217555 216875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 219930 217678 gene locus_tag LOCUS_16390 gene uvrB 219930 217678 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_16390 220568 219987 gene locus_tag LOCUS_16400 220568 219987 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816766.1 protein_id gnl|my_center|LOCUS_16400 221244 220561 gene locus_tag LOCUS_16410 221244 220561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 222458 221247 gene locus_tag LOCUS_16420 222458 221247 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705313.1 protein_id gnl|my_center|LOCUS_16420 222715 224610 gene locus_tag LOCUS_16430 222715 224610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 224603 225916 gene locus_tag LOCUS_16440 224603 225916 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_16440 227897 226290 gene locus_tag LOCUS_16450 227897 226290 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861179.1 protein_id gnl|my_center|LOCUS_16450 229262 227925 gene locus_tag LOCUS_16460 229262 227925 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963854.1 protein_id gnl|my_center|LOCUS_16460 229503 230291 gene locus_tag LOCUS_16470 229503 230291 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438434.1 protein_id gnl|my_center|LOCUS_16470 230437 230784 gene locus_tag LOCUS_16480 230437 230784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 232024 231005 gene locus_tag LOCUS_16490 232024 231005 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114555269.1 protein_id gnl|my_center|LOCUS_16490 232244 232011 gene locus_tag LOCUS_16500 232244 232011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16500 >Feature sequence6 1191 988 gene locus_tag LOCUS_16510 1191 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1332 1745 gene locus_tag LOCUS_16520 1332 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 3685 2393 gene locus_tag LOCUS_16530 3685 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 4446 3817 gene locus_tag LOCUS_16540 4446 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 5590 4670 gene locus_tag LOCUS_16550 5590 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 6233 5949 gene locus_tag LOCUS_16560 6233 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 7733 6468 gene locus_tag LOCUS_16570 7733 6468 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_16570 9405 7837 gene locus_tag LOCUS_16580 gene guaA 9405 7837 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965987.1 protein_id gnl|my_center|LOCUS_16580 9346 9567 gene locus_tag LOCUS_16590 9346 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 9573 10715 gene locus_tag LOCUS_16600 gene ansA 9573 10715 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_16600 11170 10787 gene locus_tag LOCUS_16610 11170 10787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 12259 11183 gene locus_tag LOCUS_16620 gene ychF 12259 11183 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218712.1 protein_id gnl|my_center|LOCUS_16620 12498 12884 gene locus_tag LOCUS_16630 12498 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 12874 13302 gene locus_tag LOCUS_16640 12874 13302 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386426.1 protein_id gnl|my_center|LOCUS_16640 13366 14481 gene locus_tag LOCUS_16650 13366 14481 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_16650 14562 14690 gene locus_tag LOCUS_16660 14562 14690 CDS product OadG-related small transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356001.1 protein_id gnl|my_center|LOCUS_16660 14693 16084 gene locus_tag LOCUS_16670 14693 16084 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263223.1 protein_id gnl|my_center|LOCUS_16670 16867 16358 gene locus_tag LOCUS_16680 16867 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 17837 16896 gene locus_tag LOCUS_16690 17837 16896 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 protein_id gnl|my_center|LOCUS_16690 18464 17868 gene locus_tag LOCUS_16700 gene rpsD 18464 17868 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_16700 18893 18483 gene locus_tag LOCUS_16710 gene rpsK 18893 18483 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_16710 19279 18905 gene locus_tag LOCUS_16720 gene rpsM 19279 18905 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_16720 19781 19563 gene locus_tag LOCUS_16730 gene infA 19781 19563 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_16730 20025 20516 gene locus_tag LOCUS_16740 20025 20516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 20542 20895 gene locus_tag LOCUS_16750 20542 20895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 21795 21007 gene locus_tag LOCUS_16760 gene map 21795 21007 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_16760 22418 21792 gene locus_tag LOCUS_16770 22418 21792 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_16770 23729 22443 gene locus_tag LOCUS_16780 gene secY 23729 22443 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_16780 24172 23723 gene locus_tag LOCUS_16790 gene rplO 24172 23723 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_16790 24358 24176 gene locus_tag LOCUS_16800 gene rpmD 24358 24176 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385305.1 