>Feature sequence01 96 1340 gene locus_tag LOCUS_00010 96 1340 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198991.1 protein_id gnl|my_center|LOCUS_00010 1712 2704 gene locus_tag LOCUS_00020 1712 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2722 2913 gene locus_tag LOCUS_00030 2722 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3063 3326 gene locus_tag LOCUS_00040 3063 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3349 3519 gene locus_tag LOCUS_00050 3349 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3892 5451 gene locus_tag LOCUS_00060 3892 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5462 5629 gene locus_tag LOCUS_00070 5462 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5642 5887 gene locus_tag LOCUS_00080 5642 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6168 6965 gene locus_tag LOCUS_00090 6168 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7262 6996 gene locus_tag LOCUS_00100 7262 6996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 7491 7267 gene locus_tag LOCUS_00110 7491 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7684 7893 gene locus_tag LOCUS_00120 7684 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 8083 9027 gene locus_tag LOCUS_00130 8083 9027 CDS product IS481 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026608922.1 protein_id gnl|my_center|LOCUS_00130 9437 11317 gene locus_tag LOCUS_00140 9437 11317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 11493 12806 gene locus_tag LOCUS_00150 11493 12806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13350 12865 gene locus_tag LOCUS_00160 gene rlmH 13350 12865 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695939.1 protein_id gnl|my_center|LOCUS_00160 14015 13347 gene locus_tag LOCUS_00170 14015 13347 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_00170 14959 14012 gene locus_tag LOCUS_00180 14959 14012 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858506.1 protein_id gnl|my_center|LOCUS_00180 16315 15029 gene locus_tag LOCUS_00190 16315 15029 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_00190 16798 17169 gene locus_tag LOCUS_00200 16798 17169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17180 17689 gene locus_tag LOCUS_00210 17180 17689 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_00210 17908 18411 gene locus_tag LOCUS_00220 gene ruvC 17908 18411 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_00220 18413 19012 gene locus_tag LOCUS_00230 gene ruvA 18413 19012 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_00230 19029 20066 gene locus_tag LOCUS_00240 gene ruvB 19029 20066 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344449.1 protein_id gnl|my_center|LOCUS_00240 20310 21653 gene locus_tag LOCUS_00250 gene glmM 20310 21653 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_00250 21663 22355 gene locus_tag LOCUS_00260 21663 22355 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948613.1 protein_id gnl|my_center|LOCUS_00260 22378 23241 gene locus_tag LOCUS_00270 22378 23241 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_00270 23270 24166 gene locus_tag LOCUS_00280 23270 24166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 24239 24538 gene locus_tag LOCUS_00290 24239 24538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 24563 25411 gene locus_tag LOCUS_00300 24563 25411 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_00300 25424 26287 gene locus_tag LOCUS_00310 25424 26287 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966382.1 protein_id gnl|my_center|LOCUS_00310 26365 27168 gene locus_tag LOCUS_00320 26365 27168 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_00320 27179 27463 gene locus_tag LOCUS_00330 27179 27463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 27481 28245 gene locus_tag LOCUS_00340 gene truA 27481 28245 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_00340 28211 29851 gene locus_tag LOCUS_00350 28211 29851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 29868 30746 gene locus_tag LOCUS_00360 29868 30746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 30787 33054 gene locus_tag LOCUS_00370 30787 33054 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_00370 33193 34416 gene locus_tag LOCUS_00380 33193 34416 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_00380 34491 35114 gene locus_tag LOCUS_00390 34491 35114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 35111 35659 gene locus_tag LOCUS_00400 35111 35659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 35790 36566 gene locus_tag LOCUS_00410 gene tpiA 35790 36566 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964030.1 protein_id gnl|my_center|LOCUS_00410 36685 37134 gene locus_tag LOCUS_00420 36685 37134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 37170 38693 gene locus_tag LOCUS_00430 gene gpmI 37170 38693 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_00430 39867 38785 gene locus_tag LOCUS_00440 39867 38785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 40120 41157 gene locus_tag LOCUS_00450 gene gap 40120 41157 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_00450 43434 41491 gene locus_tag LOCUS_00460 43434 41491 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_00460 44236 43532 gene locus_tag LOCUS_00470 44236 43532 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814522.1 protein_id gnl|my_center|LOCUS_00470 44957 44229 gene locus_tag LOCUS_00480 44957 44229 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_00480 46375 45158 gene locus_tag LOCUS_00490 gene tyrS 46375 45158 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_00490 46772 46966 gene locus_tag LOCUS_00500 46772 46966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 47006 48745 gene locus_tag LOCUS_00510 47006 48745 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_00510 48738 50504 gene locus_tag LOCUS_00520 48738 50504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_00520 50738 51637 gene locus_tag LOCUS_00530 50738 51637 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_00530 51634 52263 gene locus_tag LOCUS_00540 51634 52263 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_00540 52360 52812 gene locus_tag LOCUS_00550 52360 52812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 52826 53566 gene locus_tag LOCUS_00560 52826 53566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 53706 53779 gene locus_tag LOCUS_t00010 53706 53779 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 53829 53905 gene locus_tag LOCUS_t00020 53829 53905 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 53960 54037 gene locus_tag LOCUS_t00030 53960 54037 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 55397 54234 gene locus_tag LOCUS_00570 55397 54234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 56068 57036 gene locus_tag LOCUS_00580 56068 57036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 57510 58313 gene locus_tag LOCUS_00590 gene thiD 57510 58313 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_00590 58310 59623 gene locus_tag LOCUS_00600 gene thiC 58310 59623 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_00600 59945 60466 gene locus_tag LOCUS_00610 gene thiW 59945 60466 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_00610 60466 61284 gene locus_tag LOCUS_00620 gene thiM 60466 61284 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244274.1 protein_id gnl|my_center|LOCUS_00620 61425 61895 gene locus_tag LOCUS_00630 61425 61895 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_00630 61918 62559 gene locus_tag LOCUS_00640 gene thiE 61918 62559 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_00640 62759 64177 gene locus_tag LOCUS_00650 gene pyk 62759 64177 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_00650 64667 66745 gene locus_tag LOCUS_00660 gene pflB 64667 66745 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721911.1 protein_id gnl|my_center|LOCUS_00660 66735 66962 gene locus_tag LOCUS_00670 66735 66962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 67038 67289 gene locus_tag LOCUS_00680 67038 67289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 67546 68289 gene locus_tag LOCUS_00690 gene pflA 67546 68289 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807699.1 protein_id gnl|my_center|LOCUS_00690 68551 69048 gene locus_tag LOCUS_00700 68551 69048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 69197 70276 gene locus_tag LOCUS_00710 69197 70276 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288877.1 protein_id gnl|my_center|LOCUS_00710 70598 74653 gene locus_tag LOCUS_00720 gene carB 70598 74653 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_00720 74784 75989 gene locus_tag LOCUS_00730 74784 75989 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_00730 77096 76278 gene locus_tag LOCUS_00740 77096 76278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 77518 77162 gene locus_tag LOCUS_00750 gene spoVAE 77518 77162 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_00750 78534 77518 gene locus_tag LOCUS_00760 gene spoVAD 78534 77518 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_00760 78790 80043 gene locus_tag LOCUS_00770 78790 80043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 80043 80792 gene locus_tag LOCUS_00780 80043 80792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 81318 80971 gene locus_tag LOCUS_00790 81318 80971 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_00790 81568 82386 gene locus_tag LOCUS_00800 81568 82386 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680483.1 protein_id gnl|my_center|LOCUS_00800 84749 83031 gene locus_tag LOCUS_00810 84749 83031 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_00810 85027 86181 gene locus_tag LOCUS_00820 85027 86181 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418164.1 protein_id gnl|my_center|LOCUS_00820 86333 87664 gene locus_tag LOCUS_00830 86333 87664 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048231.1 protein_id gnl|my_center|LOCUS_00830 87761 88165 gene locus_tag LOCUS_00840 87761 88165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 88282 88725 gene locus_tag LOCUS_00850 88282 88725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 88778 88960 gene locus_tag LOCUS_00860 gene rpmF 88778 88960 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_00860 89182 90513 gene locus_tag LOCUS_00870 gene der 89182 90513 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_00870 90532 91191 gene locus_tag LOCUS_00880 gene plsY 90532 91191 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_00880 91206 92210 gene locus_tag LOCUS_00890 91206 92210 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392833.1 protein_id gnl|my_center|LOCUS_00890 92240 92635 gene locus_tag LOCUS_00900 92240 92635 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496720.1 protein_id gnl|my_center|LOCUS_00900 92730 93434 gene locus_tag LOCUS_00910 gene pyrH 92730 93434 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_00910 93465 94019 gene locus_tag LOCUS_00920 gene frr 93465 94019 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_00920 94023 94754 gene locus_tag LOCUS_00930 94023 94754 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_00930 94759 95589 gene locus_tag LOCUS_00940 gene cdsA 94759 95589 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_00940 95714 96859 gene locus_tag LOCUS_00950 95714 96859 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_00950 97220 98260 gene locus_tag LOCUS_00960 gene rseP 97220 98260 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_00960 98275 99327 gene locus_tag LOCUS_00970 gene ispG 98275 99327 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 protein_id gnl|my_center|LOCUS_00970 99343 103821 gene locus_tag LOCUS_00980 99343 103821 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_00980 103997 105196 gene locus_tag LOCUS_00990 gene hisZ 103997 105196 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170323.1 protein_id gnl|my_center|LOCUS_00990 105215 105850 gene locus_tag LOCUS_01000 gene hisG 105215 105850 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_01000 105880 107169 gene locus_tag LOCUS_01010 gene hisD 105880 107169 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_01010 107182 107766 gene locus_tag LOCUS_01020 gene hisB 107182 107766 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 protein_id gnl|my_center|LOCUS_01020 107767 108381 gene locus_tag LOCUS_01030 gene hisH 107767 108381 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964257.1 protein_id gnl|my_center|LOCUS_01030 108383 109138 gene locus_tag LOCUS_01040 gene hisF 108383 109138 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949116.1 protein_id gnl|my_center|LOCUS_01040 109144 109521 gene locus_tag LOCUS_01050 109144 109521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 109521 109874 gene locus_tag LOCUS_01060 gene hisI 109521 109874 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 protein_id gnl|my_center|LOCUS_01060 109876 110214 gene locus_tag LOCUS_01070 gene hisE 109876 110214 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949117.1 protein_id gnl|my_center|LOCUS_01070 110367 111131 gene locus_tag LOCUS_01080 110367 111131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 111275 112675 gene locus_tag LOCUS_01090 gene miaB 111275 112675 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_01090 112712 113122 gene locus_tag LOCUS_01100 112712 113122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 113339 115954 gene locus_tag LOCUS_01110 gene mutS 113339 115954 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_01110 116037 118115 gene locus_tag LOCUS_01120 gene mutL 116037 118115 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_01120 118137 119081 gene locus_tag LOCUS_01130 gene miaA 118137 119081 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_01130 119155 119397 gene locus_tag LOCUS_01140 gene hfq 119155 119397 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_01140 119412 120647 gene locus_tag LOCUS_01150 119412 120647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 120595 121341 gene locus_tag LOCUS_01160 120595 121341 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_01160 121344 121793 gene locus_tag LOCUS_01170 gene sepF 121344 121793 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244791.1 protein_id gnl|my_center|LOCUS_01170 121796 122578 gene locus_tag LOCUS_01180 121796 122578 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286624.1 protein_id gnl|my_center|LOCUS_01180 122598 123374 gene locus_tag LOCUS_01190 122598 123374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 123431 123946 gene locus_tag LOCUS_01200 gene lspA 123431 123946 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_01200 123933 124850 gene locus_tag LOCUS_01210 123933 124850 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_01210 124868 125689 gene locus_tag LOCUS_01220 124868 125689 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_01220 125711 126550 gene locus_tag LOCUS_01230 125711 126550 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_01230 126554 127501 gene locus_tag LOCUS_01240 126554 127501 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_01240 128203 127589 gene locus_tag LOCUS_01250 128203 127589 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_01250 128482 130581 gene locus_tag LOCUS_01260 128482 130581 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_01260 130602 133025 gene locus_tag LOCUS_01270 130602 133025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 134505 133150 gene locus_tag LOCUS_01280 gene purD 134505 133150 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_01280 135299 134595 gene locus_tag LOCUS_01290 135299 134595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 136536 135355 gene locus_tag LOCUS_01300 136536 135355 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_01300 137295 136579 gene locus_tag LOCUS_01310 137295 136579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 137950 137318 gene locus_tag LOCUS_01320 gene purN 137950 137318 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_01320 139003 137963 gene locus_tag LOCUS_01330 gene purM 139003 137963 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242485.1 protein_id gnl|my_center|LOCUS_01330 140450 139026 gene locus_tag LOCUS_01340 gene purF 140450 139026 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_01340 141877 140456 gene locus_tag LOCUS_01350 141877 140456 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_01350 142599 141883 gene locus_tag LOCUS_01360 142599 141883 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_01360 143265 142768 gene locus_tag LOCUS_01370 gene purE 143265 142768 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_01370 143896 143678 gene locus_tag LOCUS_01380 143896 143678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 144366 145226 gene locus_tag LOCUS_01390 gene rsmA 144366 145226 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_01390 145536 147812 gene locus_tag LOCUS_01400 gene spoIIE 145536 147812 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048377.1 protein_id gnl|my_center|LOCUS_01400 148055 150076 gene locus_tag LOCUS_01410 gene glgB 148055 150076 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_01410 150112 151314 gene locus_tag LOCUS_01420 gene glgC 150112 151314 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_01420 151332 152459 gene locus_tag LOCUS_01430 gene glgD 151332 152459 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_01430 152495 153907 gene locus_tag LOCUS_01440 gene glgA 152495 153907 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_01440 154598 154068 gene locus_tag LOCUS_01450 154598 154068 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964974.1 protein_id gnl|my_center|LOCUS_01450 155727 154831 gene locus_tag LOCUS_01460 155727 154831 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_01460 155915 155724 gene locus_tag LOCUS_01470 155915 155724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 156156 156293 gene locus_tag LOCUS_01480 156156 156293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 156818 156285 gene locus_tag LOCUS_01490 156818 156285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 157713 156832 gene locus_tag LOCUS_01500 gene ispE 157713 156832 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_01500 158881 157697 gene locus_tag LOCUS_01510 158881 157697 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_01510 159357 158878 gene locus_tag LOCUS_01520 159357 158878 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_01520 159592 160119 gene locus_tag LOCUS_01530 159592 160119 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965776.1 protein_id gnl|my_center|LOCUS_01530 160235 160702 gene locus_tag LOCUS_01540 160235 160702 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_01540 160699 162405 gene locus_tag LOCUS_01550 160699 162405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 162664 164904 gene locus_tag LOCUS_01560 162664 164904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 165428 164955 gene locus_tag LOCUS_01570 gene ispF 165428 164955 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_01570 166572 165460 gene locus_tag LOCUS_01580 gene pheA 166572 165460 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_01580 167212 166625 gene locus_tag LOCUS_01590 167212 166625 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_01590 167636 167223 gene locus_tag LOCUS_01600 167636 167223 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667028.1 protein_id gnl|my_center|LOCUS_01600 168911 167757 gene locus_tag LOCUS_01610 168911 167757 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_01610 169132 168908 gene locus_tag LOCUS_01620 169132 168908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 169324 169728 gene locus_tag LOCUS_01630 169324 169728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 169879 170526 gene locus_tag LOCUS_01640 169879 170526 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_01640 170765 172018 gene locus_tag LOCUS_01650 170765 172018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 172143 172472 gene locus_tag LOCUS_01660 172143 172472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 173433 172447 gene locus_tag LOCUS_01670 gene spoIID 173433 172447 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 protein_id gnl|my_center|LOCUS_01670 173646 174992 gene locus_tag LOCUS_01680 173646 174992 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_01680 175119 176453 gene locus_tag LOCUS_01690 175119 176453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 176475 177179 gene locus_tag LOCUS_01700 176475 177179 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896932.1 protein_id gnl|my_center|LOCUS_01700 177214 178719 gene locus_tag LOCUS_01710 177214 178719 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_01710 178749 179711 gene locus_tag LOCUS_01720 178749 179711 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421392.1 protein_id gnl|my_center|LOCUS_01720 179705 180526 gene locus_tag LOCUS_01730 gene prmC 179705 180526 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_01730 180641 181891 gene locus_tag LOCUS_01740 gene recA 180641 181891 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_01740 181895 182515 gene locus_tag LOCUS_01750 181895 182515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 182527 183375 gene locus_tag LOCUS_01760 182527 183375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 183862 185190 gene locus_tag LOCUS_01770 gene rimO 183862 185190 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_01770 185207 185785 gene locus_tag LOCUS_01780 gene pgsA 185207 185785 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_01780 186099 186752 gene locus_tag LOCUS_01790 gene cysE 186099 186752 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069591551.1 protein_id gnl|my_center|LOCUS_01790 186778 188193 gene locus_tag LOCUS_01800 gene cysS 186778 188193 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_01800 188205 189086 gene locus_tag LOCUS_01810 188205 189086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 189555 190991 gene locus_tag LOCUS_01820 189555 190991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 192740 191148 gene locus_tag LOCUS_01830 192740 191148 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_01830 194072 192801 gene locus_tag LOCUS_01840 194072 192801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 194941 194060 gene locus_tag LOCUS_01850 gene cdaA 194941 194060 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_01850 195965 195105 gene locus_tag LOCUS_01860 195965 195105 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357090.1 protein_id gnl|my_center|LOCUS_01860 197465 195996 gene locus_tag LOCUS_01870 197465 195996 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_01870 199159 197597 gene locus_tag LOCUS_01880 gene hcp 199159 197597 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_01880 199745 199227 gene locus_tag LOCUS_01890 199745 199227 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_01890 200193 199732 gene locus_tag LOCUS_01900 200193 199732 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811072.1 protein_id gnl|my_center|LOCUS_01900 200511 200759 gene locus_tag LOCUS_01910 200511 200759 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966909.1 protein_id gnl|my_center|LOCUS_01910 201735 200872 gene locus_tag LOCUS_01920 201735 200872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 202165 201707 gene locus_tag LOCUS_01930 202165 201707 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963442.1 protein_id gnl|my_center|LOCUS_01930 203282 202182 gene locus_tag LOCUS_01940 gene rpoD 203282 202182 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_01940 205088 203325 gene locus_tag LOCUS_01950 205088 203325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 206107 205112 gene locus_tag LOCUS_01960 206107 205112 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_01960 206847 206227 gene locus_tag LOCUS_01970 206847 206227 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357796.1 protein_id gnl|my_center|LOCUS_01970 207103 206903 gene locus_tag LOCUS_01980 gene rpmE 207103 206903 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_01980 208189 207527 gene locus_tag LOCUS_01990 gene pyrE 208189 207527 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389897.1 protein_id gnl|my_center|LOCUS_01990 210487 208235 gene locus_tag LOCUS_02000 210487 208235 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083030.1 protein_id gnl|my_center|LOCUS_02000 211200 210499 gene locus_tag LOCUS_02010 211200 210499 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 protein_id gnl|my_center|LOCUS_02010 211350 211886 gene locus_tag LOCUS_02020 211350 211886 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_02020 213097 212099 gene locus_tag LOCUS_02030 213097 212099 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_02030 213805 213113 gene locus_tag LOCUS_02040 213805 213113 CDS product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677723.1 protein_id gnl|my_center|LOCUS_02040 215710 213926 gene locus_tag LOCUS_02050 gene glgB 215710 213926 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100880.1 protein_id gnl|my_center|LOCUS_02050 215898 216458 gene locus_tag LOCUS_02060 215898 216458 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008946902.1 protein_id gnl|my_center|LOCUS_02060 219095 216576 gene locus_tag LOCUS_02070 219095 216576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 219894 219082 gene locus_tag LOCUS_02080 219894 219082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 221462 219957 gene locus_tag LOCUS_02090 gene galT 221462 219957 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_02090 222073 223743 gene locus_tag LOCUS_02100 222073 223743 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_02100 225975 223831 gene locus_tag LOCUS_02110 225975 223831 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_02110 226425 226144 gene locus_tag LOCUS_02120 226425 226144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 226975 226703 gene locus_tag LOCUS_02130 226975 226703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 227310 227152 gene locus_tag LOCUS_02140 227310 227152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 227778 227476 gene locus_tag LOCUS_02150 227778 227476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 227936 228238 gene locus_tag LOCUS_02160 227936 228238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 228370 228813 gene locus_tag LOCUS_02170 228370 228813 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357777.1 protein_id gnl|my_center|LOCUS_02170 228823 229017 gene locus_tag LOCUS_02180 228823 229017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 229167 229439 gene locus_tag LOCUS_02190 229167 229439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 229535 229771 gene locus_tag LOCUS_02200 229535 229771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 229758 230360 gene locus_tag LOCUS_02210 gene lepB 229758 230360 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014917214.1 protein_id gnl|my_center|LOCUS_02210 230405 236155 gene locus_tag LOCUS_02220 230405 236155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 236184 237776 gene locus_tag LOCUS_02230 236184 237776 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837257.1 protein_id gnl|my_center|LOCUS_02230 237909 238763 gene locus_tag LOCUS_02240 237909 238763 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775508.1 protein_id gnl|my_center|LOCUS_02240 238753 239733 gene locus_tag LOCUS_02250 238753 239733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 239777 240412 gene locus_tag LOCUS_02260 239777 240412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 240628 240452 gene locus_tag LOCUS_02270 240628 240452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 240978 241655 gene locus_tag LOCUS_02280 240978 241655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 242299 241703 gene locus_tag LOCUS_02290 242299 241703 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_02290 242562 242299 gene locus_tag LOCUS_02300 gene cotJB 242562 242299 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_02300 242794 242546 gene locus_tag LOCUS_02310 242794 242546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 243102 244304 gene locus_tag LOCUS_02320 243102 244304 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_02320 244637 244425 gene locus_tag LOCUS_02330 244637 244425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 244524 245405 gene locus_tag LOCUS_02340 244524 245405 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_02340 245474 246568 gene locus_tag LOCUS_02350 245474 246568 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_02350 246570 247328 gene locus_tag LOCUS_02360 246570 247328 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_02360 247342 248052 gene locus_tag LOCUS_02370 247342 248052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_02370 248065 248676 gene locus_tag LOCUS_02380 248065 248676 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_02380 250113 248734 gene locus_tag LOCUS_02390 250113 248734 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_02390 251586 250219 gene locus_tag LOCUS_02400 gene mgtE 251586 250219 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_02400 252021 253265 gene locus_tag LOCUS_02410 252021 253265 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_02410 253592 254038 gene locus_tag LOCUS_02420 253592 254038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 255194 254226 gene locus_tag LOCUS_02430 255194 254226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 256049 255198 gene locus_tag LOCUS_02440 gene rlmA 256049 255198 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262328.1 protein_id gnl|my_center|LOCUS_02440 256199 256348 gene locus_tag LOCUS_02450 256199 256348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 256403 259060 gene locus_tag LOCUS_02460 gene alaS 256403 259060 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_02460 259123 259464 gene locus_tag LOCUS_02470 259123 259464 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_02470 259525 261525 gene locus_tag LOCUS_02480 259525 261525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 261494 262552 gene locus_tag LOCUS_02490 gene holA 261494 262552 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_02490 262556 263179 gene locus_tag LOCUS_02500 262556 263179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 263172 264560 gene locus_tag LOCUS_02510 263172 264560 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112884.1 protein_id gnl|my_center|LOCUS_02510 264581 265678 gene locus_tag LOCUS_02520 264581 265678 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_02520 265788 266876 gene locus_tag LOCUS_02530 gene pyrB 265788 266876 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965942.1 protein_id gnl|my_center|LOCUS_02530 267087 268097 gene locus_tag LOCUS_02540 267087 268097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 268449 268168 gene locus_tag LOCUS_02550 268449 268168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 268662 269657 gene locus_tag LOCUS_02560 gene ccpA 268662 269657 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103304.1 protein_id gnl|my_center|LOCUS_02560 269745 271205 gene locus_tag LOCUS_02570 269745 271205 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666065.1 protein_id gnl|my_center|LOCUS_02570 271442 272869 gene locus_tag LOCUS_02580 271442 272869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 273046 273753 gene locus_tag LOCUS_02590 273046 273753 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454566.1 protein_id gnl|my_center|LOCUS_02590 273728 276196 gene locus_tag LOCUS_02600 273728 276196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 276366 279017 gene locus_tag LOCUS_02610 gene cas3 276366 279017 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_02610 279014 280600 gene locus_tag LOCUS_02620 279014 280600 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_02620 280625 280783 gene locus_tag LOCUS_02630 280625 280783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 280789 281541 gene locus_tag LOCUS_02640 280789 281541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 281550 281966 gene locus_tag LOCUS_02650 281550 281966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02650 281927 282172 gene locus_tag LOCUS_02660 281927 282172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 282172 282423 gene locus_tag LOCUS_02670 282172 282423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 285034 282512 gene locus_tag LOCUS_02680 285034 282512 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_02680 285378 285049 gene locus_tag LOCUS_02690 285378 285049 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551648.1 protein_id gnl|my_center|LOCUS_02690 286925 285543 gene locus_tag LOCUS_02700 286925 285543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 287290 288918 gene locus_tag LOCUS_02710 287290 288918 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_02710 289101 291137 gene locus_tag LOCUS_02720 gene recG 289101 291137 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_02720 291226 291792 gene locus_tag LOCUS_02730 291226 291792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 292080 293276 gene locus_tag LOCUS_02740 292080 293276 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_02740 293379 294863 gene locus_tag LOCUS_02750 293379 294863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 294866 295582 gene locus_tag LOCUS_02760 294866 295582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 295730 297934 gene locus_tag LOCUS_02770 295730 297934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 297952 298761 gene locus_tag LOCUS_02780 297952 298761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 298774 300627 gene locus_tag LOCUS_02790 298774 300627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 301581 300757 gene locus_tag LOCUS_02800 301581 300757 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_02800 301741 303420 gene locus_tag LOCUS_02810 301741 303420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 303448 304518 gene locus_tag LOCUS_02820 303448 304518 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_02820 305469 304588 gene locus_tag LOCUS_02830 305469 304588 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_02830 305863 305459 gene locus_tag LOCUS_02840 305863 305459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 308363 306021 gene locus_tag LOCUS_02850 gene yicI 308363 306021 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582725.1 protein_id gnl|my_center|LOCUS_02850 309958 308711 gene locus_tag LOCUS_02860 309958 308711 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_02860 310222 312426 gene locus_tag LOCUS_02870 310222 312426 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787402.1 protein_id gnl|my_center|LOCUS_02870 312733 313452 gene locus_tag LOCUS_02880 gene cas5c 312733 313452 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176707.1 protein_id gnl|my_center|LOCUS_02880 313446 315290 gene locus_tag LOCUS_02890 gene cas8c 313446 315290 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176708.1 protein_id gnl|my_center|LOCUS_02890 315308 316174 gene locus_tag LOCUS_02900 gene cas7c 315308 316174 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_02900 316174 316854 gene locus_tag LOCUS_02910 gene cas4 316174 316854 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118772.1 protein_id gnl|my_center|LOCUS_02910 316847 317869 gene locus_tag LOCUS_02920 gene cas1c 316847 317869 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_02920 317881 318171 gene locus_tag LOCUS_02930 gene cas2 317881 318171 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932801.1 protein_id gnl|my_center|LOCUS_02930 318331 319475 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcacgctccacgtgagcgtgtgagttgaaat >Feature sequence02 129 332 gene locus_tag LOCUS_02940 129 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 648 1175 gene locus_tag LOCUS_02950 648 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 1802 2149 gene locus_tag LOCUS_02960 1802 2149 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458809.1 protein_id gnl|my_center|LOCUS_02960 2142 2300 gene locus_tag LOCUS_02970 2142 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 2499 4025 gene locus_tag LOCUS_02980 2499 4025 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461951.1 protein_id gnl|my_center|LOCUS_02980 4089 4352 gene locus_tag LOCUS_02990 