>Feature sequence001 351 1706 gene locus_tag LOCUS_00010 351 1706 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_00010 3179 1809 gene locus_tag LOCUS_00020 3179 1809 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_00020 3355 4221 gene locus_tag LOCUS_00030 3355 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4498 5709 gene locus_tag LOCUS_00040 4498 5709 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_00040 7317 5800 gene locus_tag LOCUS_00050 gene gpmI 7317 5800 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_00050 8217 7450 gene locus_tag LOCUS_00060 gene tpiA 8217 7450 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_00060 8447 8214 gene locus_tag LOCUS_00070 8447 8214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9760 8546 gene locus_tag LOCUS_00080 9760 8546 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_00080 12854 10029 gene locus_tag LOCUS_00090 gene uvrA 12854 10029 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_00090 14822 12858 gene locus_tag LOCUS_00100 gene uvrB 14822 12858 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_00100 15619 14846 gene locus_tag LOCUS_00110 gene radC 15619 14846 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328269.1 protein_id gnl|my_center|LOCUS_00110 15902 16816 gene locus_tag LOCUS_00120 15902 16816 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_00120 18373 16937 gene locus_tag LOCUS_00130 gene gatB 18373 16937 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966259.1 protein_id gnl|my_center|LOCUS_00130 19851 18391 gene locus_tag LOCUS_00140 gene gatA 19851 18391 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_00140 20134 19865 gene locus_tag LOCUS_00150 gene gatC 20134 19865 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929772.1 protein_id gnl|my_center|LOCUS_00150 22187 20217 gene locus_tag LOCUS_00160 gene ligA 22187 20217 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361258.1 protein_id gnl|my_center|LOCUS_00160 20286 20295 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22987 22307 gene locus_tag LOCUS_00170 gene yunB 22987 22307 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_00170 23892 23125 gene locus_tag LOCUS_00180 23892 23125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24479 24132 gene locus_tag LOCUS_00190 gene hisI 24479 24132 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721356.1 protein_id gnl|my_center|LOCUS_00190 24831 24466 gene locus_tag LOCUS_00200 24831 24466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 25610 24855 gene locus_tag LOCUS_00210 gene hisF 25610 24855 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964259.1 protein_id gnl|my_center|LOCUS_00210 26342 25614 gene locus_tag LOCUS_00220 gene hisA 26342 25614 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949114.1 protein_id gnl|my_center|LOCUS_00220 26947 26339 gene locus_tag LOCUS_00230 gene hisH 26947 26339 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560341.1 protein_id gnl|my_center|LOCUS_00230 27531 26950 gene locus_tag LOCUS_00240 gene hisB 27531 26950 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 protein_id gnl|my_center|LOCUS_00240 28464 27553 gene locus_tag LOCUS_00250 28464 27553 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053942.1 protein_id gnl|my_center|LOCUS_00250 29771 28464 gene locus_tag LOCUS_00260 gene hisD 29771 28464 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964255.1 protein_id gnl|my_center|LOCUS_00260 30403 29768 gene locus_tag LOCUS_00270 gene hisG 30403 29768 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964254.1 protein_id gnl|my_center|LOCUS_00270 31600 30404 gene locus_tag LOCUS_00280 31600 30404 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_00280 35775 31678 gene locus_tag LOCUS_00290 35775 31678 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986794.1 protein_id gnl|my_center|LOCUS_00290 37075 35708 gene locus_tag LOCUS_00300 37075 35708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36042 36051 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 38155 37088 gene locus_tag LOCUS_00310 gene rseP 38155 37088 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_00310 39391 38246 gene locus_tag LOCUS_00320 39391 38246 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_00320 40303 39488 gene locus_tag LOCUS_00330 gene cdsA 40303 39488 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_00330 41067 40306 gene locus_tag LOCUS_00340 gene uppS 41067 40306 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384345.1 protein_id gnl|my_center|LOCUS_00340 41666 41112 gene locus_tag LOCUS_00350 gene frr 41666 41112 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_00350 42456 41725 gene locus_tag LOCUS_00360 gene pyrH 42456 41725 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_00360 43587 42664 gene locus_tag LOCUS_00370 gene tsf 43587 42664 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_00370 44443 43703 gene locus_tag LOCUS_00380 gene rpsB 44443 43703 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392546.1 protein_id gnl|my_center|LOCUS_00380 44894 44598 gene locus_tag LOCUS_00390 44894 44598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45498 44941 gene locus_tag LOCUS_00400 45498 44941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46550 45600 gene locus_tag LOCUS_00410 46550 45600 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_00410 48212 46554 gene locus_tag LOCUS_00420 48212 46554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 49140 48226 gene locus_tag LOCUS_00430 49140 48226 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542473.1 protein_id gnl|my_center|LOCUS_00430 49645 49133 gene locus_tag LOCUS_00440 gene lspA 49645 49133 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922145.1 protein_id gnl|my_center|LOCUS_00440 52489 49664 gene locus_tag LOCUS_00450 gene ileS 52489 49664 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_00450 53161 52511 gene locus_tag LOCUS_00460 53161 52511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 53975 53205 gene locus_tag LOCUS_00470 53975 53205 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002164454.1 protein_id gnl|my_center|LOCUS_00470 54482 53985 gene locus_tag LOCUS_00480 54482 53985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55216 54518 gene locus_tag LOCUS_00490 55216 54518 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_00490 56483 55206 gene locus_tag LOCUS_00500 56483 55206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56769 56530 gene locus_tag LOCUS_00510 gene hfq 56769 56530 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811582.1 protein_id gnl|my_center|LOCUS_00510 57805 56843 gene locus_tag LOCUS_00520 gene miaA 57805 56843 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245569.1 protein_id gnl|my_center|LOCUS_00520 59821 57809 gene locus_tag LOCUS_00530 gene mutL 59821 57809 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_00530 62518 59894 gene locus_tag LOCUS_00540 gene mutS 62518 59894 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_00540 62983 62567 gene locus_tag LOCUS_00550 62983 62567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 64392 62980 gene locus_tag LOCUS_00560 gene miaB 64392 62980 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_00560 64936 65841 gene locus_tag LOCUS_00570 64936 65841 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461526.1 protein_id gnl|my_center|LOCUS_00570 68925 66988 gene locus_tag LOCUS_00580 68925 66988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 70396 69122 gene locus_tag LOCUS_00590 70396 69122 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_00590 71185 70400 gene locus_tag LOCUS_00600 71185 70400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 72219 71182 gene locus_tag LOCUS_00610 72219 71182 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_00610 73232 72213 gene locus_tag LOCUS_00620 73232 72213 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_00620 74625 73234 gene locus_tag LOCUS_00630 gene murD 74625 73234 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_00630 75351 74719 gene locus_tag LOCUS_00640 75351 74719 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_00640 76851 75658 gene locus_tag LOCUS_00650 gene coaBC 76851 75658 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_00650 77247 76864 gene locus_tag LOCUS_00660 77247 76864 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287876.1 protein_id gnl|my_center|LOCUS_00660 78104 77244 gene locus_tag LOCUS_00670 gene panC 78104 77244 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287875.1 protein_id gnl|my_center|LOCUS_00670 78943 78101 gene locus_tag LOCUS_00680 gene panB 78943 78101 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287874.1 protein_id gnl|my_center|LOCUS_00680 79216 81138 gene locus_tag LOCUS_00690 79216 81138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 81348 82076 gene locus_tag LOCUS_00700 81348 82076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 82374 82754 gene locus_tag LOCUS_00710 82374 82754 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583004.1 protein_id gnl|my_center|LOCUS_00710 82748 83485 gene locus_tag LOCUS_00720 82748 83485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666599.1 protein_id gnl|my_center|LOCUS_00720 83513 84364 gene locus_tag LOCUS_00730 83513 84364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 84361 84588 gene locus_tag LOCUS_00740 84361 84588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 86031 84637 gene locus_tag LOCUS_00750 86031 84637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 >Feature sequence002 305 1555 gene locus_tag LOCUS_00760 305 1555 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_00760 1577 2488 gene locus_tag LOCUS_00770 1577 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 2510 3169 gene locus_tag LOCUS_00780 2510 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 3166 4038 gene locus_tag LOCUS_00790 3166 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 4112 4576 gene locus_tag LOCUS_00800 4112 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 4593 4901 gene locus_tag LOCUS_00810 4593 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 4915 5511 gene locus_tag LOCUS_00820 4915 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 5769 7445 gene locus_tag LOCUS_00830 5769 7445 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_00830 7473 8522 gene locus_tag LOCUS_00840 7473 8522 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_00840 8560 12066 gene locus_tag LOCUS_00850 8560 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 12926 12141 gene locus_tag LOCUS_00860 12926 12141 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_00860 13132 13713 gene locus_tag LOCUS_00870 gene eutD 13132 13713 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721580.1 protein_id gnl|my_center|LOCUS_00870 13831 15969 gene locus_tag LOCUS_00880 13831 15969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 16149 16760 gene locus_tag LOCUS_00890 16149 16760 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_00890 17137 18921 gene locus_tag LOCUS_00900 17137 18921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 19729 19460 gene locus_tag LOCUS_00910 19729 19460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 20557 20285 gene