protein_id gnl|my_center|LOCUS_16800 24886 24365 gene locus_tag LOCUS_16810 gene rpsE 24886 24365 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 protein_id gnl|my_center|LOCUS_16810 25263 24901 gene locus_tag LOCUS_16820 gene rplR 25263 24901 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966396.1 protein_id gnl|my_center|LOCUS_16820 25870 25334 gene locus_tag LOCUS_16830 gene rplF 25870 25334 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 protein_id gnl|my_center|LOCUS_16830 26302 25904 gene locus_tag LOCUS_16840 gene rpsH 26302 25904 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_16840 26626 26441 gene locus_tag LOCUS_16850 26626 26441 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_16850 27247 26690 gene locus_tag LOCUS_16860 gene rplE 27247 26690 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625881.1 protein_id gnl|my_center|LOCUS_16860 29231 27753 gene locus_tag LOCUS_16870 29231 27753 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_16870 30266 29397 gene locus_tag LOCUS_16880 30266 29397 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_16880 31041 30370 gene locus_tag LOCUS_16890 31041 30370 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112597.1 protein_id gnl|my_center|LOCUS_16890 31801 31034 gene locus_tag LOCUS_16900 31801 31034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 33303 32437 gene locus_tag LOCUS_16910 gene fba 33303 32437 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_16910 33999 33424 gene locus_tag LOCUS_16920 33999 33424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 34701 34186 gene locus_tag LOCUS_16930 gene cobO 34701 34186 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251080.1 protein_id gnl|my_center|LOCUS_16930 35678 34794 gene locus_tag LOCUS_16940 35678 34794 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430012.1 protein_id gnl|my_center|LOCUS_16940 35870 36532 gene locus_tag LOCUS_16950 35870 36532 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000069098.1 protein_id gnl|my_center|LOCUS_16950 37162 36641 gene locus_tag LOCUS_16960 37162 36641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 37627 37205 gene locus_tag LOCUS_16970 37627 37205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 38165 37620 gene locus_tag LOCUS_16980 38165 37620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 39110 38304 gene locus_tag LOCUS_16990 39110 38304 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113651.1 protein_id gnl|my_center|LOCUS_16990 40555 39287 gene locus_tag LOCUS_17000 40555 39287 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840969.1 protein_id gnl|my_center|LOCUS_17000 40771 41790 gene locus_tag LOCUS_17010 40771 41790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 42579 41815 gene locus_tag LOCUS_17020 42579 41815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285593.1 protein_id gnl|my_center|LOCUS_17020 43450 42572 gene locus_tag LOCUS_17030 gene lgt 43450 42572 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_17030 43795 43469 gene locus_tag LOCUS_17040 43795 43469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 44086 43808 gene locus_tag LOCUS_17050 44086 43808 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_17050 44708 44433 gene locus_tag LOCUS_17060 44708 44433 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_17060 44925 45512 gene locus_tag LOCUS_17070 44925 45512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 46707 45601 gene locus_tag LOCUS_17080 gene leuB 46707 45601 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143540.1 protein_id gnl|my_center|LOCUS_17080 47226 46711 gene locus_tag LOCUS_17090 gene leuD 47226 46711 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_17090 48504 47239 gene locus_tag LOCUS_17100 gene leuC 48504 47239 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_17100 50420 48885 gene locus_tag LOCUS_17110 50420 48885 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_17110 50843 51247 gene locus_tag LOCUS_17120 50843 51247 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358748.1 protein_id gnl|my_center|LOCUS_17120 51240 52370 gene locus_tag LOCUS_17130 51240 52370 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732398.1 protein_id gnl|my_center|LOCUS_17130 52678 53685 gene locus_tag LOCUS_17140 52678 53685 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_17140 53916 53713 gene locus_tag LOCUS_17150 53916 53713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 54475 53963 gene locus_tag LOCUS_17160 54475 53963 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_17160 56687 54522 gene locus_tag LOCUS_17170 56687 54522 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296832.1 protein_id gnl|my_center|LOCUS_17170 57645 56941 gene locus_tag LOCUS_17180 57645 56941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 58021 57638 gene locus_tag LOCUS_17190 58021 57638 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813646.1 protein_id gnl|my_center|LOCUS_17190 58882 58172 gene locus_tag LOCUS_17200 gene rplA 58882 58172 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061480.1 protein_id gnl|my_center|LOCUS_17200 