4089 4352 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461031.1 protein_id gnl|my_center|LOCUS_02990 4345 4653 gene locus_tag LOCUS_03000 4345 4653 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817080.1 protein_id gnl|my_center|LOCUS_03000 4767 5705 gene locus_tag LOCUS_03010 4767 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 5644 7260 gene locus_tag LOCUS_03020 5644 7260 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_03020 7320 8432 gene locus_tag LOCUS_03030 7320 8432 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458834.1 protein_id gnl|my_center|LOCUS_03030 8446 8949 gene locus_tag LOCUS_03040 8446 8949 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462001.1 protein_id gnl|my_center|LOCUS_03040 8963 9232 gene locus_tag LOCUS_03050 8963 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 10796 9426 gene locus_tag LOCUS_03060 10796 9426 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_03060 12540 10786 gene locus_tag LOCUS_03070 gene ade 12540 10786 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937748.1 protein_id gnl|my_center|LOCUS_03070 13666 12569 gene locus_tag LOCUS_03080 13666 12569 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_03080 14567 13650 gene locus_tag LOCUS_03090 14567 13650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 16270 14600 gene locus_tag LOCUS_03100 16270 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 17933 16299 gene locus_tag LOCUS_03110 17933 16299 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_03110 18981 17962 gene locus_tag LOCUS_03120 18981 17962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 protein_id gnl|my_center|LOCUS_03120 19973 18978 gene locus_tag LOCUS_03130 19973 18978 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_03130 20888 19977 gene locus_tag LOCUS_03140 20888 19977 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810093.1 protein_id gnl|my_center|LOCUS_03140 21846 20902 gene locus_tag LOCUS_03150 21846 20902 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383546.1 protein_id gnl|my_center|LOCUS_03150 22790 22185 gene locus_tag LOCUS_03160 22790 22185 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_03160 23504 22794 gene locus_tag LOCUS_03170 23504 22794 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_03170 24775 23501 gene locus_tag LOCUS_03180 24775 23501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 25586 24807 gene locus_tag LOCUS_03190 25586 24807 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984187.1 protein_id gnl|my_center|LOCUS_03190 26268 25609 gene locus_tag LOCUS_03200 26268 25609 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521640.1 protein_id gnl|my_center|LOCUS_03200 26945 26283 gene locus_tag LOCUS_03210 26945 26283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 27893 27003 gene locus_tag LOCUS_03220 27893 27003 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167356.1 protein_id gnl|my_center|LOCUS_03220 28988 28026 gene locus_tag LOCUS_03230 28988 28026 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339577.1 protein_id gnl|my_center|LOCUS_03230 29488 29898 gene locus_tag LOCUS_03240 29488 29898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 29895 30212 gene locus_tag LOCUS_03250 29895 30212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 30246 30926 gene locus_tag LOCUS_03260 30246 30926 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889578.1 protein_id gnl|my_center|LOCUS_03260 30930 32642 gene locus_tag LOCUS_03270 gene ureB 30930 32642 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724295.1 protein_id gnl|my_center|LOCUS_03270 32658 33146 gene locus_tag LOCUS_03280 32658 33146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 33163 33837 gene locus_tag LOCUS_03290 33163 33837 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357404.1 protein_id gnl|my_center|LOCUS_03290 33874 34485 gene locus_tag LOCUS_03300 gene ureG 33874 34485 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005664465.1 protein_id gnl|my_center|LOCUS_03300 34482 35249 gene locus_tag LOCUS_03310 34482 35249 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995202.1 protein_id gnl|my_center|LOCUS_03310 35574 35290 gene locus_tag LOCUS_03320 35574 35290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 36053 35586 gene locus_tag LOCUS_03330 36053 35586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 36243 38522 gene locus_tag LOCUS_03340 36243 38522 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_03340 38553 40265 gene locus_tag LOCUS_03350 38553 40265 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582688.1 protein_id gnl|my_center|LOCUS_03350 40588 40911 gene locus_tag LOCUS_03360 40588 40911 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475524.1 protein_id gnl|my_center|LOCUS_03360 40908 41537 gene locus_tag LOCUS_03370 40908 41537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 41537 42361 gene locus_tag LOCUS_03380 41537 42361 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713072.1 protein_id gnl|my_center|LOCUS_03380 42374 42556 gene locus_tag LOCUS_03390 42374 42556 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722617.1 protein_id gnl|my_center|LOCUS_03390 42787 43020 gene locus_tag LOCUS_03400 42787 43020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 43017 43214 gene locus_tag LOCUS_03410 43017 43214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 43201 44073 gene locus_tag LOCUS_03420 43201 44073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 44546 44205 gene locus_tag LOCUS_03430 gene rplQ 44546 44205 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_03430 45524 44565 gene locus_tag LOCUS_03440 45524 44565 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 protein_id gnl|my_center|LOCUS_03440 46252 45656 gene locus_tag LOCUS_03450 gene rpsD 46252 45656 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_03450 46743 46345 gene locus_tag LOCUS_03460 gene rpsK 46743 46345 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_03460 47126 46758 gene locus_tag LOCUS_03470 gene rpsM 47126 46758 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_03470 47548 47330 gene locus_tag LOCUS_03480 gene infA 47548 47330 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_03480 47847 47548 gene locus_tag LOCUS_03490 47847 47548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 48590 47844 gene locus_tag LOCUS_03500 gene map 48590 47844 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_03500 49239 48607 gene locus_tag LOCUS_03510 gene adk 49239 48607 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706319.1 protein_id gnl|my_center|LOCUS_03510 50573 49278 gene locus_tag LOCUS_03520 gene secY 50573 49278 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_03520 51016 50576 gene locus_tag LOCUS_03530 gene rplO 51016 50576 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_03530 51208 51032 gene locus_tag LOCUS_03540 gene rpmD 51208 51032 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_03540 51723 51223 gene locus_tag LOCUS_03550 gene rpsE 51723 51223 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_03550 52098 51739 gene locus_tag LOCUS_03560 gene rplR 52098 51739 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356218.1 protein_id gnl|my_center|LOCUS_03560 52668 52117 gene locus_tag LOCUS_03570 gene rplF 52668 52117 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086558.1 protein_id gnl|my_center|LOCUS_03570 53080 52682 gene locus_tag LOCUS_03580 gene rpsH 53080 52682 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_03580 53282 53097 gene locus_tag LOCUS_03590 53282 53097 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459104.1 protein_id gnl|my_center|LOCUS_03590 53839 53297 gene locus_tag LOCUS_03600 gene rplE 53839 53297 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_03600 54179 53856 gene locus_tag LOCUS_03610 gene rplX 54179 53856 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357467.1 protein_id gnl|my_center|LOCUS_03610 54565 54197 gene locus_tag LOCUS_03620 gene rplN 54565 54197 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966402.1 protein_id gnl|my_center|LOCUS_03620 54899 54639 gene locus_tag LOCUS_03630 gene rpsQ 54899 54639 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357552.1 protein_id gnl|my_center|LOCUS_03630 55118 54921 gene locus_tag LOCUS_03640 gene rpmC 55118 54921 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_03640 55549 55118 gene locus_tag LOCUS_03650 gene rplP 55549 55118 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_03650 56331 55549 gene locus_tag LOCUS_03660 gene rpsC 56331 55549 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_03660 56687 56352 gene locus_tag LOCUS_03670 gene rplV 56687 56352 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048353.1 protein_id gnl|my_center|LOCUS_03670 56988 56707 gene locus_tag LOCUS_03680 gene rpsS 56988 56707 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_03680 57845 57012 gene locus_tag LOCUS_03690 gene rplB 57845 57012 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_03690 58329 58039 gene locus_tag LOCUS_03700 gene rplW 58329 58039 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_03700 58952 58329 gene locus_tag LOCUS_03710 gene rplD 58952 58329 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_03710 59605 58970 gene locus_tag LOCUS_03720 gene rplC 59605 58970 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_03720 60014 59700 gene locus_tag LOCUS_03730 gene rpsJ 60014 59700 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284513.1 protein_id gnl|my_center|LOCUS_03730 61418 60768 gene locus_tag LOCUS_03740 61418 60768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 61551 61420 gene locus_tag LOCUS_03750 61551 61420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 63955 61667 gene locus_tag LOCUS_03760 63955 61667 CDS product dockerin type I domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964237.1 protein_id gnl|my_center|LOCUS_03760 66361 64133 gene locus_tag LOCUS_03770 66361 64133 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_03770 67268 66573 gene locus_tag LOCUS_03780 gene rplA 67268 66573 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_03780 67798 67373 gene locus_tag LOCUS_03790 gene rplK 67798 67373 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_03790 68468 67938 gene locus_tag LOCUS_03800 gene nusG 68468 67938 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_03800 68767 68513 gene locus_tag LOCUS_03810 68767 68513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 68938 68789 gene locus_tag LOCUS_03820 gene rpmG 68938 68789 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_03820 69287 69132 gene locus_tag LOCUS_03830 69287 69132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 70071 69421 gene locus_tag LOCUS_03840 70071 69421 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_03840 70968 70084 gene locus_tag LOCUS_03850 70968 70084 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_03850 72604 71036 gene locus_tag LOCUS_03860 gene cls 72604 71036 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_03860 74308 73061 gene locus_tag LOCUS_03870 74308 73061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 75563 74421 gene locus_tag LOCUS_03880 gene ugpC 75563 74421 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_03880 76442 75717 gene locus_tag LOCUS_03890 76442 75717 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860778.1 protein_id gnl|my_center|LOCUS_03890 77156 76644 gene locus_tag LOCUS_03900 77156 76644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 77561 78298 gene locus_tag LOCUS_03910 gene minD 77561 78298 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_03910 78407 78814 gene locus_tag LOCUS_03920 gene mgsA 78407 78814 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_03920 79184 79777 gene locus_tag LOCUS_03930 79184 79777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 79923 81251 gene locus_tag LOCUS_03940 gene hisS 79923 81251 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_03940 81255 81569 gene locus_tag LOCUS_03950 81255 81569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 81569 82087 gene locus_tag LOCUS_03960 81569 82087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 82129 83907 gene locus_tag LOCUS_03970 gene aspS 82129 83907 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_03970 86056 84284 gene locus_tag LOCUS_03980 86056 84284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 88313 86232 gene locus_tag LOCUS_03990 88313 86232 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_03990 89212 88610 gene locus_tag LOCUS_04000 89212 88610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 90079 89456 gene locus_tag LOCUS_04010 90079 89456 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_04010 91705 90302 gene locus_tag LOCUS_04020 91705 90302 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_04020 93465 91702 gene locus_tag LOCUS_04030 93465 91702 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_04030 94060 93479 gene locus_tag LOCUS_04040 94060 93479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 94388 94080 gene locus_tag LOCUS_04050 94388 94080 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_04050 94839 94390 gene locus_tag LOCUS_04060 94839 94390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 96930 94984 gene locus_tag LOCUS_04070 96930 94984 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869273.1 protein_id gnl|my_center|LOCUS_04070 98009 96963 gene locus_tag LOCUS_04080 98009 96963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 98355 98044 gene locus_tag LOCUS_04090 98355 98044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 98656 99102 gene locus_tag LOCUS_04100 98656 99102 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_04100 99155 100393 gene locus_tag LOCUS_04110 99155 100393 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_04110 100901 100440 gene locus_tag LOCUS_04120 100901 100440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 101419 100946 gene locus_tag LOCUS_04130 101419 100946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 101540 102427 gene locus_tag LOCUS_04140 gene thrB 101540 102427 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964548.1 protein_id gnl|my_center|LOCUS_04140 102424 102924 gene locus_tag LOCUS_04150 102424 102924 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_04150 102921 103463 gene locus_tag LOCUS_04160 102921 103463 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_04160 104266 103586 gene locus_tag LOCUS_04170 gene rpe 104266 103586 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965037.1 protein_id gnl|my_center|LOCUS_04170 106155 104296 gene locus_tag LOCUS_04180 106155 104296 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721494.1 protein_id gnl|my_center|LOCUS_04180 107340 106267 gene locus_tag LOCUS_04190 107340 106267 CDS product galactitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004058044.1 protein_id gnl|my_center|LOCUS_04190 108058 107354 gene locus_tag LOCUS_04200 108058 107354 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_04200 109353 108175 gene locus_tag LOCUS_04210 109353 108175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 109705 109986 gene locus_tag LOCUS_04220 109705 109986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 111404 110325 gene locus_tag LOCUS_04230 111404 110325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 112717 111407 gene locus_tag LOCUS_04240 112717 111407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 114876 112891 gene locus_tag LOCUS_04250 114876 112891 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_04250 115213 114863 gene locus_tag LOCUS_04260 115213 114863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 115751 115347 gene locus_tag LOCUS_04270 115751 115347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 116964 115765 gene locus_tag LOCUS_04280 116964 115765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 118403 117279 gene locus_tag LOCUS_04290 118403 117279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 118723 118403 gene locus_tag LOCUS_04300 118723 118403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 119804 118704 gene locus_tag LOCUS_04310 119804 118704 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_04310 120007 119804 gene locus_tag LOCUS_04320 120007 119804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 120213 120704 gene locus_tag LOCUS_04330 120213 120704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 122352 120817 gene locus_tag LOCUS_04340 gene guaA 122352 120817 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_04340 122640 124652 gene locus_tag LOCUS_04350 122640 124652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 125548 124841 gene locus_tag LOCUS_04360 125548 124841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 126251 125664 gene locus_tag LOCUS_04370 gene lexA 126251 125664 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699857.1 protein_id gnl|my_center|LOCUS_04370 127706 126297 gene locus_tag LOCUS_04380 gene murC 127706 126297 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425936.1 protein_id gnl|my_center|LOCUS_04380 127866 128153 gene locus_tag LOCUS_04390 gene spoVG 127866 128153 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_04390 129341 128271 gene locus_tag LOCUS_04400 129341 128271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 129493 129765 gene locus_tag LOCUS_04410 129493 129765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 129936 130385 gene locus_tag LOCUS_04420 129936 130385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 130499 130858 gene locus_tag LOCUS_04430 130499 130858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 130925 131479 gene locus_tag LOCUS_04440 130925 131479 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356258.1 protein_id gnl|my_center|LOCUS_04440 131512 131775 gene locus_tag LOCUS_04450 131512 131775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 131793 132464 gene locus_tag LOCUS_04460 131793 132464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 134395 132629 gene locus_tag LOCUS_04470 134395 132629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 135377 134388 gene locus_tag LOCUS_04480 135377 134388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 137473 135422 gene locus_tag LOCUS_04490 137473 135422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 138549 137860 gene locus_tag LOCUS_04500 138549 137860 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209426.1 protein_id gnl|my_center|LOCUS_04500 140268 138694 gene locus_tag LOCUS_04510 140268 138694 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_04510 141759 140290 gene locus_tag LOCUS_04520 gene abfB 141759 140290 CDS product alpha-L-arabinofuranosidase AbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398654.1 protein_id gnl|my_center|LOCUS_04520 141882 142667 gene locus_tag LOCUS_04530 141882 142667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 143760 142765 gene locus_tag LOCUS_04540 143760 142765 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_04540 146642 144087 gene locus_tag LOCUS_04550 gene polA 146642 144087 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_04550 147199 146639 gene locus_tag LOCUS_04560 147199 146639 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_04560 148220 147204 gene locus_tag LOCUS_04570 gene tsaD 148220 147204 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_04570 149151 148438 gene locus_tag LOCUS_04580 149151 148438 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947927.1 protein_id gnl|my_center|LOCUS_04580 149602 149141 gene locus_tag LOCUS_04590 gene rimI 149602 149141 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546589.1 protein_id gnl|my_center|LOCUS_04590 150227 149604 gene locus_tag LOCUS_04600 150227 149604 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_04600 151160 150336 gene locus_tag LOCUS_04610 gene rsmI 151160 150336 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_04610 152147 151164 gene locus_tag LOCUS_04620 gene dusB 152147 151164 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_04620 153158 152361 gene locus_tag LOCUS_04630 153158 152361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 154481 153177 gene locus_tag LOCUS_04640 154481 153177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 154889 156274 gene locus_tag LOCUS_04650 154889 156274 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_04650 156553 157206 gene locus_tag LOCUS_04660 156553 157206 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_04660 157216 158175 gene locus_tag LOCUS_04670 157216 158175 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_04670 158182 158739 gene locus_tag LOCUS_04680 158182 158739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 159013 159735 gene locus_tag LOCUS_04690 159013 159735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 159813 160739 gene locus_tag LOCUS_04700 159813 160739 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920869.1 protein_id gnl|my_center|LOCUS_04700 160987 163428 gene locus_tag LOCUS_04710 160987 163428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 163450 163989 gene locus_tag LOCUS_04720 163450 163989 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_04720 167718 164149 gene locus_tag LOCUS_04730 gene nifJ 167718 164149 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_04730 168972 168058 gene locus_tag LOCUS_04740 168972 168058 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_04740 169822 169031 gene locus_tag LOCUS_04750 169822 169031 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_04750 170110 170976 gene locus_tag LOCUS_04760 gene noc 170110 170976 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_04760 172382 171033 gene locus_tag LOCUS_04770 172382 171033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 173393 172464 gene locus_tag LOCUS_04780 173393 172464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 173618 174994 gene locus_tag LOCUS_04790 173618 174994 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_04790 175011 175784 gene locus_tag LOCUS_04800 175011 175784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 175777 176730 gene locus_tag LOCUS_04810 175777 176730 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868031.1 protein_id gnl|my_center|LOCUS_04810 176743 178113 gene locus_tag LOCUS_04820 gene mnmE 176743 178113 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_04820 178150 180033 gene locus_tag LOCUS_04830 gene mnmG 178150 180033 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_04830 180035 180754 gene locus_tag LOCUS_04840 gene rsmG 180035 180754 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131091.1 protein_id gnl|my_center|LOCUS_04840 182032 181136 gene locus_tag LOCUS_04850 182032 181136 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462331.1 protein_id gnl|my_center|LOCUS_04850 183413 182076 gene locus_tag LOCUS_04860 183413 182076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 183727 183479 gene locus_tag LOCUS_04870 gene yidD 183727 183479 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931699.1 protein_id gnl|my_center|LOCUS_04870 184103 183729 gene locus_tag LOCUS_04880 gene rnpA 184103 183729 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_04880 184465 184331 gene locus_tag LOCUS_04890 184465 184331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 185003 186364 gene locus_tag LOCUS_04900 gene dnaA 185003 186364 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_04900 186810 187916 gene locus_tag LOCUS_04910 gene dnaN 186810 187916 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_04910 187921 188145 gene locus_tag LOCUS_04920 gene yaaA 187921 188145 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_04920 188147 189277 gene locus_tag LOCUS_04930 gene recF 188147 189277 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429303.1 protein_id gnl|my_center|LOCUS_04930 189277 189537 gene locus_tag LOCUS_04940 189277 189537 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024026196.1 protein_id gnl|my_center|LOCUS_04940 189594 191570 gene locus_tag LOCUS_04950 gene gyrB 189594 191570 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435982.1 protein_id gnl|my_center|LOCUS_04950 191586 192275 gene locus_tag LOCUS_04960 191586 192275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 192322 194868 gene locus_tag LOCUS_04970 gene gyrA 192322 194868 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_04970 194872 196761 gene locus_tag LOCUS_04980 194872 196761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 198070 196787 gene locus_tag LOCUS_04990 gene serS 198070 196787 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_04990 198386 199768 gene locus_tag LOCUS_05000 198386 199768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05000 199761 200741 gene locus_tag LOCUS_05010 gene secF 199761 200741 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_05010 201495 200800 gene locus_tag LOCUS_05020 gene radC 201495 200800 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016743.1 protein_id gnl|my_center|LOCUS_05020 201756 203090 gene locus_tag LOCUS_05030 201756 203090 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_05030 203329 204807 gene locus_tag LOCUS_05040 gene guaB 203329 204807 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722118.1 protein_id gnl|my_center|LOCUS_05040 205372 204923 gene locus_tag LOCUS_05050 205372 204923 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_05050 205666 206217 gene locus_tag LOCUS_05060 205666 206217 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_05060 206406 206747 gene locus_tag LOCUS_05070 206406 206747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 206744 207700 gene locus_tag LOCUS_05080 206744 207700 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966228.1 protein_id gnl|my_center|LOCUS_05080 207681 208517 gene locus_tag LOCUS_05090 gene proB 207681 208517 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_05090 208523 209776 gene locus_tag LOCUS_05100 208523 209776 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966528.1 protein_id gnl|my_center|LOCUS_05100 209905 210519 gene locus_tag LOCUS_05110 209905 210519 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_05110 210661 212424 gene locus_tag LOCUS_05120 210661 212424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 212661 214790 gene locus_tag LOCUS_05130 212661 214790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 214881 215942 gene locus_tag LOCUS_05140 gene hisC 214881 215942 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_05140 216166 217137 gene locus_tag LOCUS_05150 gene cbiB 216166 217137 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861967.1 protein_id gnl|my_center|LOCUS_05150 217295 217083 gene locus_tag LOCUS_05160 217295 217083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 218907 217273 gene locus_tag LOCUS_05170 218907 217273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 219624 220364 gene locus_tag LOCUS_05180 219624 220364 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583915.1 protein_id gnl|my_center|LOCUS_05180 220351 221673 gene locus_tag LOCUS_05190 220351 221673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583914.1 protein_id gnl|my_center|LOCUS_05190 222596 221826 gene locus_tag LOCUS_05200 222596 221826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 223898 222681 gene locus_tag LOCUS_05210 223898 222681 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303757.1 protein_id gnl|my_center|LOCUS_05210 224268 223900 gene locus_tag LOCUS_05220 224268 223900 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202858.1 protein_id gnl|my_center|LOCUS_05220 225944 224478 gene locus_tag LOCUS_05230 225944 224478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 226755 227432 gene locus_tag LOCUS_05240 226755 227432 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973151.1 protein_id gnl|my_center|LOCUS_05240 227425 228372 gene locus_tag LOCUS_05250 227425 228372 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028504.1 protein_id gnl|my_center|LOCUS_05250 228504 231470 gene locus_tag LOCUS_05260 228504 231470 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_05260 231488 232426 gene locus_tag LOCUS_05270 231488 232426 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_05270 232445 233347 gene locus_tag LOCUS_05280 232445 233347 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_05280 233458 234999 gene locus_tag LOCUS_05290 233458 234999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05290 235001 235630 gene locus_tag LOCUS_05300 235001 235630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 235657 238134 gene locus_tag LOCUS_05310 235657 238134 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 protein_id gnl|my_center|LOCUS_05310 238134 239216 gene locus_tag LOCUS_05320 238134 239216 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_05320 239229 240278 gene locus_tag LOCUS_05330 239229 240278 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_05330 240537 241589 gene locus_tag LOCUS_05340 240537 241589 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071114.1 protein_id gnl|my_center|LOCUS_05340 241608 244583 gene locus_tag LOCUS_05350 241608 244583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 244598 245428 gene locus_tag LOCUS_05360 244598 245428 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_05360 245607 246368 gene locus_tag LOCUS_05370 245607 246368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 246436 246939 gene locus_tag LOCUS_05380 246436 246939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 246975 247769 gene locus_tag LOCUS_05390 246975 247769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 249143 247866 gene locus_tag LOCUS_05400 249143 247866 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_05400 250323 249160 gene locus_tag LOCUS_05410 gene alr 250323 249160 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_05410 250464 251060 gene locus_tag LOCUS_05420 250464 251060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 251183 252100 gene locus_tag LOCUS_05430 251183 252100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 252140 252538 gene locus_tag LOCUS_05440 252140 252538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 252754 253248 gene locus_tag LOCUS_05450 gene rimP 252754 253248 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_05450 253310 254398 gene locus_tag LOCUS_05460 gene nusA 253310 254398 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_05460 254385 254657 gene locus_tag LOCUS_05470 254385 254657 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_05470 254650 254982 gene locus_tag LOCUS_05480 254650 254982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 255011 257527 gene locus_tag LOCUS_05490 255011 257527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 257593 257976 gene locus_tag LOCUS_05500 gene rbfA 257593 257976 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670660.1 protein_id gnl|my_center|LOCUS_05500 257992 258939 gene locus_tag LOCUS_05510 257992 258939 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_05510 258939 259853 gene locus_tag LOCUS_05520 gene truB 258939 259853 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_05520 259880 260809 gene locus_tag LOCUS_05530 259880 260809 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383736.1 protein_id gnl|my_center|LOCUS_05530 260806 261345 gene locus_tag LOCUS_05540 260806 261345 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_05540 261373 262821 gene locus_tag LOCUS_05550 gene gltX 261373 262821 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_05550 263104 264081 gene locus_tag LOCUS_05560 263104 264081 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_05560 264081 264785 gene locus_tag LOCUS_05570 264081 264785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 264801 266525 gene locus_tag LOCUS_05580 264801 266525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 266545 268050 gene locus_tag LOCUS_05590 266545 268050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 268284 268565 gene locus_tag LOCUS_05600 268284 268565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 269181 268621 gene locus_tag LOCUS_05610 269181 268621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 270223 269198 gene locus_tag LOCUS_05620 270223 269198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 270567 272975 gene locus_tag LOCUS_05630 270567 272975 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195978718.1 protein_id gnl|my_center|LOCUS_05630 274519 273092 gene locus_tag LOCUS_05640 274519 273092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 276248 274938 gene locus_tag LOCUS_05650 276248 274938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 276833 277531 gene locus_tag LOCUS_05660 276833 277531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 277680 279551 gene locus_tag LOCUS_05670 277680 279551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 279972 280433 gene locus_tag LOCUS_05680 279972 280433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 280451 282013 gene locus_tag LOCUS_05690 280451 282013 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_05690 282015 283778 gene locus_tag LOCUS_05700 282015 283778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 286626 283906 gene locus_tag LOCUS_05710 286626 283906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 286940 288148 gene locus_tag LOCUS_05720 286940 288148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 288369 289634 gene locus_tag LOCUS_05730 288369 289634 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_05730 289867 289965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 291440 290115 gene locus_tag LOCUS_05740 gene xylA 291440 290115 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082185.1 protein_id gnl|my_center|LOCUS_05740 292532 292804 gene locus_tag LOCUS_05750 292532 292804 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_05750 292848 294491 gene locus_tag LOCUS_05760 gene groL 292848 294491 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_05760 294872 295576 gene locus_tag LOCUS_05770 294872 295576 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_05770 295704 296990 gene locus_tag LOCUS_05780 295704 296990 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_05780 297000 298310 gene locus_tag LOCUS_05790 297000 298310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 299392 298571 gene locus_tag LOCUS_05800 299392 298571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 299680 300126 gene locus_tag LOCUS_05810 gene spoVAC 299680 300126 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_05810 300930 300427 gene locus_tag LOCUS_05820 300930 300427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 302462 301110 gene locus_tag LOCUS_05830 302462 301110 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_05830 305138 302679 gene locus_tag LOCUS_05840 305138 302679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 305671 305138 gene locus_tag LOCUS_05850 305671 305138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 307348 305861 gene locus_tag LOCUS_05860 307348 305861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 307416 307631 gene locus_tag LOCUS_05870 307416 307631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 307971 309263 gene locus_tag LOCUS_05880 307971 309263 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869880.1 protein_id gnl|my_center|LOCUS_05880 310498 309656 gene locus_tag LOCUS_05890 310498 309656 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048346.1 protein_id gnl|my_center|LOCUS_05890 310965 310501 gene locus_tag LOCUS_05900 310965 310501 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381223.1 protein_id gnl|my_center|LOCUS_05900 311980 310991 gene locus_tag LOCUS_05910 311980 310991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 312813 311977 gene locus_tag LOCUS_05920 312813 311977 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_05920 313282 312839 gene locus_tag LOCUS_05930 313282 312839 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963446.1 protein_id gnl|my_center|LOCUS_05930 315273 313285 gene locus_tag LOCUS_05940 315273 313285 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence03 658 314 gene locus_tag LOCUS_05950 658 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 365 374 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1116 706 gene locus_tag LOCUS_05960 1116 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 1386 1117 gene locus_tag LOCUS_05970 1386 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 