>Feature sequence001 353 266 gene locus_tag LOCUS_t00010 353 266 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2567 582 gene locus_tag LOCUS_00010 2567 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4208 2574 gene locus_tag LOCUS_00020 4208 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5438 4365 gene locus_tag LOCUS_00030 5438 4365 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966322.1 protein_id gnl|my_center|LOCUS_00030 6893 5451 gene locus_tag LOCUS_00040 6893 5451 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128519551.1 protein_id gnl|my_center|LOCUS_00040 7886 6906 gene locus_tag LOCUS_00050 7886 6906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8681 7959 gene locus_tag LOCUS_00060 8681 7959 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981011.1 protein_id gnl|my_center|LOCUS_00060 9499 8681 gene locus_tag LOCUS_00070 9499 8681 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000811992.1 protein_id gnl|my_center|LOCUS_00070 10513 9536 gene locus_tag LOCUS_00080 10513 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10869 10510 gene locus_tag LOCUS_00090 10869 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11578 10883 gene locus_tag LOCUS_00100 11578 10883 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_00100 12387 11575 gene locus_tag LOCUS_00110 12387 11575 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027227.1 protein_id gnl|my_center|LOCUS_00110 14295 12397 gene locus_tag LOCUS_00120 14295 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14950 14288 gene locus_tag LOCUS_00130 14950 14288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 15163 16410 gene locus_tag LOCUS_00140 15163 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16961 17509 gene locus_tag LOCUS_00150 16961 17509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18666 17581 gene locus_tag LOCUS_00160 18666 17581 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184376.1 protein_id gnl|my_center|LOCUS_00160 19849 18659 gene locus_tag LOCUS_00170 19849 18659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073517675.1 protein_id gnl|my_center|LOCUS_00170 20820 19837 gene locus_tag LOCUS_00180 20820 19837 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096000.1 protein_id gnl|my_center|LOCUS_00180 22367 20850 gene locus_tag LOCUS_00190 22367 20850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025189880.1 protein_id gnl|my_center|LOCUS_00190 26960 22908 gene locus_tag LOCUS_00200 26960 22908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28007 27288 gene locus_tag LOCUS_00210 28007 27288 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_00210 29366 28023 gene locus_tag LOCUS_00220 29366 28023 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461524.1 protein_id gnl|my_center|LOCUS_00220 31925 29385 gene locus_tag LOCUS_00230 gene gyrA 31925 29385 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_00230 33876 31951 gene locus_tag LOCUS_00240 gene gyrB 33876 31951 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815132.1 protein_id gnl|my_center|LOCUS_00240 34981 33899 gene locus_tag LOCUS_00250 gene recF 34981 33899 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_00250 35195 34986 gene locus_tag LOCUS_00260 35195 34986 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480037.1 protein_id gnl|my_center|LOCUS_00260 36312 35209 gene locus_tag LOCUS_00270 gene dnaN 36312 35209 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_00270 37979 36588 gene locus_tag LOCUS_00280 gene dnaA 37979 36588 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_00280 38659 38793 gene locus_tag LOCUS_00290 gene rpmH 38659 38793 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_00290 38861 39196 gene locus_tag LOCUS_00300 gene rnpA 38861 39196 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_00300 39202 39411 gene locus_tag LOCUS_00310 gene yidD 39202 39411 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048456.1 protein_id gnl|my_center|LOCUS_00310 39493 40770 gene locus_tag LOCUS_00320 39493 40770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 40825 41736 gene locus_tag LOCUS_00330 40825 41736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 41827 43206 gene locus_tag LOCUS_00340 gene mnmE 41827 43206 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722170.1 protein_id gnl|my_center|LOCUS_00340 43220 45100 gene locus_tag LOCUS_00350 gene mnmG 43220 45100 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_00350 45193 45918 gene locus_tag LOCUS_00360 gene rsmG 45193 45918 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_00360 46262 46870 gene locus_tag LOCUS_00370 46262 46870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 48109 47165 gene locus_tag LOCUS_00380 48109 47165 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902464.1 protein_id gnl|my_center|LOCUS_00380 48402 48728 gene locus_tag LOCUS_00390 48402 48728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 48893 49669 gene locus_tag LOCUS_00400 48893 49669 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_00400 49660 50553 gene locus_tag LOCUS_00410 49660 50553 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_00410 50580 51089 gene locus_tag LOCUS_00420 50580 51089 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393987.1 protein_id gnl|my_center|LOCUS_00420 51243 52526 gene locus_tag LOCUS_00430 gene serS 51243 52526 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_00430 52541 53422 gene locus_tag LOCUS_00440 52541 53422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 53963 54039 gene locus_tag LOCUS_t00020 53963 54039 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54443 55318 gene locus_tag LOCUS_00450 gene noc 54443 55318 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476458.1 protein_id gnl|my_center|LOCUS_00450 55334 56119 gene locus_tag LOCUS_00460 55334 56119 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355976.1 protein_id gnl|my_center|LOCUS_00460 >Feature sequence002 565 1077 gene locus_tag LOCUS_00470 565 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2218 1619 gene locus_tag LOCUS_00480 2218 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2502 5798 gene locus_tag LOCUS_00490 2502 5798 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948403.1 protein_id gnl|my_center|LOCUS_00490 5813 7213 gene locus_tag LOCUS_00500 5813 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 7326 7970 gene locus_tag LOCUS_00510 7326 7970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 7963 11292 gene locus_tag LOCUS_00520 7963 11292 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 protein_id gnl|my_center|LOCUS_00520 11267 12499 gene locus_tag LOCUS_00530 11267 12499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 12944 14842 gene locus_tag LOCUS_00540 12944 14842 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_00540 14839 15189 gene locus_tag LOCUS_00550 14839 15189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 15254 16645 gene locus_tag LOCUS_00560 15254 16645 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245615.1 protein_id gnl|my_center|LOCUS_00560 17015 22186 gene locus_tag LOCUS_00570 17015 22186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 22165 22174 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22236 22388 gene locus_tag LOCUS_00580 22236 22388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 22462 23583 gene locus_tag LOCUS_00590 22462 23583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 23593 24270 gene locus_tag LOCUS_00600 23593 24270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 24431 26011 gene locus_tag LOCUS_00610 24431 26011 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680556.1 protein_id gnl|my_center|LOCUS_00610 26275 26664 gene locus_tag LOCUS_00620 26275 26664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 26634 26643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26681 27376 gene locus_tag LOCUS_00630 26681 27376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 27450 27692 gene locus_tag LOCUS_00640 27450 27692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 27762 28094 gene locus_tag LOCUS_00650 27762 28094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 28209 28550 gene locus_tag LOCUS_00660 28209 28550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 28537 28677 gene locus_tag LOCUS_00670 28537 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 28747 28902 gene locus_tag LOCUS_00680 28747 28902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 29078 30658 gene locus_tag LOCUS_00690 29078 30658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 30702 31160 gene locus_tag LOCUS_00700 30702 31160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 31227 32888 gene locus_tag LOCUS_00710 31227 32888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 32875 36075 gene locus_tag LOCUS_00720 32875 36075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 36090 37040 gene locus_tag LOCUS_00730 36090 37040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 37047 37382 gene locus_tag LOCUS_00740 37047 37382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 37462 37893 gene locus_tag LOCUS_00750 37462 37893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 38180 39226 gene locus_tag LOCUS_00760 38180 39226 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109323.1 protein_id gnl|my_center|LOCUS_00760 39439 39939 gene locus_tag LOCUS_00770 39439 39939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 40003 42612 gene locus_tag LOCUS_00780 40003 42612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 42637 46545 gene locus_tag LOCUS_00790 42637 46545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence003 1440 517 gene locus_tag LOCUS_00800 1440 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 2020 1844 gene locus_tag LOCUS_00810 2020 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 2403 3290 gene locus_tag LOCUS_00820 2403 3290 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682287.1 protein_id gnl|my_center|LOCUS_00820 3763 5220 gene locus_tag LOCUS_00830 gene trpE 3763 5220 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_00830 5220 5786 gene locus_tag LOCUS_00840 5220 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 5904 6917 gene locus_tag LOCUS_00850 gene trpD 5904 6917 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_00850 6921 7706 gene locus_tag LOCUS_00860 gene trpC 6921 7706 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_00860 7703 8314 gene locus_tag LOCUS_00870 7703 8314 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_00870 8347 9531 gene locus_tag LOCUS_00880 gene trpB 8347 9531 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 protein_id gnl|my_center|LOCUS_00880 9524 10297 gene locus_tag LOCUS_00890 gene trpA 9524 10297 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_00890 11437 10355 gene locus_tag LOCUS_00900 11437 10355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682004.1 protein_id gnl|my_center|LOCUS_00900 12435 11542 gene locus_tag LOCUS_00910 12435 11542 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_00910 13696 12557 gene locus_tag LOCUS_00920 13696 12557 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682009.1 protein_id gnl|my_center|LOCUS_00920 14142 13693 gene locus_tag LOCUS_00930 14142 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 14812 14225 gene locus_tag LOCUS_00940 14812 14225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 16160 14898 gene locus_tag LOCUS_00950 16160 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 18371 16752 gene locus_tag LOCUS_00960 18371 16752 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_00960 18588 18427 gene locus_tag LOCUS_00970 18588 18427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 18982 19464 gene locus_tag LOCUS_00980 18982 19464 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_00980 19454 20047 gene locus_tag LOCUS_00990 19454 20047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 20399 20244 gene locus_tag LOCUS_01000 20399 20244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 23749 20399 gene locus_tag LOCUS_01010 23749 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 24160 23897 gene locus_tag LOCUS_01020 gene rpsR 24160 23897 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_01020 24623 24183 gene locus_tag LOCUS_01030 gene ssb 24623 24183 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_01030 24926 24639 gene locus_tag LOCUS_01040 gene rpsF 24926 24639 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_01040 26813 25128 gene locus_tag LOCUS_01050 26813 25128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 27177 27031 gene locus_tag LOCUS_01060 27177 27031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 27940 28704 gene locus_tag LOCUS_01070 27940 28704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 29060 28851 gene locus_tag LOCUS_01080 29060 28851 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359346.1 protein_id gnl|my_center|LOCUS_01080 29278 29451 gene locus_tag LOCUS_01090 29278 29451 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809805.1 protein_id gnl|my_center|LOCUS_01090 30179 29517 gene locus_tag LOCUS_01100 30179 29517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 31783 30455 gene locus_tag LOCUS_01110 gene dnaB 31783 30455 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_01110 32244 31798 gene locus_tag LOCUS_01120 gene rplI 32244 31798 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_01120 34296 32245 gene locus_tag LOCUS_01130 34296 32245 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_01130 35470 34370 gene locus_tag LOCUS_01140 35470 34370 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986797.1 protein_id gnl|my_center|LOCUS_01140 36281 35499 gene locus_tag LOCUS_01150 36281 35499 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_01150 37491 36304 gene locus_tag LOCUS_01160 gene metK 37491 36304 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_01160 39095 37803 gene locus_tag LOCUS_01170 39095 37803 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966804.1 protein_id gnl|my_center|LOCUS_01170 39916 39404 gene locus_tag LOCUS_01180 gene thrB 39916 39404 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939791.1 protein_id gnl|my_center|LOCUS_01180 40045 41802 gene locus_tag LOCUS_01190 40045 41802 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193735789.1 protein_id gnl|my_center|LOCUS_01190 42464 42021 gene locus_tag LOCUS_01200 42464 42021 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048431.1 protein_id gnl|my_center|LOCUS_01200 43345 42485 gene locus_tag LOCUS_01210 gene rsmI 43345 42485 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_01210 44123 43353 gene locus_tag LOCUS_01220 44123 43353 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_01220 45033 44113 gene locus_tag LOCUS_01230 45033 44113 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963624.1 protein_id gnl|my_center|LOCUS_01230 46028 45033 gene locus_tag LOCUS_01240 46028 45033 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_01240 46650 46291 gene locus_tag LOCUS_01250 46650 46291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 47273 46686 gene locus_tag LOCUS_01260 47273 46686 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963621.1 protein_id gnl|my_center|LOCUS_01260 48401 47526 gene locus_tag LOCUS_01270 48401 47526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 49037 48741 gene locus_tag LOCUS_01280 49037 48741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence004 399 1691 gene locus_tag LOCUS_01290 399 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2232 3686 gene locus_tag LOCUS_01300 2232 3686 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661024.1 protein_id gnl|my_center|LOCUS_01300 3709 4572 gene locus_tag LOCUS_01310 gene speE 3709 4572 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366713.1 protein_id gnl|my_center|LOCUS_01310 4600 5859 gene locus_tag LOCUS_01320 4600 5859 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000088780.1 protein_id gnl|my_center|LOCUS_01320 5856 7004 gene locus_tag LOCUS_01330 gene nspC 5856 7004 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764364.1 protein_id gnl|my_center|LOCUS_01330 7067 8230 gene locus_tag LOCUS_01340 gene aguA 7067 8230 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969442.1 protein_id gnl|my_center|LOCUS_01340 8227 9108 gene locus_tag LOCUS_01350 gene aguB 8227 9108 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_01350 9192 10343 gene locus_tag LOCUS_01360 9192 10343 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765153.1 protein_id gnl|my_center|LOCUS_01360 10345 13536 gene locus_tag LOCUS_01370 10345 13536 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247465.1 protein_id gnl|my_center|LOCUS_01370 13662 14390 gene locus_tag LOCUS_01380 13662 14390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 14498 15304 gene locus_tag LOCUS_01390 gene larE 14498 15304 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_01390 15964 16794 gene locus_tag LOCUS_01400 15964 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 19264 17387 gene locus_tag LOCUS_01410 19264 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 20173 19550 gene locus_tag LOCUS_01420 20173 19550 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_01420 21557 20184 gene locus_tag LOCUS_01430 21557 20184 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_01430 23335 21569 gene locus_tag LOCUS_01440 23335 21569 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869269.1 protein_id gnl|my_center|LOCUS_01440 23915 23328 gene locus_tag LOCUS_01450 23915 23328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 24239 23931 gene locus_tag LOCUS_01460 24239 23931 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925114.1 protein_id gnl|my_center|LOCUS_01460 24716 24273 gene locus_tag LOCUS_01470 24716 24273 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869272.1 protein_id gnl|my_center|LOCUS_01470 25546 24797 gene locus_tag LOCUS_01480 25546 24797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01480 25256 25265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26835 25648 gene locus_tag LOCUS_01490 26835 25648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 27890 26832 gene locus_tag LOCUS_01500 27890 26832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 28206 27895 gene locus_tag LOCUS_01510 28206 27895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 28742 29392 gene locus_tag LOCUS_01520 gene trmB 28742 29392 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398646.1 protein_id gnl|my_center|LOCUS_01520 29459 29599 gene locus_tag LOCUS_01530 29459 29599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 30950 29718 gene locus_tag LOCUS_01540 30950 29718 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_01540 30969 31139 gene locus_tag LOCUS_01550 30969 31139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 31130 31203 gene locus_tag LOCUS_t00030 31130 31203 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 31521 32363 gene locus_tag LOCUS_01560 31521 32363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 32432 33517 gene locus_tag LOCUS_01570 32432 33517 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_01570 33536 34492 gene locus_tag LOCUS_01580 33536 34492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 34606 35907 gene locus_tag LOCUS_01590 34606 35907 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986425.1 protein_id gnl|my_center|LOCUS_01590 36201 36210 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36225 37715 gene locus_tag LOCUS_01600 36225 37715 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963421.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence005 839 2197 gene locus_tag LOCUS_01610 839 2197 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_01610 2262 2864 gene locus_tag LOCUS_01620 2262 2864 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_01620 2951 3454 gene locus_tag LOCUS_01630 2951 3454 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948064.1 protein_id gnl|my_center|LOCUS_01630 3753 5222 gene locus_tag LOCUS_01640 3753 5222 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_01640 5170 5334 gene locus_tag LOCUS_01650 5170 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 5377 6420 gene locus_tag LOCUS_01660 5377 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 6443 7690 gene locus_tag LOCUS_01670 6443 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 7872 10247 gene locus_tag LOCUS_01680 7872 10247 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_01680 10644 10444 gene locus_tag LOCUS_01690 10644 10444 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355647.1 protein_id gnl|my_center|LOCUS_01690 10946 11767 gene locus_tag LOCUS_01700 10946 11767 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_01700 11887 13227 gene locus_tag LOCUS_01710 11887 13227 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_01710 13374 14414 gene locus_tag LOCUS_01720 13374 14414 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966189.1 protein_id gnl|my_center|LOCUS_01720 14484 16217 gene locus_tag LOCUS_01730 14484 16217 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104219.1 protein_id gnl|my_center|LOCUS_01730 16219 16728 gene locus_tag LOCUS_01740 16219 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 16830 17105 gene locus_tag LOCUS_01750 gene hbs 16830 17105 CDS product non-specific DNA-binding protein Hbs inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003153447.1 protein_id gnl|my_center|LOCUS_01750 17185 17424 gene locus_tag LOCUS_01760 17185 17424 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421412.1 protein_id gnl|my_center|LOCUS_01760 17507 17794 gene locus_tag LOCUS_01770 17507 17794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 17794 18240 gene locus_tag LOCUS_01780 17794 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 18263 18577 gene locus_tag LOCUS_01790 18263 18577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 18729 20213 gene locus_tag LOCUS_01800 18729 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 20223 21626 gene locus_tag LOCUS_01810 gene tilS 20223 21626 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_01810 21628 22149 gene locus_tag LOCUS_01820 gene hpt 21628 22149 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_01820 22165 23976 gene locus_tag LOCUS_01830 gene ftsH 22165 23976 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_01830 24316 25263 gene locus_tag LOCUS_01840 24316 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 25208 26545 gene locus_tag LOCUS_01850 25208 26545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 25222 25231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 26829 26757 gene locus_tag LOCUS_t00040 26829 26757 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27177 28919 gene locus_tag LOCUS_01860 27177 28919 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_01860 28916 29635 gene locus_tag LOCUS_01870 28916 29635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 29787 31460 gene locus_tag LOCUS_01880 29787 31460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 >Feature sequence006 1117 143 gene locus_tag LOCUS_01890 gene pfkA 1117 143 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_01890 4713 1186 gene locus_tag LOCUS_01900 4713 1186 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_01900 5642 4722 gene locus_tag LOCUS_01910 5642 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 6107 5868 gene locus_tag LOCUS_01920 6107 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 6529 6155 gene locus_tag LOCUS_01930 6529 6155 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_01930 7553 6720 gene locus_tag LOCUS_01940 7553 6720 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986367.1 protein_id gnl|my_center|LOCUS_01940 8444 7740 gene locus_tag LOCUS_01950 8444 7740 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393691.1 protein_id gnl|my_center|LOCUS_01950 8725 8654 gene locus_tag LOCUS_t00050 8725 8654 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 8910 10376 gene locus_tag LOCUS_01960 8910 10376 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_01960 10437 11009 gene locus_tag LOCUS_01970 10437 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 12292 10988 gene locus_tag LOCUS_01980 12292 10988 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_01980 13189 12641 gene locus_tag LOCUS_01990 gene spoVT 13189 12641 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_01990 16484 13296 gene locus_tag LOCUS_02000 16484 13296 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_02000 16774 17373 gene locus_tag LOCUS_02010 16774 17373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 17930 17370 gene locus_tag LOCUS_02020 17930 17370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 19428 17920 gene locus_tag LOCUS_02030 19428 17920 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_02030 19904 19614 gene locus_tag LOCUS_02040 19904 19614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_02040 20259 21551 gene locus_tag LOCUS_02050 20259 21551 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_02050 22259 21624 gene locus_tag LOCUS_02060 22259 21624 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852949.1 protein_id gnl|my_center|LOCUS_02060 23466 22252 gene locus_tag LOCUS_02070 gene thiH 23466 22252 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_02070 24255 23479 gene locus_tag LOCUS_02080 24255 23479 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_02080 24959 24318 gene locus_tag LOCUS_02090 gene thiF 24959 24318 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_02090 25159 24962 gene locus_tag LOCUS_02100 gene thiS 25159 24962 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919747.1 protein_id gnl|my_center|LOCUS_02100 25686 26195 gene locus_tag LOCUS_02110 25686 26195 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_02110 26226 26447 gene locus_tag LOCUS_02120 26226 26447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 27817 26519 gene locus_tag LOCUS_02130 27817 26519 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416818.1 protein_id gnl|my_center|LOCUS_02130 28055 28879 gene locus_tag LOCUS_02140 gene mutM 28055 28879 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_02140 >Feature sequence007 <1 726 gene locus_tag LOCUS_02150 <1 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056256.1:RNA-guided endonuclease TnpB family protein 922 1710 gene locus_tag LOCUS_02160 922 1710 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943941.1 protein_id gnl|my_center|LOCUS_02160 1900 2127 gene locus_tag LOCUS_02170 1900 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 2251 3261 gene locus_tag LOCUS_02180 2251 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02180 3204 3213 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3258 4613 gene locus_tag LOCUS_02190 3258 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02190 4696 8505 gene locus_tag LOCUS_02200 4696 8505 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_02200 8953 9573 gene locus_tag LOCUS_02210 8953 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 9713 9787 gene locus_tag LOCUS_t00060 9713 9787 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9791 9876 gene locus_tag LOCUS_t00070 9791 9876 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9926 9935 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9937 10011 gene locus_tag LOCUS_t00080 9937 10011 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10119 10658 gene locus_tag LOCUS_02220 gene ispF 10119 10658 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_02220 10651 11796 gene locus_tag LOCUS_02230 10651 11796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 11975 13381 gene locus_tag LOCUS_02240 gene cysS 11975 13381 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_02240 13366 13830 gene locus_tag LOCUS_02250 13366 13830 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293091.1 protein_id gnl|my_center|LOCUS_02250 13827 14570 gene locus_tag LOCUS_02260 gene rlmB 13827 14570 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_02260 14711 14785 gene locus_tag LOCUS_t00090 14711 14785 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15079 15522 gene locus_tag LOCUS_02270 15079 15522 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_02270 15587 16813 gene locus_tag LOCUS_02280 15587 16813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 17596 16895 gene locus_tag LOCUS_02290 17596 16895 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986299.1 protein_id gnl|my_center|LOCUS_02290 17669 18097 gene locus_tag LOCUS_02300 17669 18097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 18447 20597 gene locus_tag LOCUS_02310 18447 20597 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_02310 20893 21528 gene locus_tag LOCUS_02320 20893 21528 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948000.1 protein_id gnl|my_center|LOCUS_02320 21665 22273 gene locus_tag LOCUS_02330 21665 22273 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966864.1 protein_id gnl|my_center|LOCUS_02330 22419 22913 gene locus_tag LOCUS_02340 22419 22913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 22910 23356 gene locus_tag LOCUS_02350 gene tsaE 22910 23356 