locus_tag LOCUS_00920 20557 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 20685 21137 gene locus_tag LOCUS_00930 20685 21137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 21298 21624 gene locus_tag LOCUS_00940 21298 21624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 21624 22706 gene locus_tag LOCUS_00950 gene hemW 21624 22706 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_00950 22823 22832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 22955 23584 gene locus_tag LOCUS_00960 22955 23584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 23923 24354 gene locus_tag LOCUS_00970 gene infC 23923 24354 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_00970 24371 24574 gene locus_tag LOCUS_00980 gene rpmI 24371 24574 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869473.1 protein_id gnl|my_center|LOCUS_00980 24632 24985 gene locus_tag LOCUS_00990 gene rplT 24632 24985 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_00990 25134 25955 gene locus_tag LOCUS_01000 25134 25955 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003158483.1 protein_id gnl|my_center|LOCUS_01000 25957 27201 gene locus_tag LOCUS_01010 25957 27201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 27285 29378 gene locus_tag LOCUS_01020 gene topA 27285 29378 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_01020 29379 30689 gene locus_tag LOCUS_01030 gene trmFO 29379 30689 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475886.1 protein_id gnl|my_center|LOCUS_01030 30760 31758 gene locus_tag LOCUS_01040 gene plsX 30760 31758 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684092.1 protein_id gnl|my_center|LOCUS_01040 31772 32485 gene locus_tag LOCUS_01050 gene rnc 31772 32485 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_01050 32472 33503 gene locus_tag LOCUS_01060 32472 33503 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_01060 33500 34141 gene locus_tag LOCUS_01070 33500 34141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 34185 37745 gene locus_tag LOCUS_01080 gene smc 34185 37745 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_01080 37813 39327 gene locus_tag LOCUS_01090 37813 39327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 39324 39908 gene locus_tag LOCUS_01100 39324 39908 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886588.1 protein_id gnl|my_center|LOCUS_01100 40122 40409 gene locus_tag LOCUS_01110 gene yhbY 40122 40409 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_01110 40409 41008 gene locus_tag LOCUS_01120 gene nadD 40409 41008 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223158.1 protein_id gnl|my_center|LOCUS_01120 41041 41625 gene locus_tag LOCUS_01130 gene yqeK 41041 41625 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392103.1 protein_id gnl|my_center|LOCUS_01130 41629 42873 gene locus_tag LOCUS_01140 41629 42873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 42893 43264 gene locus_tag LOCUS_01150 gene rsfS 42893 43264 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_01150 43299 43625 gene locus_tag LOCUS_01160 43299 43625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 43652 46066 gene locus_tag LOCUS_01170 gene leuS 43652 46066 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_01170 46281 46454 gene locus_tag LOCUS_01180 46281 46454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 46798 47304 gene locus_tag LOCUS_01190 46798 47304 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_01190 47306 47737 gene locus_tag LOCUS_01200 gene aroQ 47306 47737 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757082.1 protein_id gnl|my_center|LOCUS_01200 47753 48832 gene locus_tag LOCUS_01210 47753 48832 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722481.1 protein_id gnl|my_center|LOCUS_01210 48848 49348 gene locus_tag LOCUS_01220 48848 49348 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681732.1 protein_id gnl|my_center|LOCUS_01220 49569 50126 gene locus_tag LOCUS_01230 gene efp 49569 50126 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_01230 50219 50704 gene locus_tag LOCUS_01240 50219 50704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 50890 51720 gene locus_tag LOCUS_01250 50890 51720 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_01250 51723 53123 gene locus_tag LOCUS_01260 gene gltA 51723 53123 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986285.1 protein_id gnl|my_center|LOCUS_01260 53164 53667 gene locus_tag LOCUS_01270 53164 53667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 53818 54225 gene locus_tag LOCUS_01280 53818 54225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 54370 54507 gene locus_tag LOCUS_01290 gene scfA 54370 54507 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_01290 54646 56034 gene locus_tag LOCUS_01300 gene scfB 54646 56034 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_01300 56937 56155 gene locus_tag LOCUS_01310 56937 56155 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965542.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence003 3013 686 gene locus_tag LOCUS_01320 3013 686 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861587.1 protein_id gnl|my_center|LOCUS_01320 3693 3028 gene locus_tag LOCUS_01330 3693 3028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861403.1 protein_id gnl|my_center|LOCUS_01330 4875 3844 gene locus_tag LOCUS_01340 4875 3844 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861402.1 protein_id gnl|my_center|LOCUS_01340 5561 4872 gene locus_tag LOCUS_01350 5561 4872 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861401.1 protein_id gnl|my_center|LOCUS_01350 5904 5770 gene locus_tag LOCUS_01360 5904 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 6050 6238 gene locus_tag LOCUS_01370 6050 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 6274 6939 gene locus_tag LOCUS_01380 6274 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903164.1 protein_id gnl|my_center|LOCUS_01380 6955 8697 gene locus_tag LOCUS_01390 6955 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 8850 9437 gene locus_tag LOCUS_01400 8850 9437 CDS product master DNA invertase Mpi family serine-type recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680425.1 protein_id gnl|my_center|LOCUS_01400 9443 11020 gene locus_tag LOCUS_01410 9443 11020 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_01410 12184 11438 gene locus_tag LOCUS_01420 gene istB 12184 11438 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_01420 13617 12181 gene locus_tag LOCUS_01430 gene istA 13617 12181 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128955176.1 protein_id gnl|my_center|LOCUS_01430 17182 14027 gene locus_tag LOCUS_01440 17182 14027 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674564.1 protein_id gnl|my_center|LOCUS_01440 19312 17489 gene locus_tag LOCUS_01450 19312 17489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_01450 21632 19302 gene locus_tag LOCUS_01460 21632 19302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986473.1 protein_id gnl|my_center|LOCUS_01460 22086 21625 gene locus_tag LOCUS_01470 22086 21625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 23055 22465 gene locus_tag LOCUS_01480 23055 22465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 23559 23059 gene locus_tag LOCUS_01490 23559 23059 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896384.1 protein_id gnl|my_center|LOCUS_01490 23901 25094 gene locus_tag LOCUS_01500 23901 25094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 26700 25165 gene locus_tag LOCUS_01510 26700 25165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 28563 27064 gene locus_tag LOCUS_01520 28563 27064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 29150 28563 gene locus_tag LOCUS_01530 29150 28563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 29532 30839 gene locus_tag LOCUS_01540 29532 30839 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451037.1 protein_id gnl|my_center|LOCUS_01540 32295 31237 gene locus_tag LOCUS_01550 32295 31237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 34107 32806 gene locus_tag LOCUS_01560 gene eno 34107 32806 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964032.1 protein_id gnl|my_center|LOCUS_01560 35218 34541 gene locus_tag LOCUS_01570 gene tsaA 35218 34541 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_01570 35928 35260 gene locus_tag LOCUS_01580 35928 35260 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435186.1 protein_id gnl|my_center|LOCUS_01580 36788 35925 gene locus_tag LOCUS_01590 36788 35925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_01590 37168 36791 gene locus_tag LOCUS_01600 37168 36791 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_01600 37436 39832 gene locus_tag LOCUS_01610 37436 39832 CDS product N,N'-diacetylchitobiose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195978718.1 protein_id gnl|my_center|LOCUS_01610 39777 40031 gene locus_tag LOCUS_01620 39777 40031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 40405 40935 gene locus_tag LOCUS_01630 40405 40935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 41996 40986 gene locus_tag LOCUS_01640 41996 40986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 43214 42279 gene locus_tag LOCUS_01650 43214 42279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 44569 43238 gene locus_tag LOCUS_01660 44569 43238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 45168 44566 gene locus_tag LOCUS_01670 45168 44566 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459480.1 protein_id gnl|my_center|LOCUS_01670 46960 45257 gene locus_tag LOCUS_01680 46960 45257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 48470 46998 gene locus_tag LOCUS_01690 48470 46998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 49732 48467 gene locus_tag LOCUS_01700 49732 48467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 51553 49754 gene locus_tag LOCUS_01710 gene glmS 51553 49754 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_01710 52187 53446 gene locus_tag LOCUS_01720 52187 53446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 53448 53672 gene locus_tag LOCUS_01730 53448 53672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 55407 53755 gene locus_tag LOCUS_01740 55407 53755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 >Feature sequence004 3310 158 gene locus_tag LOCUS_01750 3310 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4050 3313 gene locus_tag LOCUS_01760 4050 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6373 4052 gene locus_tag LOCUS_01770 6373 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 6761 6492 gene locus_tag LOCUS_01780 6761 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 7189 6785 gene locus_tag LOCUS_01790 7189 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 7850 7203 gene locus_tag LOCUS_01800 7850 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 8232 7852 gene locus_tag LOCUS_01810 8232 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 8711 8229 gene locus_tag LOCUS_01820 8711 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 9061 8708 gene locus_tag LOCUS_01830 9061 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 9576 9064 gene locus_tag LOCUS_01840 9576 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 10551 9589 gene locus_tag