59405 58977 gene locus_tag LOCUS_17210 gene rplK 59405 58977 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_17210 60061 59525 gene locus_tag LOCUS_17220 gene nusG 60061 59525 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_17220 60412 60065 gene locus_tag LOCUS_17230 60412 60065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 60566 60491 gene locus_tag LOCUS_t00430 60566 60491 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 60728 60579 gene locus_tag LOCUS_17240 gene rpmG 60728 60579 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881260.1 protein_id gnl|my_center|LOCUS_17240 62093 60903 gene locus_tag LOCUS_17250 gene tuf 62093 60903 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903497.1 protein_id gnl|my_center|LOCUS_17250 62261 62185 gene locus_tag LOCUS_t00440 62261 62185 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 62342 62267 gene locus_tag LOCUS_t00450 62342 62267 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 62431 62348 gene locus_tag LOCUS_t00460 62431 62348 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 62744 62670 gene locus_tag LOCUS_t00470 62744 62670 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 63474 62761 gene locus_tag LOCUS_17260 63474 62761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 64395 63484 gene locus_tag LOCUS_17270 gene rlmB 64395 63484 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_17270 66255 64783 gene locus_tag LOCUS_17280 gene cysS 66255 64783 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938870.1 protein_id gnl|my_center|LOCUS_17280 66789 66292 gene locus_tag LOCUS_17290 gene ispF 66789 66292 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_17290 67658 66909 gene locus_tag LOCUS_17300 gene ispD 67658 66909 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_17300 68734 67655 gene locus_tag LOCUS_17310 gene disA 68734 67655 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296331.1 protein_id gnl|my_center|LOCUS_17310 69406 68885 gene locus_tag LOCUS_17320 69406 68885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 70019 69420 gene locus_tag LOCUS_17330 70019 69420 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_17330 70285 70142 gene locus_tag LOCUS_17340 70285 70142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 73106 70380 gene locus_tag LOCUS_17350 73106 70380 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_17350 73827 73312 gene locus_tag LOCUS_17360 73827 73312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 75160 74279 gene locus_tag LOCUS_17370 75160 74279 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_17370 75653 75162 gene locus_tag LOCUS_17380 75653 75162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 76658 75804 gene locus_tag LOCUS_17390 gene agaD 76658 75804 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000534347.1 protein_id gnl|my_center|LOCUS_17390 77454 76648 gene locus_tag LOCUS_17400 gene agaC 77454 76648 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101866.1 protein_id gnl|my_center|LOCUS_17400 78163 77681 gene locus_tag LOCUS_17410 gene agaB 78163 77681 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098017.1 protein_id gnl|my_center|LOCUS_17410 80313 78340 gene locus_tag LOCUS_17420 80313 78340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 80884 80414 gene locus_tag LOCUS_17430 gene greA 80884 80414 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_17430 81214 80930 gene locus_tag LOCUS_17440 81214 80930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 81518 81442 gene locus_tag LOCUS_t00480 81518 81442 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 82454 81555 gene locus_tag LOCUS_17450 gene ispE 82454 81555 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722719.1 protein_id gnl|my_center|LOCUS_17450 82760 82458 gene locus_tag LOCUS_17460 82760 82458 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126664.1 protein_id gnl|my_center|LOCUS_17460 83429 82983 gene locus_tag LOCUS_17470 gene dtd 83429 82983 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_17470 84076 83426 gene locus_tag LOCUS_17480 84076 83426 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816920.1 protein_id gnl|my_center|LOCUS_17480 86569 84386 gene locus_tag LOCUS_17490 86569 84386 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 protein_id gnl|my_center|LOCUS_17490 89219 86562 gene locus_tag LOCUS_17500 89219 86562 CDS product YhgE/Pip family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143686.1 protein_id gnl|my_center|LOCUS_17500 91561 89543 gene locus_tag LOCUS_17510 gene htpG 91561 89543 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_17510 91780 92508 gene locus_tag LOCUS_17520 91780 92508 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393691.1 protein_id gnl|my_center|LOCUS_17520 93978 92566 gene locus_tag LOCUS_17530 93978 92566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 94662 93982 gene locus_tag LOCUS_17540 94662 93982 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_17540 95442 94762 gene locus_tag LOCUS_17550 gene hypB 95442 94762 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940974.1 protein_id gnl|my_center|LOCUS_17550 95861 95508 