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048261.1 protein_id gnl|my_center|LOCUS_02350 23366 24019 gene locus_tag LOCUS_02360 gene tsaB 23366 24019 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_02360 23395 23404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24012 24455 gene locus_tag LOCUS_02370 gene rimI 24012 24455 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_02370 24565 24789 gene locus_tag LOCUS_02380 24565 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 24845 25756 gene locus_tag LOCUS_02390 24845 25756 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518928.1 protein_id gnl|my_center|LOCUS_02390 25824 26852 gene locus_tag LOCUS_02400 gene tsaD 25824 26852 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_02400 26853 27569 gene locus_tag LOCUS_02410 gene ispD 26853 27569 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_02410 27645 27732 gene locus_tag LOCUS_t00100 27645 27732 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27789 27880 gene locus_tag LOCUS_t00110 27789 27880 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence008 3075 1555 gene locus_tag LOCUS_02420 gene malQ 3075 1555 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_02420 3018 3027 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3894 3091 gene locus_tag LOCUS_02430 3894 3091 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000771957.1 protein_id gnl|my_center|LOCUS_02430 4072 3860 gene locus_tag LOCUS_02440 4072 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6305 4116 gene locus_tag LOCUS_02450 6305 4116 CDS product PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379197.1 protein_id gnl|my_center|LOCUS_02450 6594 7619 gene locus_tag LOCUS_02460 gene malR 6594 7619 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219053.1 protein_id gnl|my_center|LOCUS_02460 8527 7670 gene locus_tag LOCUS_02470 8527 7670 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924049.1 protein_id gnl|my_center|LOCUS_02470 8668 10959 gene locus_tag LOCUS_02480 gene glgP 8668 10959 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_02480 12520 11120 gene locus_tag LOCUS_02490 12520 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 14540 12633 gene locus_tag LOCUS_02500 14540 12633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 15804 14590 gene locus_tag LOCUS_02510 15804 14590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 16986 15859 gene locus_tag LOCUS_02520 16986 15859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 19388 17133 gene locus_tag LOCUS_02530 19388 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 20064 19519 gene locus_tag LOCUS_02540 20064 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 20729 20061 gene locus_tag LOCUS_02550 20729 20061 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168857.1 protein_id gnl|my_center|LOCUS_02550 21857 20733 gene locus_tag LOCUS_02560 21857 20733 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_02560 22335 22141 gene locus_tag LOCUS_02570 22335 22141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 22622 22332 gene locus_tag LOCUS_02580 22622 22332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 >Feature sequence009 339 85 gene locus_tag LOCUS_02590 339 85 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_02590 613 1326 gene locus_tag LOCUS_02600 613 1326 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_02600 1527 2453 gene locus_tag LOCUS_02610 1527 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 2506 3435 gene locus_tag LOCUS_02620 2506 3435 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_02620 3748 3482 gene locus_tag LOCUS_02630 3748 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 5415 4246 gene locus_tag LOCUS_02640 5415 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 5699 6754 gene locus_tag LOCUS_02650 5699 6754 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440236.1 protein_id gnl|my_center|LOCUS_02650 6857 7393 gene locus_tag LOCUS_02660 gene cobO 6857 7393 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867207.1 protein_id gnl|my_center|LOCUS_02660 8715 7711 gene locus_tag LOCUS_02670 8715 7711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 8923 9636 gene locus_tag LOCUS_02680 gene deoD 8923 9636 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_02680 9653 10057 gene locus_tag LOCUS_02690 9653 10057 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_02690 10074 11732 gene locus_tag LOCUS_02700 10074 11732 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_02700 11748 12353 gene locus_tag LOCUS_02710 11748 12353 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_02710 13596 12358 gene locus_tag LOCUS_02720 13596 12358 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461101.1 protein_id gnl|my_center|LOCUS_02720 13938 14468 gene locus_tag LOCUS_02730 13938 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 14802 15953 gene locus_tag LOCUS_02740 14802 15953 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016645.1 protein_id gnl|my_center|LOCUS_02740 15954 18416 gene locus_tag LOCUS_02750 15954 18416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 18533 19003 gene locus_tag LOCUS_02760 18533 19003 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295126.1 protein_id gnl|my_center|LOCUS_02760 19019 21076 gene locus_tag LOCUS_02770 19019 21076 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271984.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence010 95 577 gene locus_tag LOCUS_02780 95 577 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_02780 574 1746 gene locus_tag LOCUS_02790 574 1746 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_02790 1746 2249 gene locus_tag LOCUS_02800 1746 2249 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_02800 3863 2451 gene locus_tag LOCUS_02810 3863 2451 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_02810 3026 3035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4564 3860 gene locus_tag LOCUS_02820 4564 3860 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_02820 7168 4784 gene locus_tag LOCUS_02830 7168 4784 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_02830 7471 8757 gene locus_tag LOCUS_02840 7471 8757 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613276.1 protein_id gnl|my_center|LOCUS_02840 8847 9791 gene locus_tag LOCUS_02850 8847 9791 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_02850 9854 11242 gene locus_tag LOCUS_02860 gene rlmD 9854 11242 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_02860 11329 11601 gene locus_tag LOCUS_02870 11329 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 13068 11683 gene locus_tag LOCUS_02880 13068 11683 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_02880 13092 13355 gene locus_tag LOCUS_02890 13092 13355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 13382 14482 gene locus_tag LOCUS_02900 13382 14482 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986532.1 protein_id gnl|my_center|LOCUS_02900 14685 15935 gene locus_tag LOCUS_02910 14685 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 16692 15982 gene locus_tag LOCUS_02920 16692 15982 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_02920 16922 17641 gene locus_tag LOCUS_02930 16922 17641 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016025.1 protein_id gnl|my_center|LOCUS_02930 17693 18673 gene locus_tag LOCUS_02940 17693 18673 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140402.1 protein_id gnl|my_center|LOCUS_02940 18854 19687 gene locus_tag LOCUS_02950 18854 19687 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_02950 19790 20935 gene locus_tag LOCUS_02960 19790 20935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 21045 21845 gene locus_tag LOCUS_02970 21045 21845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 21620 21629 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21952 22479 gene locus_tag LOCUS_02980 21952 22479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence011 1201 806 gene locus_tag LOCUS_02990 gene mgsA 1201 806 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723016.1 protein_id gnl|my_center|LOCUS_02990 2335 1232 gene locus_tag LOCUS_03000 gene rodA 2335 1232 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_03000 2555 2304 gene locus_tag LOCUS_03010 2555 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3362 2562 gene locus_tag LOCUS_03020 gene minD 3362 2562 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_03020 4192 3500 gene locus_tag LOCUS_03030 4192 3500 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902702.1 protein_id gnl|my_center|LOCUS_03030 7176 4213 gene locus_tag LOCUS_03040 7176 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 7537 7169 gene locus_tag LOCUS_03050 7537 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 7521 7530 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8644 7691 gene locus_tag LOCUS_03060 gene mreC 8644 7691 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_03060 9137 8658 gene locus_tag LOCUS_03070 9137 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03070 9660 9097 gene locus_tag LOCUS_03080 9660 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 9188 9197 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10386 9679 gene locus_tag LOCUS_03090 gene radC 10386 9679 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816793.1 protein_id gnl|my_center|LOCUS_03090 12065 10476 gene locus_tag LOCUS_03100 12065 10476 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_03100 13290 12058 gene locus_tag LOCUS_03110 13290 12058 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_03110 14608 13319 gene locus_tag LOCUS_03120 14608 13319 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_03120 15549 14596 gene locus_tag LOCUS_03130 gene miaA 15549 14596 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965140.1 protein_id gnl|my_center|LOCUS_03130 15928 15569 gene locus_tag LOCUS_03140 15928 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03140 17639 15915 gene locus_tag LOCUS_03150 gene mutL 17639 15915 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516481.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 15939 15948 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17135 17144 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20361 17644 gene locus_tag LOCUS_03160 gene mutS 20361 17644 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_03160 21336 20434 gene locus_tag LOCUS_03170 gene rsmH 21336 20434 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015778.1 protein_id gnl|my_center|LOCUS_03170 21475 21266 gene locus_tag LOCUS_03180 21475 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 <22553 21572 gene locus_tag LOCUS_03190 <22553 21572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435252.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence012 448 209 gene locus_tag LOCUS_03200 448 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 1295 717 gene locus_tag LOCUS_03210 1295 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 2340 1372 gene locus_tag LOCUS_03220 2340 1372 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047820.1 protein_id gnl|my_center|LOCUS_03220 2842 2384 gene locus_tag LOCUS_03230 2842 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3324 2842 gene locus_tag LOCUS_03240 3324 2842 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390171.1 protein_id gnl|my_center|LOCUS_03240 4405 3317 gene locus_tag LOCUS_03250 4405 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4843 5382 gene locus_tag LOCUS_03260 4843 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 5492 5878 gene locus_tag LOCUS_03270 5492 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 6348 5965 gene locus_tag LOCUS_03280 6348 5965 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 protein_id gnl|my_center|LOCUS_03280 7856 6345 gene locus_tag LOCUS_03290 7856 6345 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_03290 8200 9435 gene locus_tag LOCUS_03300 8200 9435 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963947.1 protein_id gnl|my_center|LOCUS_03300 9660 11189 gene locus_tag LOCUS_03310 9660 11189 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_03310 12893 11355 gene locus_tag LOCUS_03320 gene asnB 12893 11355 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860775.1 protein_id gnl|my_center|LOCUS_03320 13532 13086 gene locus_tag LOCUS_03330 13532 13086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 14227 13934 gene locus_tag LOCUS_03340 14227 13934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 15617 14241 gene locus_tag LOCUS_03350 15617 14241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 16922 15783 gene locus_tag LOCUS_03360 16922 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 18492 16987 gene locus_tag LOCUS_03370 18492 16987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 19265 18531 gene locus_tag LOCUS_03380 19265 18531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 19966 19283 gene locus_tag LOCUS_03390 19966 19283 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence013 <1 3971 gene locus_tag LOCUS_03400 <1 3971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389627.1:discoidin domain-containing protein 3912 3921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4264 4698 gene locus_tag LOCUS_03410 4264 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 4981 5054 gene locus_tag LOCUS_t00120 4981 5054 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5449 6021 gene locus_tag LOCUS_03420 5449 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6037 6546 gene locus_tag LOCUS_03430 6037 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 6564 7970 gene locus_tag LOCUS_03440 6564 7970 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_03440 7980 9389 gene locus_tag LOCUS_03450 7980 9389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 9480 10118 gene locus_tag LOCUS_03460 9480 10118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10167 10976 gene locus_tag LOCUS_03470 10167 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 12032 11091 gene locus_tag LOCUS_03480 12032 11091 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_03480 12856 12020 gene locus_tag LOCUS_03490 12856 12020 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_03490 13261 13596 gene locus_tag LOCUS_03500 13261 13596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 13642 14085 gene locus_tag LOCUS_03510 13642 14085 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070756.1 protein_id gnl|my_center|LOCUS_03510 14110 15156 gene locus_tag LOCUS_03520 14110 15156 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_03520 15160 15621 gene locus_tag LOCUS_03530 15160 15621 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832356.1 protein_id gnl|my_center|LOCUS_03530 15615 16046 gene locus_tag LOCUS_03540 gene rpiB 15615 16046 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_03540 16082 16711 gene locus_tag LOCUS_03550 gene upp 16082 16711 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_03550 16754 17236 gene locus_tag LOCUS_03560 16754 17236 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_03560 17307 18248 gene locus_tag LOCUS_03570 17307 18248 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_03570 18261 19355 gene locus_tag LOCUS_03580 18261 19355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence014 571 14 gene locus_tag LOCUS_03590 571 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1339 659 gene locus_tag LOCUS_03600 1339 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 1704 2327 gene locus_tag LOCUS_03610 1704 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1929 1938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2379 4172 gene locus_tag LOCUS_03620 2379 4172 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814583.1 protein_id gnl|my_center|LOCUS_03620 4188 6182 gene locus_tag LOCUS_03630 4188 6182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_03630 6182 6781 gene locus_tag LOCUS_03640 6182 6781 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_03640 6947 7936 gene locus_tag LOCUS_03650 6947 7936 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016441.1 protein_id gnl|my_center|LOCUS_03650 8273 8989 gene locus_tag LOCUS_03660 8273 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 9146 10045 gene locus_tag LOCUS_03670 9146 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03670 10069 10914 gene locus_tag LOCUS_03680 10069 10914 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_03680 10911 11654 gene locus_tag LOCUS_03690 10911 11654 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459577.1 protein_id gnl|my_center|LOCUS_03690 12271 11783 gene locus_tag LOCUS_03700 12271 11783 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_03700 12560 14608 gene locus_tag LOCUS_03710 12560 14608 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460617.1 protein_id gnl|my_center|LOCUS_03710 15265 14621 gene locus_tag LOCUS_03720 15265 14621 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_03720 15475 16242 gene locus_tag LOCUS_03730 15475 16242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_03730 16235 17032 gene locus_tag LOCUS_03740 16235 17032 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861383.1 protein_id gnl|my_center|LOCUS_03740 17276 18034 gene locus_tag LOCUS_03750 17276 18034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 18238 19626 gene locus_tag LOCUS_03760 gene argH 18238 19626 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence015 1572 178 gene locus_tag LOCUS_03770 1572 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 2141 1656 gene locus_tag LOCUS_03780 2141 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3296 2172 gene locus_tag LOCUS_03790 3296 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4774 3410 gene locus_tag LOCUS_03800 4774 3410 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_03800 5431 4796 gene locus_tag LOCUS_03810 5431 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5731 7281 gene locus_tag LOCUS_03820 5731 7281 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_03820 7776 7270 gene locus_tag LOCUS_03830 7776 7270 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_03830 8845 7934 gene locus_tag LOCUS_03840 8845 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 10253 8937 gene locus_tag LOCUS_03850 10253 8937 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234223.1 protein_id gnl|my_center|LOCUS_03850 10848 10345 gene locus_tag LOCUS_03860 10848 10345 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381189.1 protein_id gnl|my_center|LOCUS_03860 11076 11315 gene locus_tag LOCUS_03870 11076 11315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12864 11590 gene locus_tag LOCUS_03880 12864 11590 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_03880 13721 13086 gene locus_tag LOCUS_03890 13721 13086 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_03890 14447 13737 gene locus_tag LOCUS_03900 14447 13737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_03900 15223 14462 gene locus_tag LOCUS_03910 15223 14462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_03910 16208 15225 gene locus_tag LOCUS_03920 16208 15225 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815200.1 protein_id gnl|my_center|LOCUS_03920 17199 16099 gene locus_tag LOCUS_03930 17199 16099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 16386 16395 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18690 17497 gene locus_tag LOCUS_03940 18690 17497 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815196.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence016 1786 1412 gene locus_tag LOCUS_03950 gene rplL 1786 1412 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357259.1 protein_id gnl|my_center|LOCUS_03950 2349 1858 gene locus_tag LOCUS_03960 gene rplJ 2349 1858 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360185.1 protein_id gnl|my_center|LOCUS_03960 5706 2608 gene locus_tag LOCUS_03970 5706 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6721 6029 gene locus_tag LOCUS_03980 gene rplA 6721 6029 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_03980 7249 6824 gene locus_tag LOCUS_03990 gene rplK 7249 6824 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_03990 7898 7383 gene locus_tag LOCUS_04000 gene nusG 7898 7383 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_04000 8120 7914 gene locus_tag LOCUS_04010 8120 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 9684 8500 gene locus_tag LOCUS_04020 9684 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10700 9798 gene locus_tag LOCUS_04030 10700 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 10990 10745 gene locus_tag LOCUS_04040 10990 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 13904 10974 gene locus_tag LOCUS_04050 13904 10974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 15393 14083 gene locus_tag LOCUS_04060 15393 14083 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_04060 16376 15444 gene locus_tag LOCUS_04070 gene cysK 16376 15444 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_04070 16651 17088 gene locus_tag LOCUS_04080 16651 17088 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence017 4517 420 gene locus_tag LOCUS_04090 4517 420 CDS product TIGR02680 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459216.1 protein_id gnl|my_center|LOCUS_04090 5646 4507 gene locus_tag LOCUS_04100 5646 4507 CDS product TIGR02678 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068556302.1 protein_id gnl|my_center|LOCUS_04100 7127 5643 gene locus_tag LOCUS_04110 7127 5643 CDS product TIGR02677 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459214.1 protein_id gnl|my_center|LOCUS_04110 8597 7260 gene locus_tag LOCUS_04120 8597 7260 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_04120 13872 8614 gene locus_tag LOCUS_04130 13872 8614 CDS product DUF3320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203358.1 protein_id gnl|my_center|LOCUS_04130 15615 14278 gene locus_tag LOCUS_04140 15615 14278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 16831 15632 gene locus_tag LOCUS_04150 16831 15632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 17996 16896 gene locus_tag LOCUS_04160 17996 16896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence018 557 1987 gene locus_tag LOCUS_04170 557 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2306 2049 gene locus_tag LOCUS_04180 2306 2049 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_04180 2715 3164 gene locus_tag LOCUS_04190 gene nrdR 2715 3164 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_04190 3267 5099 gene locus_tag LOCUS_04200 3267 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 5148 6494 gene locus_tag LOCUS_04210 5148 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 6469 6777 gene locus_tag LOCUS_04220 6469 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6805 7980 gene locus_tag LOCUS_04230 6805 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 8001 8798 gene locus_tag LOCUS_04240 8001 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 8920 9801 gene locus_tag LOCUS_04250 8920 9801 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_04250 9913 10563 gene locus_tag LOCUS_04260 9913 10563 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272546.1 protein_id gnl|my_center|LOCUS_04260 10574 11329 gene locus_tag LOCUS_04270 10574 11329 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815786.1 protein_id gnl|my_center|LOCUS_04270 11565 14783 gene locus_tag LOCUS_04280 gene carB 11565 14783 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_04280 14820 16079 gene locus_tag LOCUS_04290 gene uraA 14820 16079 CDS product uracil permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667891.1 protein_id gnl|my_center|LOCUS_04290 16140 17147 gene locus_tag LOCUS_04300 gene asnA 16140 17147 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence019 4383 3067 gene locus_tag LOCUS_04310 4383 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 4507 4313 gene locus_tag LOCUS_04320 4507 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4638 5801 gene locus_tag LOCUS_04330 4638 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5798 7528 gene locus_tag LOCUS_04340 5798 7528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861230.1 protein_id gnl|my_center|LOCUS_04340 8078 7695 gene locus_tag LOCUS_04350 8078 7695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8238 8672 gene locus_tag LOCUS_04360 8238 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 8946 8683 gene locus_tag LOCUS_04370 8946 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 9245 10441 gene locus_tag LOCUS_04380 9245 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 11542 10460 gene locus_tag LOCUS_04390 11542 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 13092 11545 gene locus_tag LOCUS_04400 13092 11545 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_04400 13249 14682 gene locus_tag LOCUS_04410 13249 14682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 16046 14730 gene locus_tag LOCUS_04420 16046 14730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 17339 16134 gene locus_tag LOCUS_04430 17339 16134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 17707 17336 gene locus_tag LOCUS_04440 17707 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence020 514 900 gene locus_tag LOCUS_04450 514 900 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_04450 979 2274 gene locus_tag LOCUS_04460 979 2274 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966344.1 protein_id gnl|my_center|LOCUS_04460 2622 3854 gene locus_tag LOCUS_04470 2622 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4239 5186 gene locus_tag LOCUS_04480 4239 5186 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_04480 5431 6228 gene locus_tag LOCUS_04490 5431 6228 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_04490 6228 6617 gene locus_tag LOCUS_04500 6228 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6644 8632 gene locus_tag LOCUS_04510 6644 8632 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940767.1 protein_id gnl|my_center|LOCUS_04510 8623 9066 gene locus_tag LOCUS_04520 8623 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 9051 10028 gene locus_tag LOCUS_04530 9051 10028 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_04530 10032 11069 gene locus_tag LOCUS_04540 10032 11069 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_04540 11069 11923 gene locus_tag LOCUS_04550 11069 11923 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_04550 11969 12643 gene locus_tag LOCUS_04560 11969 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 12657 14294 gene locus_tag LOCUS_04570 12657 14294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 14431 15273 gene locus_tag LOCUS_04580 14431 15273 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_04580 15274 15834 gene locus_tag LOCUS_04590 15274 15834 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_04590 16310 17734 gene locus_tag LOCUS_04600 16310 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence021 <1 677 gene locus_tag LOCUS_04610 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454209.1:ABC transporter substrate-binding protein 735 1751 gene locus_tag LOCUS_04620 735 1751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454207.1 protein_id gnl|my_center|LOCUS_04620 1741 2553 gene locus_tag LOCUS_04630 1741 2553 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476523.1 protein_id gnl|my_center|LOCUS_04630 2550 3557 gene locus_tag LOCUS_04640 2550 3557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895878.1 protein_id gnl|my_center|LOCUS_04640 3550 4440 gene locus_tag LOCUS_04650 3550 4440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902199.1 protein_id gnl|my_center|LOCUS_04650 4924 6291 gene locus_tag LOCUS_04660 4924 6291 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_04660 6304 6891 gene locus_tag LOCUS_04670 6304 6891 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435157.1 protein_id gnl|my_center|LOCUS_04670 7156 7620 gene locus_tag LOCUS_04680 7156 7620 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055906.1 protein_id gnl|my_center|LOCUS_04680 7932 10052 gene locus_tag LOCUS_04690 gene cooS 7932 10052 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768251.1 protein_id gnl|my_center|LOCUS_04690 10161 11135 gene locus_tag LOCUS_04700 10161 11135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393471.1 protein_id gnl|my_center|LOCUS_04700 11204 11983 gene locus_tag LOCUS_04710 11204 11983 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393472.1 protein_id gnl|my_center|LOCUS_04710 11988 12758 gene locus_tag LOCUS_04720 11988 12758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_04720 12972 13205 gene locus_tag LOCUS_04730 12972 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 13220 16126 gene locus_tag LOCUS_04740 13220 16126 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence022 266 1033 gene locus_tag LOCUS_04750 266 1033 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_04750 1033 1491 gene locus_tag LOCUS_04760 1033 1491 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832133.1 protein_id gnl|my_center|LOCUS_04760 1737 1540 gene locus_tag LOCUS_04770 1737 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2832 2236 gene locus_tag LOCUS_04780 2832 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04780 3397 2813 gene locus_tag LOCUS_04790 3397 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2817 2826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3617 3402 gene locus_tag LOCUS_04800 3617 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 3779 3961 gene locus_tag LOCUS_04810 3779 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4033 4299 gene locus_tag LOCUS_04820 4033 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 4286 4816 gene locus_tag LOCUS_04830 4286 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 5547 4780 gene locus_tag LOCUS_04840 5547 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 7062 6853 gene locus_tag LOCUS_04850 7062 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7532 7092 gene locus_tag LOCUS_04860 7532 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 7825 7529 gene locus_tag LOCUS_04870 7825 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 8546 7935 gene locus_tag LOCUS_04880 8546 7935 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001268842.1 protein_id gnl|my_center|LOCUS_04880 9055 9351 gene locus_tag LOCUS_04890 9055 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 9488 10030 gene locus_tag LOCUS_04900 gene yfcE 9488 10030 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_04900 10063 11214 gene locus_tag LOCUS_04910 10063 11214 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423769.1 protein_id gnl|my_center|LOCUS_04910 11211 12596 gene locus_tag LOCUS_04920 11211 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 12647 13276 gene locus_tag LOCUS_04930 12647 13276 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357527.1 protein_id gnl|my_center|LOCUS_04930 13254 13733 gene locus_tag LOCUS_04940 13254 13733 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_04940 14139 14214 gene locus_tag LOCUS_t00130 14139 14214 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14255 14325 gene locus_tag LOCUS_t00140 14255 14325 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15281 14676 gene locus_tag LOCUS_04950 gene thrH 15281 14676 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence023 1545 55 gene locus_tag LOCUS_04960 1545 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 1804 1947 gene locus_tag LOCUS_04970 1804 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 2097 4748 gene locus_tag LOCUS_04980 2097 4748 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_04980 4856 8248 gene locus_tag LOCUS_04990 gene addB 4856 8248 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_04990 8248 8859 gene locus_tag LOCUS_05000 8248 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05000 8778 8787 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8880 11879 gene locus_tag LOCUS_05010 gene addA 8880 11879 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965560.