LOCUS_01850 10551 9589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 11129 10554 gene locus_tag LOCUS_01860 11129 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 11736 11275 gene locus_tag LOCUS_01870 11736 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 12048 11812 gene locus_tag LOCUS_01880 12048 11812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 13537 12014 gene locus_tag LOCUS_01890 13537 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 14981 13503 gene locus_tag LOCUS_01900 14981 13503 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714187.1 protein_id gnl|my_center|LOCUS_01900 16390 14993 gene locus_tag LOCUS_01910 gene terL 16390 14993 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819485.1 protein_id gnl|my_center|LOCUS_01910 16766 16383 gene locus_tag LOCUS_01920 16766 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 17292 16888 gene locus_tag LOCUS_01930 17292 16888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 17768 17289 gene locus_tag LOCUS_01940 17768 17289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 17986 17849 gene locus_tag LOCUS_01950 17986 17849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 19359 17983 gene locus_tag LOCUS_01960 19359 17983 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_01960 19661 19356 gene locus_tag LOCUS_01970 19661 19356 CDS product VRR-NUC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714182.1 protein_id gnl|my_center|LOCUS_01970 22309 19919 gene locus_tag LOCUS_01980 22309 19919 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_01980 24311 22323 gene locus_tag LOCUS_01990 24311 22323 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_01990 25012 24308 gene locus_tag LOCUS_02000 25012 24308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 26157 25009 gene locus_tag LOCUS_02010 26157 25009 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_02010 26588 26157 gene locus_tag LOCUS_02020 26588 26157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 27004 26687 gene locus_tag LOCUS_02030 27004 26687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 27185 26997 gene locus_tag LOCUS_02040 27185 26997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 27936 27223 gene locus_tag LOCUS_02050 27936 27223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976047.1 protein_id gnl|my_center|LOCUS_02050 28156 27914 gene locus_tag LOCUS_02060 28156 27914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 28404 28156 gene locus_tag LOCUS_02070 28404 28156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 28810 28571 gene locus_tag LOCUS_02080 28810 28571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 29565 28861 gene locus_tag LOCUS_02090 29565 28861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 29767 29585 gene locus_tag LOCUS_02100 29767 29585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 30059 31063 gene locus_tag LOCUS_02110 30059 31063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 31395 31204 gene locus_tag LOCUS_02120 31395 31204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 31592 31428 gene locus_tag LOCUS_02130 31592 31428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 31819 31589 gene locus_tag LOCUS_02140 31819 31589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 31900 32217 gene locus_tag LOCUS_02150 31900 32217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 32716 33333 gene locus_tag LOCUS_02160 32716 33333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 33391 34824 gene locus_tag LOCUS_02170 33391 34824 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286106.1 protein_id gnl|my_center|LOCUS_02170 34945 35406 gene locus_tag LOCUS_02180 34945 35406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 35608 36420 gene locus_tag LOCUS_02190 35608 36420 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_02190 36877 37341 gene locus_tag LOCUS_02200 36877 37341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 37354 38385 gene locus_tag LOCUS_02210 37354 38385 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_02210 38692 40098 gene locus_tag LOCUS_02220 38692 40098 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964872.1 protein_id gnl|my_center|LOCUS_02220 40118 41776 gene locus_tag LOCUS_02230 40118 41776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 41789 43588 gene locus_tag LOCUS_02240 41789 43588 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_02240 43585 43863 gene locus_tag LOCUS_02250 43585 43863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 44021 45178 gene locus_tag LOCUS_02260 44021 45178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 45481 45251 gene locus_tag LOCUS_02270 45481 45251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 46236 45478 gene locus_tag LOCUS_02280 gene thiF 46236 45478 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056327.1 protein_id gnl|my_center|LOCUS_02280 46974 46258 gene locus_tag LOCUS_02290 46974 46258 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_02290 49010 46971 gene locus_tag LOCUS_02300 49010 46971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 49974 49306 gene locus_tag LOCUS_02310 49974 49306 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_02310 50894 49977 gene locus_tag LOCUS_02320 gene nadA 50894 49977 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066395.1 protein_id gnl|my_center|LOCUS_02320 51066 50899 gene locus_tag LOCUS_02330 51066 50899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 >Feature sequence005 1139 96 gene locus_tag LOCUS_02340 1139 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 1356 1153 gene locus_tag LOCUS_02350 1356 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 1594 1346 gene locus_tag LOCUS_02360 1594 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 1426 1435 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2056 1598 gene locus_tag LOCUS_02370 2056 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2426 2067 gene locus_tag LOCUS_02380 2426 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 3309 2428 gene locus_tag LOCUS_02390 3309 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3827 4165 gene locus_tag LOCUS_02400 3827 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 4433 6832 gene locus_tag LOCUS_02410 4433 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6834 7814 gene locus_tag LOCUS_02420 6834 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 11052 7984 gene locus_tag LOCUS_02430 11052 7984 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963882.1 protein_id gnl|my_center|LOCUS_02430 12410 11436 gene locus_tag LOCUS_02440 12410 11436 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013877237.1 protein_id gnl|my_center|LOCUS_02440 13758 12553 gene locus_tag LOCUS_02450 13758 12553 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_02450 15339 13846 gene locus_tag LOCUS_02460 15339 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 16281 15376 gene locus_tag LOCUS_02470 gene ftsX 16281 15376 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968247.1 protein_id gnl|my_center|LOCUS_02470 16960 16271 gene locus_tag LOCUS_02480 gene ftsE 16960 16271 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963819.1 protein_id gnl|my_center|LOCUS_02480 18233 17184 gene locus_tag LOCUS_02490 18233 17184 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966511.1 protein_id gnl|my_center|LOCUS_02490 20227 18536 gene locus_tag LOCUS_02500 gene argS 20227 18536 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393887.1 protein_id gnl|my_center|LOCUS_02500 20680 20231 gene locus_tag LOCUS_02510 20680 20231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 21537 20698 gene locus_tag LOCUS_02520 gene murI 21537 20698 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_02520 22685 21615 gene locus_tag LOCUS_02530 22685 21615 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_02530 23189 23338 gene locus_tag LOCUS_02540 gene rpmG 23189 23338 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_02540 23354 23668 gene locus_tag LOCUS_02550 23354 23668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 23698 24225 gene locus_tag LOCUS_02560 gene nusG 23698 24225 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_02560 24322 24747 gene locus_tag LOCUS_02570 gene rplK 24322 24747 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966425.1 protein_id gnl|my_center|LOCUS_02570 24842 25537 gene locus_tag LOCUS_02580 gene rplA 24842 25537 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_02580 25863 26375 gene locus_tag LOCUS_02590 gene rplJ 25863 26375 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_02590 26437 26811 gene locus_tag LOCUS_02600 gene rplL 26437 26811 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273586.1 protein_id gnl|my_center|LOCUS_02600 27142 26888 gene locus_tag LOCUS_02610 27142 26888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 27494 27156 gene locus_tag LOCUS_02620 27494 27156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 27973 27611 gene locus_tag LOCUS_02630 27973 27611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 28333 28085 gene locus_tag LOCUS_02640 28333 28085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 28492 28995 gene locus_tag LOCUS_02650 28492 28995 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_02650 29257 31746 gene locus_tag LOCUS_02660 29257 31746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 31881 32426 gene locus_tag LOCUS_02670 31881 32426 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_02670 32857 32534 gene locus_tag LOCUS_02680 32857 32534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 33099 34529 gene locus_tag LOCUS_02690 gene murC 33099 34529 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_02690 34902 35258 gene locus_tag LOCUS_02700 34902 35258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 35255 37297 gene locus_tag LOCUS_02710 35255 37297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 37307 37747 gene locus_tag LOCUS_02720 gene dut 37307 37747 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957483.1 protein_id gnl|my_center|LOCUS_02720 37776 38042 gene locus_tag LOCUS_02730 37776 38042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 38612 39631 gene locus_tag LOCUS_02740 38612 39631 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_02740 39658 40518 gene locus_tag LOCUS_02750 gene mreC 39658 40518 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546337.1 protein_id gnl|my_center|LOCUS_02750 40505 41089 gene locus_tag LOCUS_02760 40505 41089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 41127 43217 gene locus_tag LOCUS_02770 41127 43217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 43444 43848 gene locus_tag LOCUS_02780 gene mgsA 43444 43848 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_02780 43979 45295 gene locus_tag LOCUS_02790 gene hisS 43979 45295 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_02790 45298 47079 gene locus_tag LOCUS_02800 gene aspS 45298 47079 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_02800 48482 47145 gene locus_tag LOCUS_02810 48482 47145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 49609 48479 gene locus_tag LOCUS_02820 49609 48479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 50544 49600 gene locus_tag LOCUS_02830 