2234 1383 gene locus_tag LOCUS_05980 2234 1383 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_05980 2589 2392 gene locus_tag LOCUS_05990 2589 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2710 2570 gene locus_tag LOCUS_06000 2710 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 3111 2710 gene locus_tag LOCUS_06010 3111 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3887 3111 gene locus_tag LOCUS_06020 3887 3111 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 protein_id gnl|my_center|LOCUS_06020 5106 3862 gene locus_tag LOCUS_06030 5106 3862 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861009.1 protein_id gnl|my_center|LOCUS_06030 5496 5170 gene locus_tag LOCUS_06040 5496 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5684 5505 gene locus_tag LOCUS_06050 5684 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 6010 5927 gene locus_tag LOCUS_t00040 6010 5927 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6755 6384 gene locus_tag LOCUS_06060 gene rplL 6755 6384 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900419.1 protein_id gnl|my_center|LOCUS_06060 7379 6822 gene locus_tag LOCUS_06070 gene rplJ 7379 6822 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_06070 8019 7576 gene locus_tag LOCUS_06080 8019 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 8563 8006 gene locus_tag LOCUS_06090 8563 8006 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390032.1 protein_id gnl|my_center|LOCUS_06090 9096 8671 gene locus_tag LOCUS_06100 9096 8671 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258892.1 protein_id gnl|my_center|LOCUS_06100 10518 9124 gene locus_tag LOCUS_06110 gene atpD 10518 9124 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_06110 11431 10547 gene locus_tag LOCUS_06120 gene atpG 11431 10547 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_06120 12966 11461 gene locus_tag LOCUS_06130 gene atpA 12966 11461 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356056.1 protein_id gnl|my_center|LOCUS_06130 13478 12972 gene locus_tag LOCUS_06140 13478 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 13960 13475 gene locus_tag LOCUS_06150 13960 13475 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051482.1 protein_id gnl|my_center|LOCUS_06150 14213 13995 gene locus_tag LOCUS_06160 14213 13995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 14480 14262 gene locus_tag LOCUS_06170 14480 14262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 15203 14508 gene locus_tag LOCUS_06180 15203 14508 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_06180 15480 16385 gene locus_tag LOCUS_06190 15480 16385 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461665.1 protein_id gnl|my_center|LOCUS_06190 17382 16483 gene locus_tag LOCUS_06200 gene trxB 17382 16483 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_06200 17907 17455 gene locus_tag LOCUS_06210 17907 17455 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356138.1 protein_id gnl|my_center|LOCUS_06210 18194 19420 gene locus_tag LOCUS_06220 18194 19420 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963429.1 protein_id gnl|my_center|LOCUS_06220 19433 20296 gene locus_tag LOCUS_06230 19433 20296 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_06230 20289 20534 gene locus_tag LOCUS_06240 20289 20534 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816171.1 protein_id gnl|my_center|LOCUS_06240 20534 20851 gene locus_tag LOCUS_06250 gene trxA 20534 20851 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_06250 20864 21070 gene locus_tag LOCUS_06260 gene thiS 20864 21070 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_06260 21070 21882 gene locus_tag LOCUS_06270 gene moeB 21070 21882 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_06270 21879 22289 gene locus_tag LOCUS_06280 21879 22289 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_06280 23740 22463 gene locus_tag LOCUS_06290 23740 22463 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845922.1 protein_id gnl|my_center|LOCUS_06290 23997 25166 gene locus_tag LOCUS_06300 23997 25166 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_06300 25345 25548 gene locus_tag LOCUS_06310 25345 25548 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_06310 25623 26285 gene locus_tag LOCUS_06320 25623 26285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 26309 27070 gene locus_tag LOCUS_06330 26309 27070 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_06330 27087 28838 gene locus_tag LOCUS_06340 27087 28838 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861612.1 protein_id gnl|my_center|LOCUS_06340 29316 31376 gene locus_tag LOCUS_06350 29316 31376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 31511 33436 gene locus_tag LOCUS_06360 31511 33436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 33447 35168 gene locus_tag LOCUS_06370 33447 35168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 35156 36088 gene locus_tag LOCUS_06380 35156 36088 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_06380 36085 37053 gene locus_tag LOCUS_06390 36085 37053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 37377 39092 gene locus_tag LOCUS_06400 37377 39092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 39089 39619 gene locus_tag LOCUS_06410 39089 39619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 39616 40482 gene locus_tag LOCUS_06420 39616 40482 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_06420 40455 42095 gene locus_tag LOCUS_06430 40455 42095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 42085 42771 gene locus_tag LOCUS_06440 42085 42771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 45484 42803 gene locus_tag LOCUS_06450 45484 42803 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_06450 45665 46456 gene locus_tag LOCUS_06460 45665 46456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 48947 46587 gene locus_tag LOCUS_06470 48947 46587 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_06470 49541 49221 gene locus_tag LOCUS_06480 49541 49221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 50245 49535 gene locus_tag LOCUS_06490 50245 49535 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_06490 50810 50280 gene locus_tag LOCUS_06500 50810 50280 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_06500 51608 51402 gene locus_tag LOCUS_06510 51608 51402 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_06510 51859 52887 gene locus_tag LOCUS_06520 51859 52887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 53058 55517 gene locus_tag LOCUS_06530 53058 55517 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_06530 55544 56056 gene locus_tag LOCUS_06540 55544 56056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 56004 56150 gene locus_tag LOCUS_06550 56004 56150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 56231 56377 gene locus_tag LOCUS_06560 56231 56377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 57412 56498 gene locus_tag LOCUS_06570 gene argF 57412 56498 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_06570 58675 57491 gene locus_tag LOCUS_06580 58675 57491 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_06580 59565 58708 gene locus_tag LOCUS_06590 gene argB 59565 58708 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_06590 60856 59600 gene locus_tag LOCUS_06600 gene argJ 60856 59600 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_06600 62268 61321 gene locus_tag LOCUS_06610 gene argC 62268 61321 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_06610 62847 62404 gene locus_tag LOCUS_06620 62847 62404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 64201 62828 gene locus_tag LOCUS_06630 gene argH 64201 62828 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_06630 64743 64309 gene locus_tag LOCUS_06640 64743 64309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 66058 64823 gene locus_tag LOCUS_06650 66058 64823 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_06650 66534 67070 gene locus_tag LOCUS_06660 66534 67070 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_06660 67101 67298 gene locus_tag LOCUS_06670 67101 67298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 67316 67639 gene locus_tag LOCUS_06680 gene trxA 67316 67639 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_06680 68858 67899 gene locus_tag LOCUS_06690 68858 67899 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_06690 69957 68851 gene locus_tag LOCUS_06700 69957 68851 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_06700 71485 69950 gene locus_tag LOCUS_06710 71485 69950 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_06710 72790 71639 gene locus_tag LOCUS_06720 72790 71639 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_06720 73411 72836 gene locus_tag LOCUS_06730 73411 72836 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948791.1 protein_id gnl|my_center|LOCUS_06730 74396 73614 gene locus_tag LOCUS_06740 74396 73614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 77059 74519 gene locus_tag LOCUS_06750 77059 74519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 77917 77402 gene locus_tag LOCUS_06760 77917 77402 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_06760 78792 77944 gene locus_tag LOCUS_06770 gene aroE 78792 77944 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439416.1 protein_id gnl|my_center|LOCUS_06770 79337 78858 gene locus_tag LOCUS_06780 79337 78858 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_06780 79883 79356 gene locus_tag LOCUS_06790 79883 79356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 80825 79902 gene locus_tag LOCUS_06800 gene fabD 80825 79902 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_06800 81239 82246 gene locus_tag LOCUS_06810 81239 82246 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_06810 82337 83275 gene locus_tag LOCUS_06820 gene fabK 82337 83275 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_06820 83351 83899 gene locus_tag LOCUS_06830 83351 83899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 83915 84649 gene locus_tag LOCUS_06840 gene fabG 83915 84649 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_06840 84741 85973 gene locus_tag LOCUS_06850 gene fabF 84741 85973 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_06850 85989 86465 gene locus_tag LOCUS_06860 gene accB 85989 86465 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555370.1 protein_id gnl|my_center|LOCUS_06860 86486 86917 gene locus_tag LOCUS_06870 gene fabZ 86486 86917 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829953.1 protein_id gnl|my_center|LOCUS_06870 86956 88326 gene locus_tag LOCUS_06880 86956 88326 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_06880 88326 89204 gene locus_tag LOCUS_06890 gene accD 88326 89204 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_06890 89197 90012 gene locus_tag LOCUS_06900 89197 90012 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 protein_id gnl|my_center|LOCUS_06900 90123 90356 gene locus_tag LOCUS_06910 gene acpP 90123 90356 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_06910 90532 90936 gene locus_tag LOCUS_06920 90532 90936 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084116061.1 protein_id gnl|my_center|LOCUS_06920 90952 91224 gene locus_tag LOCUS_06930 90952 91224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 92291 91938 gene locus_tag LOCUS_06940 92291 91938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 94425 92890 gene locus_tag LOCUS_06950 94425 92890 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_06950 95957 94809 gene locus_tag LOCUS_06960 95957 94809 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053675.1 protein_id gnl|my_center|LOCUS_06960 96118 96738 gene locus_tag LOCUS_06970 96118 96738 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681311.1 protein_id gnl|my_center|LOCUS_06970 96930 98720 gene locus_tag LOCUS_06980 96930 98720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048173276.1 protein_id gnl|my_center|LOCUS_06980 98723 100459 gene locus_tag LOCUS_06990 98723 100459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065725.1 protein_id gnl|my_center|LOCUS_06990 106289 100521 gene locus_tag LOCUS_07000 106289 100521 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203358.1 protein_id gnl|my_center|LOCUS_07000 106526 109270 gene locus_tag LOCUS_07010 106526 109270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 109488 109412 gene locus_tag LOCUS_t00050 109488 109412 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 109638 109714 gene locus_tag LOCUS_t00060 109638 109714 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 110068 109754 gene locus_tag LOCUS_07020 110068 109754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 110362 110201 gene locus_tag LOCUS_07030 110362 110201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 110553 110735 gene locus_tag LOCUS_07040 110553 110735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 111086 110916 gene locus_tag LOCUS_07050 111086 110916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 111993 111100 gene locus_tag LOCUS_07060 111993 111100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 112991 111990 gene locus_tag LOCUS_07070 112991 111990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 113894 113100 gene locus_tag LOCUS_07080 113894 113100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 114114 113905 gene locus_tag LOCUS_07090 114114 113905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 114328 114092 gene locus_tag LOCUS_07100 114328 114092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 114579 114415 gene locus_tag LOCUS_07110 114579 114415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 116264 114588 gene locus_tag LOCUS_07120 116264 114588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 116490 116335 gene locus_tag LOCUS_07130 116490 116335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 116862 116545 gene locus_tag LOCUS_07140 116862 116545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 117158 117505 gene locus_tag LOCUS_07150 117158 117505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 117506 117739 gene locus_tag LOCUS_07160 117506 117739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 117742 118029 gene locus_tag LOCUS_07170 117742 118029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 120015 118492 gene locus_tag LOCUS_07180 gene xylB 120015 118492 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_07180 120463 120284 gene locus_tag LOCUS_07190 120463 120284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 120850 121932 gene locus_tag LOCUS_07200 gene serC 120850 121932 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_07200 122110 123261 gene locus_tag LOCUS_07210 122110 123261 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_07210 123381 123674 gene locus_tag LOCUS_07220 123381 123674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 124229 123744 gene locus_tag LOCUS_07230 124229 123744 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_07230 124439 125707 gene locus_tag LOCUS_07240 124439 125707 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_07240 125700 126203 gene locus_tag LOCUS_07250 125700 126203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 126306 127139 gene locus_tag LOCUS_07260 126306 127139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 127740 127243 gene locus_tag LOCUS_07270 127740 127243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 128129 130702 gene locus_tag LOCUS_07280 128129 130702 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254445.1 protein_id gnl|my_center|LOCUS_07280 131329 130811 gene locus_tag LOCUS_07290 gene nrdG 131329 130811 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905258.1 protein_id gnl|my_center|LOCUS_07290 133798 131624 gene locus_tag LOCUS_07300 gene nrdD 133798 131624 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_07300 134156 134232 gene locus_tag LOCUS_t00070 134156 134232 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 135304 135032 gene locus_tag LOCUS_07310 135304 135032 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147081.1 protein_id gnl|my_center|LOCUS_07310 135761 135351 gene locus_tag LOCUS_07320 135761 135351 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812484.1 protein_id gnl|my_center|LOCUS_07320 135980 135798 gene locus_tag LOCUS_07330 135980 135798 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669524.1 protein_id gnl|my_center|LOCUS_07330 137146 136061 gene locus_tag LOCUS_07340 137146 136061 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_07340 140598 138091 gene locus_tag LOCUS_07350 140598 138091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 144093 140611 gene locus_tag LOCUS_07360 144093 140611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 144524 144090 gene locus_tag LOCUS_07370 144524 144090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 145243 144872 gene locus_tag LOCUS_07380 145243 144872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 145812 145246 gene locus_tag LOCUS_07390 145812 145246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 146125 145823 gene locus_tag LOCUS_07400 146125 145823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 147314 146142 gene locus_tag LOCUS_07410 147314 146142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 149986 147311 gene locus_tag LOCUS_07420 149986 147311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 150281 149955 gene locus_tag LOCUS_07430 150281 149955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 152849 150285 gene locus_tag LOCUS_07440 152849 150285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 153291 152941 gene locus_tag LOCUS_07450 153291 152941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 154356 153295 gene locus_tag LOCUS_07460 154356 153295 CDS product DUF3991 and toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368706.1 protein_id gnl|my_center|LOCUS_07460 162987 154381 gene locus_tag LOCUS_07470 162987 154381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 163820 163089 gene locus_tag LOCUS_07480 163820 163089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 163954 164721 gene locus_tag LOCUS_07490 163954 164721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 165073 164690 gene locus_tag LOCUS_07500 165073 164690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 165251 165066 gene locus_tag LOCUS_07510 165251 165066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 165402 165232 gene locus_tag LOCUS_07520 165402 165232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 165732 165424 gene locus_tag LOCUS_07530 165732 165424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 166120 166833 gene locus_tag LOCUS_07540 166120 166833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 167412 166996 gene locus_tag LOCUS_07550 167412 166996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 167714 167409 gene locus_tag LOCUS_07560 167714 167409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 171000 167803 gene locus_tag LOCUS_07570 171000 167803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 172011 171118 gene locus_tag LOCUS_07580 172011 171118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 172610 172365 gene locus_tag LOCUS_07590 172610 172365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 173579 172659 gene locus_tag LOCUS_07600 173579 172659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 174003 173602 gene locus_tag LOCUS_07610 174003 173602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 174122 174000 gene locus_tag LOCUS_07620 174122 174000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 174595 174191 gene locus_tag LOCUS_07630 174595 174191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 175568 175134 gene locus_tag LOCUS_07640 175568 175134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 175932 175588 gene locus_tag LOCUS_07650 175932 175588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 176158 175925 gene locus_tag LOCUS_07660 176158 175925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 177117 176191 gene locus_tag LOCUS_07670 177117 176191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 177945 177130 gene locus_tag LOCUS_07680 177945 177130 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014352.1 protein_id gnl|my_center|LOCUS_07680 178364 178101 gene locus_tag LOCUS_07690 178364 178101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 178380 179333 gene locus_tag LOCUS_07700 178380 179333 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949052.1 protein_id gnl|my_center|LOCUS_07700 179679 180335 gene locus_tag LOCUS_07710 179679 180335 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_07710 183190 180650 gene locus_tag LOCUS_07720 183190 180650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 183423 183563 gene locus_tag LOCUS_07730 183423 183563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 183530 184861 gene locus_tag LOCUS_07740 gene ypeB 183530 184861 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947975.1 protein_id gnl|my_center|LOCUS_07740 184879 185490 gene locus_tag LOCUS_07750 184879 185490 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_07750 185880 187010 gene locus_tag LOCUS_07760 185880 187010 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_07760 187129 188304 gene locus_tag LOCUS_07770 gene thiI 187129 188304 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_07770 188657 189196 gene locus_tag LOCUS_07780 188657 189196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 189202 190272 gene locus_tag LOCUS_07790 189202 190272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 190373 191482 gene locus_tag LOCUS_07800 190373 191482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 191678 193117 gene locus_tag LOCUS_07810 191678 193117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 193136 193831 gene locus_tag LOCUS_07820 193136 193831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 193911 194516 gene locus_tag LOCUS_07830 193911 194516 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_07830 195214 194504 gene locus_tag LOCUS_07840 195214 194504 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459753.1 protein_id gnl|my_center|LOCUS_07840 195327 195527 gene locus_tag LOCUS_07850 195327 195527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 195542 195847 gene locus_tag LOCUS_07860 195542 195847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 196379 197581 gene locus_tag LOCUS_07870 gene ilvA 196379 197581 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_07870 197605 197979 gene locus_tag LOCUS_07880 197605 197979 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356039.1 protein_id gnl|my_center|LOCUS_07880 198146 199384 gene locus_tag LOCUS_07890 198146 199384 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037141.1 protein_id gnl|my_center|LOCUS_07890 199903 199415 gene locus_tag LOCUS_07900 gene ybaK 199903 199415 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_07900 200535 199933 gene locus_tag LOCUS_07910 200535 199933 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_07910 201381 200752 gene locus_tag LOCUS_07920 201381 200752 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_07920 203011 201596 gene locus_tag LOCUS_07930 203011 201596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 204202 203333 gene locus_tag LOCUS_07940 gene gpr 204202 203333 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430954.1 protein_id gnl|my_center|LOCUS_07940 204424 204675 gene locus_tag LOCUS_07950 gene rpsT 204424 204675 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_07950 204831 205676 gene locus_tag LOCUS_07960 204831 205676 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672882.1 protein_id gnl|my_center|LOCUS_07960 205917 207569 gene locus_tag LOCUS_07970 205917 207569 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582688.1 protein_id gnl|my_center|LOCUS_07970 210374 207699 gene locus_tag LOCUS_07980 210374 207699 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_07980 210607 211242 gene locus_tag LOCUS_07990 210607 211242 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_07990 211456 212235 gene locus_tag LOCUS_08000 211456 212235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 212304 212996 gene locus_tag LOCUS_08010 212304 212996 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_08010 212983 213708 gene locus_tag LOCUS_08020 212983 213708 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640790.1 protein_id gnl|my_center|LOCUS_08020 213846 215195 gene locus_tag LOCUS_08030 213846 215195 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_08030 215197 215937 gene locus_tag LOCUS_08040 215197 215937 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392510.1 protein_id gnl|my_center|LOCUS_08040 215940 216314 gene locus_tag LOCUS_08050 215940 216314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 216325 218034 gene locus_tag LOCUS_08060 216325 218034 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361510.1 protein_id gnl|my_center|LOCUS_08060 218121 219224 gene locus_tag LOCUS_08070 218121 219224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 219266 220261 gene locus_tag LOCUS_08080 219266 220261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 220280 221269 gene locus_tag LOCUS_08090 220280 221269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 222125 221325 gene locus_tag LOCUS_08100 222125 221325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 222799 222245 gene locus_tag LOCUS_08110 222799 222245 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_08110 225397 223016 gene locus_tag LOCUS_08120 225397 223016 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_08120 227547 226069 gene locus_tag LOCUS_08130 gene malQ 227547 226069 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_08130 228405 227734 gene locus_tag LOCUS_08140 228405 227734 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_08140 229092 229457 gene locus_tag LOCUS_08150 229092 229457 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965540.1 protein_id gnl|my_center|LOCUS_08150 229499 231832 gene locus_tag LOCUS_08160 229499 231832 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_08160 232032 233468 gene locus_tag LOCUS_08170 232032 233468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence04 76 151 gene locus_tag LOCUS_t00080 76 151 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 442 1083 gene locus_tag LOCUS_08180 442 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1071 2549 gene locus_tag LOCUS_08190 1071 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 2497 5025 gene locus_tag LOCUS_08200 2497 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 5113 5808 gene locus_tag LOCUS_08210 5113 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 5990 5805 gene locus_tag LOCUS_08220 5990 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6226 7977 gene locus_tag LOCUS_08230 6226 7977 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_08230 8085 8771 gene locus_tag LOCUS_08240 8085 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 10136 9207 gene locus_tag LOCUS_08250 10136 9207 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644751.1 protein_id gnl|my_center|LOCUS_08250 10420 11328 gene locus_tag LOCUS_08260 10420 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 11480 11935 gene locus_tag LOCUS_08270 11480 11935 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_08270 11962 13095 gene locus_tag LOCUS_08280 11962 13095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 13983 13330 gene locus_tag LOCUS_08290 13983 13330 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_08290 14215 14871 gene locus_tag LOCUS_08300 14215 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 14939 17560 gene locus_tag LOCUS_08310 gene clpB 14939 17560 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_08310 17811 20153 gene locus_tag LOCUS_08320 17811 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 20742 20215 gene locus_tag LOCUS_08330 20742 20215 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_08330 21166 22761 gene locus_tag LOCUS_08340 21166 22761 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963949.1 protein_id gnl|my_center|LOCUS_08340 22933 24486 gene locus_tag LOCUS_08350 22933 24486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 24660 25379 gene locus_tag LOCUS_08360 gene cwlD 24660 25379 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966373.1 protein_id gnl|my_center|LOCUS_08360 25565 28339 gene locus_tag LOCUS_08370 gene secA 25565 28339 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895216.1 protein_id gnl|my_center|LOCUS_08370 28408 29670 gene locus_tag LOCUS_08380 28408 29670 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_08380 29735 30904 gene locus_tag LOCUS_08390 29735 30904 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_08390 30904 31602 gene locus_tag LOCUS_08400 30904 31602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 31883 33034 gene locus_tag LOCUS_08410 31883 33034 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964144.1 protein_id gnl|my_center|LOCUS_08410 33776 33342 gene locus_tag LOCUS_08420 33776 33342 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261614.1 protein_id gnl|my_center|LOCUS_08420 34704 33781 gene locus_tag LOCUS_08430 gene nadA 34704 33781 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_08430 34919 35362 gene locus_tag LOCUS_08440 34919 35362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 35383 37914 gene locus_tag LOCUS_08450 35383 37914 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942320.1 protein_id gnl|my_center|LOCUS_08450 38206 38916 gene locus_tag LOCUS_08460 38206 38916 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262170.1 protein_id gnl|my_center|LOCUS_08460 38928 39689 gene locus_tag LOCUS_08470 38928 39689 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_08470 39895 40767 gene locus_tag LOCUS_08480 39895 40767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 41018 41887 gene locus_tag LOCUS_08490 41018 41887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 42441 41935 gene locus_tag LOCUS_08500 42441 41935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 44013 42490 gene locus_tag LOCUS_08510 44013 42490 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_08510 44389 44006 gene locus_tag LOCUS_08520 gene acpS 44389 44006 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583384.1 protein_id gnl|my_center|LOCUS_08520 44898 44392 gene locus_tag LOCUS_08530 44898 44392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 45539 44913 gene locus_tag LOCUS_08540 45539 44913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 46367 45573 gene locus_tag LOCUS_08550 46367 45573 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_08550 46813 46472 gene locus_tag LOCUS_08560 46813 46472 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963739.1 protein_id gnl|my_center|LOCUS_08560 47271 46810 gene locus_tag LOCUS_08570 gene dtd 47271 46810 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048079.1 protein_id gnl|my_center|LOCUS_08570 48113 47271 gene locus_tag LOCUS_08580 48113 47271 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932949.1 protein_id gnl|my_center|LOCUS_08580 48468 49994 gene locus_tag LOCUS_08590 48468 49994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 50203 53181 gene locus_tag LOCUS_08600 50203 53181 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_08600 53181 54446 gene locus_tag LOCUS_08610 53181 54446 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_08610 55976 54492 gene locus_tag LOCUS_08620 55976 54492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 56871 55948 gene locus_tag LOCUS_08630 56871 55948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922156.1 protein_id gnl|my_center|LOCUS_08630 57245 56868 gene locus_tag LOCUS_08640 57245 56868 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723373.1 protein_id gnl|my_center|LOCUS_08640 57613 58611 gene locus_tag LOCUS_08650 57613 58611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 58788 59348 gene locus_tag LOCUS_08660 58788 59348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 59345 60841 gene locus_tag LOCUS_08670 59345 60841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 61479 60931 gene locus_tag LOCUS_08680 61479 60931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 61619 61813 gene locus_tag LOCUS_08690 61619 61813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 61879 62610 gene locus_tag LOCUS_08700 61879 62610 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_08700 63065 63640 gene locus_tag LOCUS_08710 63065 63640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 63754 63906 gene locus_tag LOCUS_08720 63754 63906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 64092 64463 gene locus_tag LOCUS_08730 64092 64463 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964778.1 protein_id gnl|my_center|LOCUS_08730 65714 64551 gene locus_tag LOCUS_08740 gene dnaJ 65714 64551 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357822.1 protein_id gnl|my_center|LOCUS_08740 67734 65860 gene locus_tag LOCUS_08750 gene dnaK 67734 65860 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_08750 68370 67798 gene locus_tag LOCUS_08760 68370 67798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 69421 68393 gene locus_tag LOCUS_08770 gene hrcA 69421 68393 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246126.1 protein_id gnl|my_center|LOCUS_08770 70422 69673 gene locus_tag LOCUS_08780 70422 69673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 71276 70452 gene locus_tag LOCUS_08790 71276 70452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 71498 72184 gene locus_tag LOCUS_08800 gene sfsA 71498 72184 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_08800 72244 73407 gene locus_tag LOCUS_08810 72244 73407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 73580 74977 gene locus_tag LOCUS_08820 73580 74977 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963631.1 protein_id gnl|my_center|LOCUS_08820 75193 75459 gene locus_tag LOCUS_08830 75193 75459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 75896 76573 gene locus_tag LOCUS_08840 75896 76573 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_08840 76599 77930 gene locus_tag LOCUS_08850 76599 77930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 78898 78047 gene locus_tag LOCUS_08860 78898 78047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 80404 79082 gene locus_tag LOCUS_08870 80404 79082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 81353 80397 gene locus_tag LOCUS_08880 81353 80397 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000207738.1 protein_id gnl|my_center|LOCUS_08880 82077 81346 gene locus_tag LOCUS_08890 82077 81346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 84027 82360 gene locus_tag LOCUS_08900 gene ptsP 84027 82360 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_08900 84283 84972 gene locus_tag LOCUS_08910 gene sigK 84283 84972 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051382.1 protein_id gnl|my_center|LOCUS_08910 85242 85658 gene locus_tag LOCUS_08920 85242 85658 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 protein_id gnl|my_center|LOCUS_08920 86274 85780 gene locus_tag LOCUS_08930 86274 85780 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986971.1 protein_id gnl|my_center|LOCUS_08930 87586 86234 gene locus_tag LOCUS_08940 87586 86234 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_08940 88271 89074 gene locus_tag LOCUS_08950 88271 89074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 91191 89080 gene locus_tag LOCUS_08960 91191 89080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 92435 91242 gene locus_tag LOCUS_08970 gene coaBC 92435 91242 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_08970 94463 92703 gene locus_tag LOCUS_08980 94463 92703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 94739 94664 gene locus_tag LOCUS_t00090 94739 94664 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 94840 94765 gene locus_tag LOCUS_t00100 94840 94765 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 95069 95518 gene locus_tag LOCUS_08990 gene mscL 95069 95518 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643168.1 protein_id gnl|my_center|LOCUS_08990 95808 97442 gene locus_tag LOCUS_09000 95808 97442 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_09000 97465 98058 gene locus_tag LOCUS_09010 97465 98058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 98145 98236 gene locus_tag LOCUS_t00110 98145 98236 