gene locus_tag LOCUS_17560 gene hypA 95861 95508 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933459.1 protein_id gnl|my_center|LOCUS_17560 96662 95868 gene locus_tag LOCUS_17570 gene tatC 96662 95868 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887452.1 protein_id gnl|my_center|LOCUS_17570 97237 96662 gene locus_tag LOCUS_17580 97237 96662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 97657 97343 gene locus_tag LOCUS_17590 gene rsbV 97657 97343 CDS product anti sigma b factor antagonist RsbV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266470.1 protein_id gnl|my_center|LOCUS_17590 98455 97712 gene locus_tag LOCUS_17600 98455 97712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 98881 98465 gene locus_tag LOCUS_17610 98881 98465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 99741 99019 gene locus_tag LOCUS_17620 gene ubiE 99741 99019 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022004.1 protein_id gnl|my_center|LOCUS_17620 101046 99742 gene locus_tag LOCUS_17630 101046 99742 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_17630 101186 101440 gene locus_tag LOCUS_17640 101186 101440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 101443 101907 gene locus_tag LOCUS_17650 101443 101907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 103310 101934 gene locus_tag LOCUS_17660 gene nhaA 103310 101934 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_17660 104424 103483 gene locus_tag LOCUS_17670 104424 103483 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 protein_id gnl|my_center|LOCUS_17670 105511 104558 gene locus_tag LOCUS_17680 105511 104558 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_17680 105757 106710 gene locus_tag LOCUS_17690 gene manA 105757 106710 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_17690 107960 106956 gene locus_tag LOCUS_17700 107960 106956 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938705.1 protein_id gnl|my_center|LOCUS_17700 108054 108470 gene locus_tag LOCUS_17710 108054 108470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 108870 108619 gene locus_tag LOCUS_17720 108870 108619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 111058 108977 gene locus_tag LOCUS_17730 gene pflB 111058 108977 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000195485.1 protein_id gnl|my_center|LOCUS_17730 113546 111330 gene locus_tag LOCUS_17740 113546 111330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 114330 113536 gene locus_tag LOCUS_17750 114330 113536 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_17750 115300 114452 gene locus_tag LOCUS_17760 115300 114452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 116219 115470 gene locus_tag LOCUS_17770 116219 115470 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565300.1 protein_id gnl|my_center|LOCUS_17770 117321 116224 gene locus_tag LOCUS_17780 117321 116224 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_17780 117668 117856 gene locus_tag LOCUS_17790 117668 117856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 118674 117940 gene locus_tag LOCUS_17800 gene rph 118674 117940 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229452.1 protein_id gnl|my_center|LOCUS_17800 119608 118721 gene locus_tag LOCUS_17810 gene racE 119608 118721 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109674.1 protein_id gnl|my_center|LOCUS_17810 120597 119689 gene locus_tag LOCUS_17820 120597 119689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 122256 120706 gene locus_tag LOCUS_17830 122256 120706 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475458.1 protein_id gnl|my_center|LOCUS_17830 123997 122432 gene locus_tag LOCUS_17840 123997 122432 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054433.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence7 135 60 gene locus_tag LOCUS_t00490 135 60 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1163 189 gene locus_tag LOCUS_17850 gene argB 1163 189 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_17850 2272 1202 gene locus_tag LOCUS_17860 gene argC 2272 1202 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225637.1 protein_id gnl|my_center|LOCUS_17860 3643 2429 gene locus_tag LOCUS_17870 3643 2429 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_17870 3908 4291 gene locus_tag LOCUS_17880 3908 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4405 5484 gene locus_tag LOCUS_17890 4405 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 5491 6555 gene locus_tag LOCUS_17900 5491 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 6761 7621 gene locus_tag LOCUS_17910 6761 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 7777 8241 gene locus_tag LOCUS_17920 7777 8241 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_17920 8276 9058 gene locus_tag LOCUS_17930 8276 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 9670 9128 gene locus_tag LOCUS_17940 9670 9128 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080866.1 protein_id gnl|my_center|LOCUS_17940 9834 9911 gene locus_tag LOCUS_t00500 9834 9911 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12202 10112 gene locus_tag LOCUS_17950 12202 10112 