50544 49600 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence006 4302 1525 gene locus_tag LOCUS_02840 4302 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 5512 4337 gene locus_tag LOCUS_02850 5512 4337 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108595.1 protein_id gnl|my_center|LOCUS_02850 6680 5499 gene locus_tag LOCUS_02860 6680 5499 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_02860 7732 6713 gene locus_tag LOCUS_02870 7732 6713 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080062.1 protein_id gnl|my_center|LOCUS_02870 8599 7748 gene locus_tag LOCUS_02880 8599 7748 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030752.1 protein_id gnl|my_center|LOCUS_02880 9558 8596 gene locus_tag LOCUS_02890 9558 8596 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030753.1 protein_id gnl|my_center|LOCUS_02890 10956 9589 gene locus_tag LOCUS_02900 10956 9589 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030754.1 protein_id gnl|my_center|LOCUS_02900 12418 11417 gene locus_tag LOCUS_02910 gene purR 12418 11417 CDS product HTH-type transcriptional repressor PurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457245.1 protein_id gnl|my_center|LOCUS_02910 12711 13409 gene locus_tag LOCUS_02920 gene vanR 12711 13409 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_02920 13402 14739 gene locus_tag LOCUS_02930 13402 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 14833 15507 gene locus_tag LOCUS_02940 14833 15507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 15656 17284 gene locus_tag LOCUS_02950 15656 17284 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964230.1 protein_id gnl|my_center|LOCUS_02950 17869 17369 gene locus_tag LOCUS_02960 17869 17369 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807782.1 protein_id gnl|my_center|LOCUS_02960 18487 18071 gene locus_tag LOCUS_02970 18487 18071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 18816 18740 gene locus_tag LOCUS_t00010 18816 18740 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19309 19103 gene locus_tag LOCUS_02980 19309 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 20790 19387 gene locus_tag LOCUS_02990 20790 19387 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_02990 21488 20847 gene locus_tag LOCUS_03000 gene coaE 21488 20847 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_03000 22498 21485 gene locus_tag LOCUS_03010 22498 21485 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_03010 23580 22504 gene locus_tag LOCUS_03020 gene prfA 23580 22504 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943725.1 protein_id gnl|my_center|LOCUS_03020 23829 23638 gene locus_tag LOCUS_03030 23829 23638 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_03030 24124 25065 gene locus_tag LOCUS_03040 24124 25065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 25412 25137 gene locus_tag LOCUS_03050 25412 25137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 25570 26307 gene locus_tag LOCUS_03060 25570 26307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 26379 28313 gene locus_tag LOCUS_03070 26379 28313 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_03070 29149 28574 gene locus_tag LOCUS_03080 29149 28574 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_03080 29555 32095 gene locus_tag LOCUS_03090 29555 32095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 33119 32241 gene locus_tag LOCUS_03100 33119 32241 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289864.1 protein_id gnl|my_center|LOCUS_03100 33750 33283 gene locus_tag LOCUS_03110 33750 33283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 34671 33787 gene locus_tag LOCUS_03120 gene hslO 34671 33787 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_03120 35433 34675 gene locus_tag LOCUS_03130 35433 34675 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_03130 38236 35555 gene locus_tag LOCUS_03140 gene secA 38236 35555 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_03140 39029 38400 gene locus_tag LOCUS_03150 39029 38400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 39200 39045 gene locus_tag LOCUS_03160 39200 39045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 40081 39266 gene locus_tag LOCUS_03170 40081 39266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 40932 42941 gene locus_tag LOCUS_03180 40932 42941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 44746 43259 gene locus_tag LOCUS_03190 44746 43259 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_03190 49329 44761 gene locus_tag LOCUS_03200 gene gltB 49329 44761 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 protein_id gnl|my_center|LOCUS_03200 49806 49642 gene locus_tag LOCUS_03210 49806 49642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence007 1754 318 gene locus_tag LOCUS_03220 1754 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3263 1788 gene locus_tag LOCUS_03230 3263 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4001 3270 gene locus_tag LOCUS_03240 4001 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 5084 4008 gene locus_tag LOCUS_03250 5084 4008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_03250 5640 8672 gene locus_tag LOCUS_03260 5640 8672 CDS product glycoside hydrolase family 48 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964229.1 protein_id gnl|my_center|LOCUS_03260 8889 9824 gene locus_tag LOCUS_03270 8889 9824 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_03270 9842 10444 gene locus_tag LOCUS_03280 gene gmk 9842 10444 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633187.1 protein_id gnl|my_center|LOCUS_03280 10441 10662 gene locus_tag LOCUS_03290 10441 10662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 10667 13123 gene locus_tag LOCUS_03300 gene priA 10667 13123 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_03300 13162 13632 gene locus_tag LOCUS_03310 gene def 13162 13632 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_03310 13629 14561 gene locus_tag LOCUS_03320 gene fmt 13629 14561 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_03320 14590 15300 gene locus_tag LOCUS_03330 14590 15300 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383773.1 protein_id gnl|my_center|LOCUS_03330 15297 16595 gene locus_tag LOCUS_03340 gene rsmB 15297 16595 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460525.1 protein_id gnl|my_center|LOCUS_03340 16625 17722 gene locus_tag LOCUS_03350 gene rlmN 16625 17722 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_03350 17719 18471 gene locus_tag LOCUS_03360 gene prpC 17719 18471 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_03360 18477 20609 gene locus_tag LOCUS_03370 gene pknB 18477 20609 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087065956.1 protein_id gnl|my_center|LOCUS_03370 20614 21507 gene locus_tag LOCUS_03380 gene rsgA 20614 21507 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902190.1 protein_id gnl|my_center|LOCUS_03380 21495 22121 gene locus_tag LOCUS_03390 21495 22121 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_03390 22372 23154 gene locus_tag LOCUS_03400 22372 23154 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948617.1 protein_id gnl|my_center|LOCUS_03400 23483 24370 gene locus_tag LOCUS_03410 gene spoIIIAA 23483 24370 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_03410 24367 24870 gene locus_tag LOCUS_03420 24367 24870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 24864 25079 gene locus_tag LOCUS_03430 gene spoIIIAC 24864 25079 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_03430 25076 25468 gene locus_tag LOCUS_03440 25076 25468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 25465 26607 gene locus_tag LOCUS_03450 gene spoIIIAE 25465 26607 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_03450 26611 27072 gene locus_tag LOCUS_03460 26611 27072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 27053 27598 gene locus_tag LOCUS_03470 27053 27598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 27844 28512 gene locus_tag LOCUS_03480 27844 28512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 28766 29212 gene locus_tag LOCUS_03490 gene nusB 28766 29212 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977336.1 protein_id gnl|my_center|LOCUS_03490 29190 30146 gene locus_tag LOCUS_03500 29190 30146 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_03500 30134 31315 gene locus_tag LOCUS_03510 gene xseA 30134 31315 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_03510 31365 31577 gene locus_tag LOCUS_03520 31365 31577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 31561 32454 gene locus_tag LOCUS_03530 31561 32454 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_03530 32525 34423 gene locus_tag LOCUS_03540 gene dxs 32525 34423 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965377.1 protein_id gnl|my_center|LOCUS_03540 34410 35216 gene locus_tag LOCUS_03550 34410 35216 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_03550 35213 36085 gene locus_tag LOCUS_03560 35213 36085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 36093 36539 gene locus_tag LOCUS_03570 gene argR 36093 36539 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633181.1 protein_id gnl|my_center|LOCUS_03570 36539 38242 gene locus_tag LOCUS_03580 gene recN 36539 38242 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_03580 38239 40089 gene locus_tag LOCUS_03590 gene recQ 38239 40089 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965975.1 protein_id gnl|my_center|LOCUS_03590 40258 41760 gene locus_tag LOCUS_03600 40258 41760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 42789 41743 gene locus_tag LOCUS_03610 42789 41743 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681885.1 protein_id gnl|my_center|LOCUS_03610 43140 42805 gene locus_tag LOCUS_03620 43140 42805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 43634 43137 gene locus_tag LOCUS_03630 gene ybaK 43634 43137 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_03630 44182 43640 gene locus_tag LOCUS_03640 44182 43640 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433028.1 protein_id gnl|my_center|LOCUS_03640 45609 44287 gene locus_tag LOCUS_03650 gene xylA 45609 44287 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082185.1 protein_id gnl|my_center|LOCUS_03650 46624 45674 gene locus_tag LOCUS_03660 46624 45674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence008 99 1295 gene locus_tag LOCUS_03670 99 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1328 3286 gene locus_tag LOCUS_03680 1328 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3500 5635 gene locus_tag LOCUS_03690 3500 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 7769 5877 gene locus_tag LOCUS_03700 gene glgB 7769 5877 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398803.1 protein_id gnl|my_center|LOCUS_03700 8188 9051 gene locus_tag LOCUS_03710 gene fba 8188 9051 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_03710 9100 9234 gene locus_tag LOCUS_03720 9100 9234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 9527 10009 gene locus_tag LOCUS_03730 gene rimP 9527 10009 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_03730 10033 11217 gene locus_tag LOCUS_03740 gene nusA 10033 11217 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231912.1 protein_id