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 98330 98542 gene locus_tag LOCUS_09020 98330 98542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 98557 99723 gene locus_tag LOCUS_09030 98557 99723 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967050.1 protein_id gnl|my_center|LOCUS_09030 99742 101178 gene locus_tag LOCUS_09040 99742 101178 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 protein_id gnl|my_center|LOCUS_09040 101263 101517 gene locus_tag LOCUS_09050 101263 101517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 101588 103699 gene locus_tag LOCUS_09060 gene rnr 101588 103699 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_09060 106400 103989 gene locus_tag LOCUS_09070 106400 103989 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081712308.1 protein_id gnl|my_center|LOCUS_09070 107847 106972 gene locus_tag LOCUS_09080 107847 106972 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 protein_id gnl|my_center|LOCUS_09080 108762 107893 gene locus_tag LOCUS_09090 108762 107893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 109981 108881 gene locus_tag LOCUS_09100 109981 108881 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_09100 112332 110794 gene locus_tag LOCUS_09110 112332 110794 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_09110 112749 113213 gene locus_tag LOCUS_09120 112749 113213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 113210 114454 gene locus_tag LOCUS_09130 113210 114454 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_09130 114488 115654 gene locus_tag LOCUS_09140 114488 115654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 115651 116487 gene locus_tag LOCUS_09150 115651 116487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 116715 117689 gene locus_tag LOCUS_09160 116715 117689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 117750 118130 gene locus_tag LOCUS_09170 117750 118130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 118146 118568 gene locus_tag LOCUS_09180 118146 118568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 118561 118905 gene locus_tag LOCUS_09190 118561 118905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 118905 119813 gene locus_tag LOCUS_09200 118905 119813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 120770 119889 gene locus_tag LOCUS_09210 120770 119889 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389896.1 protein_id gnl|my_center|LOCUS_09210 121706 120777 gene locus_tag LOCUS_09220 121706 120777 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582885.1 protein_id gnl|my_center|LOCUS_09220 123315 121801 gene locus_tag LOCUS_09230 123315 121801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 124404 123394 gene locus_tag LOCUS_09240 gene purR 124404 123394 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366884.1 protein_id gnl|my_center|LOCUS_09240 125375 125450 gene locus_tag LOCUS_t00120 125375 125450 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 126681 127019 gene locus_tag LOCUS_09250 126681 127019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 127169 127936 gene locus_tag LOCUS_09260 127169 127936 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459342.1 protein_id gnl|my_center|LOCUS_09260 127955 128965 gene locus_tag LOCUS_09270 127955 128965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 128981 129964 gene locus_tag LOCUS_09280 gene galE 128981 129964 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016045.1 protein_id gnl|my_center|LOCUS_09280 129979 131466 gene locus_tag LOCUS_09290 129979 131466 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016044.1 protein_id gnl|my_center|LOCUS_09290 131838 131548 gene locus_tag LOCUS_09300 131838 131548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 132318 133661 gene locus_tag LOCUS_09310 132318 133661 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_09310 133851 134036 gene locus_tag LOCUS_09320 133851 134036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 135071 135538 gene locus_tag LOCUS_09330 135071 135538 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965786.1 protein_id gnl|my_center|LOCUS_09330 135555 138113 gene locus_tag LOCUS_09340 135555 138113 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_09340 138336 138157 gene locus_tag LOCUS_09350 138336 138157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 139544 138351 gene locus_tag LOCUS_09360 gene gltS 139544 138351 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_09360 140494 139541 gene locus_tag LOCUS_09370 140494 139541 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053693.1 protein_id gnl|my_center|LOCUS_09370 143334 140653 gene locus_tag LOCUS_09380 143334 140653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 144538 143345 gene locus_tag LOCUS_09390 144538 143345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 145518 144550 gene locus_tag LOCUS_09400 145518 144550 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582473.1 protein_id gnl|my_center|LOCUS_09400 145739 146674 gene locus_tag LOCUS_09410 gene spoIIIAA 145739 146674 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_09410 146676 147164 gene locus_tag LOCUS_09420 gene spoIIIAB 146676 147164 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965392.1 protein_id gnl|my_center|LOCUS_09420 147205 147402 gene locus_tag LOCUS_09430 147205 147402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 147402 147788 gene locus_tag LOCUS_09440 gene spoIIIAD 147402 147788 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428424.1 protein_id gnl|my_center|LOCUS_09440 147798 148937 gene locus_tag LOCUS_09450 gene spoIIIAE 147798 148937 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_09450 148939 149409 gene locus_tag LOCUS_09460 148939 149409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 149413 149964 gene locus_tag LOCUS_09470 149413 149964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 149983 150525 gene locus_tag LOCUS_09480 149983 150525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 150646 151008 gene locus_tag LOCUS_09490 150646 151008 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638623.1 protein_id gnl|my_center|LOCUS_09490 151044 151457 gene locus_tag LOCUS_09500 gene nusB 151044 151457 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965384.1 protein_id gnl|my_center|LOCUS_09500 151454 152395 gene locus_tag LOCUS_09510 151454 152395 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_09510 152392 153585 gene locus_tag LOCUS_09520 gene xseA 152392 153585 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_09520 153599 153787 gene locus_tag LOCUS_09530 153599 153787 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262107.1 protein_id gnl|my_center|LOCUS_09530 153780 154673 gene locus_tag LOCUS_09540 153780 154673 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_09540 154699 156555 gene locus_tag LOCUS_09550 gene dxs 154699 156555 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_09550 156548 157213 gene locus_tag LOCUS_09560 156548 157213 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09560 157373 158248 gene locus_tag LOCUS_09570 157373 158248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 158245 158703 gene locus_tag LOCUS_09580 158245 158703 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_09580 158725 160395 gene locus_tag LOCUS_09590 gene recN 158725 160395 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_09590 160504 161175 gene locus_tag LOCUS_09600 160504 161175 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_09600 161165 163531 gene locus_tag LOCUS_09610 161165 163531 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_09610 163592 163828 gene locus_tag LOCUS_09620 163592 163828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 163924 167280 gene locus_tag LOCUS_09630 gene addB 163924 167280 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_09630 167281 170991 gene locus_tag LOCUS_09640 gene addA 167281 170991 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861079.1 protein_id gnl|my_center|LOCUS_09640 171203 171757 gene locus_tag LOCUS_09650 gene infC 171203 171757 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965658.1 protein_id gnl|my_center|LOCUS_09650 171780 171977 gene locus_tag LOCUS_09660 gene rpmI 171780 171977 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_09660 172026 172379 gene locus_tag LOCUS_09670 gene rplT 172026 172379 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_09670 172498 173319 gene locus_tag LOCUS_09680 172498 173319 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_09680 173312 174544 gene locus_tag LOCUS_09690 173312 174544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 174570 176660 gene locus_tag LOCUS_09700 gene topA 174570 176660 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357484.1 protein_id gnl|my_center|LOCUS_09700 176650 177966 gene locus_tag LOCUS_09710 gene trmFO 176650 177966 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357486.1 protein_id gnl|my_center|LOCUS_09710 177977 178987 gene locus_tag LOCUS_09720 gene plsX 177977 178987 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_09720 178987 179685 gene locus_tag LOCUS_09730 gene rnc 178987 179685 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_09730 179723 180697 gene locus_tag LOCUS_09740 179723 180697 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965056.1 protein_id gnl|my_center|LOCUS_09740 180697 184263 gene locus_tag LOCUS_09750 gene smc 180697 184263 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_09750 184274 185179 gene locus_tag LOCUS_09760 gene ftsY 184274 185179 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393780.1 protein_id gnl|my_center|LOCUS_09760 185230 185730 gene locus_tag LOCUS_09770 185230 185730 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262521.1 protein_id gnl|my_center|LOCUS_09770 185741 186319 gene locus_tag LOCUS_09780 185741 186319 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_09780 186338 186634 gene locus_tag LOCUS_09790 gene yhbY 186338 186634 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358089.1 protein_id gnl|my_center|LOCUS_09790 186634 187251 gene locus_tag LOCUS_09800 gene nadD 186634 187251 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_09800 187241 187819 gene locus_tag LOCUS_09810 gene yqeK 187241 187819 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_09810 187831 188208 gene locus_tag LOCUS_09820 gene rsfS 187831 188208 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_09820 188245 190653 gene locus_tag LOCUS_09830 gene leuS 188245 190653 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_09830 190912 191085 gene locus_tag LOCUS_09840 190912 191085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 191148 191627 gene locus_tag LOCUS_09850 191148 191627 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356296.1 protein_id gnl|my_center|LOCUS_09850 191652 192506 gene locus_tag LOCUS_09860 191652 192506 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249125.1 protein_id gnl|my_center|LOCUS_09860 192525 192983 gene locus_tag LOCUS_09870 gene aroQ 192525 192983 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_09870 192976 194040 gene locus_tag LOCUS_09880 192976 194040 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_09880 194180 194737 gene locus_tag LOCUS_09890 gene efp 194180 194737 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_09890 194777 195217 gene locus_tag LOCUS_09900 194777 195217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359049.1 protein_id gnl|my_center|LOCUS_09900 195478 196101 gene locus_tag LOCUS_09910 195478 196101 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186912.1 protein_id gnl|my_center|LOCUS_09910 197341 196169 gene locus_tag LOCUS_09920 gene metK 197341 196169 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_09920 197695 198279 gene locus_tag LOCUS_09930 197695 198279 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_09930 198276 198842 gene locus_tag LOCUS_09940 198276 198842 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_09940 200107 198896 gene locus_tag LOCUS_09950 200107 198896 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_09950 200677 200120 gene locus_tag LOCUS_09960 200677 200120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 202641 200701 gene locus_tag LOCUS_09970 202641 200701 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_09970 202876 203865 gene locus_tag LOCUS_09980 202876 203865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 203875 204648 gene locus_tag LOCUS_09990 203875 204648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 204775 205857 gene locus_tag LOCUS_10000 204775 205857 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_10000 205850 206659 gene locus_tag LOCUS_10010 gene murI 205850 206659 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_10010 206675 207112 gene locus_tag LOCUS_10020 206675 207112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 207140 208828 gene locus_tag LOCUS_10030 gene argS 207140 208828 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462258.1 protein_id gnl|my_center|LOCUS_10030 209679 208876 gene locus_tag LOCUS_10040 209679 208876 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_10040 209808 210491 gene locus_tag LOCUS_10050 209808 210491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 210994 210812 gene locus_tag LOCUS_10060 210994 210812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 211024 211284 gene locus_tag LOCUS_10070 211024 211284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 211417 212190 gene locus_tag LOCUS_10080 gene rlmB 211417 212190 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_10080 212211 214505 gene locus_tag LOCUS_10090 212211 214505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 215222 214548 gene locus_tag LOCUS_10100 215222 214548 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence05 709 26 gene locus_tag LOCUS_10110 709 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1223 702 gene locus_tag LOCUS_10120 1223 702 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_10120 1460 2578 gene locus_tag LOCUS_10130 1460 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2781 3515 gene locus_tag LOCUS_10140 2781 3515 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_10140 3487 3621 gene locus_tag LOCUS_10150 3487 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3649 4515 gene locus_tag LOCUS_10160 3649 4515 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 protein_id gnl|my_center|LOCUS_10160 4651 7242 gene locus_tag LOCUS_10170 4651 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 7263 8204 gene locus_tag LOCUS_10180 7263 8204 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_10180 8206 8421 gene locus_tag LOCUS_10190 8206 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 8478 9350 gene locus_tag LOCUS_10200 8478 9350 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_10200 9347 10582 gene locus_tag LOCUS_10210 9347 10582 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_10210 10595 11926 gene locus_tag LOCUS_10220 10595 11926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 11927 13885 gene locus_tag LOCUS_10230 11927 13885 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_10230 14065 16287 gene locus_tag LOCUS_10240 14065 16287 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965598.1 protein_id gnl|my_center|LOCUS_10240 16337 17455 gene locus_tag LOCUS_10250 16337 17455 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_10250 19604 18006 gene locus_tag LOCUS_10260 19604 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 20102 19818 gene locus_tag LOCUS_10270 20102 19818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 21083 20163 gene locus_tag LOCUS_10280 gene tsf 21083 20163 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_10280 21902 21159 gene locus_tag LOCUS_10290 gene rpsB 21902 21159 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_10290 22323 22078 gene locus_tag LOCUS_10300 22323 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 23218 22433 gene locus_tag LOCUS_10310 23218 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 24173 23403 gene locus_tag LOCUS_10320 gene sigG 24173 23403 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416101.1 protein_id gnl|my_center|LOCUS_10320 24520 24311 gene locus_tag LOCUS_10330 24520 24311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 25638 24523 gene locus_tag LOCUS_10340 25638 24523 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027778.1 protein_id gnl|my_center|LOCUS_10340 26674 25628 gene locus_tag LOCUS_10350 26674 25628 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_10350 26892 27668 gene locus_tag LOCUS_10360 26892 27668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 28426 27707 gene locus_tag LOCUS_10370 gene sigE 28426 27707 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_10370 29273 28443 gene locus_tag LOCUS_10380 29273 28443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 30806 29394 gene locus_tag LOCUS_10390 30806 29394 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_10390 31551 30889 gene locus_tag LOCUS_10400 31551 30889 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816766.1 protein_id gnl|my_center|LOCUS_10400 32143 31541 gene locus_tag LOCUS_10410 gene coaE 32143 31541 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048037.1 protein_id gnl|my_center|LOCUS_10410 33159 32140 gene locus_tag LOCUS_10420 33159 32140 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_10420 34242 33163 gene locus_tag LOCUS_10430 gene prfA 34242 33163 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_10430 34499 34311 gene locus_tag LOCUS_10440 34499 34311 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_10440 34773 35228 gene locus_tag LOCUS_10450 34773 35228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 35244 37001 gene locus_tag LOCUS_10460 35244 37001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461398.1 protein_id gnl|my_center|LOCUS_10460 37018 38796 gene locus_tag LOCUS_10470 37018 38796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_10470 39017 40291 gene locus_tag LOCUS_10480 39017 40291 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856534.1 protein_id gnl|my_center|LOCUS_10480 40489 40767 gene locus_tag LOCUS_10490 40489 40767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 40793 42241 gene locus_tag LOCUS_10500 gene gatA 40793 42241 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_10500 42256 45129 gene locus_tag LOCUS_10510 42256 45129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 45341 46504 gene locus_tag LOCUS_10520 45341 46504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 46709 47542 gene locus_tag LOCUS_10530 46709 47542 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_10530 47542 48927 gene locus_tag LOCUS_10540 gene gltA 47542 48927 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_10540 49022 49354 gene locus_tag LOCUS_10550 49022 49354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 49461 49865 gene locus_tag LOCUS_10560 49461 49865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 49964 50107 gene locus_tag LOCUS_10570 gene scfA 49964 50107 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_10570 50226 51599 gene locus_tag LOCUS_10580 gene scfB 50226 51599 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_10580 51996 53009 gene locus_tag LOCUS_10590 51996 53009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 53174 53920 gene locus_tag LOCUS_10600 53174 53920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 53939 54673 gene locus_tag LOCUS_10610 53939 54673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 54718 55377 gene locus_tag LOCUS_10620 54718 55377 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246088.1 protein_id gnl|my_center|LOCUS_10620 55399 56967 gene locus_tag LOCUS_10630 55399 56967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 57004 59118 gene locus_tag LOCUS_10640 57004 59118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 59230 59823 gene locus_tag LOCUS_10650 59230 59823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 59795 60247 gene locus_tag LOCUS_10660 59795 60247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 60266 60493 gene locus_tag LOCUS_10670 60266 60493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 60508 61458 gene locus_tag LOCUS_10680 60508 61458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 61494 66602 gene locus_tag LOCUS_10690 61494 66602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 66629 71236 gene locus_tag LOCUS_10700 66629 71236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 71263 71961 gene locus_tag LOCUS_10710 71263 71961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 71994 72971 gene locus_tag LOCUS_10720 71994 72971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 73322 73077 gene locus_tag LOCUS_10730 73322 73077 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_10730 74507 73335 gene locus_tag LOCUS_10740 74507 73335 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391942.1 protein_id gnl|my_center|LOCUS_10740 75471 74599 gene locus_tag LOCUS_10750 75471 74599 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_10750 76649 75678 gene locus_tag LOCUS_10760 76649 75678 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_10760 77074 76658 gene locus_tag LOCUS_10770 77074 76658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 77770 79740 gene locus_tag LOCUS_10780 gene uvrB 77770 79740 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_10780 79939 82761 gene locus_tag LOCUS_10790 gene uvrA 79939 82761 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_10790 83301 83753 gene locus_tag LOCUS_10800 83301 83753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 83921 85774 gene locus_tag LOCUS_10810 83921 85774 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_10810 85761 86462 gene locus_tag LOCUS_10820 85761 86462 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438070.1 protein_id gnl|my_center|LOCUS_10820 86654 86998 gene locus_tag LOCUS_10830 gene rplS 86654 86998 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_10830 87447 88301 gene locus_tag LOCUS_10840 87447 88301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 88420 89055 gene locus_tag LOCUS_10850 gene lepB 88420 89055 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_10850 89052 89621 gene locus_tag LOCUS_10860 gene lepB 89052 89621 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_10860 89642 90538 gene locus_tag LOCUS_10870 gene ylqF 89642 90538 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965068.1 protein_id gnl|my_center|LOCUS_10870 90540 91154 gene locus_tag LOCUS_10880 90540 91154 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_10880 91144 91524 gene locus_tag LOCUS_10890 91144 91524 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_10890 91673 93163 gene locus_tag LOCUS_10900 gene thrC 91673 93163 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_10900 93400 93236 gene locus_tag LOCUS_10910 93400 93236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 93497 94207 gene locus_tag LOCUS_10920 93497 94207 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357219.1 protein_id gnl|my_center|LOCUS_10920 94280 95560 gene locus_tag LOCUS_10930 gene tig 94280 95560 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_10930 95624 96214 gene locus_tag LOCUS_10940 gene clpP 95624 96214 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357557.1 protein_id gnl|my_center|LOCUS_10940 96229 97494 gene locus_tag LOCUS_10950 gene clpX 96229 97494 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_10950 97901 98191 gene locus_tag LOCUS_10960 97901 98191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 98214 99476 gene locus_tag LOCUS_10970 98214 99476 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_10970 99666 100913 gene locus_tag LOCUS_10980 99666 100913 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_10980 101070 102005 gene locus_tag LOCUS_10990 gene metA 101070 102005 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_10990 102002 102682 gene locus_tag LOCUS_11000 102002 102682 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_11000 102748 103647 gene locus_tag LOCUS_11010 gene pfkB 102748 103647 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_11010 104761 103841 gene locus_tag LOCUS_11020 104761 103841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 105186 106064 gene locus_tag LOCUS_11030 105186 106064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 106185 106967 gene locus_tag LOCUS_11040 106185 106967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 108422 107232 gene locus_tag LOCUS_11050 108422 107232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 108638 109744 gene locus_tag LOCUS_11060 108638 109744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 109843 110214 gene locus_tag LOCUS_11070 109843 110214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 110399 110474 gene locus_tag LOCUS_t00130 110399 110474 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 111960 110665 gene locus_tag LOCUS_11080 gene eno 111960 110665 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_11080 113079 112372 gene locus_tag LOCUS_11090 113079 112372 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832311.1 protein_id gnl|my_center|LOCUS_11090 114296 113151 gene locus_tag LOCUS_11100 114296 113151 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_11100 114632 116023 gene locus_tag LOCUS_11110 gene murD 114632 116023 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_11110 116050 117066 gene locus_tag LOCUS_11120 116050 117066 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_11120 117073 118092 gene locus_tag LOCUS_11130 117073 118092 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_11130 118089 118865 gene locus_tag LOCUS_11140 118089 118865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 118858 120129 gene locus_tag LOCUS_11150 118858 120129 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_11150 120157 121116 gene locus_tag LOCUS_11160 gene hprK 120157 121116 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_11160 121157 121879 gene locus_tag LOCUS_11170 121157 121879 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963831.1 protein_id gnl|my_center|LOCUS_11170 121925 122839 gene locus_tag LOCUS_11180 gene murB 121925 122839 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476187.1 protein_id gnl|my_center|LOCUS_11180 122900 123757 gene locus_tag LOCUS_11190 gene rapZ 122900 123757 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_11190 123771 124712 gene locus_tag LOCUS_11200 gene whiA 123771 124712 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_11200 124715 128185 gene locus_tag LOCUS_11210 124715 128185 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_11210 128188 128355 gene locus_tag LOCUS_11220 128188 128355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 128474 129760 gene locus_tag LOCUS_11230 128474 129760 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_11230 129753 131027 gene locus_tag LOCUS_11240 129753 131027 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411954.1 protein_id gnl|my_center|LOCUS_11240 131069 132319 gene locus_tag LOCUS_11250 131069 132319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 132320 133174 gene locus_tag LOCUS_11260 gene folD 132320 133174 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226732.1 protein_id gnl|my_center|LOCUS_11260 133348 133614 gene locus_tag LOCUS_11270 gene rpsO 133348 133614 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_11270 133792 135906 gene locus_tag LOCUS_11280 gene pnp 133792 135906 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_11280 136013 136747 gene locus_tag LOCUS_11290 136013 136747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 136841 137683 gene locus_tag LOCUS_11300 136841 137683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 137826 138170 gene locus_tag LOCUS_11310 137826 138170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 138188 140434 gene locus_tag LOCUS_11320 138188 140434 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_11320 140643 141125 gene locus_tag LOCUS_11330 140643 141125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 141168 141362 gene locus_tag LOCUS_11340 141168 141362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 141352 141609 gene locus_tag LOCUS_11350 141352 141609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 142439 141642 gene locus_tag LOCUS_11360 142439 141642 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_11360 142684 143136 gene locus_tag LOCUS_11370 142684 143136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 143168 144391 gene locus_tag LOCUS_11380 143168 144391 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_11380 144460 145044 gene locus_tag LOCUS_11390 gene yfbR 144460 145044 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482513.1 protein_id gnl|my_center|LOCUS_11390 145131 145784 gene locus_tag LOCUS_11400 gene rpe 145131 145784 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_11400 146303 145767 gene locus_tag LOCUS_11410 146303 145767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 148325 146382 gene locus_tag LOCUS_11420 148325 146382 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244150.1 protein_id gnl|my_center|LOCUS_11420 148546 149358 gene locus_tag LOCUS_11430 gene speD 148546 149358 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_11430 149438 150826 gene locus_tag LOCUS_11440 149438 150826 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_11440 150843 151694 gene locus_tag LOCUS_11450 gene speE 150843 151694 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_11450 151706 152554 gene locus_tag LOCUS_11460 gene speB 151706 152554 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_11460 152566 153477 gene locus_tag LOCUS_11470 152566 153477 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986634.1 protein_id gnl|my_center|LOCUS_11470 153506 154708 gene locus_tag LOCUS_11480 153506 154708 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_11480 154723 154962 gene locus_tag LOCUS_11490 154723 154962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 154975 155205 gene locus_tag LOCUS_11500 154975 155205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 155186 155506 gene locus_tag LOCUS_11510 155186 155506 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_11510 155507 155791 gene locus_tag LOCUS_11520 155507 155791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 155808 156938 gene locus_tag LOCUS_11530 gene nspC 155808 156938 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_11530 157771 156986 gene locus_tag LOCUS_11540 157771 156986 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_11540 158199 160469 gene locus_tag LOCUS_11550 158199 160469 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987152.1 protein_id gnl|my_center|LOCUS_11550 160761 160576 gene locus_tag LOCUS_11560 gene rpmB 160761 160576 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_11560 161010 161675 gene locus_tag LOCUS_11570 161010 161675 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372445.1 protein_id gnl|my_center|LOCUS_11570 161702 162889 gene locus_tag LOCUS_11580 161702 162889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 162910 163473 gene locus_tag LOCUS_11590 gene scpB 162910 163473 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_11590 163493 164497 gene locus_tag LOCUS_11600 163493 164497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 164518 164913 gene locus_tag LOCUS_11610 gene ytfJ 164518 164913 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392871.1 protein_id gnl|my_center|LOCUS_11610 165037 166122 gene locus_tag LOCUS_11620 165037 166122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 166160 166891 gene locus_tag LOCUS_11630 166160 166891 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_11630 167125 168507 gene locus_tag LOCUS_11640 gene mmdA 167125 168507 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879706.1 protein_id gnl|my_center|LOCUS_11640 168546 168908 gene locus_tag LOCUS_11650 168546 168908 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902663.1 protein_id gnl|my_center|LOCUS_11650 168946 170343 gene locus_tag LOCUS_11660 gene oadA 168946 170343 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_11660 170452 171579 gene locus_tag LOCUS_11670 170452 171579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 172129 171614 gene locus_tag LOCUS_11680 gene yfcE 172129 171614 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_11680 173330 172143 gene locus_tag LOCUS_11690 173330 172143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 174338 173337 gene locus_tag LOCUS_11700 174338 173337 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989829.1 protein_id gnl|my_center|LOCUS_11700 174503 175333 gene locus_tag LOCUS_11710 174503 175333 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583944.1 protein_id gnl|my_center|LOCUS_11710 176457 175375 gene locus_tag LOCUS_11720 gene mnmA 176457 175375 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_11720 176869 176438 gene locus_tag LOCUS_11730 gene nifU 176869 176438 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_11730 178087 176882 gene locus_tag LOCUS_11740 gene nifS 178087 176882 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_11740 178631 178194 gene locus_tag LOCUS_11750 gene rnhA 178631 178194 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532769.1 protein_id gnl|my_center|LOCUS_11750 178881 180296 gene locus_tag LOCUS_11760 178881 180296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 181180 180389 gene locus_tag LOCUS_11770 gene trpA 181180 180389 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_11770 182360 181170 gene locus_tag LOCUS_11780 gene trpB 182360 181170 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 protein_id gnl|my_center|LOCUS_11780 182993 182361 gene locus_tag LOCUS_11790 182993 182361 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_11790 183773 182994 gene locus_tag LOCUS_11800 gene trpC 183773 182994 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966437.1 protein_id gnl|my_center|LOCUS_11800 185414 183777 gene locus_tag LOCUS_11810 185414 183777 CDS product bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943371.1 protein_id gnl|my_center|LOCUS_11810 186503 185427 gene locus_tag LOCUS_11820 gene trpS 186503 185427 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_11820 187998 186523 gene locus_tag LOCUS_11830 gene trpE 187998 186523 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_11830 188533 189855 gene locus_tag LOCUS_11840 188533 189855 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_11840 191308 189905 gene locus_tag LOCUS_11850 191308 189905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 191982 191347 gene locus_tag LOCUS_11860 191982 191347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 193414 192194 gene locus_tag LOCUS_11870 193414 192194 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897434.1 protein_id gnl|my_center|LOCUS_11870 193612 194364 gene locus_tag LOCUS_11880 193612 194364 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531770.1 protein_id gnl|my_center|LOCUS_11880 194357 194989 gene locus_tag LOCUS_11890 194357 194989 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948548.1 protein_id gnl|my_center|LOCUS_11890 195819 195031 gene locus_tag LOCUS_11900 gene udp 195819 195031 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_11900 196394 195840 gene locus_tag LOCUS_11910 196394 195840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 197296 196457 gene locus_tag LOCUS_11920 gene nadC 197296 196457 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_11920 198789 197293 gene locus_tag LOCUS_11930 gene nadB 198789 197293 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989173.1 protein_id gnl|my_center|LOCUS_11930 201689 199071 gene locus_tag LOCUS_11940 gene adhE 201689 199071 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_11940 202178 202936 gene locus_tag LOCUS_11950 202178 202936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 203148 203738 gene locus_tag LOCUS_11960 203148 203738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 204453 203785 gene locus_tag LOCUS_11970 204453 203785 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_11970 206105 204615 gene locus_tag LOCUS_11980 206105 204615 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_11980 207175 206123 gene locus_tag LOCUS_11990 207175 206123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 207977 207201 gene locus_tag LOCUS_12000 207977 