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05010 12041 15121 gene locus_tag LOCUS_05020 12041 15121 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106612643.1 protein_id gnl|my_center|LOCUS_05020 15111 16292 gene locus_tag LOCUS_05030 15111 16292 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272338.1 protein_id gnl|my_center|LOCUS_05030 16294 17205 gene locus_tag LOCUS_05040 gene murB 16294 17205 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence024 513 319 gene locus_tag LOCUS_05050 513 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2890 869 gene locus_tag LOCUS_05060 gene glgB 2890 869 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_05060 4324 2975 gene locus_tag LOCUS_05070 4324 2975 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_05070 4917 4342 gene locus_tag LOCUS_05080 4917 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 6255 4930 gene locus_tag LOCUS_05090 gene larC 6255 4930 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947957.1 protein_id gnl|my_center|LOCUS_05090 7000 6248 gene locus_tag LOCUS_05100 gene larB 7000 6248 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_05100 7544 7017 gene locus_tag LOCUS_05110 7544 7017 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130536.1 protein_id gnl|my_center|LOCUS_05110 8527 7565 gene locus_tag LOCUS_05120 8527 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 13885 8792 gene locus_tag LOCUS_05130 13885 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 15537 13978 gene locus_tag LOCUS_05140 15537 13978 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_05140 16040 16492 gene locus_tag LOCUS_05150 16040 16492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911276.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence025 826 1548 gene locus_tag LOCUS_05160 826 1548 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422086.1 protein_id gnl|my_center|LOCUS_05160 1655 2161 gene locus_tag LOCUS_05170 gene cobO 1655 2161 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_05170 2724 3617 gene locus_tag LOCUS_05180 gene dapA 2724 3617 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_05180 3697 4461 gene locus_tag LOCUS_05190 gene dapB 3697 4461 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965675.1 protein_id gnl|my_center|LOCUS_05190 4571 5410 gene locus_tag LOCUS_05200 4571 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5653 6153 gene locus_tag LOCUS_05210 5653 6153 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_05210 6160 6654 gene locus_tag LOCUS_05220 gene ybaK 6160 6654 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_05220 6763 9726 gene locus_tag LOCUS_05230 6763 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 9971 10150 gene locus_tag LOCUS_05240 9971 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 10246 12123 gene locus_tag LOCUS_05250 10246 12123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 12078 12087 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence026 <1 865 gene locus_tag LOCUS_05260 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963366.1:AAA family ATPase 872 2122 gene locus_tag LOCUS_05270 872 2122 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_05270 2163 2900 gene locus_tag LOCUS_05280 2163 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2890 4239 gene locus_tag LOCUS_05290 2890 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4278 4445 gene locus_tag LOCUS_05300 4278 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4639 6210 gene locus_tag LOCUS_05310 4639 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 6407 7063 gene locus_tag LOCUS_05320 6407 7063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 7072 7494 gene locus_tag LOCUS_05330 7072 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 7518 7934 gene locus_tag LOCUS_05340 7518 7934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 7939 9387 gene locus_tag LOCUS_05350 7939 9387 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963728.1 protein_id gnl|my_center|LOCUS_05350 9627 10256 gene locus_tag LOCUS_05360 9627 10256 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254484.1 protein_id gnl|my_center|LOCUS_05360 10944 10207 gene locus_tag LOCUS_05370 10944 10207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 11244 11651 gene locus_tag LOCUS_05380 11244 11651 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233231.1 protein_id gnl|my_center|LOCUS_05380 11689 12210 gene locus_tag LOCUS_05390 11689 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 13280 12207 gene locus_tag LOCUS_05400 13280 12207 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_05400 13489 14418 gene locus_tag LOCUS_05410 13489 14418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 14491 15012 gene locus_tag LOCUS_05420 14491 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence027 <1 544 gene locus_tag LOCUS_05430 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963821.1:S41 family peptidase 534 1367 gene locus_tag LOCUS_05440 534 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05440 1581 1955 gene locus_tag LOCUS_05450 1581 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 2062 3474 gene locus_tag LOCUS_05460 gene rho 2062 3474 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898714.1 protein_id gnl|my_center|LOCUS_05460 3657 3857 gene locus_tag LOCUS_05470 gene rpmE 3657 3857 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_05470 4066 4977 gene locus_tag LOCUS_05480 4066 4977 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_05480 4974 5858 gene locus_tag LOCUS_05490 4974 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 5851 6924 gene locus_tag LOCUS_05500 gene prfA 5851 6924 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_05500 6964 8310 gene locus_tag LOCUS_05510 gene glmM 6964 8310 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521474.1 protein_id gnl|my_center|LOCUS_05510 8378 9277 gene locus_tag LOCUS_05520 8378 9277 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054703570.1 protein_id gnl|my_center|LOCUS_05520 9282 10466 gene locus_tag LOCUS_05530 9282 10466 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459580.1 protein_id gnl|my_center|LOCUS_05530 10492 11556 gene locus_tag LOCUS_05540 gene hisC 10492 11556 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_05540 11573 12355 gene locus_tag LOCUS_05550 11573 12355 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_05550 12352 13236 gene locus_tag LOCUS_05560 gene hslO 12352 13236 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence028 1235 321 gene locus_tag LOCUS_05570 1235 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3010 1232 gene locus_tag LOCUS_05580 3010 1232 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836931.1 protein_id gnl|my_center|LOCUS_05580 1358 1367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4630 3023 gene locus_tag LOCUS_05590 4630 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 6152 4653 gene locus_tag LOCUS_05600 gene rsmF 6152 4653 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_05600 9605 6186 gene locus_tag LOCUS_05610 9605 6186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_05610 10335 9610 gene locus_tag LOCUS_05620 10335 9610 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_05620 11032 10313 gene locus_tag LOCUS_05630 11032 10313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 11499 11029 gene locus_tag LOCUS_05640 11499 11029 CDS product DUF3990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803082.1 protein_id gnl|my_center|LOCUS_05640 11732 11496 gene locus_tag LOCUS_05650 11732 11496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 11942 11760 gene locus_tag LOCUS_05660 11942 11760 CDS product DUF6440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895603.1 protein_id gnl|my_center|LOCUS_05660 12625 12008 gene locus_tag LOCUS_05670 12625 12008 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_05670 13102 12707 gene locus_tag LOCUS_05680 13102 12707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 13433 13191 gene locus_tag LOCUS_05690 13433 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05690 13619 13458 gene locus_tag LOCUS_05700 13619 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 13977 13609 gene locus_tag LOCUS_05710 13977 13609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 14475 14155 gene locus_tag LOCUS_05720 14475 14155 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004612621.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence029 568 41 gene locus_tag LOCUS_05730 568 41 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_05730 974 1945 gene locus_tag LOCUS_05740 gene bioB 974 1945 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920732.1 protein_id gnl|my_center|LOCUS_05740 2068 2613 gene locus_tag LOCUS_05750 2068 2613 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_05750 3207 2623 gene locus_tag LOCUS_05760 3207 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 9749 3279 gene locus_tag LOCUS_05770 9749 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence030 3818 297 gene locus_tag LOCUS_05780 gene mfd 3818 297 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_05780 4577 3849 gene locus_tag LOCUS_05790 gene pth 4577 3849 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_05790 6001 4583 gene locus_tag LOCUS_05800 6001 4583 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_05800 6677 5982 gene locus_tag LOCUS_05810 6677 5982 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814243.1 protein_id gnl|my_center|LOCUS_05810 8029 6911 gene locus_tag LOCUS_05820 gene glgD 8029 6911 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_05820 9300 8026 gene locus_tag LOCUS_05830 9300 8026 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082942.1 protein_id gnl|my_center|LOCUS_05830 9345 9354 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9619 10998 gene locus_tag LOCUS_05840 gene murC 9619 10998 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_05840 11208 12311 gene locus_tag LOCUS_05850 11208 12311 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132280311.1 protein_id gnl|my_center|LOCUS_05850 12322 13320 gene locus_tag LOCUS_05860 12322 13320 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence031 1376 1020 gene locus_tag LOCUS_05870 1376 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2715 1645 gene locus_tag LOCUS_05880 gene mglC 2715 1645 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275118.1 protein_id gnl|my_center|LOCUS_05880 4226 2730 gene locus_tag LOCUS_05890 gene mglA 4226 2730 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707761.1 protein_id gnl|my_center|LOCUS_05890 5590 4364 gene locus_tag LOCUS_05900 gene mglB 5590 4364 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816741.1 protein_id gnl|my_center|LOCUS_05900 6771 5752 gene locus_tag LOCUS_05910 6771 5752 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_05910 8485 6758 gene locus_tag LOCUS_05920 8485 6758 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272760.1 protein_id gnl|my_center|LOCUS_05920 10073 8469 gene locus_tag LOCUS_05930 10073 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 10786 10172 gene locus_tag LOCUS_05940 10786 10172 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_05940 11635 10802 gene locus_tag LOCUS_05950 11635 10802 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428191.1 protein_id gnl|my_center|LOCUS_05950 12187 11648 gene locus_tag LOCUS_05960 12187 11648 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869997.1 protein_id gnl|my_center|LOCUS_05960 <14116 12344 gene locus_tag LOCUS_05970 <14116 12344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000631786.1:transglutaminaseTgpA domain-containing protein >Feature sequence032 186 425 gene locus_tag LOCUS_05980 186 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 500 715 gene locus_tag LOCUS_05990 500 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 808 5484 gene locus_tag LOCUS_06000 808 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5798 6232 gene locus_tag LOCUS_06010 5798 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 6413 7942 gene locus_tag LOCUS_06020 6413 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 7911 9101 gene locus_tag LOCUS_06030 7911 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 9138 9437 gene locus_tag LOCUS_06040 9138 9437 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476650.1 protein_id gnl|my_center|LOCUS_06040 9615 11831 gene locus_tag LOCUS_06050 9615 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 11945 12484 gene locus_tag LOCUS_06060 11945 12484 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976227.1 protein_id gnl|my_center|LOCUS_06060 12634 13338 gene locus_tag LOCUS_06070 12634 13338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 13465 13875 gene locus_tag LOCUS_06080 13465 13875 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence033 294 1028 gene locus_tag LOCUS_06090 gene cobJ 294 1028 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_06090 1021 3066 gene locus_tag LOCUS_06100 1021 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3063 4484 gene locus_tag LOCUS_06110 3063 4484 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948610.1 protein_id gnl|my_center|LOCUS_06110 4481 5464 gene locus_tag LOCUS_06120 gene cbiB 4481 5464 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898268.1 protein_id gnl|my_center|LOCUS_06120 5485 6573 gene locus_tag LOCUS_06130 gene cobD 5485 6573 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_06130 6561 8090 gene locus_tag LOCUS_06140 6561 8090 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437761.1 protein_id gnl|my_center|LOCUS_06140 8080 8706 gene locus_tag LOCUS_06150 8080 8706 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_06150 8761 9552 gene locus_tag LOCUS_06160 8761 9552 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926849.1 protein_id gnl|my_center|LOCUS_06160 9549 9875 gene locus_tag LOCUS_06170 9549 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 10760 9921 gene locus_tag LOCUS_06180 10760 9921 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392733.1 protein_id gnl|my_center|LOCUS_06180 11574 10780 gene locus_tag LOCUS_06190 gene cbiQ 11574 10780 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496721.1 protein_id gnl|my_center|LOCUS_06190 12377 11586 gene locus_tag LOCUS_06200 12377 11586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 12585 13853 gene locus_tag LOCUS_06210 gene hemA 12585 13853 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392764.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence034 92 862 gene locus_tag LOCUS_06220 92 862 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_06220 876 1739 gene locus_tag LOCUS_06230 gene rsmA 876 1739 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226751.1 protein_id gnl|my_center|LOCUS_06230 1895 2791 gene locus_tag LOCUS_06240 1895 2791 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967658.1 protein_id gnl|my_center|LOCUS_06240 2833 7725 gene locus_tag LOCUS_06250 2833 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7793 8485 gene locus_tag LOCUS_06260 7793 8485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 8574 9890 gene locus_tag LOCUS_06270 8574 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 10453 9941 gene locus_tag LOCUS_06280 10453 9941 CDS product DUF4364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965681.1 protein_id gnl|my_center|LOCUS_06280 11459 10521 gene locus_tag LOCUS_06290 11459 10521 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_06290 11654 12931 gene locus_tag LOCUS_06300 11654 12931 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861243.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence035 1473 1030 gene locus_tag LOCUS_06310 gene nifU 1473 1030 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272433.1 protein_id gnl|my_center|LOCUS_06310 2763 1579 gene locus_tag LOCUS_06320 gene nifS 2763 1579 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_06320 3293 2796 gene locus_tag LOCUS_06330 3293 2796 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_06330 3481 3290 gene locus_tag LOCUS_06340 3481 3290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3467 4777 gene locus_tag LOCUS_06350 gene spoVB 3467 4777 CDS product stage V sporulation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964335.1 protein_id gnl|my_center|LOCUS_06350 4897 5082 gene locus_tag LOCUS_06360 4897 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815107.1 protein_id gnl|my_center|LOCUS_06360 5099 5350 gene locus_tag LOCUS_06370 5099 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 5512 6216 gene locus_tag LOCUS_06380 5512 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 7769 6324 gene locus_tag LOCUS_06390 gene glgA 7769 6324 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_06390 8703 7906 gene locus_tag LOCUS_06400 gene spo0A 8703 7906 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_06400 10127 8889 gene locus_tag LOCUS_06410 gene spoIVB 10127 8889 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_06410 11138 10203 gene locus_tag LOCUS_06420 11138 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06420 11905 11114 gene locus_tag LOCUS_06430 11905 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06430 11248 11257 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12394 11924 gene locus_tag LOCUS_06440 12394 11924 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_06440 13271 12408 gene locus_tag LOCUS_06450 13271 12408 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence036 1044 301 gene locus_tag LOCUS_06460 gene nagB 1044 301 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_06460 1691 1071 gene locus_tag LOCUS_06470 1691 1071 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160069703.1 protein_id gnl|my_center|LOCUS_06470 3266 1788 gene locus_tag LOCUS_06480 gene nagE 3266 1788 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705424.1 protein_id gnl|my_center|LOCUS_06480 2757 2766 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4147 3293 gene locus_tag LOCUS_06490 4147 3293 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948570.1 protein_id gnl|my_center|LOCUS_06490 5935 4556 gene locus_tag LOCUS_06500 5935 4556 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_06500 6602 6036 gene locus_tag LOCUS_06510 6602 6036 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963355.1 protein_id gnl|my_center|LOCUS_06510 7653 6766 gene locus_tag LOCUS_06520 7653 6766 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_06520 7949 9355 gene locus_tag LOCUS_06530 7949 9355 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016013.1 protein_id gnl|my_center|LOCUS_06530 9389 9715 gene locus_tag LOCUS_06540 9389 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06540 9712 11277 gene locus_tag LOCUS_06550 9712 11277 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06550 11478 12887 gene locus_tag LOCUS_06560 11478 12887 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764741.1 protein_id gnl|my_center|LOCUS_06560 13465 13148 gene locus_tag LOCUS_06570 13465 13148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence037 4056 1927 gene locus_tag LOCUS_06580 4056 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 4242 5828 gene locus_tag LOCUS_06590 4242 5828 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_06590 6019 6687 gene locus_tag LOCUS_06600 6019 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06600 6654 6663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6684 7334 gene locus_tag LOCUS_06610 6684 7334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06610 8686 7508 gene locus_tag LOCUS_06620 8686 7508 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_06620 10429 8840 gene locus_tag LOCUS_06630 10429 8840 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_06630 11010 11660 gene locus_tag LOCUS_06640 11010 11660 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964200.1 protein_id gnl|my_center|LOCUS_06640 12032 11778 gene locus_tag LOCUS_06650 12032 11778 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394408.1 protein_id gnl|my_center|LOCUS_06650 13227 12421 gene locus_tag LOCUS_06660 13227 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence038 1667 270 gene locus_tag LOCUS_06670 gene pabB 1667 270 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015796.1 protein_id gnl|my_center|LOCUS_06670 2265 1660 gene locus_tag LOCUS_06680 2265 1660 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015797.1 protein_id gnl|my_center|LOCUS_06680 2706 4223 gene locus_tag LOCUS_06690 gene malQ 2706 4223 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_06690 4220 4960 gene locus_tag LOCUS_06700 4220 4960 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948182.1 protein_id gnl|my_center|LOCUS_06700 6407 5037 gene locus_tag LOCUS_06710 6407 5037 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965427.1 protein_id gnl|my_center|LOCUS_06710 7453 6431 gene locus_tag LOCUS_06720 7453 6431 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562759.1 protein_id gnl|my_center|LOCUS_06720 9051 7507 gene locus_tag LOCUS_06730 9051 7507 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_06730 9281 9096 gene locus_tag LOCUS_06740 9281 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 10222 9455 gene locus_tag LOCUS_06750 10222 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10900 10337 gene locus_tag LOCUS_06760 10900 10337 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434848.1 protein_id gnl|my_center|LOCUS_06760 12172 10910 gene locus_tag LOCUS_06770 12172 10910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 12725 12183 gene locus_tag LOCUS_06780 12725 12183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 13232 12882 gene locus_tag LOCUS_06790 13232 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence039 3332 447 gene locus_tag LOCUS_06800 3332 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 8326 3641 gene locus_tag LOCUS_06810 8326 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 9540 8587 gene locus_tag LOCUS_06820 9540 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 8640 8649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10460 9537 gene locus_tag LOCUS_06830 10460 9537 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_06830 10593 10453 gene locus_tag LOCUS_06840 10593 10453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 10696 11376 gene locus_tag LOCUS_06850 10696 11376 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_06850 11373 12545 gene locus_tag LOCUS_06860 11373 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 12631 13215 gene locus_tag LOCUS_06870 12631 13215 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence040 1838 1041 gene locus_tag LOCUS_06880 gene srtB 1838 1041 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989918.1 protein_id gnl|my_center|LOCUS_06880 2296 1835 gene locus_tag LOCUS_06890 2296 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 8660 2331 gene locus_tag LOCUS_06900 8660 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 9705 8746 gene locus_tag LOCUS_06910 9705 8746 CDS product amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461907.1 protein_id gnl|my_center|LOCUS_06910 11045 9702 gene locus_tag LOCUS_06920 gene dcm 11045 9702 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210977.1 protein_id gnl|my_center|LOCUS_06920 11651 11079 gene locus_tag LOCUS_06930 11651 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 12163 11870 gene locus_tag LOCUS_06940 12163 11870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 12963 12151 gene locus_tag LOCUS_06950 12963 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence041 43 2526 gene locus_tag LOCUS_06960 43 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3010 3912 gene locus_tag LOCUS_06970 gene pfkB 3010 3912 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986316.1 protein_id gnl|my_center|LOCUS_06970 4035 5945 gene locus_tag LOCUS_06980 4035 5945 CDS product PTS fructose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897443.1 protein_id gnl|my_center|LOCUS_06980 6076 6867 gene locus_tag LOCUS_06990 6076 6867 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709193.1 protein_id gnl|my_center|LOCUS_06990 6984 7931 gene locus_tag LOCUS_07000 6984 7931 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_07000 8003 8992 gene locus_tag LOCUS_07010 gene argF 8003 8992 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_07010 8999 9268 gene locus_tag LOCUS_07020 8999 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 9471 10442 gene locus_tag LOCUS_07030 9471 10442 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948775.1 protein_id gnl|my_center|LOCUS_07030 10540 10890 gene locus_tag LOCUS_07040 10540 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 10880 11935 gene locus_tag LOCUS_07050 gene dusB 10880 11935 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_07050 11153 11162 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <13154 12355 gene locus_tag LOCUS_07060 <13154 12355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966472.1:glycine--tRNA ligase >Feature sequence042 589 912 gene locus_tag LOCUS_07070 589 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1055 1432 gene locus_tag LOCUS_07080 1055 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1559 1867 gene locus_tag LOCUS_07090 1559 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1871 3160 gene locus_tag LOCUS_07100 1871 3160 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102364993.1 protein_id gnl|my_center|LOCUS_07100 3166 4002 gene locus_tag LOCUS_07110 3166 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 4006 4944 gene locus_tag LOCUS_07120 4006 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5041 5355 gene locus_tag LOCUS_07130 5041 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5473 5637 gene locus_tag LOCUS_07140 5473 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5661 7394 gene locus_tag LOCUS_07150 5661 7394 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861117.1 protein_id gnl|my_center|LOCUS_07150 7409 7768 gene locus_tag LOCUS_07160 7409 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 7843 8682 gene locus_tag LOCUS_07170 7843 8682 CDS product CD0415/CD1112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426087.1 protein_id gnl|my_center|LOCUS_07170 8694 9125 gene locus_tag LOCUS_07180 8694 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 9134 9568 gene locus_tag LOCUS_07190 9134 9568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 9555 11891 gene locus_tag LOCUS_07200 9555 11891 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010773627.