gnl|my_center|LOCUS_03740 11207 11500 gene locus_tag LOCUS_03750 11207 11500 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_03750 11454 11789 gene locus_tag LOCUS_03760 11454 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 11930 14401 gene locus_tag LOCUS_03770 gene infB 11930 14401 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388357.1 protein_id gnl|my_center|LOCUS_03770 14493 14873 gene locus_tag LOCUS_03780 gene rbfA 14493 14873 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_03780 14879 15847 gene locus_tag LOCUS_03790 14879 15847 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_03790 15832 16755 gene locus_tag LOCUS_03800 gene truB 15832 16755 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_03800 16772 17698 gene locus_tag LOCUS_03810 16772 17698 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930543.1 protein_id gnl|my_center|LOCUS_03810 17736 19199 gene locus_tag LOCUS_03820 gene gltX 17736 19199 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_03820 19339 20439 gene locus_tag LOCUS_03830 19339 20439 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_03830 20439 21146 gene locus_tag LOCUS_03840 gene gldF 20439 21146 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_03840 21163 22875 gene locus_tag LOCUS_03850 21163 22875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 22888 24381 gene locus_tag LOCUS_03860 22888 24381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 24422 24712 gene locus_tag LOCUS_03870 24422 24712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 25133 25831 gene locus_tag LOCUS_03880 25133 25831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 26125 27555 gene locus_tag LOCUS_03890 26125 27555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 27705 28064 gene locus_tag LOCUS_03900 27705 28064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 28328 28636 gene locus_tag LOCUS_03910 28328 28636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 28679 29362 gene locus_tag LOCUS_03920 28679 29362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 30668 29436 gene locus_tag LOCUS_03930 30668 29436 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362269.1 protein_id gnl|my_center|LOCUS_03930 31105 31830 gene locus_tag LOCUS_03940 31105 31830 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167939808.1 protein_id gnl|my_center|LOCUS_03940 32087 35545 gene locus_tag LOCUS_03950 32087 35545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 35902 39078 gene locus_tag LOCUS_03960 35902 39078 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963882.1 protein_id gnl|my_center|LOCUS_03960 39601 40782 gene locus_tag LOCUS_03970 gene metK 39601 40782 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_03970 42508 41204 gene locus_tag LOCUS_03980 42508 41204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 42694 44364 gene locus_tag LOCUS_03990 42694 44364 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_03990 44384 44833 gene locus_tag LOCUS_04000 gene tsaE 44384 44833 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049642.1 protein_id gnl|my_center|LOCUS_04000 44814 45497 gene locus_tag LOCUS_04010 44814 45497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 45901 46341 gene locus_tag LOCUS_04020 gene rpiB 45901 46341 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_04020 46359 46988 gene locus_tag LOCUS_04030 gene upp 46359 46988 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829916.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence009 186 261 gene locus_tag LOCUS_t00020 186 261 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 267 341 gene locus_tag LOCUS_t00030 267 341 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 356 450 gene locus_tag LOCUS_r00010 356 450 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 500 575 gene locus_tag LOCUS_t00040 500 575 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 813 738 gene locus_tag LOCUS_t00050 813 738 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1124 1387 gene locus_tag LOCUS_04040 1124 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 1646 2773 gene locus_tag LOCUS_04050 1646 2773 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_04050 2789 3757 gene locus_tag LOCUS_04060 2789 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 4145 4891 gene locus_tag LOCUS_04070 4145 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 5189 6478 gene locus_tag LOCUS_04080 5189 6478 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_04080 6591 7778 gene locus_tag LOCUS_04090 gene nifS 6591 7778 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_04090 7768 8181 gene locus_tag LOCUS_04100 gene nifU 7768 8181 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391905.1 protein_id gnl|my_center|LOCUS_04100 8385 9341 gene locus_tag LOCUS_04110 8385 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 9966 9475 gene locus_tag LOCUS_04120 9966 9475 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930588.1 protein_id gnl|my_center|LOCUS_04120 10814 9975 gene locus_tag LOCUS_04130 10814 9975 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759889.1 protein_id gnl|my_center|LOCUS_04130 11725 10814 gene locus_tag LOCUS_04140 gene fabD 11725 10814 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167634.1 protein_id gnl|my_center|LOCUS_04140 12002 13009 gene locus_tag LOCUS_04150 12002 13009 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_04150 13044 13970 gene locus_tag LOCUS_04160 gene fabK 13044 13970 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048429.1 protein_id gnl|my_center|LOCUS_04160 14206 14946 gene locus_tag LOCUS_04170 gene fabG 14206 14946 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830161.1 protein_id gnl|my_center|LOCUS_04170 15061 16299 gene locus_tag LOCUS_04180 gene fabF 15061 16299 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_04180 16312 16788 gene locus_tag LOCUS_04190 gene accB 16312 16788 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194067.1 protein_id gnl|my_center|LOCUS_04190 16801 17238 gene locus_tag LOCUS_04200 gene fabZ 16801 17238 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447678.1 protein_id gnl|my_center|LOCUS_04200 17251 18624 gene locus_tag LOCUS_04210 17251 18624 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_04210 18639 19499 gene locus_tag LOCUS_04220 gene accD 18639 19499 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_04220 19502 20320 gene locus_tag LOCUS_04230 19502 20320 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048421.1 protein_id gnl|my_center|LOCUS_04230 20421 20660 gene locus_tag LOCUS_04240 20421 20660 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081111.1 protein_id gnl|my_center|LOCUS_04240 20937 21713 gene locus_tag LOCUS_04250 20937 21713 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_04250 21713 23080 gene locus_tag LOCUS_04260 21713 23080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 23087 24136 gene locus_tag LOCUS_04270 23087 24136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 24152 24643 gene locus_tag LOCUS_04280 24152 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 24640 25740 gene locus_tag LOCUS_04290 24640 25740 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_04290 26067 27254 gene locus_tag LOCUS_04300 26067 27254 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842681.1 protein_id gnl|my_center|LOCUS_04300 27259 28452 gene locus_tag LOCUS_04310 27259 28452 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_04310 28454 30988 gene locus_tag LOCUS_04320 28454 30988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 31178 32197 gene locus_tag LOCUS_04330 31178 32197 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_04330 32396 33040 gene locus_tag LOCUS_04340 32396 33040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 33195 33968 gene locus_tag LOCUS_04350 gene thyX 33195 33968 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099542.1 protein_id gnl|my_center|LOCUS_04350 33952 34629 gene locus_tag LOCUS_04360 33952 34629 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_04360 34623 35531 gene locus_tag LOCUS_04370 34623 35531 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108933.1 protein_id gnl|my_center|LOCUS_04370 35651 36193 gene locus_tag LOCUS_04380 35651 36193 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673829.1 protein_id gnl|my_center|LOCUS_04380 36186 36782 gene locus_tag LOCUS_04390 36186 36782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 36775 38301 gene locus_tag LOCUS_04400 36775 38301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 38285 39505 gene locus_tag LOCUS_04410 38285 39505 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_04410 39518 40246 gene locus_tag LOCUS_04420 39518 40246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 41116 40367 gene locus_tag LOCUS_04430 41116 40367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 42382 41120 gene locus_tag LOCUS_04440 42382 41120 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704295.1 protein_id gnl|my_center|LOCUS_04440 43145 42684 gene locus_tag LOCUS_04450 43145 42684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 44549 43761 gene locus_tag LOCUS_04460 44549 43761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 45514 44564 gene locus_tag LOCUS_04470 45514 44564 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073434.1 protein_id gnl|my_center|LOCUS_04470 45834 45511 gene locus_tag LOCUS_04480 45834 45511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence010 678 857 gene locus_tag LOCUS_04490 678 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 850 1011 gene locus_tag LOCUS_04500 850 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 1004 1213 gene locus_tag LOCUS_04510 1004 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 1210 2523 gene locus_tag LOCUS_04520 1210 2523 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_04520 2524 2751 gene locus_tag LOCUS_04530 2524 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2741 3859 gene locus_tag LOCUS_04540 2741 3859 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922060.1 protein_id gnl|my_center|LOCUS_04540 3896 4474 gene locus_tag LOCUS_04550 3896 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 4551 6143 gene locus_tag LOCUS_04560 4551 6143 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_04560 6144 8402 gene locus_tag LOCUS_04570 6144 8402 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922066.1 protein_id gnl|my_center|LOCUS_04570 8562 8966 gene locus_tag LOCUS_04580 8562 8966 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922068.1 protein_id gnl|my_center|LOCUS_04580 8959 9357 gene locus_tag LOCUS_04590 8959 9357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 9354 9644 gene locus_tag LOCUS_04600 9354 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 9641 9778 gene locus_tag LOCUS_04610 9641 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 9853 10257 gene locus_tag LOCUS_04620 9853 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 10359 10781 gene locus_tag LOCUS_04630 10359 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922073.1 protein_id gnl|my_center|LOCUS_04630 10714 11919 gene locus_tag LOCUS_04640 10714 11919 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_04640 11933 13282 gene locus_tag LOCUS_04650 