207201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 209062 207995 gene locus_tag LOCUS_12010 209062 207995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 209436 209747 gene locus_tag LOCUS_12020 209436 209747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence06 1469 117 gene locus_tag LOCUS_12030 gene gdhA 1469 117 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945505.1 protein_id gnl|my_center|LOCUS_12030 1880 2506 gene locus_tag LOCUS_12040 gene nth 1880 2506 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_12040 2582 3109 gene locus_tag LOCUS_12050 2582 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3121 3324 gene locus_tag LOCUS_12060 3121 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3675 3950 gene locus_tag LOCUS_12070 3675 3950 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_12070 3982 4389 gene locus_tag LOCUS_12080 3982 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5121 4567 gene locus_tag LOCUS_12090 5121 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 5466 6665 gene locus_tag LOCUS_12100 5466 6665 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_12100 7030 9657 gene locus_tag LOCUS_12110 7030 9657 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_12110 12946 9797 gene locus_tag LOCUS_12120 gene ileS 12946 9797 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_12120 14084 13311 gene locus_tag LOCUS_12130 14084 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 15539 14349 gene locus_tag LOCUS_12140 15539 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 16422 15763 gene locus_tag LOCUS_12150 16422 15763 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_12150 16570 17262 gene locus_tag LOCUS_12160 16570 17262 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_12160 18587 17415 gene locus_tag LOCUS_12170 18587 17415 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_12170 19678 18683 gene locus_tag LOCUS_12180 19678 18683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 20211 21521 gene locus_tag LOCUS_12190 20211 21521 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_12190 24020 21864 gene locus_tag LOCUS_12200 24020 21864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 24515 26032 gene locus_tag LOCUS_12210 24515 26032 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_12210 27633 26083 gene locus_tag LOCUS_12220 gene putP 27633 26083 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020062.1 protein_id gnl|my_center|LOCUS_12220 29856 27910 gene locus_tag LOCUS_12230 gene thrS 29856 27910 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_12230 30345 29989 gene locus_tag LOCUS_12240 30345 29989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 30959 32524 gene locus_tag LOCUS_12250 gene rny 30959 32524 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_12250 32699 34198 gene locus_tag LOCUS_12260 32699 34198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 34460 34242 gene locus_tag LOCUS_12270 34460 34242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 34606 35475 gene locus_tag LOCUS_12280 34606 35475 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_12280 35674 35958 gene locus_tag LOCUS_12290 35674 35958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 35974 37074 gene locus_tag LOCUS_12300 35974 37074 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_12300 37092 37811 gene locus_tag LOCUS_12310 37092 37811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 37867 39327 gene locus_tag LOCUS_12320 37867 39327 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_12320 39533 41203 gene locus_tag LOCUS_12330 39533 41203 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_12330 41514 42692 gene locus_tag LOCUS_12340 41514 42692 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_12340 42692 43489 gene locus_tag LOCUS_12350 42692 43489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 43494 43949 gene locus_tag LOCUS_12360 gene tsaE 43494 43949 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_12360 43930 44619 gene locus_tag LOCUS_12370 gene tsaB 43930 44619 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_12370 44632 45069 gene locus_tag LOCUS_12380 gene rpiB 44632 45069 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_12380 46578 45280 gene locus_tag LOCUS_12390 46578 45280 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_12390 47223 47798 gene locus_tag LOCUS_12400 47223 47798 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940149.1 protein_id gnl|my_center|LOCUS_12400 47779 48210 gene locus_tag LOCUS_12410 47779 48210 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879309.1 protein_id gnl|my_center|LOCUS_12410 48713 48285 gene locus_tag LOCUS_12420 48713 48285 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_12420 49927 48794 gene locus_tag LOCUS_12430 49927 48794 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_12430 51358 49943 gene locus_tag LOCUS_12440 51358 49943 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_12440 51887 51372 gene locus_tag LOCUS_12450 51887 51372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 52768 51905 gene locus_tag LOCUS_12460 52768 51905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 53890 52982 gene locus_tag LOCUS_12470 53890 52982 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_12470 54141 54905 gene locus_tag LOCUS_12480 54141 54905 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_12480 55101 56036 gene locus_tag LOCUS_12490 55101 56036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 56213 56767 gene locus_tag LOCUS_12500 gene rsmD 56213 56767 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_12500 56767 57270 gene locus_tag LOCUS_12510 gene coaD 56767 57270 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_12510 57287 57778 gene locus_tag LOCUS_12520 57287 57778 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583504.1 protein_id gnl|my_center|LOCUS_12520 58036 59328 gene locus_tag LOCUS_12530 58036 59328 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047968.1 protein_id gnl|my_center|LOCUS_12530 59377 60630 gene locus_tag LOCUS_12540 59377 60630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 60758 61780 gene locus_tag LOCUS_12550 60758 61780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 62055 62130 gene locus_tag LOCUS_t00140 62055 62130 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 62232 62308 gene locus_tag LOCUS_t00150 62232 62308 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 62370 62445 gene locus_tag LOCUS_t00160 62370 62445 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 62484 62558 gene locus_tag LOCUS_t00170 62484 62558 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 62744 63757 gene locus_tag LOCUS_12560 62744 63757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 64028 64696 gene locus_tag LOCUS_12570 64028 64696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 64953 66179 gene locus_tag LOCUS_12580 64953 66179 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_12580 66951 69581 gene locus_tag LOCUS_12590 gene ppdK 66951 69581 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_12590 72459 69730 gene locus_tag LOCUS_12600 72459 69730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 72401 72592 gene locus_tag LOCUS_12610 72401 72592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 72943 72599 gene locus_tag LOCUS_12620 72943 72599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 73652 75814 gene locus_tag LOCUS_12630 73652 75814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 75902 77863 gene locus_tag LOCUS_12640 75902 77863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 78793 77924 gene locus_tag LOCUS_12650 78793 77924 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_12650 81246 78892 gene locus_tag LOCUS_12660 81246 78892 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966466.1 protein_id gnl|my_center|LOCUS_12660 81478 81633 gene locus_tag LOCUS_12670 81478 81633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 83194 81683 gene locus_tag LOCUS_12680 gene pap 83194 81683 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_12680 83392 84426 gene locus_tag LOCUS_12690 83392 84426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 85520 84528 gene locus_tag LOCUS_12700 85520 84528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 86618 85614 gene locus_tag LOCUS_12710 86618 85614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 87363 86602 gene locus_tag LOCUS_12720 87363 86602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 87426 87845 gene locus_tag LOCUS_12730 87426 87845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722815.1 protein_id gnl|my_center|LOCUS_12730 90040 87998 gene locus_tag LOCUS_12740 90040 87998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 90618 90244 gene locus_tag LOCUS_12750 90618 90244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 91318 90632 gene locus_tag LOCUS_12760 91318 90632 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_12760 91429 92928 gene locus_tag LOCUS_12770 91429 92928 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_12770 92925 93992 gene locus_tag LOCUS_12780 92925 93992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 93979 95124 gene locus_tag LOCUS_12790 93979 95124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 95950 95105 gene locus_tag LOCUS_12800 95950 95105 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_12800 96780 95947 gene locus_tag LOCUS_12810 96780 95947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 97484 96825 gene locus_tag LOCUS_12820 97484 96825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 97658 98251 gene locus_tag LOCUS_12830 97658 98251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 98327 99325 gene locus_tag LOCUS_12840 98327 99325 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869103.1 protein_id gnl|my_center|LOCUS_12840 99353 100657 gene locus_tag LOCUS_12850 gene rsxC 99353 100657 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_12850 100672 101613 gene locus_tag LOCUS_12860 100672 101613 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583454.1 protein_id gnl|my_center|LOCUS_12860 101610 102170 gene locus_tag LOCUS_12870 101610 102170 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_12870 102163 102846 gene locus_tag LOCUS_12880 102163 102846 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_12880 102849 103418 gene locus_tag LOCUS_12890 gene rsxA 102849 103418 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_12890 103467 104705 gene locus_tag LOCUS_12900 103467 104705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 104728 105537 gene locus_tag LOCUS_12910 104728 105537 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020711.1 protein_id gnl|my_center|LOCUS_12910 105743 108526 gene locus_tag LOCUS_12920 105743 108526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 108606 108854 gene locus_tag LOCUS_12930 108606 108854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 110869 108956 gene locus_tag LOCUS_12940 110869 108956 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_12940 112627 110870 gene locus_tag LOCUS_12950 112627 110870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_12950 113084 112653 gene locus_tag LOCUS_12960 113084 112653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 113284 114156 gene locus_tag LOCUS_12970 113284 114156 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705289.1 protein_id gnl|my_center|LOCUS_12970 114989 114255 gene locus_tag LOCUS_12980 114989 114255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 115267 115632 gene locus_tag LOCUS_12990 115267 115632 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_12990 115795 116631 gene locus_tag LOCUS_13000 115795 116631 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107914.1 protein_id gnl|my_center|LOCUS_13000 116631 117755 gene locus_tag LOCUS_13010 116631 117755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 117752 118615 gene locus_tag LOCUS_13020 117752 118615 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389753.1 protein_id gnl|my_center|LOCUS_13020 118643 119377 gene locus_tag LOCUS_13030 118643 119377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812647.1 protein_id gnl|my_center|LOCUS_13030 119555 120520 gene locus_tag LOCUS_13040 gene prmA 119555 120520 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385115.1 protein_id gnl|my_center|LOCUS_13040 120542 120880 gene locus_tag LOCUS_13050 120542 120880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 122440 120965 gene locus_tag LOCUS_13060 gene spoIVA 122440 120965 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_13060 124012 122453 gene locus_tag LOCUS_13070 124012 122453 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898760.1 protein_id gnl|my_center|LOCUS_13070 124239 125027 gene locus_tag LOCUS_13080 124239 125027 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_13080 125272 127845 gene locus_tag LOCUS_13090 125272 127845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 129137 127920 gene locus_tag LOCUS_13100 129137 127920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 129290 129733 gene locus_tag LOCUS_13110 129290 129733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 130720 129782 gene locus_tag LOCUS_13120 130720 129782 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937723.1 protein_id gnl|my_center|LOCUS_13120 131184 132041 gene locus_tag LOCUS_13130 131184 132041 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764616.1 protein_id gnl|my_center|LOCUS_13130 132063 132569 gene locus_tag LOCUS_13140 132063 132569 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_13140 132598 133470 gene locus_tag LOCUS_13150 132598 133470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 136068 133537 gene locus_tag LOCUS_13160 136068 133537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 136323 138074 gene locus_tag LOCUS_13170 136323 138074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 139727 138174 gene locus_tag LOCUS_13180 139727 138174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 140223 141968 gene locus_tag LOCUS_13190 140223 141968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 142193 142020 gene locus_tag LOCUS_13200 142193 142020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence07 <1 650 gene locus_tag LOCUS_13210 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963484.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 778 1086 gene locus_tag LOCUS_13220 778 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 1129 1203 gene locus_tag LOCUS_t00180 1129 1203 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1465 1836 gene locus_tag LOCUS_13230 1465 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1842 2213 gene locus_tag LOCUS_13240 1842 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2275 3081 gene locus_tag LOCUS_13250 2275 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4160 3066 gene locus_tag LOCUS_13260 4160 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 7597 6974 gene locus_tag LOCUS_13270 7597 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 8139 7864 gene locus_tag LOCUS_13280 8139 7864 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206812040.1 protein_id gnl|my_center|LOCUS_13280 8281 8862 gene locus_tag LOCUS_13290 8281 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 9805 8942 gene locus_tag LOCUS_13300 9805 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 10011 10844 gene locus_tag LOCUS_13310 10011 10844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 11161 10952 gene locus_tag LOCUS_13320 11161 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 12348 11572 gene locus_tag LOCUS_13330 12348 11572 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_13330 13977 12406 gene locus_tag LOCUS_13340 13977 12406 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_13340 14565 14083 gene locus_tag LOCUS_13350 14565 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 14846 14562 gene locus_tag LOCUS_13360 14846 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 15230 16006 gene locus_tag LOCUS_13370 15230 16006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 16224 16910 gene locus_tag LOCUS_13380 16224 16910 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074366.1 protein_id gnl|my_center|LOCUS_13380 17100 18581 gene locus_tag LOCUS_13390 17100 18581 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_13390 18597 19022 gene locus_tag LOCUS_13400 18597 19022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 19586 19170 gene locus_tag LOCUS_13410 19586 19170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 19734 19862 gene locus_tag LOCUS_13420 19734 19862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 19894 21222 gene locus_tag LOCUS_13430 19894 21222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 23462 21543 gene locus_tag LOCUS_13440 23462 21543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 24051 26228 gene locus_tag LOCUS_13450 24051 26228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 26421 27764 gene locus_tag LOCUS_13460 26421 27764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 27962 28090 gene locus_tag LOCUS_13470 27962 28090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 28094 28906 gene locus_tag LOCUS_13480 28094 28906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 28944 30050 gene locus_tag LOCUS_13490 28944 30050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 30140 30331 gene locus_tag LOCUS_13500 30140 30331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 30297 30539 gene locus_tag LOCUS_13510 30297 30539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 30655 31782 gene locus_tag LOCUS_13520 30655 31782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 31788 32546 gene locus_tag LOCUS_13530 31788 32546 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222616.1 protein_id gnl|my_center|LOCUS_13530 32637 33329 gene locus_tag LOCUS_13540 32637 33329 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_13540 33455 34696 gene locus_tag LOCUS_13550 gene urtA 33455 34696 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860043.1 protein_id gnl|my_center|LOCUS_13550 34795 35700 gene locus_tag LOCUS_13560 gene urtB 34795 35700 CDS product urea ABC transporter permease subunit UrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889580.1 protein_id gnl|my_center|LOCUS_13560 35718 36827 gene locus_tag LOCUS_13570 gene urtC 35718 36827 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_13570 36829 37608 gene locus_tag LOCUS_13580 gene urtD 36829 37608 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104862.1 protein_id gnl|my_center|LOCUS_13580 37610 38302 gene locus_tag LOCUS_13590 gene urtE 37610 38302 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149319367.1 protein_id gnl|my_center|LOCUS_13590 38328 39398 gene locus_tag LOCUS_13600 38328 39398 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_13600 39452 39649 gene locus_tag LOCUS_13610 39452 39649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 39755 40876 gene locus_tag LOCUS_13620 39755 40876 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263718.1 protein_id gnl|my_center|LOCUS_13620 42205 40952 gene locus_tag LOCUS_13630 42205 40952 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_13630 43266 42307 gene locus_tag LOCUS_13640 43266 42307 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966656.1 protein_id gnl|my_center|LOCUS_13640 44507 43263 gene locus_tag LOCUS_13650 44507 43263 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966655.1 protein_id gnl|my_center|LOCUS_13650 44650 45885 gene locus_tag LOCUS_13660 44650 45885 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_13660 45898 46350 gene locus_tag LOCUS_13670 45898 46350 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479829.1 protein_id gnl|my_center|LOCUS_13670 47914 46715 gene locus_tag LOCUS_13680 47914 46715 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860903.1 protein_id gnl|my_center|LOCUS_13680 50255 48075 gene locus_tag LOCUS_13690 50255 48075 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_13690 50833 50291 gene locus_tag LOCUS_13700 50833 50291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 53121 50851 gene locus_tag LOCUS_13710 53121 50851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_13710 54993 53497 gene locus_tag LOCUS_13720 54993 53497 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_13720 56223 55270 gene locus_tag LOCUS_13730 56223 55270 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_13730 57608 56238 gene locus_tag LOCUS_13740 57608 56238 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141432.1 protein_id gnl|my_center|LOCUS_13740 59601 57664 gene locus_tag LOCUS_13750 59601 57664 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963745.1 protein_id gnl|my_center|LOCUS_13750 60767 59781 gene locus_tag LOCUS_13760 60767 59781 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167747.1 protein_id gnl|my_center|LOCUS_13760 62260 60908 gene locus_tag LOCUS_13770 62260 60908 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_13770 64937 62253 gene locus_tag LOCUS_13780 64937 62253 CDS product ricin-type beta-trefoil lectin domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020638992.1 protein_id gnl|my_center|LOCUS_13780 65916 65098 gene locus_tag LOCUS_13790 65916 65098 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_13790 66307 67020 gene locus_tag LOCUS_13800 66307 67020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 67185 68117 gene locus_tag LOCUS_13810 gene cysK 67185 68117 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_13810 69607 68405 gene locus_tag LOCUS_13820 69607 68405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 70146 69625 gene locus_tag LOCUS_13830 70146 69625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 71203 70292 gene locus_tag LOCUS_13840 71203 70292 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787859.1 protein_id gnl|my_center|LOCUS_13840 71969 71196 gene locus_tag LOCUS_13850 gene pyrK 71969 71196 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983358.1 protein_id gnl|my_center|LOCUS_13850 72470 71988 gene locus_tag LOCUS_13860 72470 71988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 73427 72492 gene locus_tag LOCUS_13870 gene pyrF 73427 72492 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_13870 74724 73456 gene locus_tag LOCUS_13880 74724 73456 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_13880 75292 74813 gene locus_tag LOCUS_13890 75292 74813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 76999 75332 gene locus_tag LOCUS_13900 gene ilvD 76999 75332 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_13900 77560 77042 gene locus_tag LOCUS_13910 77560 77042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 78376 77576 gene locus_tag LOCUS_13920 78376 77576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 79360 78401 gene locus_tag LOCUS_13930 gene glcK 79360 78401 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391706.1 protein_id gnl|my_center|LOCUS_13930 79634 79389 gene locus_tag LOCUS_13940 79634 79389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 80601 79645 gene locus_tag LOCUS_13950 gene manA 80601 79645 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_13950 81447 80731 gene locus_tag LOCUS_13960 81447 80731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 81752 82183 gene locus_tag LOCUS_13970 gene ruvX 81752 82183 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964987.1 protein_id gnl|my_center|LOCUS_13970 82146 83006 gene locus_tag LOCUS_13980 82146 83006 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_13980 83291 82965 gene locus_tag LOCUS_13990 83291 82965 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437529.1 protein_id gnl|my_center|LOCUS_13990 83714 83355 gene locus_tag LOCUS_14000 83714 83355 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437532.1 protein_id gnl|my_center|LOCUS_14000 84002 83769 gene locus_tag LOCUS_14010 84002 83769 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_14010 84358 84116 gene locus_tag LOCUS_14020 gene rpsP 84358 84116 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_14020 85793 84426 gene locus_tag LOCUS_14030 gene ffh 85793 84426 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_14030 86222 85827 gene locus_tag LOCUS_14040 86222 85827 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_14040 86430 87398 gene locus_tag LOCUS_14050 86430 87398 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732378.1 protein_id gnl|my_center|LOCUS_14050 88982 89338 gene locus_tag LOCUS_14060 88982 89338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 90719 89892 gene locus_tag LOCUS_14070 90719 89892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 91332 91748 gene locus_tag LOCUS_14080 91332 91748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 91817 92887 gene locus_tag LOCUS_14090 91817 92887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 92899 95370 gene locus_tag LOCUS_14100 92899 95370 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038016.1 protein_id gnl|my_center|LOCUS_14100 95502 97235 gene locus_tag LOCUS_14110 95502 97235 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_14110 97235 99070 gene locus_tag LOCUS_14120 97235 99070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_14120 100541 99345 gene locus_tag LOCUS_14130 100541 99345 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_14130 100774 101937 gene locus_tag LOCUS_14140 100774 101937 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_14140 101958 106058 gene locus_tag LOCUS_14150 101958 106058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 106086 107096 gene locus_tag LOCUS_14160 106086 107096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 108174 107311 gene locus_tag LOCUS_14170 108174 107311 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017012.1 protein_id gnl|my_center|LOCUS_14170 108354 110459 gene locus_tag LOCUS_14180 108354 110459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 110503 111576 gene locus_tag LOCUS_14190 110503 111576 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_14190 113167 111725 gene locus_tag LOCUS_14200 gene glgA 113167 111725 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_14200 113401 115017 gene locus_tag LOCUS_14210 113401 115017 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_14210 115042 115539 gene locus_tag LOCUS_14220 115042 115539 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_14220 115631 117130 gene locus_tag LOCUS_14230 115631 117130 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_14230 117498 117767 gene locus_tag LOCUS_14240 117498 117767 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_14240 117786 119141 gene locus_tag LOCUS_14250 117786 119141 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_14250 119197 119976 gene locus_tag LOCUS_14260 119197 119976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 120007 120867 gene locus_tag LOCUS_14270 120007 120867 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_14270 120998 121867 gene locus_tag LOCUS_14280 gene dpsA 120998 121867 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392578.1 protein_id gnl|my_center|LOCUS_14280 121857 122441 gene locus_tag LOCUS_14290 121857 122441 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429956.1 protein_id gnl|my_center|LOCUS_14290 122806 124887 gene locus_tag LOCUS_14300 gene fusA 122806 124887 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048368.1 protein_id gnl|my_center|LOCUS_14300 126619 125090 gene locus_tag LOCUS_14310 126619 125090 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_14310 127589 126642 gene locus_tag LOCUS_14320 127589 126642 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_14320 129606 128308 gene locus_tag LOCUS_14330 129606 128308 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_14330 129975 129757 gene locus_tag LOCUS_14340 129975 129757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 130824 130405 gene locus_tag LOCUS_14350 130824 130405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 131284 130817 gene locus_tag LOCUS_14360 131284 130817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 132323 132129 gene locus_tag LOCUS_14370 132323 132129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence08 345 85 gene locus_tag LOCUS_14380 345 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1618 2715 gene locus_tag LOCUS_14390 1618 2715 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_14390 2728 3372 gene locus_tag LOCUS_14400 2728 3372 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_14400 3384 3545 gene locus_tag LOCUS_14410 3384 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3563 4681 gene locus_tag LOCUS_14420 3563 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 4674 5357 gene locus_tag LOCUS_14430 4674 5357 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_14430 5865 7667 gene locus_tag LOCUS_14440 gene pepF 5865 7667 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_14440 8417 8154 gene locus_tag LOCUS_14450 8417 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 10109 8475 gene locus_tag LOCUS_14460 10109 8475 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_14460 10498 10151 gene locus_tag LOCUS_14470 10498 10151 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720130.1 protein_id gnl|my_center|LOCUS_14470 11282 10632 gene locus_tag LOCUS_14480 11282 10632 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_14480 11517 12953 gene locus_tag LOCUS_14490 11517 12953 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837071.1 protein_id gnl|my_center|LOCUS_14490 13046 13675 gene locus_tag LOCUS_14500 gene upp 13046 13675 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294095.1 protein_id gnl|my_center|LOCUS_14500 13908 15404 gene locus_tag LOCUS_14510 13908 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 16885 15449 gene locus_tag LOCUS_14520 16885 15449 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_14520 18394 16937 gene locus_tag LOCUS_14530 18394 16937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 19478 18573 gene locus_tag LOCUS_14540 gene ftsX 19478 18573 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198720.1 protein_id gnl|my_center|LOCUS_14540 20151 19465 gene locus_tag LOCUS_14550 gene ftsE 20151 19465 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_14550 21294 20209 gene locus_tag LOCUS_14560 21294 20209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 21734 22240 gene locus_tag LOCUS_14570 gene rimM 21734 22240 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_14570 22240 22743 gene locus_tag LOCUS_14580 22240 22743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 22745 23485 gene locus_tag LOCUS_14590 gene trmD 22745 23485 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829466.1 protein_id gnl|my_center|LOCUS_14590 23769 24041 gene locus_tag LOCUS_14600 23769 24041 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_14600 24499 25251 gene locus_tag LOCUS_14610 24499 25251 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_14610 25412 25726 gene locus_tag LOCUS_14620 25412 25726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 26321 25818 gene locus_tag LOCUS_14630 26321 25818 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022620559.1 protein_id gnl|my_center|LOCUS_14630 26722 26501 gene locus_tag LOCUS_14640 26722 26501 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_14640 26926 27783 gene locus_tag LOCUS_14650 26926 27783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 27912 29714 gene locus_tag LOCUS_14660 gene lepA 27912 29714 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_14660 29896 30369 gene locus_tag LOCUS_14670 29896 30369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 30366 31463 gene locus_tag LOCUS_14680 gene hemW 30366 31463 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_14680 31613 32611 gene locus_tag LOCUS_14690 31613 32611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 32745 33596 gene locus_tag LOCUS_14700 32745 33596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 33865 34839 gene locus_tag LOCUS_14710 33865 34839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 34970 35242 gene locus_tag LOCUS_14720 34970 35242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 35579 35962 gene locus_tag LOCUS_14730 35579 35962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 35963 36691 gene locus_tag LOCUS_14740 gene atpB 35963 36691 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_14740 36745 36999 gene locus_tag LOCUS_14750 gene atpE 36745 36999 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_14750 37055 37570 gene locus_tag LOCUS_14760 37055 37570 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966153.1 protein_id gnl|my_center|LOCUS_14760 37570 38118 gene locus_tag LOCUS_14770 37570 38118 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289009.1 protein_id gnl|my_center|LOCUS_14770 38139 39653 gene locus_tag LOCUS_14780 gene atpA 38139 39653 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421367.1 protein_id gnl|my_center|LOCUS_14780 39667 40530 gene locus_tag LOCUS_14790 gene atpG 39667 40530 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_14790 40684 42093 gene locus_tag LOCUS_14800 gene atpD 40684 42093 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_14800 42209 42610 gene locus_tag LOCUS_14810 42209 42610 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_14810 42767 44545 gene locus_tag LOCUS_14820 42767 44545 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_14820 44641 46095 gene locus_tag LOCUS_14830 44641 46095 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_14830 46188 46442 gene locus_tag LOCUS_14840 46188 46442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 46712 47086 gene locus_tag LOCUS_14850 46712 47086 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_14850 47218 47865 gene locus_tag LOCUS_14860 47218 47865 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_14860 48285 52019 gene locus_tag LOCUS_14870 48285 52019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 54197 52098 gene locus_tag LOCUS_14880 54197 52098 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_14880 54445 54197 gene locus_tag LOCUS_14890 54445 54197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 54921 56840 gene locus_tag LOCUS_14900 54921 56840 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860962.1 protein_id gnl|my_center|LOCUS_14900 56972 57118 gene locus_tag LOCUS_14910 56972 57118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 57317 58636 gene locus_tag LOCUS_14920 57317 58636 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_14920 59539 58898 gene locus_tag LOCUS_14930 59539 58898 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460105.1 protein_id gnl|my_center|LOCUS_14930 62365 61250 gene locus_tag LOCUS_14940 62365 61250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 62859 62416 gene locus_tag LOCUS_14950 62859 62416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 63413 62988 gene locus_tag LOCUS_14960 63413 62988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 63833 63519 gene locus_tag LOCUS_14970 63833 63519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 63820 63960 gene locus_tag LOCUS_14980 63820 63960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 64010 64312 gene locus_tag LOCUS_14990 64010 64312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 64423 64905 gene locus_tag LOCUS_15000 64423 64905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 65452 65069 gene locus_tag LOCUS_15010 65452 65069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15010 66456 65566 gene locus_tag LOCUS_15020 66456 65566 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_15020 66592 68136 gene locus_tag LOCUS_15030 66592 68136 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_15030 68153 69931 gene locus_tag LOCUS_15040 68153 69931 CDS product glycoside hydrolase family 44 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964233.1 protein_id gnl|my_center|LOCUS_15040 71465 71013 gene locus_tag LOCUS_15050 gene nrdR 71465 71013 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584044.1 protein_id gnl|my_center|LOCUS_15050 73049 71874 gene locus_tag LOCUS_15060 73049 71874 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_15060 73474 74892 gene locus_tag LOCUS_15070 73474 74892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 75971 74955 gene locus_tag LOCUS_15080 75971 74955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 76803 76228 gene locus_tag LOCUS_15090 76803 76228 