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461804.1 protein_id gnl|my_center|LOCUS_17950 12602 13477 gene locus_tag LOCUS_17960 12602 13477 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868898.1 protein_id gnl|my_center|LOCUS_17960 13477 14253 gene locus_tag LOCUS_17970 13477 14253 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_17970 17045 14475 gene locus_tag LOCUS_17980 17045 14475 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_17980 21490 17759 gene locus_tag LOCUS_17990 21490 17759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 24470 21933 gene locus_tag LOCUS_18000 24470 21933 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902213.1 protein_id gnl|my_center|LOCUS_18000 24683 24979 gene locus_tag LOCUS_18010 24683 24979 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053232.1 protein_id gnl|my_center|LOCUS_18010 25234 25046 gene locus_tag LOCUS_18020 25234 25046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 26590 25253 gene locus_tag LOCUS_18030 26590 25253 CDS product coproporphyrinogen III oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074137.1 protein_id gnl|my_center|LOCUS_18030 29733 26689 gene locus_tag LOCUS_18040 29733 26689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 30944 30216 gene locus_tag LOCUS_18050 gene nagB 30944 30216 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_18050 31617 31117 gene locus_tag LOCUS_18060 31617 31117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 32973 31636 gene locus_tag LOCUS_18070 gene glmM 32973 31636 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_18070 33537 33142 gene locus_tag LOCUS_18080 gene rpsI 33537 33142 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814701.1 protein_id gnl|my_center|LOCUS_18080 33984 33541 gene locus_tag LOCUS_18090 gene rplM 33984 33541 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016252.1 protein_id gnl|my_center|LOCUS_18090 35065 34190 gene locus_tag LOCUS_18100 35065 34190 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_18100 35620 35165 gene locus_tag LOCUS_18110 35620 35165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 36488 35862 gene locus_tag LOCUS_18120 36488 35862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 36892 37242 gene locus_tag LOCUS_18130 36892 37242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 37334 37531 gene locus_tag LOCUS_18140 37334 37531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 37541 37789 gene locus_tag LOCUS_18150 37541 37789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 37892 38542 gene locus_tag LOCUS_18160 37892 38542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 40635 39148 gene locus_tag LOCUS_18170 40635 39148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 41374 40730 gene locus_tag LOCUS_18180 41374 40730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 41758 41375 gene locus_tag LOCUS_18190 41758 41375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 41906 42127 gene locus_tag LOCUS_18200 41906 42127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 42130 42297 gene locus_tag LOCUS_18210 42130 42297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 42497 42673 gene locus_tag LOCUS_18220 42497 42673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 42670 42891 gene locus_tag LOCUS_18230 42670 42891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 42888 43289 gene locus_tag LOCUS_18240 42888 43289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 43279 43554 gene locus_tag LOCUS_18250 43279 43554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 43541 43765 gene locus_tag LOCUS_18260 43541 43765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 43779 44240 gene locus_tag LOCUS_18270 43779 44240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 44541 44762 gene locus_tag LOCUS_18280 44541 44762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 44759 45151 gene locus_tag LOCUS_18290 44759 45151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 45148 45429 gene locus_tag LOCUS_18300 45148 45429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 45583 45810 gene locus_tag LOCUS_18310 45583 45810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 45810 46004 gene locus_tag LOCUS_18320 45810 46004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 46006 46227 gene locus_tag LOCUS_18330 46006 46227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 46227 47477 gene locus_tag LOCUS_18340 46227 47477 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_18340 47560 47811 gene locus_tag LOCUS_18350 47560 47811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 47818 47994 gene locus_tag LOCUS_18360 47818 47994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 47972 48292 gene locus_tag LOCUS_18370 gene mihF 47972 48292 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224622.1 protein_id gnl|my_center|LOCUS_18370 48289 48693 gene locus_tag LOCUS_18380 48289 48693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 48690 49145 gene locus_tag LOCUS_18390 48690 49145 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609585.1 protein_id gnl|my_center|LOCUS_18390 49156 49431 gene locus_tag LOCUS_18400 49156 