11933 13282 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921892.1 protein_id gnl|my_center|LOCUS_04650 13272 14501 gene locus_tag LOCUS_04660 13272 14501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 14494 14679 gene locus_tag LOCUS_04670 14494 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 14708 15067 gene locus_tag LOCUS_04680 14708 15067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 15177 15323 gene locus_tag LOCUS_04690 15177 15323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 15467 15754 gene locus_tag LOCUS_04700 15467 15754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 15747 16352 gene locus_tag LOCUS_04710 15747 16352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 16369 17232 gene locus_tag LOCUS_04720 16369 17232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 17232 17564 gene locus_tag LOCUS_04730 17232 17564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 17581 17895 gene locus_tag LOCUS_04740 17581 17895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 17895 18338 gene locus_tag LOCUS_04750 17895 18338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 18335 18745 gene locus_tag LOCUS_04760 18335 18745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 18758 19261 gene locus_tag LOCUS_04770 gene lmaA 18758 19261 CDS product protein LmaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721744.1 protein_id gnl|my_center|LOCUS_04770 19275 19592 gene locus_tag LOCUS_04780 19275 19592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 19733 20032 gene locus_tag LOCUS_04790 19733 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 20025 20912 gene locus_tag LOCUS_04800 20025 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 20912 22144 gene locus_tag LOCUS_04810 20912 22144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 22169 25279 gene locus_tag LOCUS_04820 22169 25279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 25292 26095 gene locus_tag LOCUS_04830 25292 26095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 26113 28695 gene locus_tag LOCUS_04840 26113 28695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 28722 29138 gene locus_tag LOCUS_04850 28722 29138 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_04850 29141 30157 gene locus_tag LOCUS_04860 29141 30157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 30621 30367 gene locus_tag LOCUS_04870 gene cotJB 30621 30367 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002157501.1 protein_id gnl|my_center|LOCUS_04870 30886 30614 gene locus_tag LOCUS_04880 30886 30614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 31230 31658 gene locus_tag LOCUS_04890 gene iscR 31230 31658 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705634.1 protein_id gnl|my_center|LOCUS_04890 31655 32407 gene locus_tag LOCUS_04900 gene sufC 31655 32407 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_04900 32514 33920 gene locus_tag LOCUS_04910 gene sufB 32514 33920 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_04910 33931 34968 gene locus_tag LOCUS_04920 gene sufD 33931 34968 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_04920 34970 36199 gene locus_tag LOCUS_04930 34970 36199 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_04930 36186 36623 gene locus_tag LOCUS_04940 36186 36623 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_04940 36704 36916 gene locus_tag LOCUS_04950 36704 36916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 36921 38063 gene locus_tag LOCUS_04960 36921 38063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 38396 38154 gene locus_tag LOCUS_04970 38396 38154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 38901 38371 gene locus_tag LOCUS_04980 38901 38371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 39661 40245 gene locus_tag LOCUS_04990 39661 40245 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_04990 40260 41642 gene locus_tag LOCUS_05000 40260 41642 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052123.1 protein_id gnl|my_center|LOCUS_05000 41686 43299 gene locus_tag LOCUS_05010 41686 43299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 43315 43866 gene locus_tag LOCUS_05020 gene hpt 43315 43866 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_05020 43866 45230 gene locus_tag LOCUS_05030 43866 45230 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence011 2044 32 gene locus_tag LOCUS_05040 2044 32 CDS product alkyl/aryl-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859398.1 protein_id gnl|my_center|LOCUS_05040 3343 2060 gene locus_tag LOCUS_05050 3343 2060 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150981032.1 protein_id gnl|my_center|LOCUS_05050 4403 3357 gene locus_tag LOCUS_05060 4403 3357 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728151.1 protein_id gnl|my_center|LOCUS_05060 5227 4460 gene locus_tag LOCUS_05070 5227 4460 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808828.1 protein_id gnl|my_center|LOCUS_05070 6035 5241 gene locus_tag LOCUS_05080 6035 5241 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206755.1 protein_id gnl|my_center|LOCUS_05080 6417 7490 gene locus_tag LOCUS_05090 6417 7490 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_05090 9765 7540 gene locus_tag LOCUS_05100 9765 7540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 10181 13339 gene locus_tag LOCUS_05110 10181 13339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 14799 13654 gene locus_tag LOCUS_05120 14799 13654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 15760 14843 gene locus_tag LOCUS_05130 15760 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 16045 15764 gene locus_tag LOCUS_05140 16045 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 16334 16343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 17983 16694 gene locus_tag LOCUS_05150 17983 16694 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964890.1 protein_id gnl|my_center|LOCUS_05150 18877 17996 gene locus_tag LOCUS_05160 gene rgbR 18877 17996 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 protein_id gnl|my_center|LOCUS_05160 21364 18890 gene locus_tag LOCUS_05170 21364 18890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 42032 21378 gene locus_tag LOCUS_05180 42032 21378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 21437 21536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 42723 43121 gene locus_tag LOCUS_05190 42723 43121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 43140 43367 gene locus_tag LOCUS_05200 43140 43367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence012 2347 77 gene locus_tag LOCUS_05210 2347 77 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_05210 3316 2429 gene locus_tag LOCUS_05220 3316 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 4489 3320 gene locus_tag LOCUS_05230 4489 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 5259 4522 gene locus_tag LOCUS_05240 gene truA 5259 4522 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_05240 7937 5256 gene locus_tag LOCUS_05250 7937 5256 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361467.1 protein_id gnl|my_center|LOCUS_05250 8752 7949 gene locus_tag LOCUS_05260 8752 7949 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_05260 9621 8746 gene locus_tag LOCUS_05270 9621 8746 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_05270 10484 9636 gene locus_tag LOCUS_05280 10484 9636 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156226187.1 protein_id gnl|my_center|LOCUS_05280 10710 10537 gene locus_tag LOCUS_05290 10710 10537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 11670 10801 gene locus_tag LOCUS_05300 11670 10801 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_05300 13051 11699 gene locus_tag LOCUS_05310 gene glmM 13051 11699 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_05310 14253 13183 gene locus_tag LOCUS_05320 gene ruvB 14253 13183 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000344450.1 protein_id gnl|my_center|LOCUS_05320 14894 14274 gene locus_tag LOCUS_05330 gene ruvA 14894 14274 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393203.1 protein_id gnl|my_center|LOCUS_05330 15406 14891 gene locus_tag LOCUS_05340 gene ruvC 15406 14891 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_05340 15660 16778 gene locus_tag LOCUS_05350 gene pheA 15660 16778 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_05350 17595 16837 gene locus_tag LOCUS_05360 17595 16837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 18110 19135 gene locus_tag LOCUS_05370 18110 19135 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082283.1 protein_id gnl|my_center|LOCUS_05370 19328 20788 gene locus_tag LOCUS_05380 19328 20788 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_05380 21337 20909 gene locus_tag LOCUS_05390 gene ruvX 21337 20909 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810863.1 protein_id gnl|my_center|LOCUS_05390 22261 21350 gene locus_tag LOCUS_05400 22261 21350 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_05400 23031 22261 gene locus_tag LOCUS_05410 gene pyrK 23031 22261 CDS product dihydroorotate oxidase B electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983359.1 protein_id gnl|my_center|LOCUS_05410 26300 23109 gene locus_tag LOCUS_05420 gene carB 26300 23109 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_05420 27410 26304 gene locus_tag LOCUS_05430 gene carA 27410 26304 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429883.1 protein_id gnl|my_center|LOCUS_05430 28391 27501 gene locus_tag LOCUS_05440 gene pyrF 28391 27501 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_05440 27595 27604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29685 28381 gene locus_tag LOCUS_05450 29685 28381 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_05450 30236 29682 gene locus_tag LOCUS_05460 gene pyrR 30236 29682 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_05460 31371 30496 gene locus_tag LOCUS_05470 gene rsmA 31371 30496 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_05470 35006 31368 gene locus_tag LOCUS_05480 gene addA 35006 31368 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948198.1 protein_id gnl|my_center|LOCUS_05480 38368 35006 gene locus_tag LOCUS_05490 gene addB 38368 35006 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948191.1 protein_id gnl|my_center|LOCUS_05490 38983 38540 gene locus_tag LOCUS_05500 38983 38540 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 protein_id gnl|my_center|LOCUS_05500 39607 39155 gene locus_tag LOCUS_05510 39607 39155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 40101 39604 gene locus_tag LOCUS_05520 gene coaD 40101 39604 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_05520 40651 40109 gene locus_tag LOCUS_05530 gene rsmD 40651 40109 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence013 401 1243 gene locus_tag LOCUS_05540 401 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1590 3083 gene locus_tag LOCUS_05550 1590 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 3207 4250 gene locus_tag LOCUS_05560 3207 4250 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287755.1 protein_id gnl|my_center|LOCUS_05560 4250 5137 gene locus_tag LOCUS_05570 4250 5137 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_05570 6149 5298 gene locus_tag