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_15090 81497 76968 gene locus_tag LOCUS_15100 81497 76968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 82213 81494 gene locus_tag LOCUS_15110 82213 81494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 82448 83056 gene locus_tag LOCUS_15120 gene thrH 82448 83056 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_15120 83083 84327 gene locus_tag LOCUS_15130 83083 84327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 84581 84880 gene locus_tag LOCUS_15140 84581 84880 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_15140 84924 85496 gene locus_tag LOCUS_15150 84924 85496 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_15150 85509 85916 gene locus_tag LOCUS_15160 85509 85916 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_15160 86213 86425 gene locus_tag LOCUS_15170 86213 86425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 86495 86716 gene locus_tag LOCUS_15180 86495 86716 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_15180 86820 89309 gene locus_tag LOCUS_15190 86820 89309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 89361 89519 gene locus_tag LOCUS_15200 89361 89519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 89554 89931 gene locus_tag LOCUS_15210 89554 89931 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362768.1 protein_id gnl|my_center|LOCUS_15210 90109 90807 gene locus_tag LOCUS_15220 90109 90807 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_15220 90819 93077 gene locus_tag LOCUS_15230 90819 93077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 93374 94759 gene locus_tag LOCUS_15240 gene trkA 93374 94759 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_15240 94770 96239 gene locus_tag LOCUS_15250 94770 96239 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_15250 97102 96311 gene locus_tag LOCUS_15260 97102 96311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 97379 97705 gene locus_tag LOCUS_15270 97379 97705 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_15270 98095 97829 gene locus_tag LOCUS_15280 gene spoIIID 98095 97829 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_15280 98305 99891 gene locus_tag LOCUS_15290 98305 99891 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_15290 99984 100919 gene locus_tag LOCUS_15300 99984 100919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 101073 102746 gene locus_tag LOCUS_15310 101073 102746 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861273.1 protein_id gnl|my_center|LOCUS_15310 103418 102834 gene locus_tag LOCUS_15320 103418 102834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 105983 103698 gene locus_tag LOCUS_15330 gene recQ 105983 103698 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_15330 106319 108829 gene locus_tag LOCUS_15340 106319 108829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 108913 111249 gene locus_tag LOCUS_15350 108913 111249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 111535 112797 gene locus_tag LOCUS_15360 111535 112797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 113149 114171 gene locus_tag LOCUS_15370 gene aroF 113149 114171 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_15370 114284 114754 gene locus_tag LOCUS_15380 114284 114754 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775190.1 protein_id gnl|my_center|LOCUS_15380 114804 115913 gene locus_tag LOCUS_15390 gene aroB 114804 115913 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_15390 115926 117155 gene locus_tag LOCUS_15400 gene aroA 115926 117155 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_15400 117242 118333 gene locus_tag LOCUS_15410 gene aroC 117242 118333 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_15410 118361 118960 gene locus_tag LOCUS_15420 118361 118960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 119068 119571 gene locus_tag LOCUS_15430 119068 119571 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_15430 119564 120661 gene locus_tag LOCUS_15440 119564 120661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 121279 121288 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence09 178 285 gene locus_tag LOCUS_r00010 178 285 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 334 409 gene locus_tag LOCUS_t00190 334 409 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1082 609 gene locus_tag LOCUS_15450 1082 609 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261902.1 protein_id gnl|my_center|LOCUS_15450 1935 1180 gene locus_tag LOCUS_15460 1935 1180 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_15460 2162 4312 gene locus_tag LOCUS_15470 2162 4312 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_15470 4533 5258 gene locus_tag LOCUS_15480 4533 5258 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861321.1 protein_id gnl|my_center|LOCUS_15480 5258 6583 gene locus_tag LOCUS_15490 5258 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 6706 7302 gene locus_tag LOCUS_15500 6706 7302 CDS product accessory gene regulator B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454130.1 protein_id gnl|my_center|LOCUS_15500 7289 7423 gene locus_tag LOCUS_15510 7289 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 10133 7962 gene locus_tag LOCUS_15520 10133 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 10403 11098 gene locus_tag LOCUS_15530 10403 11098 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_15530 11104 12393 gene locus_tag LOCUS_15540 11104 12393 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861322.1 protein_id gnl|my_center|LOCUS_15540 12820 12518 gene locus_tag LOCUS_15550 12820 12518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 12978 12793 gene locus_tag LOCUS_15560 12978 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 13256 13411 gene locus_tag LOCUS_15570 13256 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 13446 16763 gene locus_tag LOCUS_15580 13446 16763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 16780 17643 gene locus_tag LOCUS_15590 16780 17643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 18474 17881 gene locus_tag LOCUS_15600 18474 17881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 19938 18493 gene locus_tag LOCUS_15610 19938 18493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 20651 19980 gene locus_tag LOCUS_15620 20651 19980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 21599 21997 gene locus_tag LOCUS_15630 21599 21997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 22136 22333 gene locus_tag LOCUS_15640 22136 22333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 22427 24091 gene locus_tag LOCUS_15650 22427 24091 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_15650 25713 24025 gene locus_tag LOCUS_15660 25713 24025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 26159 25773 gene locus_tag LOCUS_15670 26159 25773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 26968 26339 gene locus_tag LOCUS_15680 26968 26339 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883952.1 protein_id gnl|my_center|LOCUS_15680 27747 26965 gene locus_tag LOCUS_15690 27747 26965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 28130 28603 gene locus_tag LOCUS_15700 28130 28603 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682186.1 protein_id gnl|my_center|LOCUS_15700 28775 29095 gene locus_tag LOCUS_15710 28775 29095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 29128 29454 gene locus_tag LOCUS_15720 29128 29454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 29590 29514 gene locus_tag LOCUS_t00200 29590 29514 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 31716 29830 gene locus_tag LOCUS_15730 31716 29830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 32963 32034 gene locus_tag LOCUS_15740 32963 32034 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680020.1 protein_id gnl|my_center|LOCUS_15740 35348 33342 gene locus_tag LOCUS_15750 gene feoB 35348 33342 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_15750 35587 35345 gene locus_tag LOCUS_15760 35587 35345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 35814 36059 gene locus_tag LOCUS_15770 35814 36059 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963809.1 protein_id gnl|my_center|LOCUS_15770 36297 37520 gene locus_tag LOCUS_15780 gene hydF 36297 37520 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_15780 37498 38538 gene locus_tag LOCUS_15790 gene hydE 37498 38538 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_15790 38538 39302 gene locus_tag LOCUS_15800 38538 39302 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461419.1 protein_id gnl|my_center|LOCUS_15800 39299 40591 gene locus_tag LOCUS_15810 39299 40591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 40588 41706 gene locus_tag LOCUS_15820 40588 41706 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_15820 41740 42501 gene locus_tag LOCUS_15830 41740 42501 CDS product nitrogenase iron protein NifH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461208.1 protein_id gnl|my_center|LOCUS_15830 42494 43795 gene locus_tag LOCUS_15840 42494 43795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 43792 44859 gene locus_tag LOCUS_15850 43792 44859 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272909.1 protein_id gnl|my_center|LOCUS_15850 44856 45257 gene locus_tag LOCUS_15860 44856 45257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 45257 47536 gene locus_tag LOCUS_15870 gene hypF 45257 47536 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_15870 47819 48028 gene locus_tag LOCUS_15880 47819 48028 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393665.1 protein_id gnl|my_center|LOCUS_15880 48025 49077 gene locus_tag LOCUS_15890 gene hypD 48025 49077 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810717.1 protein_id gnl|my_center|LOCUS_15890 49106 50113 gene locus_tag LOCUS_15900 gene hypE 49106 50113 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_15900 51605 50346 gene locus_tag LOCUS_15910 gene hemL 51605 50346 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224512.1 protein_id gnl|my_center|LOCUS_15910 52575 51607 gene locus_tag LOCUS_15920 gene hemB 52575 51607 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 protein_id gnl|my_center|LOCUS_15920 54049 52589 gene locus_tag LOCUS_15930 gene cobA 54049 52589 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948608.1 protein_id gnl|my_center|LOCUS_15930 54906 54046 gene locus_tag LOCUS_15940 gene hemC 54906 54046 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836539.1 protein_id gnl|my_center|LOCUS_15940 55523 54903 gene locus_tag LOCUS_15950 55523 54903 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_15950 56638 55526 gene locus_tag LOCUS_15960 gene hemA 56638 55526 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367110.1 protein_id gnl|my_center|LOCUS_15960 57186 56635 gene locus_tag LOCUS_15970 57186 56635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 58170 57250 gene locus_tag LOCUS_15980 58170 57250 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_15980 58871 58302 gene locus_tag LOCUS_15990 58871 58302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 59938 58877 gene locus_tag LOCUS_16000 59938 58877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 60309 62324 gene locus_tag LOCUS_16010 60309 62324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 62468 62247 gene locus_tag LOCUS_16020 62468 62247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 62901 62539 gene locus_tag LOCUS_16030 62901 62539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 62994 63449 gene locus_tag LOCUS_16040 62994 63449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 63800 63645 gene locus_tag LOCUS_16050 63800 63645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 64539 64204 gene locus_tag LOCUS_16060 64539 64204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 65270 64680 gene locus_tag LOCUS_16070 65270 64680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 65517 65290 gene locus_tag LOCUS_16080 65517 65290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 66071 65562 gene locus_tag LOCUS_16090 66071 65562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 66433 66080 gene locus_tag LOCUS_16100 66433 66080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 66950 66360 gene locus_tag LOCUS_16110 66950 66360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 67222 66971 gene locus_tag LOCUS_16120 67222 66971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 67508 67236 gene locus_tag LOCUS_16130 67508 67236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 68026 67901 gene locus_tag LOCUS_16140 68026 67901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 68461 68201 gene locus_tag LOCUS_16150 68461 68201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 68963 68475 gene locus_tag LOCUS_16160 68963 68475 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462001.1 protein_id gnl|my_center|LOCUS_16160 70071 68983 gene locus_tag LOCUS_16170 70071 68983 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458834.1 protein_id gnl|my_center|LOCUS_16170 71745 70129 gene locus_tag LOCUS_16180 71745 70129 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_16180 72622 71684 gene locus_tag LOCUS_16190 72622 71684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 73042 72734 gene locus_tag LOCUS_16200 73042 72734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 73317 73042 gene locus_tag LOCUS_16210 73317 73042 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671306.1 protein_id gnl|my_center|LOCUS_16210 74917 73373 gene locus_tag LOCUS_16220 74917 73373 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461951.1 protein_id gnl|my_center|LOCUS_16220 75109 74990 gene locus_tag LOCUS_16230 75109 74990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 75279 75121 gene locus_tag LOCUS_16240 75279 75121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 75455 75276 gene locus_tag LOCUS_16250 75455 75276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 76379 76155 gene locus_tag LOCUS_16260 76379 76155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 78842 76632 gene locus_tag LOCUS_16270 78842 76632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 79712 78855 gene locus_tag LOCUS_16280 79712 78855 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861296.1 protein_id gnl|my_center|LOCUS_16280 81297 79729 gene locus_tag LOCUS_16290 81297 79729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 82475 81312 gene locus_tag LOCUS_16300 82475 81312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 82929 82561 gene locus_tag LOCUS_16310 82929 82561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 83223 83020 gene locus_tag LOCUS_16320 83223 83020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 83963 83442 gene locus_tag LOCUS_16330 83963 83442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 84235 84552 gene locus_tag LOCUS_16340 84235 84552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 85502 84762 gene locus_tag LOCUS_16350 85502 84762 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964889.1 protein_id gnl|my_center|LOCUS_16350 88129 85676 gene locus_tag LOCUS_16360 gene mobP3 88129 85676 CDS product MobP3 family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458828.1 protein_id gnl|my_center|LOCUS_16360 88903 88439 gene locus_tag LOCUS_16370 88903 88439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 89389 88985 gene locus_tag LOCUS_16380 89389 88985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272682.1 protein_id gnl|my_center|LOCUS_16380 89980 89744 gene locus_tag LOCUS_16390 89980 89744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 90977 90000 gene locus_tag LOCUS_16400 90977 90000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 91171 90977 gene locus_tag LOCUS_16410 91171 90977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 93061 91226 gene locus_tag LOCUS_16420 93061 91226 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272164.1 protein_id gnl|my_center|LOCUS_16420 93641 93051 gene locus_tag LOCUS_16430 93641 93051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272690.1 protein_id gnl|my_center|LOCUS_16430 93908 93642 gene locus_tag LOCUS_16440 93908 93642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272691.1 protein_id gnl|my_center|LOCUS_16440 94658 94023 gene locus_tag LOCUS_16450 94658 94023 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583636.1 protein_id gnl|my_center|LOCUS_16450 95739 94813 gene locus_tag LOCUS_16460 95739 94813 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272168.1 protein_id gnl|my_center|LOCUS_16460 97792 96038 gene locus_tag LOCUS_16470 97792 96038 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459375.1 protein_id gnl|my_center|LOCUS_16470 99308 97896 gene locus_tag LOCUS_16480 99308 97896 CDS product DUF3991 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461990.1 protein_id gnl|my_center|LOCUS_16480 99403 99753 gene locus_tag LOCUS_16490 99403 99753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 100528 99818 gene locus_tag LOCUS_16500 100528 99818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 100871 100545 gene locus_tag LOCUS_16510 100871 100545 CDS product DUF3852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158208705.1 protein_id gnl|my_center|LOCUS_16510 105247 100868 gene locus_tag LOCUS_16520 105247 100868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 106237 105317 gene locus_tag LOCUS_16530 106237 105317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 106708 106346 gene locus_tag LOCUS_16540 106708 106346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence10 214 3141 gene locus_tag LOCUS_16550 214 3141 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054447.1 protein_id gnl|my_center|LOCUS_16550 3543 4217 gene locus_tag LOCUS_16560 3543 4217 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_16560 4201 5745 gene locus_tag LOCUS_16570 4201 5745 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459501.1 protein_id gnl|my_center|LOCUS_16570 6456 6097 gene locus_tag LOCUS_tm00010 6456 6097 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6927 6460 gene locus_tag LOCUS_16580 gene smpB 6927 6460 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_16580 7144 8511 gene locus_tag LOCUS_16590 7144 8511 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_16590 9527 8901 gene locus_tag LOCUS_16600 9527 8901 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940908.1 protein_id gnl|my_center|LOCUS_16600 10613 9714 gene locus_tag LOCUS_16610 10613 9714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 11070 11696 gene locus_tag LOCUS_16620 11070 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 11784 11981 gene locus_tag LOCUS_16630 11784 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 13033 12242 gene locus_tag LOCUS_16640 13033 12242 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_16640 13852 13220 gene locus_tag LOCUS_16650 13852 13220 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548076.1 protein_id gnl|my_center|LOCUS_16650 14673 13945 gene locus_tag LOCUS_16660 14673 13945 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_16660 14976 15461 gene locus_tag LOCUS_16670 14976 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 17285 15957 gene locus_tag LOCUS_16680 17285 15957 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_16680 18101 17304 gene locus_tag LOCUS_16690 18101 17304 CDS product DUF4866 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930717.1 protein_id gnl|my_center|LOCUS_16690 19027 18125 gene locus_tag LOCUS_16700 19027 18125 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977934.1 protein_id gnl|my_center|LOCUS_16700 19181 19876 gene locus_tag LOCUS_16710 19181 19876 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_16710 20214 21005 gene locus_tag LOCUS_16720 20214 21005 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101871.1 protein_id gnl|my_center|LOCUS_16720 21752 21150 gene locus_tag LOCUS_16730 21752 21150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 22288 22124 gene locus_tag LOCUS_16740 22288 22124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 22553 22278 gene locus_tag LOCUS_16750 22553 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 22989 22543 gene locus_tag LOCUS_16760 22989 22543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 24172 23222 gene locus_tag LOCUS_16770 24172 23222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 24623 24162 gene locus_tag LOCUS_16780 24623 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 25443 24844 gene locus_tag LOCUS_16790 25443 24844 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248985.1 protein_id gnl|my_center|LOCUS_16790 26942 25509 gene locus_tag LOCUS_16800 26942 25509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 28291 27176 gene locus_tag LOCUS_16810 28291 27176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 29471 28305 gene locus_tag LOCUS_16820 29471 28305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 30724 29471 gene locus_tag LOCUS_16830 30724 29471 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837503.1 protein_id gnl|my_center|LOCUS_16830 31042 31380 gene locus_tag LOCUS_16840 31042 31380 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813967.1 protein_id gnl|my_center|LOCUS_16840 31842 31525 gene locus_tag LOCUS_16850 31842 31525 CDS product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296262.1 protein_id gnl|my_center|LOCUS_16850 32794 31853 gene locus_tag LOCUS_16860 32794 31853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 33909 32797 gene locus_tag LOCUS_16870 33909 32797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 34197 34370 gene locus_tag LOCUS_16880 34197 34370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 36190 34430 gene locus_tag LOCUS_16890 36190 34430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 36468 41222 gene locus_tag LOCUS_16900 36468 41222 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072770864.1 protein_id gnl|my_center|LOCUS_16900 41957 41634 gene locus_tag LOCUS_16910 41957 41634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 42042 42329 gene locus_tag LOCUS_16920 42042 42329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 42667 42335 gene locus_tag LOCUS_16930 42667 42335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 43521 43796 gene locus_tag LOCUS_16940 43521 43796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 43805 44170 gene locus_tag LOCUS_16950 43805 44170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 44170 44775 gene locus_tag LOCUS_16960 44170 44775 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_16960 44780 45928 gene locus_tag LOCUS_16970 44780 45928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 46754 45972 gene locus_tag LOCUS_16980 46754 45972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816588.1 protein_id gnl|my_center|LOCUS_16980 47446 46748 gene locus_tag LOCUS_16990 47446 46748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_16990 47767 47507 gene locus_tag LOCUS_17000 gene spoVS 47767 47507 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404341.1 protein_id gnl|my_center|LOCUS_17000 48642 47875 gene locus_tag LOCUS_17010 gene ymdB 48642 47875 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_17010 50701 48761 gene locus_tag LOCUS_17020 gene ftsH 50701 48761 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373798.1 protein_id gnl|my_center|LOCUS_17020 51264 50740 gene locus_tag LOCUS_17030 gene hpt 51264 50740 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262637.1 protein_id gnl|my_center|LOCUS_17030 52689 51364 gene locus_tag LOCUS_17040 gene tilS 52689 51364 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_17040 54043 52682 gene locus_tag LOCUS_17050 gene dnaB 54043 52682 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_17050 54492 54046 gene locus_tag LOCUS_17060 gene rplI 54492 54046 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_17060 56492 54516 gene locus_tag LOCUS_17070 56492 54516 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_17070 58444 56540 gene locus_tag LOCUS_17080 58444 56540 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_17080 60937 58787 gene locus_tag LOCUS_17090 60937 58787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 61097 63457 gene locus_tag LOCUS_17100 gene pcrA 61097 63457 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002319708.1 protein_id gnl|my_center|LOCUS_17100 63772 63560 gene locus_tag LOCUS_17110 63772 63560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 64911 63829 gene locus_tag LOCUS_17120 64911 63829 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438084.1 protein_id gnl|my_center|LOCUS_17120 65003 65284 gene locus_tag LOCUS_17130 65003 65284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 65284 66471 gene locus_tag LOCUS_17140 65284 66471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 66602 67561 gene locus_tag LOCUS_17150 66602 67561 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_17150 67527 68078 gene locus_tag LOCUS_17160 67527 68078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 68065 68553 gene locus_tag LOCUS_17170 68065 68553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 68566 69480 gene locus_tag LOCUS_17180 gene era 68566 69480 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_17180 69505 69672 gene locus_tag LOCUS_17190 69505 69672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 69635 70387 gene locus_tag LOCUS_17200 69635 70387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 70432 72828 gene locus_tag LOCUS_17210 70432 72828 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_17210 72884 73513 gene locus_tag LOCUS_17220 gene yunB 72884 73513 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393210.1 protein_id gnl|my_center|LOCUS_17220 73797 75773 gene locus_tag LOCUS_17230 gene ligA 73797 75773 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_17230 75815 76084 gene locus_tag LOCUS_17240 gene gatC 75815 76084 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288477.1 protein_id gnl|my_center|LOCUS_17240 76097 77548 gene locus_tag LOCUS_17250 gene gatA 76097 77548 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048224.1 protein_id gnl|my_center|LOCUS_17250 77566 79002 gene locus_tag LOCUS_17260 gene gatB 77566 79002 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965957.1 protein_id gnl|my_center|LOCUS_17260 80365 79061 gene locus_tag LOCUS_17270 gene mtaB 80365 79061 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_17270 80616 80846 gene locus_tag LOCUS_17280 80616 80846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 81369 81599 gene locus_tag LOCUS_17290 81369 81599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 81708 82466 gene locus_tag LOCUS_17300 81708 82466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 82563 84050 gene locus_tag LOCUS_17310 82563 84050 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_17310 84232 87945 gene locus_tag LOCUS_17320 84232 87945 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_17320 88004 88270 gene locus_tag LOCUS_17330 88004 88270 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129524.1 protein_id gnl|my_center|LOCUS_17330 89226 88474 gene locus_tag LOCUS_17340 89226 88474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 89284 89745 gene locus_tag LOCUS_17350 89284 89745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 89955 89812 gene locus_tag LOCUS_17360 89955 89812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 90389 89970 gene locus_tag LOCUS_17370 90389 89970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 91279 90773 gene locus_tag LOCUS_17380 91279 90773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 92653 91748 gene locus_tag LOCUS_17390 92653 91748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 93500 92946 gene locus_tag LOCUS_17400 93500 92946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 93851 93504 gene locus_tag LOCUS_17410 93851 93504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 94465 93983 gene locus_tag LOCUS_17420 94465 93983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 95478 94597 gene locus_tag LOCUS_17430 95478 94597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 96108 95686 gene locus_tag LOCUS_17440 96108 95686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 96712 96215 gene locus_tag LOCUS_17450 96712 96215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 97322 96693 gene locus_tag LOCUS_17460 97322 96693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 97704 97447 gene locus_tag LOCUS_17470 97704 97447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 98152 97730 gene locus_tag LOCUS_17480 98152 97730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 98764 98267 gene locus_tag LOCUS_17490 98764 98267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 99095 98775 gene locus_tag LOCUS_17500 99095 98775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 99759 99292 gene locus_tag LOCUS_17510 99759 99292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 100478 99762 gene locus_tag LOCUS_17520 100478 99762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 100982 100638 gene locus_tag LOCUS_17530 100982 100638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 101806 100994 gene locus_tag LOCUS_17540 101806 100994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 102389 101838 gene locus_tag LOCUS_17550 102389 101838 CDS product suppressor of fused domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227008.1 protein_id gnl|my_center|LOCUS_17550 102696 102367 gene locus_tag LOCUS_17560 102696 102367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 102769 102778 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 103594 103166 gene locus_tag LOCUS_17570 103594 103166 CDS product DUF1851 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964950.1 protein_id gnl|my_center|LOCUS_17570 103647 103655 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 104869 103823 gene locus_tag LOCUS_17580 104869 103823 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673299.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence11 206 48 gene locus_tag LOCUS_17590 206 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1564 320 gene locus_tag LOCUS_17600 1564 320 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557280.1 protein_id gnl|my_center|LOCUS_17600 2053 1802 gene locus_tag LOCUS_17610 2053 1802 CDS product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925352.1 protein_id gnl|my_center|LOCUS_17610 4013 2115 gene locus_tag LOCUS_17620 4013 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 4207 4329 gene locus_tag LOCUS_17630 4207 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 4558 5124 gene locus_tag LOCUS_17640 4558 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 5075 6505 gene locus_tag LOCUS_17650 5075 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 7224 6544 gene locus_tag LOCUS_17660 gene sleB 7224 6544 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964005.1 protein_id gnl|my_center|LOCUS_17660 8444 8962 gene locus_tag LOCUS_17670 8444 8962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 8959 9555 gene locus_tag LOCUS_17680 8959 9555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 9570 10088 gene locus_tag LOCUS_17690 9570 10088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 10204 11052 gene locus_tag LOCUS_17700 10204 11052 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_17700 11068 11925 gene locus_tag LOCUS_17710 11068 11925 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_17710 11928 13217 gene locus_tag LOCUS_17720 gene pepV 11928 13217 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016277.1 protein_id gnl|my_center|LOCUS_17720 13314 14150 gene locus_tag LOCUS_17730 13314 14150 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_17730 15416 14202 gene locus_tag LOCUS_17740 15416 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 15972 15496 gene locus_tag LOCUS_17750 15972 15496 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_17750 16517 16008 gene locus_tag LOCUS_17760 16517 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 17283 16579 gene locus_tag LOCUS_17770 17283 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 17684 19555 gene locus_tag LOCUS_17780 17684 19555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 19873 21354 gene locus_tag LOCUS_17790 gene glpK 19873 21354 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_17790 22974 21691 gene locus_tag LOCUS_17800 22974 21691 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_17800 24824 22983 gene locus_tag LOCUS_17810 gene uvrC 24824 22983 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_17810 26688 24892 gene locus_tag LOCUS_17820 26688 24892 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_17820 27002 28072 gene locus_tag LOCUS_17830 27002 28072 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_17830 28138 28848 gene locus_tag LOCUS_17840 28138 28848 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_17840 30739 28967 gene locus_tag LOCUS_17850 30739 28967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732216.1 protein_id gnl|my_center|LOCUS_17850 32503 30740 gene locus_tag LOCUS_17860 32503 30740 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 protein_id gnl|my_center|LOCUS_17860 33593 32886 gene locus_tag LOCUS_17870 33593 32886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 34967 33609 gene locus_tag LOCUS_17880 34967 33609 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_17880 35700 37652 gene locus_tag LOCUS_17890 gene metG 35700 37652 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_17890 37696 37772 gene locus_tag LOCUS_t00210 37696 37772 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 38662 38186 gene locus_tag LOCUS_17900 38662 38186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 38979 39326 gene locus_tag LOCUS_17910 38979 39326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 39330 39734 gene locus_tag LOCUS_17920 39330 39734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 41479 39779 gene locus_tag LOCUS_17930 41479 39779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994508.1 protein_id gnl|my_center|LOCUS_17930 42211 41744 gene locus_tag LOCUS_17940 42211 41744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 42966 42433 gene locus_tag LOCUS_17950 42966 42433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 44646 43408 gene locus_tag LOCUS_17960 44646 43408 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210835.1 protein_id gnl|my_center|LOCUS_17960 46163 44673 gene locus_tag LOCUS_17970 46163 44673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 46531 46250 gene locus_tag LOCUS_17980 46531 46250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 47983 47132 gene locus_tag LOCUS_17990 47983 47132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 49700 48105 gene locus_tag LOCUS_18000 49700 48105 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_18000 50960 49974 gene locus_tag LOCUS_18010 50960 49974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 51184 50957 gene locus_tag LOCUS_18020 51184 50957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 51552 51866 gene locus_tag LOCUS_18030 51552 51866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 51869 53200 gene locus_tag LOCUS_18040 51869 53200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 53256 53579 gene locus_tag LOCUS_18050 53256 53579 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640965.1 protein_id gnl|my_center|LOCUS_18050 53614 54609 gene locus_tag LOCUS_18060 53614 54609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 54651 55514 gene locus_tag LOCUS_18070 54651 55514 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_18070 55646 57019 gene locus_tag LOCUS_18080 gene radA 55646 57019 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_18080 57669 57085 gene locus_tag LOCUS_18090 57669 57085 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231441.1 protein_id gnl|my_center|LOCUS_18090 59036 57822 gene locus_tag LOCUS_18100 59036 57822 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_18100 59504 60127 gene locus_tag LOCUS_18110 59504 60127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 60152 60919 gene locus_tag LOCUS_18120 60152 60919 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_18120 61123 63096 gene locus_tag LOCUS_18130 61123 63096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 64946 63159 gene locus_tag LOCUS_18140 64946 63159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 66298 64958 gene locus_tag