49431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 49431 49871 gene locus_tag LOCUS_18410 gene dut 49431 49871 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_18410 49883 50332 gene locus_tag LOCUS_18420 49883 50332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 50439 50756 gene locus_tag LOCUS_18430 50439 50756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 50927 51349 gene locus_tag LOCUS_18440 50927 51349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 51330 53066 gene locus_tag LOCUS_18450 51330 53066 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296487.1 protein_id gnl|my_center|LOCUS_18450 53069 54346 gene locus_tag LOCUS_18460 53069 54346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 54327 54962 gene locus_tag LOCUS_18470 54327 54962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 54967 56259 gene locus_tag LOCUS_18480 54967 56259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 56270 56572 gene locus_tag LOCUS_18490 56270 56572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 56569 56880 gene locus_tag LOCUS_18500 56569 56880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 56912 57244 gene locus_tag LOCUS_18510 56912 57244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 57241 57570 gene locus_tag LOCUS_18520 57241 57570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 57581 58177 gene locus_tag LOCUS_18530 57581 58177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 58188 58601 gene locus_tag LOCUS_18540 58188 58601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 58510 58788 gene locus_tag LOCUS_18550 58510 58788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 58879 61533 gene locus_tag LOCUS_18560 58879 61533 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286502.1 protein_id gnl|my_center|LOCUS_18560 61523 62260 gene locus_tag LOCUS_18570 61523 62260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 62251 63999 gene locus_tag LOCUS_18580 62251 63999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 64181 64561 gene locus_tag LOCUS_18590 64181 64561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 64534 66102 gene locus_tag LOCUS_18600 64534 66102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 67520 66645 gene locus_tag LOCUS_18610 67520 66645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 67710 68156 gene locus_tag LOCUS_18620 67710 68156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 68158 68418 gene locus_tag LOCUS_18630 68158 68418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 68411 69112 gene locus_tag LOCUS_18640 68411 69112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 69102 70166 gene locus_tag LOCUS_18650 69102 70166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 70418 70236 gene locus_tag LOCUS_18660 70418 70236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 70709 70566 gene locus_tag LOCUS_18670 70709 70566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 71269 71000 gene locus_tag LOCUS_18680 71269 71000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 71663 71262 gene locus_tag LOCUS_18690 71663 71262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 72153 72401 gene locus_tag LOCUS_18700 72153 72401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 74140 72458 gene locus_tag LOCUS_18710 74140 72458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 75657 74137 gene locus_tag LOCUS_18720 gene gatA 75657 74137 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_18720 75968 75657 gene locus_tag LOCUS_18730 75968 75657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 78878 76164 gene locus_tag LOCUS_18740 78878 76164 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362858.1 protein_id gnl|my_center|LOCUS_18740 79378 78944 gene locus_tag LOCUS_18750 79378 78944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 81056 79743 gene locus_tag LOCUS_18760 81056 79743 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 protein_id gnl|my_center|LOCUS_18760 82169 81201 gene locus_tag LOCUS_18770 82169 81201 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289121.1 protein_id gnl|my_center|LOCUS_18770 82422 82859 gene locus_tag LOCUS_18780 82422 82859 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723309.1 protein_id gnl|my_center|LOCUS_18780 84038 82962 gene locus_tag LOCUS_18790 84038 82962 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_18790 84715 84044 gene locus_tag LOCUS_18800 84715 84044 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674592.1 protein_id gnl|my_center|LOCUS_18800 86740 84866 gene locus_tag LOCUS_18810 86740 84866 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948291.1 protein_id gnl|my_center|LOCUS_18810 89520 87106 gene locus_tag LOCUS_18820 89520 87106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 90045 89545 gene locus_tag LOCUS_18830 90045 89545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 90725 90057 gene locus_tag LOCUS_18840 90725 90057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 91886 90735 gene locus_tag LOCUS_18850 gene alr 91886 90735 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_18850 93505 91889 gene locus_tag LOCUS_18860 93505 91889 