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence043 117 608 gene locus_tag LOCUS_07210 gene mog 117 608 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986482.1 protein_id gnl|my_center|LOCUS_07210 635 1669 gene locus_tag LOCUS_07220 635 1669 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_07220 1673 2653 gene locus_tag LOCUS_07230 gene moaA 1673 2653 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002371204.1 protein_id gnl|my_center|LOCUS_07230 2671 4245 gene locus_tag LOCUS_07240 2671 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4242 4361 gene locus_tag LOCUS_07250 4242 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4375 5220 gene locus_tag LOCUS_07260 gene modA 4375 5220 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243706.1 protein_id gnl|my_center|LOCUS_07260 5230 5955 gene locus_tag LOCUS_07270 gene modB 5230 5955 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_07270 5912 6970 gene locus_tag LOCUS_07280 5912 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 6983 8158 gene locus_tag LOCUS_07290 6983 8158 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434244.1 protein_id gnl|my_center|LOCUS_07290 8160 9188 gene locus_tag LOCUS_07300 gene selD 8160 9188 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462047.1 protein_id gnl|my_center|LOCUS_07300 9201 9824 gene locus_tag LOCUS_07310 gene yedF 9201 9824 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462046.1 protein_id gnl|my_center|LOCUS_07310 9826 10065 gene locus_tag LOCUS_07320 9826 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10186 11523 gene locus_tag LOCUS_07330 10186 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 10967 10976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence044 937 1134 gene locus_tag LOCUS_07340 937 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1782 5360 gene locus_tag LOCUS_07350 1782 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07350 5305 6498 gene locus_tag LOCUS_07360 5305 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5331 5340 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6717 8462 gene locus_tag LOCUS_07370 6717 8462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_07370 8459 10186 gene locus_tag LOCUS_07380 8459 10186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_07380 10498 11019 gene locus_tag LOCUS_07390 10498 11019 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897366.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence045 137 973 gene locus_tag LOCUS_07400 137 973 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_07400 1513 992 gene locus_tag LOCUS_07410 1513 992 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_07410 1682 1852 gene locus_tag LOCUS_07420 1682 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2044 2649 gene locus_tag LOCUS_07430 2044 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2749 3327 gene locus_tag LOCUS_07440 2749 3327 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_07440 3404 6157 gene locus_tag LOCUS_07450 3404 6157 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_07450 6238 7950 gene locus_tag LOCUS_07460 6238 7950 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_07460 7928 8113 gene locus_tag LOCUS_07470 7928 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 8169 10109 gene locus_tag LOCUS_07480 8169 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 10721 10221 gene locus_tag LOCUS_07490 10721 10221 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_07490 11104 11337 gene locus_tag LOCUS_07500 11104 11337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 11327 11704 gene locus_tag LOCUS_07510 11327 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 11709 12428 gene locus_tag LOCUS_07520 11709 12428 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356899.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence046 1721 930 gene locus_tag LOCUS_07530 1721 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2472 1915 gene locus_tag LOCUS_07540 gene efp 2472 1915 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_07540 3660 2593 gene locus_tag LOCUS_07550 gene papA 3660 2593 CDS product aminopeptidase PapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230224.1 protein_id gnl|my_center|LOCUS_07550 4199 3657 gene locus_tag LOCUS_07560 4199 3657 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_07560 5085 4234 gene locus_tag LOCUS_07570 5085 4234 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767761.1 protein_id gnl|my_center|LOCUS_07570 5658 5278 gene locus_tag LOCUS_07580 5658 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7107 5725 gene locus_tag LOCUS_07590 7107 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 8042 7119 gene locus_tag LOCUS_07600 8042 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 9521 8067 gene locus_tag LOCUS_07610 9521 8067 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_07610 10899 9532 gene locus_tag LOCUS_07620 gene trkA 10899 9532 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_07620 11448 11026 gene locus_tag LOCUS_07630 11448 11026 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932326.1 protein_id gnl|my_center|LOCUS_07630 <12498 11517 gene locus_tag LOCUS_07640 <12498 11517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860860.1:sensor histidine kinase >Feature sequence047 477 1133 gene locus_tag LOCUS_07650 477 1133 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357915.1 protein_id gnl|my_center|LOCUS_07650 1561 1190 gene locus_tag LOCUS_07660 1561 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 7736 1746 gene locus_tag LOCUS_07670 7736 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 8656 7832 gene locus_tag LOCUS_07680 8656 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 10511 8634 gene locus_tag LOCUS_07690 10511 8634 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942801.1 protein_id gnl|my_center|LOCUS_07690 12084 10483 gene locus_tag LOCUS_07700 12084 10483 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714962.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence048 62 286 gene locus_tag LOCUS_07710 62 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 696 1436 gene locus_tag LOCUS_07720 gene cas6 696 1436 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 protein_id gnl|my_center|LOCUS_07720 1429 3810 gene locus_tag LOCUS_07730 gene cas10 1429 3810 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900580.1 protein_id gnl|my_center|LOCUS_07730 3797 4201 gene locus_tag LOCUS_07740 3797 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4214 4879 gene locus_tag LOCUS_07750 gene csm3 4214 4879 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414292.1 protein_id gnl|my_center|LOCUS_07750 4892 5818 gene locus_tag LOCUS_07760 gene csm4 4892 5818 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837016.1 protein_id gnl|my_center|LOCUS_07760 5815 6939 gene locus_tag LOCUS_07770 gene csm5 5815 6939 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414285.1 protein_id gnl|my_center|LOCUS_07770 7120 7722 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attaagaaatatagctccccgagaggggacggaaac 7801 8802 gene locus_tag LOCUS_07780 gene cas1 7801 8802 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414279.1 protein_id gnl|my_center|LOCUS_07780 8756 9121 gene locus_tag LOCUS_07790 8756 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 9141 10457 gene locus_tag LOCUS_07800 gene csm6 9141 10457 CDS product type III-A CRISPR-associated CARF protein Csm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899494.1 protein_id gnl|my_center|LOCUS_07800 <12411 10543 gene locus_tag LOCUS_07810 <12411 10543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810412.1:ferrous iron transport protein B >Feature sequence049 2713 1511 gene locus_tag LOCUS_07820 2713 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 4205 2748 gene locus_tag LOCUS_07830 4205 2748 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296829.1 protein_id gnl|my_center|LOCUS_07830 4470 4982 gene locus_tag LOCUS_07840 4470 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5451 5026 gene locus_tag LOCUS_07850 5451 5026 CDS product DUF1934 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966177.1 protein_id gnl|my_center|LOCUS_07850 6273 5452 gene locus_tag LOCUS_07860 gene murI 6273 5452 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_07860 6996 6349 gene locus_tag LOCUS_07870 6996 6349 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303217.1 protein_id gnl|my_center|LOCUS_07870 7493 10279 gene locus_tag LOCUS_07880 7493 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 11391 10459 gene locus_tag LOCUS_07890 11391 10459 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_07890 <12233 11388 gene locus_tag LOCUS_07900 <12233 11388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416935.1:HPr(Ser) kinase/phosphatase >Feature sequence050 <1 2422 gene locus_tag LOCUS_07910 <1 2422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986885.1:alanine--tRNA ligase 2561 2737 gene locus_tag LOCUS_07920 gene rpsU 2561 2737 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_07920 2926 4107 gene locus_tag LOCUS_07930 gene dacF 2926 4107 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_07930 4346 5134 gene locus_tag LOCUS_07940 4346 5134 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_07940 5139 5900 gene locus_tag LOCUS_07950 5139 5900 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_07950 5854 6438 gene locus_tag LOCUS_07960 gene scpB 5854 6438 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428258.1 protein_id gnl|my_center|LOCUS_07960 6497 7282 gene locus_tag LOCUS_07970 6497 7282 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678767.1 protein_id gnl|my_center|LOCUS_07970 7379 8593 gene locus_tag LOCUS_07980 7379 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 8885 10318 gene locus_tag LOCUS_07990 8885 10318 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_07990 10333 11079 gene locus_tag LOCUS_08000 10333 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 11094 11462 gene locus_tag LOCUS_08010 11094 11462 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence051 1195 575 gene locus_tag LOCUS_08020 1195 575 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_08020 2123 1188 gene locus_tag LOCUS_08030 2123 1188 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_08030 3463 2120 gene locus_tag LOCUS_08040 gene rsxC 3463 2120 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_08040 4430 3537 gene locus_tag LOCUS_08050 4430 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 4622 5779 gene locus_tag LOCUS_08060 4622 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6428 5709 gene locus_tag LOCUS_08070 6428 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08070 6807 6382 gene locus_tag LOCUS_08080 6807 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08080 6465 6474 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7640 6795 gene locus_tag LOCUS_08090 7640 6795 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439450.1 protein_id gnl|my_center|LOCUS_08090 8308 7637 gene locus_tag LOCUS_08100 gene cmk 8308 7637 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565355.1 protein_id gnl|my_center|LOCUS_08100 9570 8329 gene locus_tag LOCUS_08110 9570 8329 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_08110 11976 9586 gene locus_tag LOCUS_08120 11976 9586 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence052 <1 1023 gene locus_tag LOCUS_08130 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948151.1:FAD:protein FMN transferase 1058 2746 gene locus_tag LOCUS_08140 1058 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2765 3262 gene locus_tag LOCUS_08150 2765 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 3266 4129 gene locus_tag LOCUS_08160 3266 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4242 5981 gene locus_tag LOCUS_08170 4242 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 6053 6134 gene locus_tag LOCUS_t00150 6053 6134 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6449 8143 gene locus_tag LOCUS_08180 6449 8143 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_08180 8300 9067 gene locus_tag LOCUS_08190 8300 9067 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964820.1 protein_id gnl|my_center|LOCUS_08190 9306 10433 gene locus_tag LOCUS_08200 9306 10433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 10635 11963 gene locus_tag LOCUS_08210 10635 11963 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401829.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence053 1058 1067 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3770 1326 gene locus_tag LOCUS_08220 3770 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 4205 4062 gene locus_tag LOCUS_08230 4205 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4828 4442 gene locus_tag LOCUS_08240 4828 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6922 4904 gene locus_tag LOCUS_08250 6922 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7380 6979 gene locus_tag LOCUS_08260 7380 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 8764 7463 gene locus_tag LOCUS_08270 8764 7463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 10037 8754 gene locus_tag LOCUS_08280 10037 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 10530 10018 gene locus_tag LOCUS_08290 10530 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 10518 11096 gene locus_tag LOCUS_08300 10518 11096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 11900 11259 gene locus_tag LOCUS_08310 11900 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence054 739 119 gene locus_tag LOCUS_08320 gene rplD 739 119 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_08320 1401 766 gene locus_tag LOCUS_08330 gene rplC 1401 766 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966412.1 protein_id gnl|my_center|LOCUS_08330 1852 1532 gene locus_tag LOCUS_08340 gene rpsJ 1852 1532 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860633.1 protein_id gnl|my_center|LOCUS_08340 3434 2178 gene locus_tag LOCUS_08350 3434 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 5290 3413 gene locus_tag LOCUS_08360 5290 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 6220 5531 gene locus_tag LOCUS_08370 6220 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 11900 6633 gene locus_tag LOCUS_08380 11900 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence055 <1 1675 gene locus_tag LOCUS_08390 <1 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082478.1:beta-glucosidase 3168 1780 gene locus_tag LOCUS_08400 3168 1780 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_08400 3615 4355 gene locus_tag LOCUS_08410 3615 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 4481 5467 gene locus_tag LOCUS_08420 4481 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 6756 5776 gene locus_tag LOCUS_08430 gene bsh 6756 5776 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_08430 7473 6823 gene locus_tag LOCUS_08440 7473 6823 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_08440 7797 8390 gene locus_tag LOCUS_08450 7797 8390 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546635.1 protein_id gnl|my_center|LOCUS_08450 8408 8608 gene locus_tag LOCUS_08460 8408 8608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 8752 9189 gene locus_tag LOCUS_08470 8752 9189 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475872.1 protein_id gnl|my_center|LOCUS_08470 9196 10359 gene locus_tag LOCUS_08480 gene rlmD 9196 10359 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_08480 10664 11224 gene locus_tag LOCUS_08490 10664 11224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 11263 11937 gene locus_tag LOCUS_08500 11263 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence056 2455 1361 gene locus_tag LOCUS_08510 2455 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4063 2471 gene locus_tag LOCUS_08520 4063 2471 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473139.1 protein_id gnl|my_center|LOCUS_08520 4856 4077 gene locus_tag LOCUS_08530 4856 4077 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393477.1 protein_id gnl|my_center|LOCUS_08530 5620 4853 gene locus_tag LOCUS_08540 5620 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6585 5656 gene locus_tag LOCUS_08550 6585 5656 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339083.1 protein_id gnl|my_center|LOCUS_08550 6691 6539 gene locus_tag LOCUS_08560 6691 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 9086 6990 gene locus_tag LOCUS_08570 9086 6990 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_08570 9588 9160 gene locus_tag LOCUS_08580 9588 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 10242 9688 gene locus_tag LOCUS_08590 10242 9688 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_08590 <11648 10441 gene locus_tag LOCUS_08600 <11648 10441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460956.1:cell wall hydrolase >Feature sequence057 97 2661 gene locus_tag LOCUS_08610 97 2661 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861274.1 protein_id gnl|my_center|LOCUS_08610 364 373 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2877 3950 gene locus_tag LOCUS_08620 2877 3950 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_08620 4049 5698 gene locus_tag LOCUS_08630 gene dnaX 4049 5698 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_08630 5867 6223 gene locus_tag LOCUS_08640 5867 6223 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_08640 6223 6819 gene locus_tag LOCUS_08650 gene recR 6223 6819 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_08650 7440 6856 gene locus_tag LOCUS_08660 gene yyaC 7440 6856 CDS product spore protease YyaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966987.1 protein_id gnl|my_center|LOCUS_08660 7643 8935 gene locus_tag LOCUS_08670 7643 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 9076 10347 gene locus_tag LOCUS_08680 9076 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 10361 11083 gene locus_tag LOCUS_08690 10361 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence058 16 2790 gene locus_tag LOCUS_08700 16 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2889 4127 gene locus_tag LOCUS_08710 2889 4127 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_08710 4255 4404 gene locus_tag LOCUS_08720 4255 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08720 4653 6320 gene locus_tag LOCUS_08730 4653 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 6535 7593 gene locus_tag LOCUS_08740 6535 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 7590 8213 gene locus_tag LOCUS_08750 7590 8213 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804777.1 protein_id gnl|my_center|LOCUS_08750 8217 8447 gene locus_tag LOCUS_08760 8217 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 8374 8757 gene locus_tag LOCUS_08770 8374 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 8788 10152 gene locus_tag LOCUS_08780 8788 10152 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence059 346 1374 gene locus_tag LOCUS_08790 346 1374 CDS product stealth conserved region 3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207631.1 protein_id gnl|my_center|LOCUS_08790 1435 3597 gene locus_tag LOCUS_08800 1435 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3605 4513 gene locus_tag LOCUS_08810 3605 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4533 7010 gene locus_tag LOCUS_08820 4533 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 7014 8849 gene locus_tag LOCUS_08830 7014 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 8867 10330 gene locus_tag LOCUS_08840 gene pelF 8867 10330 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence060 2928 367 gene locus_tag LOCUS_08850 2928 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 6580 3125 gene locus_tag LOCUS_08860 6580 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 7317 6595 gene locus_tag LOCUS_08870 7317 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 8600 8220 gene locus_tag LOCUS_08880 8600 8220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 10081 8774 gene locus_tag LOCUS_08890 10081 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 10382 10137 gene locus_tag LOCUS_08900 10382 10137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 <11220 10369 gene locus_tag LOCUS_08910 <11220 10369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836733.1:M56 family metallopeptidase >Feature sequence061 439 8 gene locus_tag LOCUS_08920 gene mraZ 439 8 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_08920 6509 747 gene locus_tag LOCUS_08930 6509 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 6924 6751 gene locus_tag LOCUS_08940 6924 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 7818 6952 gene locus_tag LOCUS_08950 gene lgt 7818 6952 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_08950 8940 7843 gene locus_tag LOCUS_08960 gene ychF 8940 7843 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_08960 9736 9071 gene locus_tag LOCUS_08970 9736 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 10407 9733 gene locus_tag LOCUS_08980 gene rpe 10407 9733 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_08980 <11170 10413 gene locus_tag LOCUS_08990 <11170 10413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009893669.1:ribosome small subunit-dependent GTPase A >Feature sequence062 1898 942 gene locus_tag LOCUS_09000 1898 942 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_09000 3097 1922 gene locus_tag LOCUS_09010 3097 1922 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467215.1 protein_id gnl|my_center|LOCUS_09010 3976 3113 gene locus_tag LOCUS_09020 3976 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 4224 4003 gene locus_tag LOCUS_09030 4224 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4006 4015 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5173 4229 gene locus_tag LOCUS_09040 5173 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 8747 5187 gene locus_tag LOCUS_09050 gene smc 8747 5187 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_09050 9449 8751 gene locus_tag LOCUS_09060 gene rnc 9449 8751 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_09060 9767 9537 gene locus_tag LOCUS_09070 gene acpP 9767 9537 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_09070 10802 9783 gene locus_tag LOCUS_09080 gene plsX 10802 9783 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence063 <1 1337 gene locus_tag LOCUS_09090 <1 1337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965428.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 1338 3644 gene locus_tag LOCUS_09100 gene priA 1338 3644 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378970.1 protein_id gnl|my_center|LOCUS_09100 3666 4142 gene locus_tag LOCUS_09110 gene def 3666 4142 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_09110 4179 5108 gene locus_tag LOCUS_09120 gene fmt 4179 5108 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_09120 5108 5803 gene locus_tag LOCUS_09130 5108 5803 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287139.1 protein_id gnl|my_center|LOCUS_09130 5796 7142 gene locus_tag LOCUS_09140 gene rsmB 5796 7142 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861607.1 protein_id gnl|my_center|LOCUS_09140 7152 8198 gene locus_tag LOCUS_09150 gene rlmN 7152 8198 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_09150 8203 8946 gene locus_tag LOCUS_09160 8203 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence064 263 272 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 287 1420 gene locus_tag LOCUS_09170 287 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09170 1823 2764 gene locus_tag LOCUS_09180 gene acsD 1823 2764 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432254.1 protein_id gnl|my_center|LOCUS_09180 2792 4135 gene locus_tag LOCUS_09190 gene acsC 2792 4135 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436924.1 protein_id gnl|my_center|LOCUS_09190 4168 4953 gene locus_tag LOCUS_09200 gene acsE 4168 4953 CDS product carbon monoxide dehydrogenase/acetyl-CoA synthase methytransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418356.1 protein_id gnl|my_center|LOCUS_09200 4957 6879 gene locus_tag LOCUS_09210 gene acsV 4957 6879 CDS product corrinoid activation/regeneration protein AcsV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436926.1 protein_id gnl|my_center|LOCUS_09210 6938 8218 gene locus_tag LOCUS_09220 6938 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 8235 9092 gene locus_tag LOCUS_09230 8235 9092 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_09230 9098 9268 gene locus_tag LOCUS_09240 9098 9268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 9199 9208 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9219 9608 gene locus_tag LOCUS_09250 9219 9608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 9720 10055 gene locus_tag LOCUS_09260 9720 10055 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079948.1 protein_id gnl|my_center|LOCUS_09260 <10778 10251 gene locus_tag LOCUS_09270 <10778 10251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_186843528.1:GTP pyrophosphokinase family protein >Feature sequence065 1404 1066 gene locus_tag LOCUS_09280 1404 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2108 1473 gene locus_tag LOCUS_09290 2108 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4148 2139 gene locus_tag LOCUS_09300 4148 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4756 4304 gene locus_tag LOCUS_09310 4756 4304 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416968.1 protein_id gnl|my_center|LOCUS_09310 6415 4850 gene locus_tag LOCUS_09320 6415 4850 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048310.1 protein_id gnl|my_center|LOCUS_09320 7730 6378 gene locus_tag LOCUS_09330 7730 6378 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357478.1 protein_id gnl|my_center|LOCUS_09330 10129 7739 gene locus_tag LOCUS_09340 10129 7739 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965638.1 protein_id gnl|my_center|LOCUS_09340 10653 10255 gene locus_tag LOCUS_09350 10653 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence066 305 685 gene locus_tag LOCUS_09360 305 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 754 1242 gene locus_tag LOCUS_09370 754 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 1261 1743 gene locus_tag LOCUS_09380 1261 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1829 2188 gene locus_tag LOCUS_09390 1829 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2201 2485 gene locus_tag LOCUS_09400 2201 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 4350 2692 gene locus_tag LOCUS_09410 gene hcp 4350 2692 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966037.1 protein_id gnl|my_center|LOCUS_09410 4695 5252 gene locus_tag LOCUS_09420 4695 5252 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_09420 6300 5563 gene locus_tag LOCUS_09430 6300 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 7292 6438 gene locus_tag LOCUS_09440 7292 6438 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082812.1 protein_id gnl|my_center|LOCUS_09440 8206 7403 gene locus_tag LOCUS_09450 8206 7403 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964639.1 protein_id gnl|my_center|LOCUS_09450 9050 9529 gene locus_tag LOCUS_09460 9050 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 9547 10029 gene locus_tag LOCUS_09470 9547 10029 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385459.1 protein_id gnl|my_center|LOCUS_09470 10406 10026 gene locus_tag LOCUS_09480 10406 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence067 108 536 gene locus_tag LOCUS_09490 gene fabZ 108 536 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287621.1 protein_id gnl|my_center|LOCUS_09490 550 1902 gene locus_tag LOCUS_09500 550 1902 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_09500 1915 3636 gene locus_tag LOCUS_09510 1915 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 3637 4701 gene locus_tag LOCUS_09520 3637 4701 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048432.1 protein_id gnl|my_center|LOCUS_09520 4161 4170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4851 6302 gene locus_tag LOCUS_09530 gene gltX 4851 6302 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_09530 6306 8180 gene locus_tag LOCUS_09540 6306 8180 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860946.1 protein_id gnl|my_center|LOCUS_09540 8177 9133 gene locus_tag LOCUS_09550 8177 9133 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434205.