LOCUS_18150 66298 64958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 66555 67031 gene locus_tag LOCUS_18160 gene greA 66555 67031 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_18160 67069 68640 gene locus_tag LOCUS_18170 gene lysS 67069 68640 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_18170 70017 68785 gene locus_tag LOCUS_18180 70017 68785 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006906966.1 protein_id gnl|my_center|LOCUS_18180 70308 70093 gene locus_tag LOCUS_18190 70308 70093 CDS product excisionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905235.1 protein_id gnl|my_center|LOCUS_18190 72153 70354 gene locus_tag LOCUS_18200 72153 70354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 72364 73824 gene locus_tag LOCUS_18210 72364 73824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 74257 75414 gene locus_tag LOCUS_18220 74257 75414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 75716 75477 gene locus_tag LOCUS_18230 75716 75477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 >Feature sequence12 360 1622 gene locus_tag LOCUS_18240 gene leuC 360 1622 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_18240 1714 2103 gene locus_tag LOCUS_18250 1714 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 2131 2610 gene locus_tag LOCUS_18260 gene leuD 2131 2610 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_18260 2684 3358 gene locus_tag LOCUS_18270 2684 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3360 4442 gene locus_tag LOCUS_18280 gene leuB 3360 4442 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_18280 4477 5442 gene locus_tag LOCUS_18290 4477 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5508 7199 gene locus_tag LOCUS_18300 5508 7199 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_18300 7226 7804 gene locus_tag LOCUS_18310 7226 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 7862 9016 gene locus_tag LOCUS_18320 7862 9016 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262240.1 protein_id gnl|my_center|LOCUS_18320 10913 9234 gene locus_tag LOCUS_18330 10913 9234 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_18330 12814 10922 gene locus_tag LOCUS_18340 gene nuoF 12814 10922 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_18340 13292 12816 gene locus_tag LOCUS_18350 gene nuoE 13292 12816 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_18350 14583 13609 gene locus_tag LOCUS_18360 14583 13609 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_18360 14790 15752 gene locus_tag LOCUS_18370 14790 15752 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680111.1 protein_id gnl|my_center|LOCUS_18370 15815 16903 gene locus_tag LOCUS_18380 15815 16903 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890975.1 protein_id gnl|my_center|LOCUS_18380 16918 17547 gene locus_tag LOCUS_18390 16918 17547 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964116.1 protein_id gnl|my_center|LOCUS_18390 17654 18526 gene locus_tag LOCUS_18400 17654 18526 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964117.1 protein_id gnl|my_center|LOCUS_18400 18570 20528 gene locus_tag LOCUS_18410 gene pulA 18570 20528 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_18410 20671 22086 gene locus_tag LOCUS_18420 20671 22086 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_18420 23086 22151 gene locus_tag LOCUS_18430 23086 22151 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_18430 24152 23100 gene locus_tag LOCUS_18440 gene gmd 24152 23100 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288198.1 protein_id gnl|my_center|LOCUS_18440 25488 24172 gene locus_tag LOCUS_18450 25488 24172 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288195.1 protein_id gnl|my_center|LOCUS_18450 25962 25504 gene locus_tag LOCUS_18460 25962 25504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 28630 27035 gene locus_tag LOCUS_18470 28630 27035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 29318 28599 gene locus_tag LOCUS_18480 29318 28599 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846775.1 protein_id gnl|my_center|LOCUS_18480 33302 29988 gene locus_tag LOCUS_18490 33302 29988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 35479 33779 gene locus_tag LOCUS_18500 35479 33779 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861938.1 protein_id gnl|my_center|LOCUS_18500 35784 35635 gene locus_tag LOCUS_18510 35784 35635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 37469 36435 gene locus_tag LOCUS_18520 37469 36435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 38681 37791 gene locus_tag LOCUS_18530 38681 37791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 40449 39496 gene locus_tag LOCUS_18540 40449 39496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 41104 40712 gene locus_tag LOCUS_18550 41104 40712 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459856.1 protein_id gnl|my_center|LOCUS_18550 41425 42297 gene locus_tag LOCUS_18560 41425 42297 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946804.1 protein_id gnl|my_center|LOCUS_18560 42615 42367 gene locus_tag LOCUS_18570 42615 42367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 44579 43182 gene locus_tag LOCUS_18580 44579 43182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 45247 44663 gene locus_tag LOCUS_18590 45247 44663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 45544 46008 gene locus_tag LOCUS_18600 45544 46008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 46563 50237 gene locus_tag LOCUS_18610 46563 50237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 50909 50295 gene locus_tag LOCUS_18620 50909 50295 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_18620 51290 51108 gene locus_tag LOCUS_18630 51290 51108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 51700 52968 gene locus_tag LOCUS_18640 51700 52968 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_18640 52980 55007 gene locus_tag LOCUS_18650 52980 55007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 55022 55546 gene locus_tag LOCUS_18660 55022 55546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 55530 56327 gene locus_tag LOCUS_18670 55530 56327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 56328 56744 gene locus_tag LOCUS_18680 56328 56744 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930108.1 protein_id gnl|my_center|LOCUS_18680 56778 57950 gene locus_tag LOCUS_18690 56778 57950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 57978 59057 gene locus_tag LOCUS_18700 57978 59057 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531351.1 protein_id gnl|my_center|LOCUS_18700 59078 60229 gene locus_tag LOCUS_18710 59078 60229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 60274 61626 gene locus_tag LOCUS_18720 60274 61626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 63056 61779 gene locus_tag LOCUS_18730 63056 61779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 63222 64361 gene locus_tag LOCUS_18740 63222 64361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 64354 65850 gene locus_tag LOCUS_18750 64354 65850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 65856 66047 gene locus_tag LOCUS_18760 65856 66047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 66709 66299 gene locus_tag LOCUS_18770 66709 66299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 66896 67984 gene locus_tag LOCUS_18780 66896 67984 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_18780 68001 69233 gene locus_tag LOCUS_18790 68001 69233 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_18790 >Feature sequence13 624 716 gene locus_tag LOCUS_t00220 624 716 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 805 1293 gene locus_tag LOCUS_18800 805 1293 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027905.1 protein_id gnl|my_center|LOCUS_18800 2401 1547 gene locus_tag LOCUS_18810 2401 1547 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_18810 2534 2382 gene locus_tag LOCUS_18820 2534 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 3118 2561 gene locus_tag LOCUS_18830 3118 2561 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456102.1 protein_id gnl|my_center|LOCUS_18830 3430 4320 gene locus_tag LOCUS_18840 3430 4320 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416734.1 protein_id gnl|my_center|LOCUS_18840 4387 4462 gene locus_tag LOCUS_t00230 4387 4462 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6061 4598 gene locus_tag LOCUS_18850 6061 4598 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_18850 10710 6160 gene locus_tag LOCUS_18860 gene gltB 10710 6160 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_18860 11707 11069 gene locus_tag LOCUS_18870 11707 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 13311 11761 gene locus_tag LOCUS_18880 13311 11761 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_18880 14739 13534 gene locus_tag LOCUS_18890 14739 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 15453 15283 gene locus_tag LOCUS_18900 15453 15283 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_18900 16043 15609 gene locus_tag LOCUS_18910 16043 15609 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_18910 17369 16062 gene locus_tag LOCUS_18920 17369 16062 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_18920 17931 17434 gene locus_tag LOCUS_18930 17931 17434 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_18930 18506 17931 gene locus_tag LOCUS_18940 18506 17931 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_18940 20262 18535 gene locus_tag LOCUS_18950 gene iorA 20262 18535 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_18950 20863 22104 gene locus_tag LOCUS_18960 gene galK 20863 22104 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_18960 22118 22654 gene locus_tag LOCUS_18970 22118 22654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 22673 23341 gene locus_tag LOCUS_18980 gene trmB 22673 23341 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239380.1 protein_id gnl|my_center|LOCUS_18980 23341 23835 gene locus_tag LOCUS_18990 23341 23835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 23948 24439 gene locus_tag LOCUS_19000 23948 24439 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_19000 24436 25917 gene locus_tag LOCUS_19010 24436 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 27021 25996 gene locus_tag LOCUS_19020 gene ilvC 27021 25996 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081338.1 protein_id gnl|my_center|LOCUS_19020 27587 27090 gene locus_tag LOCUS_19030 gene ilvN 27587 27090 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_19030 29331 27706 gene locus_tag LOCUS_19040 29331 27706 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_19040 29579 29667 gene locus_tag LOCUS_t00240 29579 29667 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29690 29779 gene locus_tag LOCUS_t00250 29690 29779 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30538 29888 gene locus_tag LOCUS_19050 30538 29888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 32264 30660 gene locus_tag LOCUS_19060 gene pckA 32264 30660 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_19060 34667 32772 gene locus_tag LOCUS_19070 34667 32772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 36574 34868 gene locus_tag LOCUS_19080 36574 34868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 36801 37514 gene locus_tag LOCUS_19090 36801 37514 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895627.1 protein_id gnl|my_center|LOCUS_19090 37514 38836 gene locus_tag LOCUS_19100 37514 38836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 40464 38905 gene locus_tag LOCUS_19110 40464 38905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 40600 40451 gene locus_tag LOCUS_19120 40600 40451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 40946 42043 gene locus_tag LOCUS_19130 gene gldA 40946 42043 CDS product bifunctional L-1,2-propanediol dehydrogenase/glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373992.1 protein_id gnl|my_center|LOCUS_19130 42531 42199 gene locus_tag LOCUS_19140 42531 42199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 42704 44467 gene locus_tag LOCUS_19150 42704 44467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 47781 44527 gene locus_tag LOCUS_19160 47781 44527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 48007 48083 gene locus_tag LOCUS_t00260 48007 48083 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 50059 48272 gene locus_tag LOCUS_19170 50059 48272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 53181 50068 gene locus_tag LOCUS_19180 53181 50068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 53372 53671 gene locus_tag LOCUS_19190 53372 53671 CDS product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296262.1 protein_id gnl|my_center|LOCUS_19190 53717 54031 gene locus_tag LOCUS_19200 53717 54031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 54028 54669 gene locus_tag LOCUS_19210 54028 54669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 54759 54884 gene locus_tag LOCUS_19220 54759 54884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 55052 56272 gene locus_tag LOCUS_19230 55052 56272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence14 <1 548 gene locus_tag LOCUS_19240 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010905481.1:restriction endonuclease subunit S 2088 1351 gene locus_tag LOCUS_19250 2088 1351 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_19250 3236 2085 gene locus_tag LOCUS_19260 3236 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 3827 5644 gene locus_tag LOCUS_19270 3827 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 6121 6306 gene locus_tag LOCUS_19280 6121 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 6429 7703 gene locus_tag LOCUS_19290 6429 7703 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_19290 7932 7858 gene locus_tag LOCUS_t00270 7932 7858 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8030 7954 gene locus_tag LOCUS_t00280 8030 7954 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8331 10391 gene locus_tag LOCUS_19300 8331 10391 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_19300 10388 11302 gene locus_tag LOCUS_19310 10388 11302 CDS product CorA family divalent cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682345.1 protein_id gnl|my_center|LOCUS_19310 11488 11790 gene locus_tag LOCUS_19320 11488 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 11816 13258 gene locus_tag LOCUS_19330 gene proS 11816 13258 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_19330 14358 13333 gene locus_tag LOCUS_19340 14358 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 14611 16500 gene locus_tag LOCUS_19350 gene htpG 14611 16500 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966587.1 protein_id gnl|my_center|LOCUS_19350 16835 17671 gene locus_tag LOCUS_19360 gene licT 16835 17671 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_19360 17776 19929 gene locus_tag LOCUS_19370 gene ptsG 17776 19929 CDS product glucose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948935.1 protein_id gnl|my_center|LOCUS_19370 19949 20206 gene locus_tag LOCUS_19380 19949 20206 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_19380 20340 21974 gene locus_tag LOCUS_19390 gene ptsP 20340 21974 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_19390 22204 22755 gene locus_tag LOCUS_19400 22204 22755 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_19400 22748 23551 gene locus_tag LOCUS_19410 22748 23551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 23603 25225 gene locus_tag LOCUS_19420 23603 25225 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109265.1 protein_id gnl|my_center|LOCUS_19420 25381 25836 gene locus_tag LOCUS_19430 25381 25836 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_19430 25833 26537 gene locus_tag LOCUS_19440 25833 26537 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948330.1 protein_id gnl|my_center|LOCUS_19440 27397 26603 gene locus_tag LOCUS_19450 27397 26603 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808997.1 protein_id gnl|my_center|LOCUS_19450 28379 27408 gene locus_tag LOCUS_19460 28379 27408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461145.1 protein_id gnl|my_center|LOCUS_19460 29488 28466 gene locus_tag LOCUS_19470 29488 28466 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_19470 29707 32097 gene locus_tag LOCUS_19480 29707 32097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 33340 32150 gene locus_tag LOCUS_19490 33340 32150 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966309.1 protein_id gnl|my_center|LOCUS_19490 34564 33458 gene locus_tag LOCUS_19500 34564 33458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 36000 34690 gene locus_tag LOCUS_19510 36000 34690 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_19510 36310 37236 gene locus_tag LOCUS_19520 36310 37236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 37809 37327 gene locus_tag LOCUS_19530 37809 37327 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965952.1 protein_id gnl|my_center|LOCUS_19530 37892 38152 gene locus_tag LOCUS_19540 37892 38152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 38192 38647 gene locus_tag LOCUS_19550 38192 38647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 38634 38969 gene locus_tag LOCUS_19560 38634 38969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 40069 38966 gene locus_tag LOCUS_19570 40069 38966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 41102 40170 gene locus_tag LOCUS_19580 41102 40170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 41416 41967 gene locus_tag LOCUS_19590 41416 41967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 42024 42710 gene locus_tag LOCUS_19600 42024 42710 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_19600 42843 43133 gene locus_tag LOCUS_19610 42843 43133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 44030 43209 gene locus_tag LOCUS_19620 44030 43209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 47111 44163 gene locus_tag LOCUS_19630 47111 44163 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361467.1 protein_id gnl|my_center|LOCUS_19630 48045 47098 gene locus_tag LOCUS_19640 48045 47098 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_19640 48708 48124 gene locus_tag LOCUS_19650 48708 48124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 49626 48757 gene locus_tag LOCUS_19660 49626 48757 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_19660 49797 50807 gene locus_tag LOCUS_19670 gene galE 49797 50807 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_19670 50979 51395 gene locus_tag LOCUS_19680 50979 51395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 51376 51816 gene locus_tag LOCUS_19690 gene spoIIAB 51376 51816 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_19690 51818 52483 gene locus_tag LOCUS_19700 gene sigF 51818 52483 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403644.1 protein_id gnl|my_center|LOCUS_19700 53929 52520 gene locus_tag LOCUS_19710 53929 52520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 54139 55128 gene locus_tag LOCUS_19720 54139 55128 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_19720 55925 55734 gene locus_tag LOCUS_19730 55925 55734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 >Feature sequence15 75 1 gene locus_tag LOCUS_t00290 75 1 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 177 102 gene locus_tag LOCUS_t00300 177 102 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1209 340 gene locus_tag LOCUS_19740 gene hslO 1209 340 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_19740 1966 1214 gene locus_tag LOCUS_19750 1966 1214 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965668.1 protein_id gnl|my_center|LOCUS_19750 2268 1966 gene locus_tag LOCUS_19760 2268 1966 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965963.1 protein_id gnl|my_center|LOCUS_19760 3102 2380 gene locus_tag LOCUS_19770 gene ysxC 3102 2380 CDS product ribosome biogenesis GTP-binding protein YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869116.1 protein_id gnl|my_center|LOCUS_19770 5525 3114 gene locus_tag LOCUS_19780 gene lon 5525 3114 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_19780 5931 5686 gene locus_tag LOCUS_19790 gene rpsR 5931 5686 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_19790 6502 5978 gene locus_tag LOCUS_19800 gene ssb 6502 5978 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831333.1 protein_id gnl|my_center|LOCUS_19800 6815 6525 gene locus_tag LOCUS_19810 gene rpsF 6815 6525 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_19810 7890 6946 gene locus_tag LOCUS_19820 7890 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 8049 9167 gene locus_tag LOCUS_19830 gene prfB 8049 9167 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096772597.1 protein_id gnl|my_center|LOCUS_19830 10097 9213 gene locus_tag LOCUS_19840 10097 9213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 10762 10169 gene locus_tag LOCUS_19850 10762 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 11613 10813 gene locus_tag LOCUS_19860 gene proC 11613 10813 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732991.1 protein_id gnl|my_center|LOCUS_19860 12427 11789 gene locus_tag LOCUS_19870 12427 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 13647 12685 gene locus_tag LOCUS_19880 gene pfkA 13647 12685 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_19880 15603 13777 gene locus_tag LOCUS_19890 15603 13777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 16513 15731 gene locus_tag LOCUS_19900 16513 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 18880 16643 gene locus_tag LOCUS_19910 gene gyrA 18880 16643 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632827.1 protein_id gnl|my_center|LOCUS_19910 20010 18886 gene locus_tag LOCUS_19920 20010 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027738.1 protein_id gnl|my_center|LOCUS_19920 22014 20032 gene locus_tag LOCUS_19930 gene gyrB 22014 20032 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_19930 22225 22989 gene locus_tag LOCUS_19940 22225 22989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 22958 23143 gene locus_tag LOCUS_19950 22958 23143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 23207 23689 gene locus_tag LOCUS_19960 23207 23689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 23700 24167 gene locus_tag LOCUS_19970 23700 24167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 24167 24373 gene locus_tag LOCUS_19980 24167 24373 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986143.1 protein_id gnl|my_center|LOCUS_19980 24767 25195 gene locus_tag LOCUS_19990 gene rplM 24767 25195 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_19990 25212 25613 gene locus_tag LOCUS_20000 gene rpsI 25212 25613 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_20000 25807 26913 gene locus_tag LOCUS_20010 25807 26913 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_20010 26874 29270 gene locus_tag LOCUS_20020 26874 29270 CDS product DUF5682 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084336.1 protein_id gnl|my_center|LOCUS_20020 29267 30409 gene locus_tag LOCUS_20030 29267 30409 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786824.1 protein_id gnl|my_center|LOCUS_20030 30421 32151 gene locus_tag LOCUS_20040 30421 32151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 32148 35501 gene locus_tag LOCUS_20050 32148 35501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 36913 35546 gene locus_tag LOCUS_20060 36913 35546 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_20060 38208 37114 gene locus_tag LOCUS_20070 gene ychF 38208 37114 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_20070 38484 38227 gene locus_tag LOCUS_20080 38484 38227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 41306 38499 gene locus_tag LOCUS_20090 41306 38499 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286287.1 protein_id gnl|my_center|LOCUS_20090 41792 41328 gene locus_tag LOCUS_20100 41792 41328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 42992 41799 gene locus_tag LOCUS_20110 42992 41799 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_20110 43216 44928 gene locus_tag LOCUS_20120 gene spoVB 43216 44928 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812078.1 protein_id gnl|my_center|LOCUS_20120 44987 45784 gene locus_tag LOCUS_20130 44987 45784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 45824 46099 gene locus_tag LOCUS_20140 45824 46099 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_20140 46166 46408 gene locus_tag LOCUS_20150 46166 46408 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_20150 48116 46452 gene locus_tag LOCUS_20160 48116 46452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 49116 48277 gene locus_tag LOCUS_20170 gene pdaA 49116 48277 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897898.1 protein_id gnl|my_center|LOCUS_20170 49492 49247 gene locus_tag LOCUS_20180 49492 49247 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_20180 52035 49621 gene locus_tag LOCUS_20190 gene pheT 52035 49621 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_20190 52648 52058 gene locus_tag LOCUS_20200 52648 52058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 53667 52648 gene locus_tag LOCUS_20210 gene pheS 53667 52648 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_20210 54659 54015 gene locus_tag LOCUS_20220 54659 54015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 >Feature sequence16 252 557 gene locus_tag LOCUS_20230 252 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 637 798 gene locus_tag LOCUS_20240 637 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 819 983 gene locus_tag LOCUS_20250 819 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 1019 1624 gene locus_tag LOCUS_20260 1019 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 1646 2230 gene locus_tag LOCUS_20270 1646 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2251 2688 gene locus_tag LOCUS_20280 2251 2688 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_20280 2714 4513 gene locus_tag LOCUS_20290 2714 4513 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_20290 4506 4751 gene locus_tag LOCUS_20300 4506 4751 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291951.1 protein_id gnl|my_center|LOCUS_20300 5049 5498 gene locus_tag LOCUS_20310 5049 5498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 5518 6048 gene locus_tag LOCUS_20320 5518 6048 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_20320 6952 7383 gene locus_tag LOCUS_20330 gene mraZ 6952 7383 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 protein_id gnl|my_center|LOCUS_20330 7383 8318 gene locus_tag LOCUS_20340 gene rsmH 7383 8318 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_20340 8392 8868 gene locus_tag LOCUS_20350 8392 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 9024 11357 gene locus_tag LOCUS_20360 9024 11357 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949034.1 protein_id gnl|my_center|LOCUS_20360 11383 12831 gene locus_tag LOCUS_20370 11383 12831 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_20370 12997 14358 gene locus_tag LOCUS_20380 12997 14358 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_20380 14394 15398 gene locus_tag LOCUS_20390 gene mraY 14394 15398 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_20390 15423 16649 gene locus_tag LOCUS_20400 gene spoVE 15423 16649 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_20400 16665 17792 gene locus_tag LOCUS_20410 gene murG 16665 17792 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460696.1 protein_id gnl|my_center|LOCUS_20410 17821 18729 gene locus_tag LOCUS_20420 17821 18729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 18791 20050 gene locus_tag LOCUS_20430 gene murA 18791 20050 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_20430 20069 21172 gene locus_tag LOCUS_20440 20069 21172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 21428 22558 gene locus_tag LOCUS_20450 gene ftsZ 21428 22558 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965000.1 protein_id gnl|my_center|LOCUS_20450 22878 23867 gene locus_tag LOCUS_20460 22878 23867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 23877 24434 gene locus_tag LOCUS_20470 23877 24434 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_20470 24464 24643 gene locus_tag LOCUS_20480 24464 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 24671 25231 gene locus_tag LOCUS_20490 gene sigH 24671 25231 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393956.1 protein_id gnl|my_center|LOCUS_20490 25328 25606 gene locus_tag LOCUS_20500 25328 25606 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_20500 26466 25657 gene locus_tag LOCUS_20510 26466 25657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 26582 29584 gene locus_tag LOCUS_20520 26582 29584 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288607.1 protein_id gnl|my_center|LOCUS_20520 29595 33080 gene locus_tag LOCUS_20530 29595 33080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 34092 33118 gene locus_tag LOCUS_20540 gene bsh 34092 33118 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287105.1 protein_id gnl|my_center|LOCUS_20540 34310 35839 gene locus_tag LOCUS_20550 gene cls 34310 35839 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_20550 36436 36972 gene locus_tag LOCUS_20560 36436 36972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 36965 37636 gene locus_tag LOCUS_20570 36965 37636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 37676 37885 gene locus_tag LOCUS_20580 37676 37885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 37901 39112 gene locus_tag LOCUS_20590 37901 39112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 39114 40391 gene locus_tag LOCUS_20600 39114 40391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 40405 40917 gene locus_tag LOCUS_20610 40405 40917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20610 41540 41286 gene locus_tag LOCUS_20620 41540 41286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 45837 42211 gene locus_tag LOCUS_20630 45837 42211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774973.1 protein_id gnl|my_center|LOCUS_20630 46037 46168 gene locus_tag LOCUS_20640 46037 46168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 46649 46254 gene locus_tag LOCUS_20650 46649 46254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 46637 47017 gene locus_tag LOCUS_20660 46637 47017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20660 47007 47192 gene locus_tag LOCUS_20670 47007 47192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 49895 47475 gene locus_tag LOCUS_20680 49895 47475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 50684 49902 gene locus_tag LOCUS_20690 50684 49902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 52245 50824 gene locus_tag LOCUS_20700 52245 50824 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722014.1 protein_id gnl|my_center|LOCUS_20700 52709 52443 gene locus_tag LOCUS_20710 52709 52443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 53109 52723 gene locus_tag LOCUS_20720 53109 52723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 53218 53502 gene locus_tag LOCUS_20730 53218 53502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 53486 53752 gene locus_tag LOCUS_20740 53486 53752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 >Feature sequence17 828 10 gene locus_tag LOCUS_20750 828 10 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_20750 1133 936 gene locus_tag LOCUS_20760 1133 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1254 1114 gene locus_tag LOCUS_20770 1254 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1491 1255 gene locus_tag LOCUS_20780 1491 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2264 1491 gene locus_tag LOCUS_20790 2264 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 3529 2261 gene locus_tag LOCUS_20800 gene dcm 3529 2261 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210977.1 protein_id gnl|my_center|LOCUS_20800 3847 3584 gene locus_tag LOCUS_20810 3847 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 4311 4227 gene locus_tag LOCUS_t00310 4311 4227 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4408 4333 gene locus_tag LOCUS_t00320 4408 4333 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4583 4507 gene locus_tag LOCUS_t00330 4583 4507 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4974 5945 gene locus_tag LOCUS_20820 4974 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 6248 7117 gene locus_tag LOCUS_20830 6248 7117 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_20830 7332 8159 gene locus_tag LOCUS_20840 gene pstC 7332 8159 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_20840 8156 9010 gene locus_tag LOCUS_20850 gene pstA 8156 9010 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_20850 9014 9769 gene locus_tag LOCUS_20860 gene pstB 9014 9769 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_20860 9806 10465 gene locus_tag LOCUS_20870 gene phoU 9806 10465 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_20870 10625 12406 gene locus_tag LOCUS_20880 10625 12406 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_20880 12425 13102 gene locus_tag LOCUS_20890 12425 13102 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_20890 13130 14860 gene locus_tag LOCUS_20900 13130 14860 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_20900 15172 15945 gene locus_tag LOCUS_20910 15172 15945 CDS product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015821.1 protein_id gnl|my_center|LOCUS_20910 16229 17650 gene locus_tag LOCUS_20920 16229 17650 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_20920 17665 19923 gene locus_tag LOCUS_20930 17665 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 21824 20676 gene locus_tag LOCUS_20940 21824 20676 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_20940 22283 21843 gene locus_tag LOCUS_20950 gene dut 22283 21843 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957483.1 protein_id gnl|my_center|LOCUS_20950 24357 22285 gene locus_tag LOCUS_20960 24357 22285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 24863 24357 gene locus_tag LOCUS_20970 24863 24357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 25068 25502 gene locus_tag LOCUS_20980 25068 25502 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_20980 25879 26751 gene locus_tag LOCUS_20990 gene pdxS 25879 26751 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_20990 26753 27322 gene locus_tag LOCUS_21000 gene pdxT 26753 27322 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461704.1 protein_id gnl|my_center|LOCUS_21000 27523 28074 gene locus_tag LOCUS_21010 27523 28074 CDS product TIGR04002 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888217.1 protein_id gnl|my_center|LOCUS_21010 28947 28318 gene locus_tag LOCUS_21020 28947 28318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 29284 29559 gene locus_tag LOCUS_21030 29284 29559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 30026 31468 gene locus_tag LOCUS_21040 30026 31468 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243035.1 protein_id gnl|my_center|LOCUS_21040 31481 32167 gene locus_tag LOCUS_21050 31481 32167 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242701.1 protein_id gnl|my_center|LOCUS_21050 32164 34011 gene locus_tag LOCUS_21060 32164 34011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 34027 35301 gene locus_tag LOCUS_21070 34027 35301 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_21070 36426 35572 gene locus_tag LOCUS_21080 gene metF 36426 35572 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_21080 36708 38123 gene locus_tag LOCUS_21090 36708 38123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 39156 38374 gene locus_tag LOCUS_21100 gene spo0A 39156 38374 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_21100 40653 39427 gene locus_tag LOCUS_21110 gene spoIVB 40653 39427 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944619.1 protein_id gnl|my_center|LOCUS_21110 40904 41542 gene locus_tag LOCUS_21120 40904 41542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 41672 42676 gene locus_tag LOCUS_21130 41672 42676 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693667.1 protein_id gnl|my_center|LOCUS_21130 44498 43221 gene locus_tag LOCUS_21140 44498 43221 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_21140 45080 46078 gene locus_tag LOCUS_21150 45080 46078 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_21150 46774 46280 gene locus_tag LOCUS_21160 46774 