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403284.1 protein_id gnl|my_center|LOCUS_18860 94049 93483 gene locus_tag LOCUS_18870 94049 93483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence8 215 577 gene locus_tag LOCUS_18880 215 577 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965745.1 protein_id gnl|my_center|LOCUS_18880 858 646 gene locus_tag LOCUS_18890 858 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 1257 868 gene locus_tag LOCUS_18900 1257 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 1647 1321 gene locus_tag LOCUS_18910 1647 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1798 2613 gene locus_tag LOCUS_18920 1798 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2709 3233 gene locus_tag LOCUS_18930 gene ruvC 2709 3233 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_18930 3230 3853 gene locus_tag LOCUS_18940 gene ruvA 3230 3853 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 protein_id gnl|my_center|LOCUS_18940 3855 4925 gene locus_tag LOCUS_18950 gene ruvB 3855 4925 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_18950 5010 6677 gene locus_tag LOCUS_18960 5010 6677 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_18960 6728 7579 gene locus_tag LOCUS_18970 gene folD 6728 7579 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_18970 8046 7819 gene locus_tag LOCUS_18980 8046 7819 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085446.1 protein_id gnl|my_center|LOCUS_18980 8320 9885 gene locus_tag LOCUS_18990 8320 9885 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389450.1 protein_id gnl|my_center|LOCUS_18990 9937 10365 gene locus_tag LOCUS_19000 9937 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 10375 12129 gene locus_tag LOCUS_19010 10375 12129 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 protein_id gnl|my_center|LOCUS_19010 12952 12206 gene locus_tag LOCUS_19020 12952 12206 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_19020 13084 15249 gene locus_tag LOCUS_19030 13084 15249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 15250 15819 gene locus_tag LOCUS_19040 15250 15819 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405836.1 protein_id gnl|my_center|LOCUS_19040 16055 15801 gene locus_tag LOCUS_19050 16055 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 15939 16439 gene locus_tag LOCUS_19060 15939 16439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 17622 16408 gene locus_tag LOCUS_19070 gene queA 17622 16408 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965581.1 protein_id gnl|my_center|LOCUS_19070 18260 17679 gene locus_tag LOCUS_19080 18260 17679 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_19080 19825 18332 gene locus_tag LOCUS_19090 19825 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 20470 20006 gene locus_tag LOCUS_19100 20470 20006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322028.1 protein_id gnl|my_center|LOCUS_19100 20636 21556 gene locus_tag LOCUS_19110 20636 21556 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261898.1 protein_id gnl|my_center|LOCUS_19110 21890 21618 gene locus_tag LOCUS_19120 21890 21618 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966918.1 protein_id gnl|my_center|LOCUS_19120 22202 21981 gene locus_tag LOCUS_19130 22202 21981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 24742 22412 gene locus_tag LOCUS_19140 24742 22412 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_19140 26052 24913 gene locus_tag LOCUS_19150 gene mnmA 26052 24913 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460325.1 protein_id gnl|my_center|LOCUS_19150 26551 26123 gene locus_tag LOCUS_19160 26551 26123 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_19160 26783 27721 gene locus_tag LOCUS_19170 gene cysK 26783 27721 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_19170 29538 27907 gene locus_tag LOCUS_19180 gene pruA 29538 27907 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247315.1 protein_id gnl|my_center|LOCUS_19180 30295 29708 gene locus_tag LOCUS_19190 30295 29708 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_19190 30472 33363 gene locus_tag LOCUS_19200 gene uvrA 30472 33363 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_19200 34403 33378 gene locus_tag LOCUS_19210 34403 33378 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390097.1 protein_id gnl|my_center|LOCUS_19210 35921 34464 gene locus_tag LOCUS_19220 35921 34464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 36512 36030 gene locus_tag LOCUS_19230 36512 36030 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037432.1 protein_id gnl|my_center|LOCUS_19230 36790 37650 gene locus_tag LOCUS_19240 36790 37650 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_19240 37840 39180 gene locus_tag LOCUS_19250 37840 39180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 39191 39976 gene locus_tag LOCUS_19260 39191 39976 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_19260 40197 41189 gene locus_tag LOCUS_19270 gene hemH 40197 41189 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023853055.1 protein_id gnl|my_center|LOCUS_19270 41295 42263 gene locus_tag LOCUS_19280 41295 