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence068 1275 442 gene locus_tag LOCUS_09560 1275 442 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_09560 1823 1272 gene locus_tag LOCUS_09570 1823 1272 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_09570 1977 2423 gene locus_tag LOCUS_09580 1977 2423 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_09580 2642 2430 gene locus_tag LOCUS_09590 2642 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2823 3161 gene locus_tag LOCUS_09600 2823 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3297 3530 gene locus_tag LOCUS_09610 3297 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3661 3993 gene locus_tag LOCUS_09620 3661 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 5026 4085 gene locus_tag LOCUS_09630 gene metA 5026 4085 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_09630 6683 5079 gene locus_tag LOCUS_09640 gene cls 6683 5079 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262851.1 protein_id gnl|my_center|LOCUS_09640 8652 6691 gene locus_tag LOCUS_09650 gene ligA 8652 6691 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_09650 9446 8628 gene locus_tag LOCUS_09660 gene rluF 9446 8628 CDS product 23S rRNA pseudouridine(2604) synthase RluF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963354.1 protein_id gnl|my_center|LOCUS_09660 9987 9520 gene locus_tag LOCUS_09670 9987 9520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence069 657 2336 gene locus_tag LOCUS_09680 657 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2333 4060 gene locus_tag LOCUS_09690 2333 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4057 4812 gene locus_tag LOCUS_09700 4057 4812 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917245.1 protein_id gnl|my_center|LOCUS_09700 4982 6004 gene locus_tag LOCUS_09710 4982 6004 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 protein_id gnl|my_center|LOCUS_09710 6857 6171 gene locus_tag LOCUS_09720 6857 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09720 8328 6847 gene locus_tag LOCUS_09730 8328 6847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 6867 6876 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9499 8474 gene locus_tag LOCUS_09740 9499 8474 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622700.1 protein_id gnl|my_center|LOCUS_09740 10012 9602 gene locus_tag LOCUS_09750 10012 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence070 1181 57 gene locus_tag LOCUS_09760 1181 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2747 1269 gene locus_tag LOCUS_09770 2747 1269 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947970.1 protein_id gnl|my_center|LOCUS_09770 3671 2979 gene locus_tag LOCUS_09780 3671 2979 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_09780 4620 3760 gene locus_tag LOCUS_09790 gene ispE 4620 3760 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_09790 6380 4812 gene locus_tag LOCUS_09800 6380 4812 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_09800 6859 6443 gene locus_tag LOCUS_09810 6859 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 8161 6953 gene locus_tag LOCUS_09820 8161 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 8693 8136 gene locus_tag LOCUS_09830 8693 8136 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_09830 9696 8929 gene locus_tag LOCUS_09840 9696 8929 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015795.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence071 3600 781 gene locus_tag LOCUS_09850 3600 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4197 7340 gene locus_tag LOCUS_09860 gene ileS 4197 7340 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_09860 7353 9812 gene locus_tag LOCUS_09870 7353 9812 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence072 464 922 gene locus_tag LOCUS_09880 464 922 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815471.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09880 857 866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 889 1029 gene locus_tag LOCUS_09890 889 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1067 2581 gene locus_tag LOCUS_09900 gene atpA 1067 2581 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462231.1 protein_id gnl|my_center|LOCUS_09900 2622 3479 gene locus_tag LOCUS_09910 gene atpG 2622 3479 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_09910 3521 4912 gene locus_tag LOCUS_09920 gene atpD 3521 4912 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_09920 4924 5343 gene locus_tag LOCUS_09930 4924 5343 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966148.1 protein_id gnl|my_center|LOCUS_09930 5543 6313 gene locus_tag LOCUS_09940 5543 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 6455 7090 gene locus_tag LOCUS_09950 6455 7090 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903260.1 protein_id gnl|my_center|LOCUS_09950 7295 7669 gene locus_tag LOCUS_09960 7295 7669 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358748.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence073 1556 243 gene locus_tag LOCUS_09970 1556 243 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460409.1 protein_id gnl|my_center|LOCUS_09970 2730 1870 gene locus_tag LOCUS_09980 2730 1870 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_09980 3178 2951 gene locus_tag LOCUS_09990 3178 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 4517 3267 gene locus_tag LOCUS_10000 gene coaBC 4517 3267 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_10000 4760 5392 gene locus_tag LOCUS_10010 4760 5392 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356501.1 protein_id gnl|my_center|LOCUS_10010 5464 6246 gene locus_tag LOCUS_10020 5464 6246 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_10020 6396 6468 gene locus_tag LOCUS_t00160 6396 6468 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7664 6657 gene locus_tag LOCUS_10030 7664 6657 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399225.1 protein_id gnl|my_center|LOCUS_10030 8507 7668 gene locus_tag LOCUS_10040 gene panC 8507 7668 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_10040 9017 8634 gene locus_tag LOCUS_10050 9017 8634 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence074 398 847 gene locus_tag LOCUS_10060 398 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1832 969 gene locus_tag LOCUS_10070 1832 969 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_10070 2699 1875 gene locus_tag LOCUS_10080 2699 1875 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929570.1 protein_id gnl|my_center|LOCUS_10080 2979 3773 gene locus_tag LOCUS_10090 gene proC 2979 3773 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360723.1 protein_id gnl|my_center|LOCUS_10090 3786 5180 gene locus_tag LOCUS_10100 3786 5180 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_10100 5379 7346 gene locus_tag LOCUS_10110 5379 7346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10110 7252 9366 gene locus_tag LOCUS_10120 7252 9366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10120 >Feature sequence075 2583 1819 gene locus_tag LOCUS_10130 gene truA 2583 1819 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986454.1 protein_id gnl|my_center|LOCUS_10130 4358 2976 gene locus_tag LOCUS_10140 4358 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6130 4355 gene locus_tag LOCUS_10150 6130 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 7644 6127 gene locus_tag LOCUS_10160 7644 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 7978 7718 gene locus_tag LOCUS_10170 7978 7718 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219835.1 protein_id gnl|my_center|LOCUS_10170 8939 7971 gene locus_tag LOCUS_10180 gene whiA 8939 7971 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_10180 9724 8951 gene locus_tag LOCUS_10190 gene rapZ 9724 8951 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence076 199 882 gene locus_tag LOCUS_10200 199 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 898 1935 gene locus_tag LOCUS_10210 898 1935 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989953.1 protein_id gnl|my_center|LOCUS_10210 1955 2269 gene locus_tag LOCUS_10220 1955 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2250 2618 gene locus_tag LOCUS_10230 2250 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2615 3112 gene locus_tag LOCUS_10240 2615 3112 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002403769.1 protein_id gnl|my_center|LOCUS_10240 3109 3468 gene locus_tag LOCUS_10250 3109 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3487 3903 gene locus_tag LOCUS_10260 3487 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3917 4363 gene locus_tag LOCUS_10270 3917 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 4426 4722 gene locus_tag LOCUS_10280 4426 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 4754 8632 gene locus_tag LOCUS_10290 4754 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 8684 9049 gene locus_tag LOCUS_10300 8684 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence077 452 1072 gene locus_tag LOCUS_10310 452 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2905 1064 gene locus_tag LOCUS_10320 2905 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5053 3341 gene locus_tag LOCUS_10330 5053 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 6456 5320 gene locus_tag LOCUS_10340 6456 5320 CDS product DUF4317 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964047.1 protein_id gnl|my_center|LOCUS_10340 7115 8554 gene locus_tag LOCUS_10350 gene proS 7115 8554 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040972.1 protein_id gnl|my_center|LOCUS_10350 <9662 8781 gene locus_tag LOCUS_10360 <9662 8781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392748.1:6-phosphofructokinase >Feature sequence078 2887 2084 gene locus_tag LOCUS_10370 2887 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 4840 3161 gene locus_tag LOCUS_10380 4840 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5721 4876 gene locus_tag LOCUS_10390 5721 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 6249 6040 gene locus_tag LOCUS_10400 6249 6040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 6703 6395 gene locus_tag LOCUS_10410 6703 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 7927 6797 gene locus_tag LOCUS_10420 gene tgt 7927 6797 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048086.1 protein_id gnl|my_center|LOCUS_10420 9462 8125 gene locus_tag LOCUS_10430 9462 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence079 86 433 gene locus_tag LOCUS_10440 gene rsfS 86 433 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_10440 1261 638 gene locus_tag LOCUS_10450 gene lexA 1261 638 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238209.1 protein_id gnl|my_center|LOCUS_10450 1551 1919 gene locus_tag LOCUS_10460 1551 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 2022 2252 gene locus_tag LOCUS_10470 2022 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2624 3685 gene locus_tag LOCUS_10480 2624 3685 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_10480 4726 3854 gene locus_tag LOCUS_10490 4726 3854 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_10490 5045 5395 gene locus_tag LOCUS_10500 5045 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5926 5477 gene locus_tag LOCUS_10510 gene dtd 5926 5477 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691419.1 protein_id gnl|my_center|LOCUS_10510 6566 5934 gene locus_tag LOCUS_10520 6566 5934 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_10520 7613 6702 gene locus_tag LOCUS_10530 7613 6702 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_10530 8146 7634 gene locus_tag LOCUS_10540 gene lspA 8146 7634 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000745687.1 protein_id gnl|my_center|LOCUS_10540 9280 8165 gene locus_tag LOCUS_10550 gene aroB 9280 8165 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920845.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence080 1189 326 gene locus_tag LOCUS_10560 1189 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10560 2162 1140 gene locus_tag LOCUS_10570 2162 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10570 1196 1205 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3063 2176 gene locus_tag LOCUS_10580 3063 2176 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_10580 3289 3053 gene locus_tag LOCUS_10590 3289 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4578 3292 gene locus_tag LOCUS_10600 gene xseA 4578 3292 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_10600 5012 4617 gene locus_tag LOCUS_10610 5012 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5498 5115 gene locus_tag LOCUS_10620 5498 5115 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_10620 7165 5576 gene locus_tag LOCUS_10630 7165 5576 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_10630 8325 7333 gene locus_tag LOCUS_10640 8325 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8969 8490 gene locus_tag LOCUS_10650 8969 8490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 8982 8991 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence081 1451 237 gene locus_tag LOCUS_10660 1451 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 264 273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2164 1448 gene locus_tag LOCUS_10670 2164 1448 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854386.1 protein_id gnl|my_center|LOCUS_10670 3356 2232 gene locus_tag LOCUS_10680 3356 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3870 3337 gene locus_tag LOCUS_10690 3870 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4172 5158 gene locus_tag LOCUS_10700 4172 5158 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_10700 7424 5301 gene locus_tag LOCUS_10710 7424 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 8191 7421 gene locus_tag LOCUS_10720 8191 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 <9243 8188 gene locus_tag LOCUS_10730 <9243 8188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897245.1:molybdopterin-dependent oxidoreductase >Feature sequence082 2109 256 gene locus_tag LOCUS_10740 gene ftsH 2109 256 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_10740 2893 2204 gene locus_tag LOCUS_10750 2893 2204 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_10750 4376 2865 gene locus_tag LOCUS_10760 4376 2865 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_10760 4697 4518 gene locus_tag LOCUS_10770 4697 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 4807 4625 gene locus_tag LOCUS_10780 4807 4625 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_10780 5577 4864 gene locus_tag LOCUS_10790 5577 4864 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_10790 6419 5628 gene locus_tag LOCUS_10800 gene srtB 6419 5628 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_10800 7577 6420 gene locus_tag LOCUS_10810 7577 6420 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 protein_id gnl|my_center|LOCUS_10810 8262 7567 gene locus_tag LOCUS_10820 gene vanR 8262 7567 CDS product vancomycin resistance response regulator transcription factor VanR-I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461303.1 protein_id gnl|my_center|LOCUS_10820 <9188 8437 gene locus_tag LOCUS_10830 <9188 8437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462263.1:asparagine--tRNA ligase >Feature sequence083 47 835 gene locus_tag LOCUS_10840 47 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 862 4605 gene locus_tag LOCUS_10850 gene rpoC 862 4605 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_10850 4800 6116 gene locus_tag LOCUS_10860 4800 6116 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066177.1 protein_id gnl|my_center|LOCUS_10860 6283 6714 gene locus_tag LOCUS_10870 6283 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 8346 6889 gene locus_tag LOCUS_10880 8346 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence084 1697 1071 gene locus_tag LOCUS_10890 gene purN 1697 1071 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_10890 2716 1691 gene locus_tag LOCUS_10900 gene purM 2716 1691 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_10900 3250 2744 gene locus_tag LOCUS_10910 gene purE 3250 2744 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_10910 5385 3337 gene locus_tag LOCUS_10920 5385 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 5794 5480 gene locus_tag LOCUS_10930 5794 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 6206 5787 gene locus_tag LOCUS_10940 6206 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 6405 6253 gene locus_tag LOCUS_10950 6405 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 7108 6428 gene locus_tag LOCUS_10960 gene pyrE 7108 6428 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_10960 7728 7120 gene locus_tag LOCUS_10970 7728 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 8032 7697 gene locus_tag LOCUS_10980 8032 7697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10980 8808 8029 gene locus_tag LOCUS_10990 8808 8029 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence085 931 206 gene locus_tag LOCUS_11000 931 206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666599.1 protein_id gnl|my_center|LOCUS_11000 1286 924 gene locus_tag LOCUS_11010 1286 924 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403434.1 protein_id gnl|my_center|LOCUS_11010 2663 1791 gene locus_tag LOCUS_11020 2663 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3614 2721 gene locus_tag LOCUS_11030 3614 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4230 3607 gene locus_tag LOCUS_11040 4230 3607 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262569.1 protein_id gnl|my_center|LOCUS_11040 4547 4227 gene locus_tag LOCUS_11050 4547 4227 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940906.1 protein_id gnl|my_center|LOCUS_11050 5559 4639 gene locus_tag LOCUS_11060 5559 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 8842 5675 gene locus_tag LOCUS_11070 8842 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence086 1432 260 gene locus_tag LOCUS_11080 1432 260 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_11080 1881 1600 gene locus_tag LOCUS_11090 1881 1600 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_11090 3388 1937 gene locus_tag LOCUS_11100 3388 1937 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987157.1 protein_id gnl|my_center|LOCUS_11100 4216 3410 gene locus_tag LOCUS_11110 4216 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 6098 4203 gene locus_tag LOCUS_11120 6098 4203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_11120 7842 6082 gene locus_tag LOCUS_11130 7842 6082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_11130 8344 7835 gene locus_tag LOCUS_11140 8344 7835 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence087 <1 918 gene locus_tag LOCUS_11150 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461096.1:IS66 family transposase 1045 1464 gene locus_tag LOCUS_11160 1045 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1468 4071 gene locus_tag LOCUS_11170 1468 4071 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143241.1 protein_id gnl|my_center|LOCUS_11170 4161 4397 gene locus_tag LOCUS_11180 4161 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4550 6418 gene locus_tag LOCUS_11190 gene glmS 4550 6418 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_11190 6515 7024 gene locus_tag LOCUS_11200 6515 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 7163 8077 gene locus_tag LOCUS_11210 gene rfbD 7163 8077 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476435.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence088 257 826 gene locus_tag LOCUS_11220 257 826 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_11220 975 1550 gene locus_tag LOCUS_11230 975 1550 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389803.1 protein_id gnl|my_center|LOCUS_11230 1757 2698 gene locus_tag LOCUS_11240 1757 2698 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754393.1 protein_id gnl|my_center|LOCUS_11240 2728 3672 gene locus_tag LOCUS_11250 gene pstC 2728 3672 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_11250 3662 4537 gene locus_tag LOCUS_11260 gene pstA 3662 4537 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432350.1 protein_id gnl|my_center|LOCUS_11260 4557 5315 gene locus_tag LOCUS_11270 gene pstB 4557 5315 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432349.1 protein_id gnl|my_center|LOCUS_11270 5330 5995 gene locus_tag LOCUS_11280 gene phoU 5330 5995 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965016.1 protein_id gnl|my_center|LOCUS_11280 6106 6684 gene locus_tag LOCUS_11290 gene rsmD 6106 6684 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_11290 6681 7172 gene locus_tag LOCUS_11300 gene coaD 6681 7172 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_11300 7260 7859 gene locus_tag LOCUS_11310 7260 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence089 662 1282 gene locus_tag LOCUS_11320 662 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2189 1458 gene locus_tag LOCUS_11330 2189 1458 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_11330 3945 2155 gene locus_tag LOCUS_11340 3945 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4612 3965 gene locus_tag LOCUS_11350 4612 3965 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_11350 5959 4721 gene locus_tag LOCUS_11360 5959 4721 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_11360 6167 5913 gene locus_tag LOCUS_11370 6167 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 7032 6202 gene locus_tag LOCUS_11380 7032 6202 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379689.1 protein_id gnl|my_center|LOCUS_11380 8115 7045 gene locus_tag LOCUS_11390 8115 7045 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence090 1922 78 gene locus_tag LOCUS_11400 1922 78 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_11400 3651 1897 gene locus_tag LOCUS_11410 3651 1897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_11410 3966 3739 gene locus_tag LOCUS_11420 3966 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4388 5992 gene locus_tag LOCUS_11430 gene pckA 4388 5992 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761973.1 protein_id gnl|my_center|LOCUS_11430 8253 6199 gene locus_tag LOCUS_11440 8253 6199 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470194.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence091 819 7022 gene locus_tag LOCUS_11450 819 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 7230 8318 gene locus_tag LOCUS_11460 7230 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence092 <1 691 gene locus_tag LOCUS_11470 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245023.1:peptidoglycan-N-acetylmuramic acid deacetylase PdaC 2476 866 gene locus_tag LOCUS_11480 2476 866 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_11480 4100 2622 gene locus_tag LOCUS_11490 4100 2622 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_11490 4335 6338 gene locus_tag LOCUS_11500 gene ftsH 4335 6338 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963922.1 protein_id gnl|my_center|LOCUS_11500 6357 8213 gene locus_tag LOCUS_11510 gene uvrC 6357 8213 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence093 654 1664 gene locus_tag LOCUS_11520 gene spoVAD 654 1664 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_11520 1689 2045 gene locus_tag LOCUS_11530 gene spoVAE 1689 2045 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_11530 2067 2999 gene locus_tag LOCUS_11540 2067 2999 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_11540 3141 4655 gene locus_tag LOCUS_11550 gene glpK 3141 4655 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_11550 5081 5314 gene locus_tag LOCUS_11560 5081 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 5273 5282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5422 6150 gene locus_tag LOCUS_11570 5422 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 6163 7053 gene locus_tag LOCUS_11580 6163 7053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016023.1 protein_id gnl|my_center|LOCUS_11580 7046 7819 gene locus_tag LOCUS_11590 7046 7819 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948811.1 protein_id gnl|my_center|LOCUS_11590 8005 8496 gene locus_tag LOCUS_11600 gene nrdG 8005 8496 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence094 157 2436 gene locus_tag LOCUS_11610 157 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2440 3582 gene locus_tag LOCUS_11620 2440 3582 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964720.1 protein_id gnl|my_center|LOCUS_11620 3637 4218 gene locus_tag LOCUS_11630 3637 4218 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420269.1 protein_id gnl|my_center|LOCUS_11630 4282 4872 gene locus_tag LOCUS_11640 4282 4872 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246350.1 protein_id gnl|my_center|LOCUS_11640 4985 7651 gene locus_tag LOCUS_11650 4985 7651 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_11650 5577 5586 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7790 8053 gene locus_tag LOCUS_11660 7790 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence095 505 1359 gene locus_tag LOCUS_11670 505 1359 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_11670 1352 2026 gene locus_tag LOCUS_11680 1352 2026 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_11680 2048 2305 gene locus_tag LOCUS_11690 2048 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3320 2295 gene locus_tag LOCUS_11700 3320 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3971 3411 gene locus_tag LOCUS_11710 3971 3411 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881430.1 protein_id gnl|my_center|LOCUS_11710 4145 4154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5165 4161 gene locus_tag LOCUS_11720 5165 4161 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_11720 5367 6290 gene locus_tag LOCUS_11730 5367 6290 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_11730 6448 6735 gene locus_tag LOCUS_11740 6448 6735 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219429.1 protein_id gnl|my_center|LOCUS_11740 7396 6788 gene locus_tag LOCUS_11750 7396 6788 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964199.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence096 7768 7529 gene locus_tag LOCUS_11760 7768 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 7854 8321 gene locus_tag LOCUS_11770 7854 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence097 1572 913 gene locus_tag LOCUS_11780 1572 913 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_11780 2223 1636 gene locus_tag LOCUS_11790 2223 1636 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_11790 3364 2342 gene locus_tag LOCUS_11800 3364 2342 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_11800 3923 3528 gene locus_tag LOCUS_11810 3923 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386950.1 protein_id gnl|my_center|LOCUS_11810 4283 4792 gene locus_tag LOCUS_11820 4283 4792 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_11820 <8388 4943 gene locus_tag LOCUS_11830 <8388 4943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030935.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence098 1060 41 gene locus_tag LOCUS_11840 1060 41 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_11840 1677 1075 gene locus_tag LOCUS_11850 1677 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2792 1674 gene locus_tag LOCUS_11860 gene recA 2792 1674 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_11860 4120 3446 gene locus_tag LOCUS_11870 4120 3446 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_11870 6143 4107 gene locus_tag LOCUS_11880 6143 4107 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_11880 6962 6159 gene locus_tag LOCUS_11890 6962 6159 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041455.1 protein_id gnl|my_center|LOCUS_11890 7842 6955 gene locus_tag LOCUS_11900 7842 6955 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626569.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence099 543 241 gene locus_tag LOCUS_11910 543 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1984 653 gene locus_tag LOCUS_11920 gene rimO 1984 653 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986784.1 protein_id gnl|my_center|LOCUS_11920 2225 1974 gene locus_tag LOCUS_11930 gene rpoZ 2225 1974 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388622.1 protein_id gnl|my_center|LOCUS_11930 2862 2230 gene locus_tag LOCUS_11940 gene gmk 2862 2230 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_11940 3137 2859 gene locus_tag LOCUS_11950 3137 2859 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392410.1 protein_id gnl|my_center|LOCUS_11950 4027 3149 gene locus_tag LOCUS_11960 4027 3149 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_11960 <8136 4199 gene locus_tag LOCUS_11970 <8136 4199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390216.1:discoidin domain-containing protein >Feature sequence100 337 729 gene locus_tag LOCUS_11980 337 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 748 1302 gene locus_tag LOCUS_11990 748 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1289 2587 gene locus_tag LOCUS_12000 1289 2587 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_12000 2607 4031 gene locus_tag LOCUS_12010 2607 4031 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 protein_id gnl|my_center|LOCUS_12010 4018 5538 gene locus_tag LOCUS_12020 4018 5538 CDS product minor capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429838.1 protein_id gnl|my_center|LOCUS_12020 5501 5725 gene locus_tag LOCUS_12030 5501 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5772 6098 gene locus_tag LOCUS_12040 5772 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6258 6458 gene locus_tag LOCUS_12050 6258 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6581 7351 gene locus_tag LOCUS_12060 6581 7351 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905966.1 protein_id gnl|my_center|LOCUS_12060 7348 7563 gene locus_tag LOCUS_12070 7348 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence101 131 358 gene locus_tag LOCUS_12080 131 358 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_12080 440 670 gene locus_tag LOCUS_12090 440 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12090 689 946 gene locus_tag LOCUS_12100 689 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12100 948 1706 gene locus_tag LOCUS_12110 gene trmD 948 1706 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_12110 1794 2141 gene locus_tag LOCUS_12120 gene rplS 1794 2141 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419350.1 protein_id gnl|my_center|LOCUS_12120 2286 2951 gene locus_tag LOCUS_12130 2286 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2965 3828 gene locus_tag LOCUS_12140 gene ylqF 2965 3828 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236704.1 protein_id gnl|my_center|LOCUS_12140 3852 4367 gene locus_tag LOCUS_12150 gene lepB 3852 4367 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_12150 4382 4915 gene locus_tag LOCUS_12160 gene lepB 4382 4915 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_12160 5127 5894 gene locus_tag LOCUS_12170 5127 5894 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_12170 5987 6364 gene locus_tag LOCUS_12180 5987 6364 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707590.1 protein_id gnl|my_center|LOCUS_12180 6455 7285 gene locus_tag LOCUS_12190 gene pgeF 6455 7285 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967191.