46280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 47606 46788 gene locus_tag LOCUS_21170 47606 46788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 47834 49261 gene locus_tag LOCUS_21180 gene glmU 47834 49261 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048387.1 protein_id gnl|my_center|LOCUS_21180 49488 50111 gene locus_tag LOCUS_21190 gene pth 49488 50111 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_21190 50218 53673 gene locus_tag LOCUS_21200 gene mfd 50218 53673 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence18 533 1825 gene locus_tag LOCUS_21210 533 1825 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434259.1 protein_id gnl|my_center|LOCUS_21210 2893 2006 gene locus_tag LOCUS_21220 2893 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3071 5788 gene locus_tag LOCUS_21230 3071 5788 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202204.1 protein_id gnl|my_center|LOCUS_21230 5981 6994 gene locus_tag LOCUS_21240 5981 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 7014 7847 gene locus_tag LOCUS_21250 7014 7847 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476368.1 protein_id gnl|my_center|LOCUS_21250 9890 8391 gene locus_tag LOCUS_21260 gene galT 9890 8391 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_21260 10252 9896 gene locus_tag LOCUS_21270 10252 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 11306 10254 gene locus_tag LOCUS_21280 11306 10254 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_21280 12626 11337 gene locus_tag LOCUS_21290 gene galK 12626 11337 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053399.1 protein_id gnl|my_center|LOCUS_21290 14050 12623 gene locus_tag LOCUS_21300 gene melB 14050 12623 CDS product melibiose:sodium transporter MelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028111.1 protein_id gnl|my_center|LOCUS_21300 15186 14200 gene locus_tag LOCUS_21310 15186 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 16066 15197 gene locus_tag LOCUS_21320 16066 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 17804 16050 gene locus_tag LOCUS_21330 17804 16050 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_21330 19389 17806 gene locus_tag LOCUS_21340 19389 17806 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288004.1 protein_id gnl|my_center|LOCUS_21340 20943 19825 gene locus_tag LOCUS_21350 20943 19825 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_21350 21173 21766 gene locus_tag LOCUS_21360 21173 21766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 22221 23291 gene locus_tag LOCUS_21370 22221 23291 CDS product PRK06851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048278.1 protein_id gnl|my_center|LOCUS_21370 23724 23281 gene locus_tag LOCUS_21380 23724 23281 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_21380 23867 24907 gene locus_tag LOCUS_21390 23867 24907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 24921 25901 gene locus_tag LOCUS_21400 24921 25901 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_21400 25913 27241 gene locus_tag LOCUS_21410 25913 27241 CDS product triacylglycerol lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964346.1 protein_id gnl|my_center|LOCUS_21410 27449 27282 gene locus_tag LOCUS_21420 27449 27282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 27803 27453 gene locus_tag LOCUS_21430 27803 27453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 29774 27834 gene locus_tag LOCUS_21440 29774 27834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 33191 29943 gene locus_tag LOCUS_21450 gene recB 33191 29943 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022196.1 protein_id gnl|my_center|LOCUS_21450 35905 33188 gene locus_tag LOCUS_21460 35905 33188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 36169 37512 gene locus_tag LOCUS_21470 36169 37512 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_21470 37618 37704 gene locus_tag LOCUS_t00340 37618 37704 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 41365 37757 gene locus_tag LOCUS_21480 41365 37757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence19 104 460 gene locus_tag LOCUS_21490 104 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 659 1015 gene locus_tag LOCUS_21500 659 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1283 1462 gene locus_tag LOCUS_21510 1283 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 1551 1913 gene locus_tag LOCUS_21520 1551 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 1861 2235 gene locus_tag LOCUS_21530 1861 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21530 2302 2856 gene locus_tag LOCUS_21540 2302 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21540 3814 2960 gene locus_tag LOCUS_21550 3814 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 6091 3821 gene locus_tag LOCUS_21560 6091 3821 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_21560 6618 6172 gene locus_tag LOCUS_21570 6618 6172 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966110.1 protein_id gnl|my_center|LOCUS_21570 7214 6615 gene locus_tag LOCUS_21580 7214 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 7451 9271 gene locus_tag LOCUS_21590 gene glmS 7451 9271 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_21590 9325 9972 gene locus_tag LOCUS_21600 9325 9972 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066430.1 protein_id gnl|my_center|LOCUS_21600 10113 10991 gene locus_tag LOCUS_21610 10113 10991 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_21610 11006 11263 gene locus_tag LOCUS_21620 11006 11263 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_21620 11256 11900 gene locus_tag LOCUS_21630 gene gmk 11256 11900 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547929.1 protein_id gnl|my_center|LOCUS_21630 11890 12099 gene locus_tag LOCUS_21640 11890 12099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 12130 14595 gene locus_tag LOCUS_21650 gene priA 12130 14595 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666732.1 protein_id gnl|my_center|LOCUS_21650 14614 15075 gene locus_tag LOCUS_21660 gene def 14614 15075 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_21660 15075 16007 gene locus_tag LOCUS_21670 gene fmt 15075 16007 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_21670 16020 17336 gene locus_tag LOCUS_21680 gene rsmB 16020 17336 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249680.1 protein_id gnl|my_center|LOCUS_21680 17341 18387 gene locus_tag LOCUS_21690 gene rlmN 17341 18387 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986842.1 protein_id gnl|my_center|LOCUS_21690 18406 19134 gene locus_tag LOCUS_21700 18406 19134 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_21700 19177 21297 gene locus_tag LOCUS_21710 gene pknB 19177 21297 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_21710 21301 22185 gene locus_tag LOCUS_21720 gene rsgA 21301 22185 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_21720 22178 22837 gene locus_tag LOCUS_21730 22178 22837 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_21730 24294 23224 gene locus_tag LOCUS_21740 24294 23224 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_21740 24560 24790 gene locus_tag LOCUS_21750 24560 24790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 24846 25343 gene locus_tag LOCUS_21760 24846 25343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 25347 27407 gene locus_tag LOCUS_21770 25347 27407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 27420 28595 gene locus_tag LOCUS_21780 27420 28595 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_21780 29148 28789 gene locus_tag LOCUS_21790 29148 28789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 29666 31084 gene locus_tag LOCUS_21800 29666 31084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 31081 32343 gene locus_tag LOCUS_21810 31081 32343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 32372 33799 gene locus_tag LOCUS_21820 32372 33799 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771251.1 protein_id gnl|my_center|LOCUS_21820 33796 34566 gene locus_tag LOCUS_21830 33796 34566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 34579 35811 gene locus_tag LOCUS_21840 34579 35811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 35937 36971 gene locus_tag LOCUS_21850 35937 36971 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_21850 36973 37482 gene locus_tag LOCUS_21860 36973 37482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 37522 38712 gene locus_tag LOCUS_21870 37522 38712 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107233.1 protein_id gnl|my_center|LOCUS_21870 38726 39919 gene locus_tag LOCUS_21880 38726 39919 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107232.1 protein_id gnl|my_center|LOCUS_21880 39919 40377 gene locus_tag LOCUS_21890 39919 40377 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129415.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence20 406 38 gene locus_tag LOCUS_21900 406 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 1188 406 gene locus_tag LOCUS_21910 1188 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 2452 1163 gene locus_tag LOCUS_21920 2452 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 2816 2511 gene locus_tag LOCUS_21930 2816 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3266 3180 gene locus_tag LOCUS_t00350 3266 3180 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4100 3570 gene locus_tag LOCUS_21940 4100 3570 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434065.1 protein_id gnl|my_center|LOCUS_21940 5095 4232 gene locus_tag LOCUS_21950 gene fba 5095 4232 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_21950 5768 5196 gene locus_tag LOCUS_21960 5768 5196 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_21960 7121 5802 gene locus_tag LOCUS_21970 gene glnA 7121 5802 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_21970 9212 7248 gene locus_tag LOCUS_21980 9212 7248 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_21980 9378 10463 gene locus_tag LOCUS_21990 9378 10463 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289599.1 protein_id gnl|my_center|LOCUS_21990 10465 11088 gene locus_tag LOCUS_22000 10465 11088 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666641.1 protein_id gnl|my_center|LOCUS_22000 12966 11149 gene locus_tag LOCUS_22010 gene typA 12966 11149 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_22010 13410 14558 gene locus_tag LOCUS_22020 gene fucO 13410 14558 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013588.1 protein_id gnl|my_center|LOCUS_22020 14711 15391 gene locus_tag LOCUS_22030 14711 15391 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_22030 15384 16688 gene locus_tag LOCUS_22040 15384 16688 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_22040 16828 17775 gene locus_tag LOCUS_22050 16828 17775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057287.1 protein_id gnl|my_center|LOCUS_22050 17780 18901 gene locus_tag LOCUS_22060 17780 18901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294551.1 protein_id gnl|my_center|LOCUS_22060 18888 20054 gene locus_tag LOCUS_22070 18888 20054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 20160 21215 gene locus_tag LOCUS_22080 20160 21215 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_22080 22698 21334 gene locus_tag LOCUS_22090 22698 21334 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897252.1 protein_id gnl|my_center|LOCUS_22090 24375 22816 gene locus_tag LOCUS_22100 24375 22816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 24546 25541 gene locus_tag LOCUS_22110 gene mgrA 24546 25541 CDS product L-glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529545.1 protein_id gnl|my_center|LOCUS_22110 25560 26198 gene locus_tag LOCUS_22120 25560 26198 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129648.1 protein_id gnl|my_center|LOCUS_22120 27411 26236 gene locus_tag LOCUS_22130 27411 26236 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459186.1 protein_id gnl|my_center|LOCUS_22130 27686 28609 gene locus_tag LOCUS_22140 27686 28609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797800.1 protein_id gnl|my_center|LOCUS_22140 31337 28725 gene locus_tag LOCUS_22150 31337 28725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 32038 31337 gene locus_tag LOCUS_22160 32038 31337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_22160 32818 32192 gene locus_tag LOCUS_22170 32818 32192 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679286.1 protein_id gnl|my_center|LOCUS_22170 32964 33278 gene locus_tag LOCUS_22180 32964 33278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 34723 33728 gene locus_tag LOCUS_22190 34723 33728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 34926 34732 gene locus_tag LOCUS_22200 34926 34732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 36068 34947 gene locus_tag LOCUS_22210 36068 34947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 36528 36202 gene locus_tag LOCUS_22220 36528 36202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 37061 36822 gene locus_tag LOCUS_22230 37061 36822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence21 315 1295 gene locus_tag LOCUS_22240 315 1295 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_22240 2557 1334 gene locus_tag LOCUS_22250 2557 1334 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_22250 3976 2576 gene locus_tag LOCUS_22260 3976 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 4504 3980 gene locus_tag LOCUS_22270 4504 3980 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_22270 5094 4552 gene locus_tag LOCUS_22280 5094 4552 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775259.1 protein_id gnl|my_center|LOCUS_22280 6019 5114 gene locus_tag LOCUS_22290 6019 5114 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054703570.1 protein_id gnl|my_center|LOCUS_22290 6698 6030 gene locus_tag LOCUS_22300 6698 6030 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_22300 7461 6688 gene locus_tag LOCUS_22310 gene thyX 7461 6688 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421197.1 protein_id gnl|my_center|LOCUS_22310 8049 7600 gene locus_tag LOCUS_22320 8049 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 8595 8059 gene locus_tag LOCUS_22330 8595 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 8809 9477 gene locus_tag LOCUS_22340 8809 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 9574 11034 gene locus_tag LOCUS_22350 9574 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 11639 11124 gene locus_tag LOCUS_22360 gene nrdG 11639 11124 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_22360 13900 11642 gene locus_tag LOCUS_22370 13900 11642 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_22370 14512 14315 gene locus_tag LOCUS_22380 14512 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 14796 16631 gene locus_tag LOCUS_22390 gene asnB 14796 16631 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_22390 16904 17347 gene locus_tag LOCUS_22400 16904 17347 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057865.1 protein_id gnl|my_center|LOCUS_22400 17382 18356 gene locus_tag LOCUS_22410 17382 18356 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_22410 19259 18585 gene locus_tag LOCUS_22420 19259 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 19723 19334 gene locus_tag LOCUS_22430 19723 19334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 20058 19723 gene locus_tag LOCUS_22440 20058 19723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 20209 20045 gene locus_tag LOCUS_22450 20209 20045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 20639 20220 gene locus_tag LOCUS_22460 20639 20220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 20907 20653 gene locus_tag LOCUS_22470 20907 20653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 21420 20977 gene locus_tag LOCUS_22480 21420 20977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 21889 21476 gene locus_tag LOCUS_22490 21889 21476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 22134 23324 gene locus_tag LOCUS_22500 22134 23324 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115270946.1 protein_id gnl|my_center|LOCUS_22500 23887 23804 gene locus_tag LOCUS_t00360 23887 23804 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence22 332 766 gene locus_tag LOCUS_22510 332 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 786 1988 gene locus_tag LOCUS_22520 786 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2015 3214 gene locus_tag LOCUS_22530 2015 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3214 4314 gene locus_tag LOCUS_22540 3214 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4316 5170 gene locus_tag LOCUS_22550 4316 5170 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861379.1 protein_id gnl|my_center|LOCUS_22550 5452 5805 gene locus_tag LOCUS_22560 5452 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 6070 5858 gene locus_tag LOCUS_22570 6070 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 7951 6284 gene locus_tag LOCUS_22580 7951 6284 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_22580 8638 7973 gene locus_tag LOCUS_22590 8638 7973 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_22590 9372 8926 gene locus_tag LOCUS_22600 9372 8926 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851996.1 protein_id gnl|my_center|LOCUS_22600 10882 9740 gene locus_tag LOCUS_22610 gene tgt 10882 9740 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_22610 11990 10896 gene locus_tag LOCUS_22620 11990 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 12373 11990 gene locus_tag LOCUS_22630 12373 11990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 13484 12363 gene locus_tag LOCUS_22640 13484 12363 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355505.1 protein_id gnl|my_center|LOCUS_22640 14606 13554 gene locus_tag LOCUS_22650 gene queA 14606 13554 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_22650 15128 14958 gene locus_tag LOCUS_22660 15128 14958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 15188 16270 gene locus_tag LOCUS_22670 gene asd 15188 16270 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963889.1 protein_id gnl|my_center|LOCUS_22670 16307 17197 gene locus_tag LOCUS_22680 gene dapA 16307 17197 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_22680 17351 18109 gene locus_tag LOCUS_22690 gene dapB 17351 18109 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_22690 18463 19161 gene locus_tag LOCUS_22700 18463 19161 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680891.1 protein_id gnl|my_center|LOCUS_22700 19158 19874 gene locus_tag LOCUS_22710 19158 19874 CDS product GHKL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680890.1 protein_id gnl|my_center|LOCUS_22710 19969 21843 gene locus_tag LOCUS_22720 19969 21843 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682372.1 protein_id gnl|my_center|LOCUS_22720 21836 23734 gene locus_tag LOCUS_22730 21836 23734 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680887.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence23 <1 755 gene locus_tag LOCUS_22740 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000794333.1:restriction endonuclease subunit S 767 3961 gene locus_tag LOCUS_22750 767 3961 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068838.1 protein_id gnl|my_center|LOCUS_22750 4322 4567 gene locus_tag LOCUS_22760 4322 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4583 5509 gene locus_tag LOCUS_22770 4583 5509 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003822229.1 protein_id gnl|my_center|LOCUS_22770 6624 5665 gene locus_tag LOCUS_22780 6624 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 7505 6759 gene locus_tag LOCUS_22790 7505 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 8449 7499 gene locus_tag LOCUS_22800 8449 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 8723 8547 gene locus_tag LOCUS_22810 8723 8547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 9070 10092 gene locus_tag LOCUS_22820 9070 10092 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_22820 10514 11371 gene locus_tag LOCUS_22830 10514 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 11389 12813 gene locus_tag LOCUS_22840 11389 12813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 12933 13694 gene locus_tag LOCUS_22850 12933 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 13809 14576 gene locus_tag LOCUS_22860 13809 14576 CDS product glycoside hydrolase family 16 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966092.1 protein_id gnl|my_center|LOCUS_22860 15972 14803 gene locus_tag LOCUS_22870 15972 14803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 16320 16612 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq actggtgcgaatttgcactggtctaaaac 17011 19767 gene locus_tag LOCUS_22880 17011 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 19812 20054 gene locus_tag LOCUS_22890 19812 20054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 20236 19991 gene locus_tag LOCUS_22900 20236 19991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 >Feature sequence24 599 4423 gene locus_tag LOCUS_22910 gene rpoB 599 4423 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048357.1 protein_id gnl|my_center|LOCUS_22910 4543 8121 gene locus_tag LOCUS_22920 gene rpoC 4543 8121 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_22920 8213 8698 gene locus_tag LOCUS_22930 8213 8698 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_22930 8867 10210 gene locus_tag LOCUS_22940 8867 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 10418 10843 gene locus_tag LOCUS_22950 gene rpsL 10418 10843 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_22950 11039 11509 gene locus_tag LOCUS_22960 gene rpsG 11039 11509 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_22960 11531 13609 gene locus_tag LOCUS_22970 gene fusA 11531 13609 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_22970 13724 14923 gene locus_tag LOCUS_22980 gene tuf 13724 14923 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723640.1 protein_id gnl|my_center|LOCUS_22980 15070 16230 gene locus_tag LOCUS_22990 15070 16230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 16227 16700 gene locus_tag LOCUS_23000 gene tadA 16227 16700 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_23000 17320 16718 gene locus_tag LOCUS_23010 gene recR 17320 16718 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_23010 17670 17320 gene locus_tag LOCUS_23020 17670 17320 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_23020 19305 17695 gene locus_tag LOCUS_23030 gene dnaX 19305 17695 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963452.1 protein_id gnl|my_center|LOCUS_23030 20521 19643 gene locus_tag LOCUS_23040 20521 19643 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942263.1 protein_id gnl|my_center|LOCUS_23040 20902 20522 gene locus_tag LOCUS_23050 20902 20522 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064788.1 protein_id gnl|my_center|LOCUS_23050 21127 21213 gene locus_tag LOCUS_t00370 21127 21213 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence25 290 967 gene locus_tag LOCUS_23060 290 967 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044826408.1 protein_id gnl|my_center|LOCUS_23060 972 2045 gene locus_tag LOCUS_23070 972 2045 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_23070 3371 2106 gene locus_tag LOCUS_23080 3371 2106 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_23080 4592 3489 gene locus_tag LOCUS_23090 4592 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 5245 4628 gene locus_tag LOCUS_23100 5245 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 5641 5261 gene locus_tag LOCUS_23110 5641 5261 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811095.1 protein_id gnl|my_center|LOCUS_23110 5873 5643 gene locus_tag LOCUS_23120 5873 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 7414 5978 gene locus_tag LOCUS_23130 gene purB 7414 5978 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_23130 7706 8017 gene locus_tag LOCUS_23140 gene rplU 7706 8017 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457386.1 protein_id gnl|my_center|LOCUS_23140 8017 8337 gene locus_tag LOCUS_23150 8017 8337 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392095.1 protein_id gnl|my_center|LOCUS_23150 8373 8654 gene locus_tag LOCUS_23160 gene rpmA 8373 8654 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564659.1 protein_id gnl|my_center|LOCUS_23160 8752 10029 gene locus_tag LOCUS_23170 gene obgE 8752 10029 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_23170 10059 10448 gene locus_tag LOCUS_23180 10059 10448 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 protein_id gnl|my_center|LOCUS_23180 10472 11215 gene locus_tag LOCUS_23190 10472 11215 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_23190 11675 12985 gene locus_tag LOCUS_23200 11675 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 >Feature sequence26 142 456 gene locus_tag LOCUS_23210 142 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 656 528 gene locus_tag LOCUS_23220 656 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2666 735 gene locus_tag LOCUS_23230 2666 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 2930 2688 gene locus_tag LOCUS_23240 2930 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 4494 3133 gene locus_tag LOCUS_23250 gene rlmD 4494 3133 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_23250 5935 4478 gene locus_tag LOCUS_23260 5935 4478 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_23260 6576 5932 gene locus_tag LOCUS_23270 6576 5932 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_23270 8980 6590 gene locus_tag LOCUS_23280 8980 6590 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_23280 11021 8982 gene locus_tag LOCUS_23290 11021 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence27 2264 156 gene locus_tag LOCUS_23300 2264 156 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_23300 3079 2375 gene locus_tag LOCUS_23310 3079 2375 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_23310 4592 3099 gene locus_tag LOCUS_23320 4592 3099 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013584.1 protein_id gnl|my_center|LOCUS_23320 5367 4807 gene locus_tag LOCUS_23330 5367 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23330 7529 5454 gene locus_tag LOCUS_23340 7529 5454 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_23340 7912 8514 gene locus_tag LOCUS_23350 7912 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 8518 9273 gene locus_tag LOCUS_23360 8518 9273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 9287 10189 gene locus_tag LOCUS_23370 9287 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence28 188 739 gene locus_tag LOCUS_23380 188 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3029 819 gene locus_tag LOCUS_23390 3029 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 4202 3042 gene locus_tag LOCUS_23400 4202 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 5154 4216 gene locus_tag LOCUS_23410 5154 4216 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553997.1 protein_id gnl|my_center|LOCUS_23410 6376 5123 gene locus_tag LOCUS_23420 gene rlmD 6376 5123 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_23420 6893 7320 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaactcacacgctcacgtggagcgtgac >Feature sequence29 245 1180 gene locus_tag LOCUS_23430 245 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1259 6409 gene locus_tag LOCUS_23440 1259 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 6409 6744 gene locus_tag LOCUS_23450 6409 6744 CDS product DUF3852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158208705.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence30 497 1426 gene locus_tag LOCUS_23460 497 1426 CDS product DUF6045 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272743.1 protein_id gnl|my_center|LOCUS_23460 1423 1689 gene locus_tag LOCUS_23470 1423 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272691.1 protein_id gnl|my_center|LOCUS_23470 1690 2280 gene locus_tag LOCUS_23480 1690 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272690.1 protein_id gnl|my_center|LOCUS_23480 2270 4123 gene locus_tag LOCUS_23490 2270 4123 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272164.1 protein_id gnl|my_center|LOCUS_23490 4128 5105 gene locus_tag LOCUS_23500 4128 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272737.1 protein_id gnl|my_center|LOCUS_23500 5125 5361 gene locus_tag LOCUS_23510 5125 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 5658 6116 gene locus_tag LOCUS_23520 5658 6116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461992.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence31 145 654 gene locus_tag LOCUS_23530 145 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1350 1784 gene locus_tag LOCUS_23540 1350 1784 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670476.1 protein_id gnl|my_center|LOCUS_23540 2052 2429 gene locus_tag LOCUS_23550 2052 2429 CDS product TnpV protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140406.1 protein_id gnl|my_center|LOCUS_23550 2669 4771 gene locus_tag LOCUS_23560 2669 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 4954 5202 gene locus_tag LOCUS_23570 4954 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence32 976 104 gene locus_tag LOCUS_23580 976 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 1998 973 gene locus_tag LOCUS_23590 1998 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 3058 2024 gene locus_tag LOCUS_23600 3058 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 4258 3137 gene locus_tag LOCUS_23610 4258 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 4733 4332 gene locus_tag LOCUS_23620 4733 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 5346 4924 gene locus_tag LOCUS_23630 5346 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence33 267 1538 gene locus_tag LOCUS_23640 gene dcm 267 1538 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210977.1 protein_id gnl|my_center|LOCUS_23640 1531 2295 gene locus_tag LOCUS_23650 1531 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 2295 2663 gene locus_tag LOCUS_23660 2295 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 2664 2981 gene locus_tag LOCUS_23670 2664 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence34 >Feature sequence35 107 1144 gene locus_tag LOCUS_23680 107 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23680 1244 2605 gene locus_tag LOCUS_23690 1244 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23690 >Feature sequence36 121 1533 gene locus_tag LOCUS_23700 121 1533 CDS product DUF3991 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461898.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence37 108 596 gene locus_tag LOCUS_23710 108 596 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_23710 1140 2090 gene locus_tag LOCUS_23720 1140 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence38 397 110 gene locus_tag LOCUS_23730 397 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 717 878 gene locus_tag LOCUS_23740 717 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 964 2136 gene locus_tag LOCUS_23750 964 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence39 205 771 gene locus_tag LOCUS_23760 205 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 1280 858 gene locus_tag LOCUS_23770 1280 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence40 392 859 gene locus_tag LOCUS_23780 392 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461992.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence41 740 303 gene locus_tag LOCUS_23790 740 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence42 669 142 gene locus_tag LOCUS_23800 669 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1065 691 gene locus_tag LOCUS_23810 1065 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1406 1128 gene locus_tag LOCUS_23820 1406 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1168 1177 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence43 717 55 gene locus_tag LOCUS_23830 717 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1133 864 gene locus_tag LOCUS_23840 1133 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence44 >Feature sequence45 255 413 gene locus_tag LOCUS_23850 255 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 327 336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1038 1047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence46 132 284 gene locus_tag LOCUS_23860 132 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 338 1171 gene locus_tag LOCUS_23870 338 1171 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_23870 >Feature sequence47 344 562 gene locus_tag LOCUS_23880 344 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 630 932 gene locus_tag LOCUS_23890 630 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 949 1152 gene locus_tag LOCUS_23900 949 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 >Feature sequence48 >Feature sequence49 >Feature sequence50 >Feature sequence51 246 512 gene locus_tag LOCUS_23910 246 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence52 >Feature sequence53 479 739 gene locus_tag LOCUS_23920 479 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence54 782 907 gene locus_tag LOCUS_23930 782 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 >Feature sequence55 >Feature sequence56 69 527 gene locus_tag LOCUS_23940 69 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 832 581 gene locus_tag LOCUS_23950 832 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 >Feature sequence57 >Feature sequence58 <1 547 gene locus_tag LOCUS_23960 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404917.1:ABC transporter ATP-binding protein >Feature sequence59 <920 284 gene locus_tag LOCUS_23970 <920 284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000522871.1:ABC transporter ATP-binding protein >Feature sequence60 345 354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence61 564 130 gene locus_tag LOCUS_23980 564 130 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044976.1 protein_id gnl|my_center|LOCUS_23980 >Feature sequence62 338 347 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 836 411 gene locus_tag LOCUS_23990 836 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 >Feature sequence63 537 202 gene locus_tag LOCUS_24000 537 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence64 599 327 gene locus_tag LOCUS_24010 599 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24010 340 349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence65 870 235 gene locus_tag LOCUS_24020 870 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence66 >Feature sequence67 76 207 gene locus_tag LOCUS_24030 76 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 235 417 gene locus_tag LOCUS_24040 235 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 >Feature sequence68 410 419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence69 >Feature sequence70 318 106 gene locus_tag LOCUS_24050 318 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 704 399 gene locus_tag LOCUS_24060 704 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence71 <1 503 gene locus_tag LOCUS_24070 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003428619.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence72 621 355 gene locus_tag LOCUS_24080 621 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 >Feature sequence73 381 390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence74 >Feature sequence75 >Feature sequence76 252 497 gene locus_tag LOCUS_24090 252 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence77 111 263 gene locus_tag LOCUS_24100 111 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 293 553 gene locus_tag LOCUS_24110 293 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence78 >Feature sequence79 >Feature sequence80 100 570 gene locus_tag LOCUS_24120 100 570 CDS product LURP-one-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900805.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence81 571 68 gene locus_tag LOCUS_24130 571 68 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462001.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence82 >Feature sequence83 189 362 gene locus_tag LOCUS_24140 189 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 >Feature sequence84 >Feature sequence85 >Feature sequence86 3 359 gene locus_tag LOCUS_24150 3 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence87 >Feature sequence88 >Feature sequence89 112 435 gene locus_tag LOCUS_24160 112 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence90 >Feature sequence91 >Feature sequence92