LOCUS_05580 6149 5298 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162927877.1 protein_id gnl|my_center|LOCUS_05580 7247 6156 gene locus_tag LOCUS_05590 7247 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 8554 7268 gene locus_tag LOCUS_05600 8554 7268 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732282.1 protein_id gnl|my_center|LOCUS_05600 9833 8556 gene locus_tag LOCUS_05610 9833 8556 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_05610 11031 12083 gene locus_tag LOCUS_05620 gene aroB 11031 12083 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_05620 12080 13324 gene locus_tag LOCUS_05630 gene aroA 12080 13324 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_05630 13302 14393 gene locus_tag LOCUS_05640 gene aroC 13302 14393 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_05640 14456 15031 gene locus_tag LOCUS_05650 14456 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 17136 15778 gene locus_tag LOCUS_05660 gene gdhA 17136 15778 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051757.1 protein_id gnl|my_center|LOCUS_05660 18539 17889 gene locus_tag LOCUS_05670 18539 17889 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_05670 18815 20305 gene locus_tag LOCUS_05680 18815 20305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 20318 21121 gene locus_tag LOCUS_05690 20318 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 21633 22502 gene locus_tag LOCUS_05700 21633 22502 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_05700 22559 23269 gene locus_tag LOCUS_05710 22559 23269 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_05710 23583 25874 gene locus_tag LOCUS_05720 23583 25874 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584099.1 protein_id gnl|my_center|LOCUS_05720 26752 25991 gene locus_tag LOCUS_05730 gene pflA 26752 25991 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000807699.1 protein_id gnl|my_center|LOCUS_05730 27136 26897 gene locus_tag LOCUS_05740 27136 26897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 27403 27194 gene locus_tag LOCUS_05750 27403 27194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 29527 27440 gene locus_tag LOCUS_05760 gene pflB 29527 27440 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_05760 29948 30817 gene locus_tag LOCUS_05770 29948 30817 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964728.1 protein_id gnl|my_center|LOCUS_05770 31915 30788 gene locus_tag LOCUS_05780 31915 30788 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113569.1 protein_id gnl|my_center|LOCUS_05780 32081 33166 gene locus_tag LOCUS_05790 gene mnmA 32081 33166 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_05790 33396 33794 gene locus_tag LOCUS_05800 33396 33794 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937835.1 protein_id gnl|my_center|LOCUS_05800 34105 35034 gene locus_tag LOCUS_05810 34105 35034 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963617.1 protein_id gnl|my_center|LOCUS_05810 36368 35112 gene locus_tag LOCUS_05820 36368 35112 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_05820 36526 37032 gene locus_tag LOCUS_05830 gene gtcA 36526 37032 CDS product cell wall teichoic acid glycosylation protein GtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724105.1 protein_id gnl|my_center|LOCUS_05830 37271 37954 gene locus_tag LOCUS_05840 37271 37954 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_05840 37951 38325 gene locus_tag LOCUS_05850 37951 38325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 38833 38423 gene locus_tag LOCUS_05860 38833 38423 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084116061.1 protein_id gnl|my_center|LOCUS_05860 39808 39332 gene locus_tag LOCUS_05870 39808 39332 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064487.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence014 825 181 gene locus_tag LOCUS_05880 825 181 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545914.1 protein_id gnl|my_center|LOCUS_05880 4434 1033 gene locus_tag LOCUS_05890 4434 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4982 4434 gene locus_tag LOCUS_05900 4982 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 6581 5058 gene locus_tag LOCUS_05910 6581 5058 CDS product FapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870047.1 protein_id gnl|my_center|LOCUS_05910 8736 6907 gene locus_tag LOCUS_05920 8736 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 8997 9437 gene locus_tag LOCUS_05930 8997 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 9475 10800 gene locus_tag LOCUS_05940 9475 10800 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_05940 11202 13358 gene locus_tag LOCUS_05950 11202 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 13373 14413 gene locus_tag LOCUS_05960 13373 14413 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_05960 14681 14756 gene locus_tag LOCUS_t00060 14681 14756 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14759 14835 gene locus_tag LOCUS_t00070 14759 14835 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 14841 14916 gene locus_tag LOCUS_t00080 14841 14916 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14919 14993 gene locus_tag LOCUS_t00090 14919 14993 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 15160 15906 gene locus_tag LOCUS_05970 15160 15906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 16237 16052 gene locus_tag LOCUS_05980 gene rpmB 16237 16052 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_05980 16634 17311 gene locus_tag LOCUS_05990 16634 17311 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372445.1 protein_id gnl|my_center|LOCUS_05990 17316 18038 gene locus_tag LOCUS_06000 gene scpA 17316 18038 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199758.1 protein_id gnl|my_center|LOCUS_06000 18128 18670 gene locus_tag LOCUS_06010 gene scpB 18128 18670 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_06010 18692 19411 gene locus_tag LOCUS_06020 18692 19411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 19427 19867 gene locus_tag LOCUS_06030 gene ytfJ 19427 19867 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402813.1 protein_id gnl|my_center|LOCUS_06030 19926 21068 gene locus_tag LOCUS_06040 19926 21068 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_06040 21093 21860 gene locus_tag LOCUS_06050 21093 21860 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_06050 21925 22872 gene locus_tag LOCUS_06060 gene metA 21925 22872 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_06060 24217 22964 gene locus_tag LOCUS_06070 24217 22964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890480.1 protein_id gnl|my_center|LOCUS_06070 24660 26621 gene locus_tag LOCUS_06080 24660 26621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 29030 26895 gene locus_tag LOCUS_06090 29030 26895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 29813 36121 gene locus_tag LOCUS_06100 29813 36121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 36097 36270 gene locus_tag LOCUS_06110 36097 36270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 36284 36529 gene locus_tag LOCUS_06120 36284 36529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 36848 37306 gene locus_tag LOCUS_06130 36848 37306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 38482 37469 gene locus_tag LOCUS_06140 38482 37469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 39671 38526 gene locus_tag LOCUS_06150 39671 38526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence015 887 561 gene locus_tag LOCUS_06160 887 561 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056318.1 protein_id gnl|my_center|LOCUS_06160 1886 1026 gene locus_tag LOCUS_06170 1886 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2530 4032 gene locus_tag LOCUS_06180 2530 4032 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_06180 4056 4424 gene locus_tag LOCUS_06190 4056 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5014 4718 gene locus_tag LOCUS_06200 5014 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 5299 5015 gene locus_tag LOCUS_06210 5299 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 6314 5820 gene locus_tag LOCUS_06220 6314 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 7080 6598 gene locus_tag LOCUS_06230 7080 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 7663 8985 gene locus_tag LOCUS_06240 7663 8985 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225468.1 protein_id gnl|my_center|LOCUS_06240 8987 9886 gene locus_tag LOCUS_06250 8987 9886 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000032532.1 protein_id gnl|my_center|LOCUS_06250 9858 10709 gene locus_tag LOCUS_06260 9858 10709 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546230.1 protein_id gnl|my_center|LOCUS_06260 10713 11807 gene locus_tag LOCUS_06270 gene ugpC 10713 11807 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289507.1 protein_id gnl|my_center|LOCUS_06270 11821 13119 gene locus_tag LOCUS_06280 11821 13119 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 protein_id gnl|my_center|LOCUS_06280 13775 14299 gene locus_tag LOCUS_06290 13775 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 15573 14548 gene locus_tag LOCUS_06300 15573 14548 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000555352.1 protein_id gnl|my_center|LOCUS_06300 15898 17307 gene locus_tag LOCUS_06310 gene gtfA 15898 17307 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775657.1 protein_id gnl|my_center|LOCUS_06310 17318 18295 gene locus_tag LOCUS_06320 17318 18295 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_06320 19956 19084 gene locus_tag LOCUS_06330 19956 19084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 21375 20215 gene locus_tag LOCUS_06340 21375 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 22037 21372 gene locus_tag LOCUS_06350 22037 21372 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_06350 22267 22410 gene locus_tag LOCUS_06360 22267 22410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 22403 23326 gene locus_tag LOCUS_06370 22403 23326 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_06370 23323 24213 gene locus_tag LOCUS_06380 23323 24213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 24810 26033 gene locus_tag LOCUS_06390 24810 26033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 26153 29935 gene locus_tag LOCUS_06400 26153 29935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 35826 30385 gene locus_tag LOCUS_06410 35826 30385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 37190 36156 gene locus_tag LOCUS_06420 37190 36156 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence016 82 753 gene locus_tag LOCUS_06430 82 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2784 1207 gene locus_tag LOCUS_06440 2784 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4495 3338 gene locus_tag LOCUS_06450 4495 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4809 4946 gene locus_tag LOCUS_06460 4809 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 7395 5098 gene locus_tag LOCUS_06470 7395 5098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 8324 7767 gene locus_tag LOCUS_06480 8324 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 9116 8391 gene locus_tag LOCUS_06490 9116 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 10979 9156 gene locus_tag