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence102 720 5981 gene locus_tag LOCUS_12200 720 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 6038 6193 gene locus_tag LOCUS_12210 6038 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 6183 6461 gene locus_tag LOCUS_12220 6183 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 6462 7025 gene locus_tag LOCUS_12230 6462 7025 CDS product PcfB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861118.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence103 921 730 gene locus_tag LOCUS_12240 921 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1245 2609 gene locus_tag LOCUS_12250 1245 2609 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_12250 2615 3172 gene locus_tag LOCUS_12260 gene folE 2615 3172 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380915.1 protein_id gnl|my_center|LOCUS_12260 3172 3660 gene locus_tag LOCUS_12270 3172 3660 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966208.1 protein_id gnl|my_center|LOCUS_12270 3690 4496 gene locus_tag LOCUS_12280 gene folP 3690 4496 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966209.1 protein_id gnl|my_center|LOCUS_12280 4518 5333 gene locus_tag LOCUS_12290 gene folK 4518 5333 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016121.1 protein_id gnl|my_center|LOCUS_12290 5326 6456 gene locus_tag LOCUS_12300 gene pheA 5326 6456 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_12300 6509 7819 gene locus_tag LOCUS_12310 6509 7819 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966536.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence104 9 6002 gene locus_tag LOCUS_12320 9 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence105 450 1970 gene locus_tag LOCUS_12330 450 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1982 2536 gene locus_tag LOCUS_12340 1982 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 2552 4399 gene locus_tag LOCUS_12350 2552 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4413 6587 gene locus_tag LOCUS_12360 4413 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence106 1129 560 gene locus_tag LOCUS_12370 1129 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1181 1378 gene locus_tag LOCUS_12380 1181 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2070 1672 gene locus_tag LOCUS_12390 2070 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 2210 2365 gene locus_tag LOCUS_12400 2210 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2391 2645 gene locus_tag LOCUS_12410 2391 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2652 2855 gene locus_tag LOCUS_12420 2652 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2868 3101 gene locus_tag LOCUS_12430 2868 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3125 3340 gene locus_tag LOCUS_12440 3125 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3337 3603 gene locus_tag LOCUS_12450 3337 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3678 4973 gene locus_tag LOCUS_12460 3678 4973 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_12460 4974 6116 gene locus_tag LOCUS_12470 4974 6116 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_12470 6136 6579 gene locus_tag LOCUS_12480 6136 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence107 208 35 gene locus_tag LOCUS_12490 208 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1178 645 gene locus_tag LOCUS_12500 1178 645 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_12500 1718 1188 gene locus_tag LOCUS_12510 1718 1188 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705809.1 protein_id gnl|my_center|LOCUS_12510 3192 2245 gene locus_tag LOCUS_12520 3192 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12520 3670 3125 gene locus_tag LOCUS_12530 3670 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12530 3201 3210 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5233 4004 gene locus_tag LOCUS_12540 gene pepT 5233 4004 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460034.1 protein_id gnl|my_center|LOCUS_12540 7049 5346 gene locus_tag LOCUS_12550 7049 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence108 <1 5568 gene locus_tag LOCUS_12560 <1 5568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227523.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 5777 7507 gene locus_tag LOCUS_12570 5777 7507 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence109 2387 1323 gene locus_tag LOCUS_12580 gene ispG 2387 1323 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_12580 2955 2464 gene locus_tag LOCUS_12590 2955 2464 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966286.1 protein_id gnl|my_center|LOCUS_12590 3878 3027 gene locus_tag LOCUS_12600 3878 3027 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_12600 5052 3910 gene locus_tag LOCUS_12610 5052 3910 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_12610 5315 5157 gene locus_tag LOCUS_12620 5315 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 6544 5249 gene locus_tag LOCUS_12630 6544 5249 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12630 5374 5382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6668 7654 gene locus_tag LOCUS_12640 6668 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence110 1997 2557 gene locus_tag LOCUS_12650 1997 2557 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816608.1 protein_id gnl|my_center|LOCUS_12650 2779 3924 gene locus_tag LOCUS_12660 gene fucO 2779 3924 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_12660 4341 6026 gene locus_tag LOCUS_12670 4341 6026 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_12670 6232 6831 gene locus_tag LOCUS_12680 6232 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 6935 7162 gene locus_tag LOCUS_12690 6935 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence111 1829 459 gene locus_tag LOCUS_12700 1829 459 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_12700 2811 1840 gene locus_tag LOCUS_12710 2811 1840 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948398.1 protein_id gnl|my_center|LOCUS_12710 3467 2808 gene locus_tag LOCUS_12720 3467 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3562 4155 gene locus_tag LOCUS_12730 3562 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4239 5057 gene locus_tag LOCUS_12740 gene pdaA 4239 5057 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438596.1 protein_id gnl|my_center|LOCUS_12740 6123 5098 gene locus_tag LOCUS_12750 gene queA 6123 5098 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_12750 6751 6137 gene locus_tag LOCUS_12760 6751 6137 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_12760 <7889 6767 gene locus_tag LOCUS_12770 <7889 6767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965653.1:phenylalanine--tRNA ligase subunit beta >Feature sequence112 789 193 gene locus_tag LOCUS_12780 789 193 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427659.1 protein_id gnl|my_center|LOCUS_12780 922 1008 gene locus_tag LOCUS_t00170 922 1008 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1101 1958 gene locus_tag LOCUS_12790 1101 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 3372 2455 gene locus_tag LOCUS_12800 gene nadA 3372 2455 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_12800 3920 3369 gene locus_tag LOCUS_12810 3920 3369 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294232.1 protein_id gnl|my_center|LOCUS_12810 4786 3935 gene locus_tag LOCUS_12820 gene nadC 4786 3935 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 protein_id gnl|my_center|LOCUS_12820 6068 4779 gene locus_tag LOCUS_12830 6068 4779 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_12830 6310 6161 gene locus_tag LOCUS_12840 6310 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 6344 7726 gene locus_tag LOCUS_12850 6344 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence113 6148 926 gene locus_tag LOCUS_12860 6148 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7632 6619 gene locus_tag LOCUS_12870 7632 6619 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789714.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence114 1210 3012 gene locus_tag LOCUS_12880 1210 3012 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289076.1 protein_id gnl|my_center|LOCUS_12880 3025 3981 gene locus_tag LOCUS_12890 3025 3981 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_12890 4108 5508 gene locus_tag LOCUS_12900 4108 5508 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_12900 5523 6827 gene locus_tag LOCUS_12910 5523 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 6847 7794 gene locus_tag LOCUS_12920 gene rfbN 6847 7794 CDS product O antigen biosynthesis rhamnosyltransferase RfbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705149.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence115 1401 139 gene locus_tag LOCUS_12930 1401 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 1932 1411 gene locus_tag LOCUS_12940 1932 1411 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814454.1 protein_id gnl|my_center|LOCUS_12940 4471 2168 gene locus_tag LOCUS_12950 4471 2168 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593936.1 protein_id gnl|my_center|LOCUS_12950 5195 4560 gene locus_tag LOCUS_12960 5195 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5949 5212 gene locus_tag LOCUS_12970 5949 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 <7725 5957 gene locus_tag LOCUS_12980 <7725 5957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048018.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence116 481 666 gene locus_tag LOCUS_12990 481 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 644 1198 gene locus_tag LOCUS_13000 644 1198 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000627663.1 protein_id gnl|my_center|LOCUS_13000 1274 2746 gene locus_tag LOCUS_13010 1274 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 2748 4538 gene locus_tag LOCUS_13020 gene pepF 2748 4538 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_13020 5616 4612 gene locus_tag LOCUS_13030 5616 4612 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_13030 6473 5628 gene locus_tag LOCUS_13040 6473 5628 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_13040 7683 6505 gene locus_tag LOCUS_13050 gene spoVE 7683 6505 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence117 251 260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 897 352 gene locus_tag LOCUS_13060 897 352 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_13060 1526 1143 gene locus_tag LOCUS_13070 1526 1143 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_13070 1740 2651 gene locus_tag LOCUS_13080 gene trxB 1740 2651 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_13080 2909 4579 gene locus_tag LOCUS_13090 2909 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 5179 5466 gene locus_tag LOCUS_13100 5179 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 5240 5249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5865 7538 gene locus_tag LOCUS_13110 5865 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence118 <1 1266 gene locus_tag LOCUS_13120 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389524.1:recombinase family protein 1424 3784 gene locus_tag LOCUS_13130 1424 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13130 3748 3757 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3919 5931 gene locus_tag LOCUS_13140 3919 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 6095 6778 gene locus_tag LOCUS_13150 6095 6778 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044679.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence119 443 997 gene locus_tag LOCUS_13160 gene frr 443 997 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_13160 1079 1642 gene locus_tag LOCUS_13170 1079 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13170 1621 1630 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1803 2612 gene locus_tag LOCUS_13180 1803 2612 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_13180 2623 3768 gene locus_tag LOCUS_13190 2623 3768 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_13190 3770 4804 gene locus_tag LOCUS_13200 gene rseP 3770 4804 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965102.1 protein_id gnl|my_center|LOCUS_13200 5051 5479 gene locus_tag LOCUS_13210 gene rplM 5051 5479 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918559.1 protein_id gnl|my_center|LOCUS_13210 5496 5885 gene locus_tag LOCUS_13220 gene rpsI 5496 5885 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_13220 6192 6326 gene locus_tag LOCUS_13230 6192 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 6316 7245 gene locus_tag LOCUS_13240 gene rhuM 6316 7245 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence120 26 1165 gene locus_tag LOCUS_13250 26 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1159 1938 gene locus_tag LOCUS_13260 1159 1938 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_13260 1983 2354 gene locus_tag LOCUS_13270 1983 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2486 2854 gene locus_tag LOCUS_13280 2486 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 2869 4956 gene locus_tag LOCUS_13290 2869 4956 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_13290 5240 5449 gene locus_tag LOCUS_13300 5240 5449 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_13300 5500 5721 gene locus_tag LOCUS_13310 5500 5721 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360987.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence121 51 938 gene locus_tag LOCUS_13320 51 938 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_13320 932 1738 gene locus_tag LOCUS_13330 932 1738 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_13330 1949 2710 gene locus_tag LOCUS_13340 gene truA 1949 2710 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_13340 2833 4956 gene locus_tag LOCUS_13350 2833 4956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 5421 5080 gene locus_tag LOCUS_13360 5421 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 5601 6356 gene locus_tag LOCUS_13370 5601 6356 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence122 393 869 gene locus_tag LOCUS_13380 gene nuoE 393 869 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_13380 869 2749 gene locus_tag LOCUS_13390 gene nuoF 869 2749 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_13390 2761 4449 gene locus_tag LOCUS_13400 2761 4449 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_13400 4501 5970 gene locus_tag LOCUS_13410 gene spoIVA 4501 5970 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_13410 6377 6643 gene locus_tag LOCUS_13420 6377 6643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence123 3781 992 gene locus_tag LOCUS_13430 3781 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 4075 3887 gene locus_tag LOCUS_13440 4075 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13440 5172 4423 gene locus_tag LOCUS_13450 gene tpiA 5172 4423 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_13450 6557 5352 gene locus_tag LOCUS_13460 6557 5352 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence124 1463 93 gene locus_tag LOCUS_13470 1463 93 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_13470 1866 1588 gene locus_tag LOCUS_13480 1866 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2344 1916 gene locus_tag LOCUS_13490 2344 1916 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051407.1 protein_id gnl|my_center|LOCUS_13490 2485 3486 gene locus_tag LOCUS_13500 2485 3486 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_13500 4357 3605 gene locus_tag LOCUS_13510 4357 3605 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_13510 4712 6121 gene locus_tag LOCUS_13520 4712 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 6118 6873 gene locus_tag LOCUS_13530 6118 6873 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203367.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence125 3854 1497 gene locus_tag LOCUS_13540 3854 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 6152 3897 gene locus_tag LOCUS_13550 6152 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence126 990 112 gene locus_tag LOCUS_13560 990 112 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725703.1 protein_id gnl|my_center|LOCUS_13560 1194 1955 gene locus_tag LOCUS_13570 gene aroD 1194 1955 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897376.1 protein_id gnl|my_center|LOCUS_13570 2069 2866 gene locus_tag LOCUS_13580 2069 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2859 3602 gene locus_tag LOCUS_13590 gene sigE 2859 3602 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774280.1 protein_id gnl|my_center|LOCUS_13590 3729 5171 gene locus_tag LOCUS_13600 gene purF 3729 5171 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_13600 5187 6620 gene locus_tag LOCUS_13610 gene purB 5187 6620 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence127 2095 3450 gene locus_tag LOCUS_13620 2095 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3597 4526 gene locus_tag LOCUS_13630 3597 4526 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_13630 4536 5615 gene locus_tag LOCUS_13640 4536 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 4957 4966 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence128 91 492 gene locus_tag LOCUS_13650 91 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 531 1877 gene locus_tag LOCUS_13660 531 1877 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_13660 2005 2832 gene locus_tag LOCUS_13670 2005 2832 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_13670 2836 4194 gene locus_tag LOCUS_13680 2836 4194 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_13680 4181 4588 gene locus_tag LOCUS_13690 4181 4588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 4756 5199 gene locus_tag LOCUS_13700 4756 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 6398 5484 gene locus_tag LOCUS_13710 6398 5484 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143015502.1 protein_id gnl|my_center|LOCUS_13710 6607 6395 gene locus_tag LOCUS_13720 6607 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 6576 6585 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence129 605 1852 gene locus_tag LOCUS_13730 605 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2013 2963 gene locus_tag LOCUS_13740 2013 2963 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_13740 2981 4033 gene locus_tag LOCUS_13750 2981 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4040 5776 gene locus_tag LOCUS_13760 4040 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence130 1215 5561 gene locus_tag LOCUS_13770 1215 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 5629 5904 gene locus_tag LOCUS_13780 5629 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 5907 6092 gene locus_tag LOCUS_13790 5907 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 6209 6661 gene locus_tag LOCUS_13800 6209 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence131 <1 631 gene locus_tag LOCUS_13810 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760790.1:tryptophan--tRNA ligase 1952 642 gene locus_tag LOCUS_13820 1952 642 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461202.1 protein_id gnl|my_center|LOCUS_13820 2629 1949 gene locus_tag LOCUS_13830 2629 1949 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_13830 3030 5222 gene locus_tag LOCUS_13840 gene topB 3030 5222 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140209.1 protein_id gnl|my_center|LOCUS_13840 6104 5256 gene locus_tag LOCUS_13850 6104 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence132 1015 83 gene locus_tag LOCUS_13860 gene arcC 1015 83 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002367131.1 protein_id gnl|my_center|LOCUS_13860 1750 2736 gene locus_tag LOCUS_13870 gene spoIIIAA 1750 2736 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_13870 2730 3149 gene locus_tag LOCUS_13880 2730 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 3146 3526 gene locus_tag LOCUS_13890 gene spoIIIAD 3146 3526 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_13890 3526 4770 gene locus_tag LOCUS_13900 gene spoIIIAE 3526 4770 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965389.1 protein_id gnl|my_center|LOCUS_13900 4788 5306 gene locus_tag LOCUS_13910 4788 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 5312 5899 gene locus_tag LOCUS_13920 5312 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence133 549 274 gene locus_tag LOCUS_13930 549 274 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_13930 1931 609 gene locus_tag LOCUS_13940 1931 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2814 1921 gene locus_tag LOCUS_13950 gene cdaA 2814 1921 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_13950 3778 2786 gene locus_tag LOCUS_13960 3778 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4197 3775 gene locus_tag LOCUS_13970 4197 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4987 4268 gene locus_tag LOCUS_13980 4987 4268 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 protein_id gnl|my_center|LOCUS_13980 6507 4984 gene locus_tag LOCUS_13990 6507 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence134 502 182 gene locus_tag LOCUS_14000 502 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1097 474 gene locus_tag LOCUS_14010 1097 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1412 1948 gene locus_tag LOCUS_14020 gene pgsA 1412 1948 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_14020 1972 3228 gene locus_tag LOCUS_14030 1972 3228 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966849.1 protein_id gnl|my_center|LOCUS_14030 3608 3282 gene locus_tag LOCUS_14040 3608 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3969 3532 gene locus_tag LOCUS_14050 3969 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 4146 4280 gene locus_tag LOCUS_14060 4146 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 4566 4312 gene locus_tag LOCUS_14070 4566 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 6270 4624 gene locus_tag LOCUS_14080 6270 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 6121 6130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence135 2333 201 gene locus_tag LOCUS_14090 gene nrdD 2333 201 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_14090 2889 2455 gene locus_tag LOCUS_14100 2889 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4479 3067 gene locus_tag LOCUS_14110 4479 3067 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393287.1 protein_id gnl|my_center|LOCUS_14110 5880 4858 gene locus_tag LOCUS_14120 5880 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 6340 5882 gene locus_tag LOCUS_14130 6340 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence136 247 3780 gene locus_tag LOCUS_14140 247 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14140 3717 3726 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence137 3499 2891 gene locus_tag LOCUS_14150 3499 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence138 <6297 1847 gene locus_tag LOCUS_14160 <6297 1847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024196.1:PKD domain-containing protein >Feature sequence139 3323 1167 gene locus_tag LOCUS_14170 3323 1167 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963529.1 protein_id gnl|my_center|LOCUS_14170 3922 3449 gene locus_tag LOCUS_14180 gene tadA 3922 3449 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_14180 4100 4831 gene locus_tag LOCUS_14190 4100 4831 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_14190 <6075 4983 gene locus_tag LOCUS_14200 <6075 4983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104439672.1:DUF6128 domain-containing protein >Feature sequence140 27 115 gene locus_tag LOCUS_t00180 27 115 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1217 144 gene locus_tag LOCUS_14210 1217 144 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861579.1 protein_id gnl|my_center|LOCUS_14210 1951 1391 gene locus_tag LOCUS_14220 1951 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 2968 1973 gene locus_tag LOCUS_14230 2968 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3020 3217 gene locus_tag LOCUS_14240 3020 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3408 3527 gene locus_tag LOCUS_14250 3408 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3925 3524 gene locus_tag LOCUS_14260 3925 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 4362 4502 gene locus_tag LOCUS_14270 4362 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 4528 4782 gene locus_tag LOCUS_14280 4528 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4789 5007 gene locus_tag LOCUS_14290 4789 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 5004 5330 gene locus_tag LOCUS_14300 5004 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5828 5337 gene locus_tag LOCUS_14310 5828 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence141 1298 630 gene locus_tag LOCUS_14320 1298 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2373 1525 gene locus_tag LOCUS_14330 2373 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2634 3011 gene locus_tag LOCUS_14340 2634 3011 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_14340 4938 3082 gene locus_tag LOCUS_14350 4938 3082 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 protein_id gnl|my_center|LOCUS_14350 3112 3121 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5299 5078 gene locus_tag LOCUS_14360 5299 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 5702 5340 gene locus_tag LOCUS_14370 5702 5340 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence142 704 1651 gene locus_tag LOCUS_14380 704 1651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016909.1 protein_id gnl|my_center|LOCUS_14380 1644 2492 gene locus_tag LOCUS_14390 1644 2492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_14390 2495 3274 gene locus_tag LOCUS_14400 2495 3274 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016906.1 protein_id gnl|my_center|LOCUS_14400 3278 4036 gene locus_tag LOCUS_14410 3278 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence143 871 599 gene locus_tag LOCUS_14420 871 599 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_14420 1510 914 gene locus_tag LOCUS_14430 1510 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2126 1497 gene locus_tag LOCUS_14440 gene coaE 2126 1497 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_14440 4768 2144 gene locus_tag LOCUS_14450 gene polA 4768 2144 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_14450 5408 4794 gene locus_tag LOCUS_14460 5408 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 5555 5640 gene locus_tag LOCUS_t00190 5555 5640 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 300 1247 gene locus_tag LOCUS_14470 300 1247 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_14470 1260 2084 gene locus_tag LOCUS_14480 gene recT 1260 2084 CDS product recombination protein RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166313.1 protein_id gnl|my_center|LOCUS_14480 2065 2526 gene locus_tag LOCUS_14490 2065 2526 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_14490 2548 3408 gene locus_tag LOCUS_14500 2548 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3418 4128 gene locus_tag LOCUS_14510 3418 4128 CDS product ORF6C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001002368.1 protein_id gnl|my_center|LOCUS_14510 4125 4316 gene locus_tag LOCUS_14520 4125 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 4318 5052 gene locus_tag LOCUS_14530 4318 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 5021 5482 gene locus_tag LOCUS_14540 5021 5482 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence145 1334 1343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1439 2488 gene locus_tag LOCUS_14550 gene cobT 1439 2488 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_14550 2502 3014 gene locus_tag LOCUS_14560 