42263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 42345 43265 gene locus_tag LOCUS_19290 gene rapZ 42345 43265 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641036.1 protein_id gnl|my_center|LOCUS_19290 43362 44294 gene locus_tag LOCUS_19300 gene whiA 43362 44294 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976869.1 protein_id gnl|my_center|LOCUS_19300 44528 45553 gene locus_tag LOCUS_19310 gene gap 44528 45553 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_19310 45686 46879 gene locus_tag LOCUS_19320 45686 46879 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_19320 46869 47639 gene locus_tag LOCUS_19330 gene tpiA 46869 47639 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546605.1 protein_id gnl|my_center|LOCUS_19330 47644 49200 gene locus_tag LOCUS_19340 gene gpmI 47644 49200 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_19340 49469 49597 gene locus_tag LOCUS_19350 49469 49597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 49869 50861 gene locus_tag LOCUS_19360 49869 50861 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289456.1 protein_id gnl|my_center|LOCUS_19360 50876 51691 gene locus_tag LOCUS_19370 50876 51691 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 protein_id gnl|my_center|LOCUS_19370 51714 52631 gene locus_tag LOCUS_19380 51714 52631 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700025.1 protein_id gnl|my_center|LOCUS_19380 52769 53164 gene locus_tag LOCUS_19390 52769 53164 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286668.1 protein_id gnl|my_center|LOCUS_19390 53303 53557 gene locus_tag LOCUS_19400 53303 53557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 53678 55354 gene locus_tag LOCUS_19410 53678 55354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014806.1 protein_id gnl|my_center|LOCUS_19410 56822 55389 gene locus_tag LOCUS_19420 56822 55389 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_19420 56980 57585 gene locus_tag LOCUS_19430 56980 57585 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673938.1 protein_id gnl|my_center|LOCUS_19430 57705 59306 gene locus_tag LOCUS_19440 57705 59306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 59450 61135 gene locus_tag LOCUS_19450 59450 61135 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_19450 62879 61389 gene locus_tag LOCUS_19460 gene gltX 62879 61389 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_19460 63012 63764 gene locus_tag LOCUS_19470 63012 63764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 63761 66328 gene locus_tag LOCUS_19480 63761 66328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 66577 67860 gene locus_tag LOCUS_19490 gene metK 66577 67860 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_19490 68625 67981 gene locus_tag LOCUS_19500 gene serB 68625 67981 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263175.1 protein_id gnl|my_center|LOCUS_19500 69551 68685 gene locus_tag LOCUS_19510 69551 68685 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948024.1 protein_id gnl|my_center|LOCUS_19510 70691 69711 gene locus_tag LOCUS_19520 gene pta 70691 69711 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_19520 70909 72111 gene locus_tag LOCUS_19530 gene glf 70909 72111 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_19530 72104 73174 gene locus_tag LOCUS_19540 72104 73174 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964797.1 protein_id gnl|my_center|LOCUS_19540 73277 73822 gene locus_tag LOCUS_19550 73277 73822 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_19550 73910 74485 gene locus_tag LOCUS_19560 73910 74485 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937833.1 protein_id gnl|my_center|LOCUS_19560 74530 75567 gene locus_tag LOCUS_19570 74530 75567 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_19570 76876 75554 gene locus_tag LOCUS_19580 gene rlmD 76876 75554 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143127.1 protein_id gnl|my_center|LOCUS_19580 79629 76981 gene locus_tag LOCUS_19590 79629 76981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 80179 81420 gene locus_tag LOCUS_19600 gene arcA 80179 81420 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681549.1 protein_id gnl|my_center|LOCUS_19600 81530 82525 gene locus_tag LOCUS_19610 gene argF 81530 82525 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_19610 82670 84262 gene locus_tag LOCUS_19620 82670 84262 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356134.1 protein_id gnl|my_center|LOCUS_19620 84494 85096 gene locus_tag LOCUS_19630 84494 85096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 86635 85154 gene locus_tag LOCUS_19640 86635 85154 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_19640 86799 87296 gene locus_tag LOCUS_19650 86799 87296 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817058.1 protein_id gnl|my_center|LOCUS_19650 87461 87534 gene locus_tag LOCUS_t00510 87461 87534 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 87556 87632 gene locus_tag LOCUS_t00520 87556 87632 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 87669 87745 gene locus_tag LOCUS_t00530 87669 87745 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38