gene cobU 2502 3014 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948598.1 protein_id gnl|my_center|LOCUS_14560 3069 3836 gene locus_tag LOCUS_14570 gene cobS 3069 3836 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460078.1 protein_id gnl|my_center|LOCUS_14570 3921 4301 gene locus_tag LOCUS_14580 3921 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4412 5011 gene locus_tag LOCUS_14590 4412 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 5050 5652 gene locus_tag LOCUS_14600 gene ruvA 5050 5652 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence146 1024 302 gene locus_tag LOCUS_14610 1024 302 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_14610 1104 1754 gene locus_tag LOCUS_14620 1104 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1819 2496 gene locus_tag LOCUS_14630 1819 2496 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680765.1 protein_id gnl|my_center|LOCUS_14630 2493 3293 gene locus_tag LOCUS_14640 2493 3293 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_14640 3385 3648 gene locus_tag LOCUS_14650 3385 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4753 4073 gene locus_tag LOCUS_14660 4753 4073 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_14660 <5650 4810 gene locus_tag LOCUS_14670 <5650 4810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435963.1:molecular chaperone HtpG >Feature sequence147 144 512 gene locus_tag LOCUS_14680 144 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 732 1016 gene locus_tag LOCUS_14690 732 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1048 2406 gene locus_tag LOCUS_14700 1048 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2477 4969 gene locus_tag LOCUS_14710 2477 4969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence148 <1 1934 gene locus_tag LOCUS_14720 <1 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289265.1:formate C-acetyltransferase 1423 1432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1936 2679 gene locus_tag LOCUS_14730 gene pflA 1936 2679 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289264.1 protein_id gnl|my_center|LOCUS_14730 3774 2902 gene locus_tag LOCUS_14740 3774 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3328 3337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence149 1730 1137 gene locus_tag LOCUS_14750 1730 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2437 1757 gene locus_tag LOCUS_14760 2437 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2874 2659 gene locus_tag LOCUS_14770 2874 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3968 3078 gene locus_tag LOCUS_14780 3968 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4701 4039 gene locus_tag LOCUS_14790 4701 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5297 4893 gene locus_tag LOCUS_14800 5297 4893 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813029.1 protein_id gnl|my_center|LOCUS_14800 5517 5332 gene locus_tag LOCUS_14810 5517 5332 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence150 895 904 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4465 2135 gene locus_tag LOCUS_14820 4465 2135 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809460.1 protein_id gnl|my_center|LOCUS_14820 5176 4478 gene locus_tag LOCUS_14830 5176 4478 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence151 2027 1143 gene locus_tag LOCUS_14840 2027 1143 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121002.1 protein_id gnl|my_center|LOCUS_14840 2270 2097 gene locus_tag LOCUS_14850 2270 2097 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_14850 4949 2358 gene locus_tag LOCUS_14860 gene clpB 4949 2358 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence152 2686 1613 gene locus_tag LOCUS_14870 gene carA 2686 1613 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_14870 3012 4238 gene locus_tag LOCUS_14880 gene sleC 3012 4238 CDS product spore cortex-lytic germination protein SleC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425119.1 protein_id gnl|my_center|LOCUS_14880 5146 4349 gene locus_tag LOCUS_14890 5146 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence153 276 2261 gene locus_tag LOCUS_14900 276 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 2258 3703 gene locus_tag LOCUS_14910 2258 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3760 4119 gene locus_tag LOCUS_14920 3760 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4291 4563 gene locus_tag LOCUS_14930 gene spoIIID 4291 4563 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_14930 4701 5201 gene locus_tag LOCUS_14940 4701 5201 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence154 91 1200 gene locus_tag LOCUS_14950 91 1200 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861704.1 protein_id gnl|my_center|LOCUS_14950 2204 1356 gene locus_tag LOCUS_14960 2204 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2522 3412 gene locus_tag LOCUS_14970 2522 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4155 3514 gene locus_tag LOCUS_14980 4155 3514 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_14980 4546 4157 gene locus_tag LOCUS_14990 4546 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence155 2434 458 gene locus_tag LOCUS_15000 2434 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3294 3629 gene locus_tag LOCUS_15010 3294 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4106 3597 gene locus_tag LOCUS_15020 4106 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4366 4548 gene locus_tag LOCUS_15030 4366 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4618 4833 gene locus_tag LOCUS_15040 4618 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence156 587 1918 gene locus_tag LOCUS_15050 gene aspS 587 1918 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529801.1 protein_id gnl|my_center|LOCUS_15050 2001 2294 gene locus_tag LOCUS_15060 gene gatC 2001 2294 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_15060 2305 3789 gene locus_tag LOCUS_15070 gene gatA 2305 3789 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_15070 3791 5230 gene locus_tag LOCUS_15080 gene gatB 3791 5230 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048223.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence157 1874 201 gene locus_tag LOCUS_15090 1874 201 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_15090 2749 1964 gene locus_tag LOCUS_15100 2749 1964 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_15100 3462 2746 gene locus_tag LOCUS_15110 3462 2746 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263081.1 protein_id gnl|my_center|LOCUS_15110 4571 3474 gene locus_tag LOCUS_15120 gene rpoD 4571 3474 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence158 <1 1074 gene locus_tag LOCUS_15130 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357079.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 1090 1725 gene locus_tag LOCUS_15140 1090 1725 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_15140 1840 3312 gene locus_tag LOCUS_15150 1840 3312 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_15150 3287 3904 gene locus_tag LOCUS_15160 3287 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3895 5154 gene locus_tag LOCUS_15170 gene hisS 3895 5154 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964121.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence159 263 1726 gene locus_tag LOCUS_15180 263 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1884 3158 gene locus_tag LOCUS_15190 1884 3158 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_15190 3522 3824 gene locus_tag LOCUS_15200 gene ureA 3522 3824 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694143.1 protein_id gnl|my_center|LOCUS_15200 3884 4243 gene locus_tag LOCUS_15210 3884 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15210 >Feature sequence160 151 2238 gene locus_tag LOCUS_15220 151 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 2239 4932 gene locus_tag LOCUS_15230 2239 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence161 <1 644 gene locus_tag LOCUS_15240 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707673.1:DMT family transporter 1524 610 gene locus_tag LOCUS_15250 1524 610 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_15250 1717 2883 gene locus_tag LOCUS_15260 1717 2883 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966242.1 protein_id gnl|my_center|LOCUS_15260 2899 4395 gene locus_tag LOCUS_15270 gene galT 2899 4395 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence162 122 1087 gene locus_tag LOCUS_15280 122 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 372 381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1084 2115 gene locus_tag LOCUS_15290 1084 2115 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_15290 2112 2609 gene locus_tag LOCUS_15300 gene ybeY 2112 2609 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_15300 2622 3749 gene locus_tag LOCUS_15310 2622 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence163 3517 86 gene locus_tag LOCUS_15320 3517 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 4485 4853 gene locus_tag LOCUS_15330 gene rpsM 4485 4853 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence164 90 824 gene locus_tag LOCUS_15340 90 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1564 875 gene locus_tag LOCUS_15350 1564 875 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388341.1 protein_id gnl|my_center|LOCUS_15350 2779 1784 gene locus_tag LOCUS_15360 gene cysK 2779 1784 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_15360 2640 2649 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3800 2763 gene locus_tag LOCUS_15370 3800 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4111 3878 gene locus_tag LOCUS_15380 4111 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4662 4111 gene locus_tag LOCUS_15390 4662 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 4145 4154 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4783 4792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence165 <1 700 gene locus_tag LOCUS_15400 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438328.1:DNA translocase FtsK 582 591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 702 1592 gene locus_tag LOCUS_15410 702 1592 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896496.1 protein_id gnl|my_center|LOCUS_15410 1592 2980 gene locus_tag LOCUS_15420 gene gltA 1592 2980 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_15420 3248 4516 gene locus_tag LOCUS_15430 gene leuC 3248 4516 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_15430 4530 5018 gene locus_tag LOCUS_15440 gene leuD 4530 5018 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence166 <1 716 gene locus_tag LOCUS_15450 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000724295.1:urease subunit beta 913 1419 gene locus_tag LOCUS_15460 gene ureI 913 1419 CDS product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 protein_id gnl|my_center|LOCUS_15460 1421 1900 gene locus_tag LOCUS_15470 gene ureE 1421 1900 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583097.1 protein_id gnl|my_center|LOCUS_15470 1968 2168 gene locus_tag LOCUS_15480 1968 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15480 2140 2652 gene locus_tag LOCUS_15490 2140 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15490 2150 2159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2667 3275 gene locus_tag LOCUS_15500 gene ureG 2667 3275 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238762.1 protein_id gnl|my_center|LOCUS_15500 3387 4172 gene locus_tag LOCUS_15510 3387 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence167 311 320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 395 1201 gene locus_tag LOCUS_15520 395 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15520 1387 2235 gene locus_tag LOCUS_15530 1387 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2407 3462 gene locus_tag LOCUS_15540 2407 3462 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_15540 3544 4539 gene locus_tag LOCUS_15550 3544 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4458 4958 gene locus_tag LOCUS_15560 4458 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15560 >Feature sequence168 <1 2576 gene locus_tag LOCUS_15570 <1 2576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390216.1:discoidin domain-containing protein 3108 4748 gene locus_tag LOCUS_15580 3108 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence169 <1 3092 gene locus_tag LOCUS_15590 <1 3092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966712.1:DNA polymerase III subunit alpha 3110 4312 gene locus_tag LOCUS_15600 3110 4312 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence170 1370 213 gene locus_tag LOCUS_15610 gene hemW 1370 213 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_15610 3194 1398 gene locus_tag LOCUS_15620 gene lepA 3194 1398 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964590.1 protein_id gnl|my_center|LOCUS_15620 4534 3275 gene locus_tag LOCUS_15630 4534 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence171 79 708 gene locus_tag LOCUS_15640 79 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 705 1433 gene locus_tag LOCUS_15650 705 1433 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234935.1 protein_id gnl|my_center|LOCUS_15650 1430 3421 gene locus_tag LOCUS_15660 1430 3421 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_15660 3423 4199 gene locus_tag LOCUS_15670 3423 4199 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436810.1 protein_id gnl|my_center|LOCUS_15670 4263 4838 gene locus_tag LOCUS_15680 4263 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence172 1658 498 gene locus_tag LOCUS_15690 gene metK 1658 498 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229102.1 protein_id gnl|my_center|LOCUS_15690 4818 1747 gene locus_tag LOCUS_15700 4818 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence173 249 70 gene locus_tag LOCUS_15710 249 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1216 206 gene locus_tag LOCUS_15720 1216 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 273 282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1754 1284 gene locus_tag LOCUS_15730 1754 1284 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864729.1 protein_id gnl|my_center|LOCUS_15730 1296 1305 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3871 1835 gene locus_tag LOCUS_15740 3871 1835 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459160.1 protein_id gnl|my_center|LOCUS_15740 4632 3868 gene locus_tag LOCUS_15750 4632 3868 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence174 668 312 gene locus_tag LOCUS_15760 gene ndoA 668 312 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156187.1 protein_id gnl|my_center|LOCUS_15760 1917 739 gene locus_tag LOCUS_15770 gene alr 1917 739 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_15770 3464 1962 gene locus_tag LOCUS_15780 3464 1962 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865220.1 protein_id gnl|my_center|LOCUS_15780 4177 3536 gene locus_tag LOCUS_15790 4177 3536 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_15790 <4811 4280 gene locus_tag LOCUS_15800 <4811 4280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963601.1:aspartate kinase >Feature sequence175 1517 198 gene locus_tag LOCUS_15810 1517 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 390 399 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2480 1527 gene locus_tag LOCUS_15820 2480 1527 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816612.1 protein_id gnl|my_center|LOCUS_15820 <4803 2487 gene locus_tag LOCUS_15830 <4803 2487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011446981.1:CDP-glycerol glycerophosphotransferase family protein >Feature sequence176 728 1321 gene locus_tag LOCUS_15840 728 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1622 2509 gene locus_tag LOCUS_15850 gene xerD 1622 2509 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_15850 3038 2562 gene locus_tag LOCUS_15860 3038 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3208 3846 gene locus_tag LOCUS_15870 gene thiE 3208 3846 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904284.1 protein_id gnl|my_center|LOCUS_15870 3889 4689 gene locus_tag LOCUS_15880 gene thiD 3889 4689 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence177 3101 2226 gene locus_tag LOCUS_15890 gene uppP 3101 2226 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_15890 3374 4090 gene locus_tag LOCUS_15900 3374 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4336 4103 gene locus_tag LOCUS_15910 4336 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4756 4358 gene locus_tag LOCUS_15920 4756 4358 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461818.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence178 2053 1871 gene locus_tag LOCUS_15930 2053 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 2817 2029 gene locus_tag LOCUS_15940 2817 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2288 2297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3900 2845 gene locus_tag LOCUS_15950 3900 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 <4771 4034 gene locus_tag LOCUS_15960 <4771 4034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869062.1:galactose/glucose ABC transporter substrate-binding protein MglB >Feature sequence179 2506 839 gene locus_tag LOCUS_15970 gene ilvD 2506 839 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_15970 3672 2545 gene locus_tag LOCUS_15980 gene leuB 3672 2545 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_15980 <4756 3845 gene locus_tag LOCUS_15990 <4756 3845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476159.1:YfhO family protein >Feature sequence180 1623 757 gene locus_tag LOCUS_16000 1623 757 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_16000 2100 1627 gene locus_tag LOCUS_16010 gene rnhA 2100 1627 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917872.1 protein_id gnl|my_center|LOCUS_16010 3265 2231 gene locus_tag LOCUS_16020 3265 2231 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_16020 4286 3447 gene locus_tag LOCUS_16030 gene thiM 4286 3447 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence181 >Feature sequence182 <4660 295 gene locus_tag LOCUS_16040 <4660 295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704753.1:thermostable cytotonic enterotoxin Ast >Feature sequence183 1505 723 gene locus_tag LOCUS_16050 1505 723 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_16050 2728 1574 gene locus_tag LOCUS_16060 2728 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16060 3462 2710 gene locus_tag LOCUS_16070 3462 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16070 2746 2755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4351 3581 gene locus_tag LOCUS_16080 4351 3581 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence184 640 1068 gene locus_tag LOCUS_16090 gene rplM 640 1068 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_16090 1087 1488 gene locus_tag LOCUS_16100 gene rpsI 1087 1488 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_16100 1766 3025 gene locus_tag LOCUS_16110 1766 3025 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_16110 3012 3692 gene locus_tag LOCUS_16120 3012 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence185 <1 1001 gene locus_tag LOCUS_16130 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674061.1:YhgE/Pip domain-containing protein 350 359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence186 2245 323 gene locus_tag LOCUS_16140 gene gyrB 2245 323 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027445.1 protein_id gnl|my_center|LOCUS_16140 2429 2357 gene locus_tag LOCUS_t00200 2429 2357 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 <4603 2710 gene locus_tag LOCUS_16150 <4603 2710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207553109.1:endo-alpha-N-acetylgalactosaminidase family protein >Feature sequence187 <1 1776 gene locus_tag LOCUS_16160 <1 1776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000391086.1:ribonuclease R 1823 2263 gene locus_tag LOCUS_16170 gene smpB 1823 2263 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_16170 2394 2739 gene locus_tag LOCUS_tm00010 2394 2739 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3986 2757 gene locus_tag LOCUS_16180 3986 2757 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531626.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence188 <1 1382 gene locus_tag LOCUS_16190 <1 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461425.1:cell wall-binding repeat-containing protein 1379 2650 gene locus_tag LOCUS_16200 1379 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2673 3617 gene locus_tag LOCUS_16210 2673 3617 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence189 1061 621 gene locus_tag LOCUS_16220 1061 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 665 674 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2094 1087 gene locus_tag LOCUS_16230 2094 1087 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_16230 4274 2232 gene locus_tag LOCUS_16240 4274 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16240 >Feature sequence190 86 235 gene locus_tag LOCUS_16250 86 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 446 1030 gene locus_tag LOCUS_16260 446 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1326 1775 gene locus_tag LOCUS_16270 1326 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1838 2668 gene locus_tag LOCUS_16280 1838 2668 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_16280 3353 2616 gene locus_tag LOCUS_16290 3353 2616 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence191 111 941 gene locus_tag LOCUS_16300 111 941 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292113.1 protein_id gnl|my_center|LOCUS_16300 1153 2448 gene locus_tag LOCUS_16310 1153 2448 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_16310 2465 2614 gene locus_tag LOCUS_16320 2465 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2624 4231 gene locus_tag LOCUS_16330 2624 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence192 2271 340 gene locus_tag LOCUS_16340 2271 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 2957 2268 gene locus_tag LOCUS_16350 2957 2268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631600.1 protein_id gnl|my_center|LOCUS_16350 <4428 2980 gene locus_tag LOCUS_16360 <4428 2980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243035.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence193 1430 207 gene locus_tag LOCUS_16370 gene argJ 1430 207 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_16370 2495 1455 gene locus_tag LOCUS_16380 gene argC 2495 1455 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851634.1 protein_id gnl|my_center|LOCUS_16380 2904 3212 gene locus_tag LOCUS_16390 2904 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16390 3148 4086 gene locus_tag LOCUS_16400 3148 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16400 3190 3199 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence194 <1 682 gene locus_tag LOCUS_16410 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:S8 family serine peptidase 360 369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 754 2145 gene locus_tag LOCUS_16420 754 2145 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_16420 2159 2839 gene locus_tag LOCUS_16430 2159 2839 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814961.1 protein_id gnl|my_center|LOCUS_16430 2873 4081 gene locus_tag LOCUS_16440 2873 4081 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence195 <1 1676 gene locus_tag LOCUS_16450 <1 1676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965567.1:aspartate--tRNA ligase 2924 1794 gene locus_tag LOCUS_16460 2924 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 3064 4302 gene locus_tag LOCUS_16470 gene glyA 3064 4302 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227669.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence196 <1 3250 gene locus_tag LOCUS_16480 <1 3250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461425.1:cell wall-binding repeat-containing protein note possible pseudo, frameshifted 3238 3247 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence197 552 268 gene locus_tag LOCUS_16490 552 268 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_16490 868 626 gene locus_tag LOCUS_16500 868 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1884 1090 gene locus_tag LOCUS_16510 gene codY 1884 1090 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438268.1 protein_id gnl|my_center|LOCUS_16510 4122 2047 gene locus_tag LOCUS_16520 gene topA 4122 2047 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence198 1559 2983 gene locus_tag LOCUS_16530 1559 2983 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392886.1 protein_id gnl|my_center|LOCUS_16530 3113 3535 gene locus_tag LOCUS_16540 3113 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence199 <1 539 gene locus_tag LOCUS_16550 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000162279.1:ATP-binding protein 544 1449 gene locus_tag LOCUS_16560 544 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1505 2242 gene locus_tag LOCUS_16570 1505 2242 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_16570 2357 2782 gene locus_tag LOCUS_16580 2357 2782 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_16580 2916 3413 gene locus_tag LOCUS_16590 gene ilvN 2916 3413 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023691.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence200 1644 1201 gene locus_tag LOCUS_16600 1644 1201 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941202.1 protein_id gnl|my_center|LOCUS_16600 3199 1811 gene locus_tag LOCUS_16610 gene mgtE 3199 1811 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829287.1 protein_id gnl|my_center|LOCUS_16610 <4209 3587 gene locus_tag LOCUS_16620 <4209 3587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680864.1:heavy metal translocating P-type ATPase >Feature sequence201 1532 183 gene locus_tag LOCUS_16630 1532 183 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_16630 1917 2600 gene locus_tag LOCUS_16640 1917 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 2955 2548 gene locus_tag LOCUS_16650 2955 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence202 <1 1088 gene locus_tag LOCUS_16660 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895216.1:preprotein translocase subunit SecA 1254 2273 gene locus_tag LOCUS_16670 gene prfB 1254 2273 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_16670 2386 3312 gene locus_tag LOCUS_16680 2386 3312 CDS product PEP phosphonomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901609.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence203 <1 859 gene locus_tag LOCUS_16690 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462038.1:DUF1015 family protein 1092 3737 gene locus_tag LOCUS_16700 gene glgB 1092 3737 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence204 >Feature sequence205 51 371 gene locus_tag LOCUS_16710 51 371 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_16710 372 1109 gene locus_tag LOCUS_16720 372 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1106 1291 gene locus_tag LOCUS_16730 1106 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1390 1575 gene locus_tag LOCUS_16740 1390 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1708 1905 gene locus_tag LOCUS_16750 1708 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1955 2932 gene locus_tag LOCUS_16760 gene holA 1955 2932 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430958.1 protein_id gnl|my_center|LOCUS_16760 3275 3012 gene locus_tag LOCUS_16770 gene rpsT 3275 3012 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence206 2583 3878 gene locus_tag LOCUS_16780 2583 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence207 1344 64 gene locus_tag LOCUS_16790 1344 64 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_16790 1894 1430 gene locus_tag LOCUS_16800 1894 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 2043 1912 gene locus_tag LOCUS_16810 2043 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 2849 2373 gene locus_tag LOCUS_16820 2849 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4016 3039 gene locus_tag LOCUS_16830 4016 3039 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence208 2341 218 gene locus_tag LOCUS_16840 2341 218 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_16840 <4037 2606 gene locus_tag LOCUS_16850 <4037 2606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461804.1:glutamine synthetase III >Feature sequence209 1538 1200 gene locus_tag LOCUS_16860 1538 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1668 1420 gene locus_tag LOCUS_16870 1668 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 <4009 1777 gene locus_tag LOCUS_16880 <4009 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002319708.1:DNA helicase PcrA >Feature sequence210 305 2371 gene locus_tag LOCUS_16890 305 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2529 3779 gene locus_tag LOCUS_16900 2529 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence211 423 1154 gene locus_tag LOCUS_16910 423 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1197 1664 gene locus_tag LOCUS_16920 1197 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16920 1213 1222 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1630 1926 gene locus_tag LOCUS_16930 1630 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16930 1648 1657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1920 2945 gene locus_tag LOCUS_16940 1920 2945 CDS product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610204.1 protein_id gnl|my_center|LOCUS_16940 3348 3357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence212 479 1759 gene locus_tag LOCUS_16950 479 1759 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_16950 3177 1837 gene locus_tag LOCUS_16960 3177 1837 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_16960 3941 3201 gene locus_tag LOCUS_16970 3941 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence213 176 901 gene locus_tag LOCUS_16980 176 901 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821952.1 protein_id gnl|my_center|LOCUS_16980 1783 908 gene locus_tag LOCUS_16990 1783 908 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082812.1 protein_id gnl|my_center|LOCUS_16990 1988 2977 gene locus_tag LOCUS_17000 1988 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3879 3094 gene locus_tag LOCUS_17010 3879 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence214 677 147 gene locus_tag LOCUS_17020 677 147 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_17020 1155 2321 gene locus_tag LOCUS_17030 1155 2321 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_17030 2356 2365 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3495 2461 gene locus_tag LOCUS_17040 3495 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence215 2286 1384 gene locus_tag LOCUS_17050 2286 1384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_17050 2653 2279 gene locus_tag LOCUS_17060 2653 2279 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645984.1 protein_id gnl|my_center|LOCUS_17060 <3803 2854 gene locus_tag LOCUS_17070 <3803 2854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262909.1:M20/M25/M40 family metallo-hydrolase >Feature sequence216 161 2428 gene locus_tag LOCUS_17080 161 2428 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922066.1 protein_id gnl|my_center|LOCUS_17080 2697 2918 gene locus_tag LOCUS_17090 2697 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2908 3312 gene locus_tag LOCUS_17100 2908 3312 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_17100 3309 3548 gene locus_tag LOCUS_17110 3309 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence217 1407 346 gene locus_tag LOCUS_17120 1407 346 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_17120 2241 1564 gene locus_tag LOCUS_17130 2241 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2444 3013 gene locus_tag LOCUS_17140 gene dhaS 2444 3013 CDS product dihydroxyacetone kinase transcriptional activator DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204220.1 protein_id gnl|my_center|LOCUS_17140 3719 2976 gene locus_tag LOCUS_17150 3719 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence218 <1 1291 gene locus_tag LOCUS_17160 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454735.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 1420 1689 gene locus_tag LOCUS_17170 1420 1689 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_17170 1674 2138 gene locus_tag LOCUS_17180 gene ruvX 1674 2138 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730148.1 protein_id gnl|my_center|LOCUS_17180 2167 2421 gene locus_tag LOCUS_17190 2167 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2459 3589 gene locus_tag LOCUS_17200 2459 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17200 3535 3558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence219 <1 2141 gene locus_tag LOCUS_17210 <1 2141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987043.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 2420 2235 gene locus_tag LOCUS_17220 2420 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2947 2432 gene locus_tag LOCUS_17230 2947 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17230 2443 2452 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3750 2980 gene locus_tag LOCUS_17240 3750 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence220 1095 676 gene locus_tag LOCUS_17250 1095 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17250 1640 1317 gene locus_tag LOCUS_17260 1640 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3495 1696 gene locus_tag LOCUS_17270 3495 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence221 <1 861 gene locus_tag LOCUS_17280 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437017.1:ABC transporter ATP-binding protein 851 1666 gene locus_tag LOCUS_17290 851 1666 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808911.1 protein_id gnl|my_center|LOCUS_17290 1663 3546 gene locus_tag LOCUS_17300 1663 3546 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948299.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence222 1023 2867 gene locus_tag LOCUS_17310 gene asnB 1023 2867 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906399.1 protein_id gnl|my_center|LOCUS_17310 2889 3533 gene locus_tag LOCUS_17320 2889 3533 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence223 254 337 gene locus_tag LOCUS_t00210 254 337 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 347 432 gene locus_tag LOCUS_t00220 347 432 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1560 550 gene locus_tag LOCUS_17330 1560 550 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_17330 1864 3360 gene locus_tag LOCUS_17340 gene malQ 1864 3360 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence224 >Feature sequence225 <1 625 gene locus_tag LOCUS_17350 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454967.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 650 1744 gene locus_tag LOCUS_17360 gene spoVE 650 1744 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_17360 1792 3054 gene locus_tag LOCUS_17370 gene murA 1792 3054 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence226 1958 780 gene locus_tag LOCUS_17380 1958 780 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_17380 2771 2058 gene locus_tag LOCUS_17390 2771 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3489 3007 gene locus_tag LOCUS_17400 3489 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence227 2920 1286 gene locus_tag LOCUS_17410 2920 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence228 1968 436 gene locus_tag LOCUS_17420 1968 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17420 2191 1856 gene locus_tag LOCUS_17430 2191 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17430 2831 2175 gene locus_tag LOCUS_17440 2831 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17440 2281 2290 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3478 2850 gene locus_tag LOCUS_17450 <3478 2850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022327.1:Ppx/GppA phosphatase family protein >Feature sequence229 101 307 gene locus_tag LOCUS_17460 101 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 326 451 gene locus_tag LOCUS_17470 326 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 569 1963 gene locus_tag LOCUS_17480 569 1963 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_17480 1999 2826 gene locus_tag LOCUS_17490 1999 2826 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814219.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence230 1447 101 gene locus_tag LOCUS_17500 gene ffh 1447 101 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_17500 1810 1472 gene locus_tag LOCUS_17510 1810 1472 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393779.1 protein_id gnl|my_center|LOCUS_17510 2874 1879 gene locus_tag LOCUS_17520 2874 1879 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222165.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence231 267 686 gene locus_tag LOCUS_17530 267 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_17530 1020 805 gene locus_tag LOCUS_17540 1020 805 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948188.1 protein_id gnl|my_center|LOCUS_17540 1162 2673 gene locus_tag LOCUS_17550 1162 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2889 2898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence232 597 1517 gene locus_tag LOCUS_17560 597 1517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_17560 1579 2442 gene locus_tag LOCUS_17570 1579 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence233 375 384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 636 1049 gene locus_tag LOCUS_17580 636 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 1232 2608 gene locus_tag LOCUS_17590 gene radA 1232 2608 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_17590 2928 2797 gene locus_tag LOCUS_17600 2928 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 3026 3035 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence234 221 583 gene locus_tag LOCUS_17610 221 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 665 1792 gene locus_tag LOCUS_17620 gene rpoD 665 1792 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_17620 2755 1865 gene locus_tag LOCUS_17630 2755 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence235 1395 283 gene locus_tag LOCUS_17640 1395 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2957 1395 gene locus_tag LOCUS_17650 2957 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence236 100 612 gene locus_tag LOCUS_17660 100 612 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939955.1 protein_id gnl|my_center|LOCUS_17660 1053 1175 gene locus_tag LOCUS_17670 1053 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1554 2552 gene locus_tag LOCUS_17680 1554 2552 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_17680 2881 2909 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence237 674 36 gene locus_tag LOCUS_17690 gene yihA 674 36 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_17690 3038 702 gene locus_tag LOCUS_17700 gene lon 3038 702 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence238 1495 188 gene locus_tag LOCUS_17710 gene hisD 1495 188 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_17710 2147 1500 gene locus_tag LOCUS_17720 gene hisG 2147 1500 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358779.1 protein_id gnl|my_center|LOCUS_17720 <3159 2144 gene locus_tag LOCUS_17730 <3159 2144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964253.1:ATP phosphoribosyltransferase regulatory subunit >Feature sequence239 1232 129 gene locus_tag LOCUS_17740 gene aroC 1232 129 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_17740 1377 1562 gene locus_tag LOCUS_17750 1377 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 1520 1771 gene locus_tag LOCUS_17760 1520 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1937 2770 gene locus_tag LOCUS_17770 1937 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence240 1341 265 gene locus_tag LOCUS_17780 gene mutY 1341 265 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989787.1 protein_id gnl|my_center|LOCUS_17780 2852 1437 gene locus_tag LOCUS_17790 2852 1437 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964065.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence241 1093 425 gene locus_tag LOCUS_17800 1093 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1365 1105 gene locus_tag LOCUS_17810 1365 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2386 1388 gene locus_tag LOCUS_17820 2386 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17820 1394 1403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3051 2554 gene locus_tag LOCUS_17830 3051 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence242 1487 2368 gene locus_tag LOCUS_17840 gene pdxS 1487 2368 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113518.1 protein_id gnl|my_center|LOCUS_17840 2368 2937 gene locus_tag LOCUS_17850 gene pdxT 2368 2937 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461704.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence243 139 1503 gene locus_tag LOCUS_17860 139 1503 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965017.1 protein_id gnl|my_center|LOCUS_17860 1496 2824 gene locus_tag LOCUS_17870 gene der 1496 2824 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence244 <2926 932 gene locus_tag LOCUS_17880 <2926 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012972567.1:choline binding-anchored murein hydrolase LytC >Feature sequence245 2660 873 gene locus_tag LOCUS_17890 2660 873 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence246 <1 946 gene locus_tag LOCUS_17900 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013363706.1:DNA methylase 939 1358 gene locus_tag LOCUS_17910 939 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1521 1916 gene locus_tag LOCUS_17920 1521 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 1859 1868 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1883 2440 gene locus_tag LOCUS_17930 1883 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17930 >Feature sequence247 1533 436 gene locus_tag LOCUS_17940 gene glf 1533 436 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986979.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence248 >Feature sequence249 743 1411 gene locus_tag LOCUS_17950 743 1411 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437518.1 protein_id gnl|my_center|LOCUS_17950 <2771 1392 gene locus_tag LOCUS_17960 <2771 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043943623.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence250 36 398 gene locus_tag LOCUS_17970 36 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 418 1401 gene locus_tag LOCUS_17980 gene hemB 418 1401 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_17980 1401 2681 gene locus_tag LOCUS_17990 gene hemL 1401 2681 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095641.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence251 <1 735 gene locus_tag LOCUS_18000 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416645.1:GTPase Era 806 1582 gene locus_tag LOCUS_18010 gene recO 806 1582 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730435.1 protein_id gnl|my_center|LOCUS_18010 1711 2478 gene locus_tag LOCUS_18020 1711 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence252 62 655 gene locus_tag LOCUS_18030 gene rpsD 62 655 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_18030 723 1682 gene locus_tag LOCUS_18040 723 1682 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225835.1 protein_id gnl|my_center|LOCUS_18040 1820 2356 gene locus_tag LOCUS_18050 gene rplQ 1820 2356 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence253 <2664 331 gene locus_tag LOCUS_18060 <2664 331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000515824.1:beta-N-acetylglucosaminidase domain-containing protein >Feature sequence254 859 233 gene locus_tag LOCUS_18070 859 233 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530477.1 protein_id gnl|my_center|LOCUS_18070 1197 2576 gene locus_tag LOCUS_18080 1197 2576 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence255 1558 497 gene locus_tag LOCUS_18090 1558 497 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_18090 <2640 1700 gene locus_tag LOCUS_18100 <2640 1700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016741.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase >Feature sequence256 227 1024 gene locus_tag LOCUS_18110 gene rfbD 227 1024 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_18110 <2638 1138 gene locus_tag LOCUS_18120 <2638 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_018306202.1:aryl-sulfate sulfotransferase >Feature sequence257 2502 931 gene locus_tag LOCUS_18130 2502 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 1020 1029 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence258 1487 753 gene locus_tag LOCUS_18140 gene rpsB 1487 753 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_18140 <2615 1647 gene locus_tag LOCUS_18150 <2615 1647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244568.1:ABC transporter permease >Feature sequence259 195 4 gene locus_tag LOCUS_18160 195 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 527 210 gene locus_tag LOCUS_18170 527 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1069 680 gene locus_tag LOCUS_18180 1069 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1959 1165 gene locus_tag LOCUS_18190 1959 1165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_18190 <2560 1952 gene locus_tag LOCUS_18200 <2560 1952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811777.1:ABC transporter permease >Feature sequence260 771 154 gene locus_tag LOCUS_18210 771 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18210 <2557 764 gene locus_tag LOCUS_18220 <2557 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048254.1:insulinase family protein note possible pseudo, frameshifted 798 807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence261 <2516 1297 gene locus_tag LOCUS_18230 <2516 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861666.1:thioether cross-link-forming SCIFF peptide maturase >Feature sequence262 974 291 gene locus_tag LOCUS_18240 974 291 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_18240 2514 997 gene locus_tag LOCUS_18250 2514 997 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence263 145 915 gene locus_tag LOCUS_18260 145 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1025 2194 gene locus_tag LOCUS_18270 1025 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18270 2086 2095 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2116 2466 gene locus_tag LOCUS_18280 2116 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18280 >Feature sequence264 295 110 gene locus_tag LOCUS_18290 gene rpmB 295 110 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_18290 494 850 gene locus_tag LOCUS_18300 494 850 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence265 346 68 gene locus_tag LOCUS_18310 346 68 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_18310 1543 350 gene locus_tag LOCUS_18320 gene nusA 1543 350 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460395.1 protein_id gnl|my_center|LOCUS_18320 2031 1567 gene locus_tag LOCUS_18330 2031 1567 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence266 1685 525 gene locus_tag LOCUS_18340 1685 525 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_18340 1812 1687 gene locus_tag LOCUS_18350 1812 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18350 <2490 1856 gene locus_tag LOCUS_18360 <2490 1856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462039.1:3-phosphoserine/phosphohydroxythreonine transaminase note possible pseudo, frameshifted >Feature sequence267 <1 1080 gene locus_tag LOCUS_18370 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966776.1:methyl-accepting chemotaxis protein 1706 1104 gene locus_tag LOCUS_18380 1706 1104 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_18380 1857 1866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2001 2249 gene locus_tag LOCUS_18390 2001 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2237 2246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence268 638 1282 gene locus_tag LOCUS_18400 638 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence269 3 569 gene locus_tag LOCUS_18410 3 569 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642751.1 protein_id gnl|my_center|LOCUS_18410 586 1833 gene locus_tag LOCUS_18420 586 1833 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_18420 2194 2382 gene locus_tag LOCUS_18430 2194 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 >Feature sequence270 <1 1190 gene locus_tag LOCUS_18440 <1 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898459.1:Na/Pi cotransporter family protein note possible pseudo, internal stop codon 1203 1493 gene locus_tag LOCUS_18450 1203 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 1667 2053 gene locus_tag LOCUS_18460 1667 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence271 875 168 gene locus_tag LOCUS_18470 875 168 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898027.1 protein_id gnl|my_center|LOCUS_18470 1423 872 gene locus_tag LOCUS_18480 1423 872 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_18480 1976 1494 gene locus_tag LOCUS_18490 1976 1494 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence272 <1 2091 gene locus_tag LOCUS_18500 <1 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807931.1:glutamate synthase large subunit >Feature sequence273 <1 2260 gene locus_tag LOCUS_18510 <1 2260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401468.1:excinuclease ABC subunit UvrA >Feature sequence274 354 626 gene locus_tag LOCUS_18520 354 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 623 1387 gene locus_tag LOCUS_18530 gene istB 623 1387 CDS product IS21-like element ISPsy14 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104225.1 protein_id gnl|my_center|LOCUS_18530 1758 1390 gene locus_tag LOCUS_18540 1758 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence275 459 319 gene locus_tag LOCUS_18550 459 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 1493 846 gene locus_tag LOCUS_18560 1493 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence276 1511 528 gene locus_tag LOCUS_18570 1511 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence277 692 6 gene locus_tag LOCUS_18580 692 6 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964567.1 protein_id gnl|my_center|LOCUS_18580 <2207 676 gene locus_tag LOCUS_18590 <2207 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964566.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence278 183 665 gene locus_tag LOCUS_18600 gene greA 183 665 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence279 174 1013 gene locus_tag LOCUS_18610 gene dapF 174 1013 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_18610 1129 1833 gene locus_tag LOCUS_18620 1129 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18620 1820 1829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence280 >Feature sequence281 >Feature sequence282 190 909 gene locus_tag LOCUS_18630 190 909 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_18630 906 1535 gene locus_tag LOCUS_18640 906 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 1522 1872 gene locus_tag LOCUS_18650 1522 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18650 >Feature sequence283 2049 1192 gene locus_tag LOCUS_18660 2049 1192 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence284 1196 1023 gene locus_tag LOCUS_18670 1196 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1390 1199 gene locus_tag LOCUS_18680 1390 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 <2048 1380 gene locus_tag LOCUS_18690 <2048 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000797500.1:HAMP domain-containing sensor histidine kinase >Feature sequence285 1095 175 gene locus_tag LOCUS_18700 1095 175 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence286 >Feature sequence287 1637 768 gene locus_tag LOCUS_18710 gene rfbA 1637 768 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence288 2 595 gene locus_tag LOCUS_18720 2 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 623 1870 gene locus_tag LOCUS_18730 gene hydF 623 1870 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence289 1409 663 gene locus_tag LOCUS_18740 1409 663 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_18740 <1951 1425 gene locus_tag LOCUS_18750 <1951 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990133.1:50S ribosomal protein L11 methyltransferase >Feature sequence290 501 193 gene locus_tag LOCUS_18760 501 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 954 574 gene locus_tag LOCUS_18770 954 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18770 1828 881 gene locus_tag LOCUS_18780 1828 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 909 918 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence291 533 330 gene locus_tag LOCUS_18790 533 330 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_18790 1557 535 gene locus_tag LOCUS_18800 1557 535 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence292 503 33 gene locus_tag LOCUS_18810 gene spoVAC 503 33 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965602.1 protein_id gnl|my_center|LOCUS_18810 957 535 gene locus_tag LOCUS_18820 957 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1621 959 gene locus_tag LOCUS_18830 1621 959 CDS product stage V sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000438369.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence293 683 1183 gene locus_tag LOCUS_18840 683 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence294 <1 1505 gene locus_tag LOCUS_18850 <1 1505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964031.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence295 >Feature sequence296 1356 256 gene locus_tag LOCUS_18860 gene tyrA 1356 256 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228123.1 protein_id gnl|my_center|LOCUS_18860 >Feature sequence297 499 92 gene locus_tag LOCUS_18870 499 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 611 456 gene locus_tag LOCUS_18880 611 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1432 740 gene locus_tag LOCUS_18890 1432 740 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_18890 947 956 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1700 1416 gene locus_tag LOCUS_18900 1700 1416 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence298 1162 191 gene locus_tag LOCUS_18910 1162 191 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_18910 1529 1146 gene locus_tag LOCUS_18920 gene rbfA 1529 1146 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence299 1519 632 gene locus_tag LOCUS_18930 1519 632 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence300 767 630 gene locus_tag LOCUS_18940 767 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 <1620 778 gene locus_tag LOCUS_18950 <1620 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888359.1:threonine--tRNA ligase >Feature sequence301 1276 1296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence302 1183 830 gene locus_tag LOCUS_18960 1183 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence303 >Feature sequence304 1062 85 gene locus_tag LOCUS_18970 gene bsh 1062 85 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence305 1279 509 gene locus_tag LOCUS_18980 1279 509 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915025.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence306 >Feature sequence307 70 519 gene locus_tag LOCUS_18990 70 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 633 899 gene locus_tag LOCUS_19000 gene rpsO 633 899 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence308 396 611 gene locus_tag LOCUS_19010 396 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 582 591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence309 >Feature sequence310 >Feature sequence311 >Feature sequence312 549 148 gene locus_tag LOCUS_19020 549 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 <1134 563 gene locus_tag LOCUS_19030 <1134 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861114.1:ATP-binding protein >Feature sequence313 >Feature sequence314 >Feature sequence315 >Feature sequence316 <1 766 gene locus_tag LOCUS_19040 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949155.1:homocysteine S-methyltransferase family protein >Feature sequence317 >Feature sequence318 862 578 gene locus_tag LOCUS_19050 862 578 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476589.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence319 >Feature sequence320 >Feature sequence321 452 658 gene locus_tag LOCUS_19060 452 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19060 597 606 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence322 544 553 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence323 166 92 gene locus_tag LOCUS_t00230 166 92 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence324 783 529 gene locus_tag LOCUS_19070 783 529 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476589.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence325 >Feature sequence326 >Feature sequence327 2 397 gene locus_tag LOCUS_19080 2 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19080 340 349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence328 49 480 gene locus_tag LOCUS_19090 49 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence329 736 419 gene locus_tag LOCUS_19100 736 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence330 367 376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence331 >Feature sequence332 >Feature sequence333 >Feature sequence334 >Feature sequence335 >Feature sequence336 269 541 gene locus_tag LOCUS_19110 269 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence337 1 306 gene locus_tag LOCUS_19120 1 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19120 293 302 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence338 >Feature sequence339 >Feature sequence340 2 247 gene locus_tag LOCUS_19130 2 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence341 430 176 gene locus_tag LOCUS_19140 430 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence342 272 281 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence343 >Feature sequence344 >Feature sequence345 >Feature sequence346 317 493 gene locus_tag LOCUS_19150 317 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150