LOCUS_06500 10979 9156 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948830.1 protein_id gnl|my_center|LOCUS_06500 13970 11262 gene locus_tag LOCUS_06510 13970 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 14923 14678 gene locus_tag LOCUS_06520 14923 14678 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348590.1 protein_id gnl|my_center|LOCUS_06520 15301 15119 gene locus_tag LOCUS_06530 15301 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 17099 15498 gene locus_tag LOCUS_06540 17099 15498 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_06540 18585 17557 gene locus_tag LOCUS_06550 18585 17557 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_06550 19494 18601 gene locus_tag LOCUS_06560 19494 18601 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_06560 22295 19491 gene locus_tag LOCUS_06570 22295 19491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 22944 22315 gene locus_tag LOCUS_06580 22944 22315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06580 24463 22952 gene locus_tag LOCUS_06590 24463 22952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06590 25367 24480 gene locus_tag LOCUS_06600 25367 24480 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_06600 26312 25380 gene locus_tag LOCUS_06610 26312 25380 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_06610 29319 26332 gene locus_tag LOCUS_06620 29319 26332 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_06620 29419 29598 gene locus_tag LOCUS_06630 29419 29598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 31134 30088 gene locus_tag LOCUS_06640 31134 30088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 31471 31139 gene locus_tag LOCUS_06650 31471 31139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 32019 31468 gene locus_tag LOCUS_06660 32019 31468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 32482 32168 gene locus_tag LOCUS_06670 32482 32168 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475524.1 protein_id gnl|my_center|LOCUS_06670 33260 32508 gene locus_tag LOCUS_06680 33260 32508 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_06680 33553 34047 gene locus_tag LOCUS_06690 33553 34047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 34034 35287 gene locus_tag LOCUS_06700 34034 35287 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_06700 35395 36513 gene locus_tag LOCUS_06710 35395 36513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 36529 36882 gene locus_tag LOCUS_06720 36529 36882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence017 93 977 gene locus_tag LOCUS_06730 93 977 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891824.1 protein_id gnl|my_center|LOCUS_06730 2627 1209 gene locus_tag LOCUS_06740 2627 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 3159 2596 gene locus_tag LOCUS_06750 3159 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4275 3346 gene locus_tag LOCUS_06760 4275 3346 CDS product acyl-CoA thioester hydrolase/BAAT C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680020.1 protein_id gnl|my_center|LOCUS_06760 4277 4462 gene locus_tag LOCUS_06770 4277 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 4860 4561 gene locus_tag LOCUS_06780 4860 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5555 4857 gene locus_tag LOCUS_06790 5555 4857 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943112.1 protein_id gnl|my_center|LOCUS_06790 5789 6229 gene locus_tag LOCUS_06800 5789 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6859 7785 gene locus_tag LOCUS_06810 gene cysK 6859 7785 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_06810 7795 8046 gene locus_tag LOCUS_06820 7795 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 8577 8113 gene locus_tag LOCUS_06830 8577 8113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 9428 8574 gene locus_tag LOCUS_06840 9428 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9927 10241 gene locus_tag LOCUS_06850 9927 10241 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869719.1 protein_id gnl|my_center|LOCUS_06850 10246 11832 gene locus_tag LOCUS_06860 10246 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06860 11853 12185 gene locus_tag LOCUS_06870 11853 12185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 12189 13322 gene locus_tag LOCUS_06880 12189 13322 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267598.1 protein_id gnl|my_center|LOCUS_06880 13598 14122 gene locus_tag LOCUS_06890 13598 14122 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765867.1 protein_id gnl|my_center|LOCUS_06890 14144 15355 gene locus_tag LOCUS_06900 14144 15355 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_06900 15435 16574 gene locus_tag LOCUS_06910 15435 16574 CDS product tyramine oxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014462.1 protein_id gnl|my_center|LOCUS_06910 16674 17930 gene locus_tag LOCUS_06920 16674 17930 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_06920 18038 19270 gene locus_tag LOCUS_06930 18038 19270 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 protein_id gnl|my_center|LOCUS_06930 19285 19623 gene locus_tag LOCUS_06940 19285 19623 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545312.1 protein_id gnl|my_center|LOCUS_06940 19982 20722 gene locus_tag LOCUS_06950 19982 20722 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_06950 20763 22373 gene locus_tag LOCUS_06960 20763 22373 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435782.1 protein_id gnl|my_center|LOCUS_06960 22389 23405 gene locus_tag LOCUS_06970 22389 23405 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965779.1 protein_id gnl|my_center|LOCUS_06970 24230 23406 gene locus_tag LOCUS_06980 24230 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 24752 26218 gene locus_tag LOCUS_06990 gene trpE 24752 26218 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113204.1 protein_id gnl|my_center|LOCUS_06990 26215 27849 gene locus_tag LOCUS_07000 26215 27849 CDS product bifunctional anthranilate synthase component II/anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943371.1 protein_id gnl|my_center|LOCUS_07000 27859 28644 gene locus_tag LOCUS_07010 gene trpC 27859 28644 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221930.1 protein_id gnl|my_center|LOCUS_07010 28641 29246 gene locus_tag LOCUS_07020 28641 29246 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966436.1 protein_id gnl|my_center|LOCUS_07020 29248 30435 gene locus_tag LOCUS_07030 gene trpB 29248 30435 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 protein_id gnl|my_center|LOCUS_07030 30428 31222 gene locus_tag LOCUS_07040 gene trpA 30428 31222 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_07040 31543 32388 gene locus_tag LOCUS_07050 31543 32388 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459478.1 protein_id gnl|my_center|LOCUS_07050 32430 32912 gene locus_tag LOCUS_07060 32430 32912 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_07060 32940 34130 gene locus_tag LOCUS_07070 32940 34130 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808537.1 protein_id gnl|my_center|LOCUS_07070 34118 34969 gene locus_tag LOCUS_07080 gene ispE 34118 34969 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_07080 36803 35088 gene locus_tag LOCUS_07090 36803 35088 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence018 3261 73 gene locus_tag LOCUS_07100 3261 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4590 3289 gene locus_tag LOCUS_07110 4590 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 5047 4574 gene locus_tag LOCUS_07120 5047 4574 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810593.1 protein_id gnl|my_center|LOCUS_07120 5357 5914 gene locus_tag LOCUS_07130 5357 5914 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_07130 6176 6003 gene locus_tag LOCUS_07140 6176 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6299 6811 gene locus_tag LOCUS_07150 6299 6811 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814644.1 protein_id gnl|my_center|LOCUS_07150 7966 6911 gene locus_tag LOCUS_07160 7966 6911 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_07160 9669 8062 gene locus_tag LOCUS_07170 9669 8062 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_07170 10046 9666 gene locus_tag LOCUS_07180 10046 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 12303 10933 gene locus_tag LOCUS_07190 12303 10933 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_07190 12597 12328 gene locus_tag LOCUS_07200 12597 12328 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721327.1 protein_id gnl|my_center|LOCUS_07200 13882 12680 gene locus_tag LOCUS_07210 13882 12680 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_07210 14779 13928 gene locus_tag LOCUS_07220 gene dapF 14779 13928 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941199.1 protein_id gnl|my_center|LOCUS_07220 15060 15338 gene locus_tag LOCUS_07230 15060 15338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 15430 16884 gene locus_tag LOCUS_07240 gene gatA 15430 16884 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_07240 16902 19772 gene locus_tag LOCUS_07250 16902 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 19890 20570 gene locus_tag LOCUS_07260 19890 20570 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_07260 22017 20659 gene locus_tag LOCUS_07270 22017 20659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 23309 22014 gene locus_tag LOCUS_07280 23309 22014 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002486299.1 protein_id gnl|my_center|LOCUS_07280 23763 23302 gene locus_tag LOCUS_07290 23763 23302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 24243 24767 gene locus_tag LOCUS_07300 gene raiA 24243 24767 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671185.1 protein_id gnl|my_center|LOCUS_07300 26123 24990 gene locus_tag LOCUS_07310 gene tgt 26123 24990 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965580.1 protein_id gnl|my_center|LOCUS_07310 27272 26229 gene locus_tag LOCUS_07320 gene queA 27272 26229 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_07320 27608 28687 gene locus_tag LOCUS_07330 gene asd 27608 28687 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_07330 28748 29638 gene locus_tag LOCUS_07340 gene dapA 28748 29638 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_07340 29674 30429 gene locus_tag LOCUS_07350 gene dapB 29674 30429 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861884.1 protein_id gnl|my_center|LOCUS_07350 31401 30592 gene locus_tag LOCUS_07360 31401 30592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 32218 34377 gene locus_tag LOCUS_07370 gene nrdD 32218 34377 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693847.1 protein_id gnl|my_center|LOCUS_07370 34393 34905 gene locus_tag LOCUS_07380 34393 34905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 <36802 35083 gene locus_tag LOCUS_07390 <36802 35083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582688.1:glycosyl hydrolase >Feature sequence019 185 2446 gene locus_tag LOCUS_07400 gene metE 185 2446 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836499.1 protein_id gnl|my_center|LOCUS_07400 3917 2619 gene locus_tag LOCUS_07410 gene lysA 3917 2619 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392877.1 protein_id gnl|my_center|LOCUS_07410 4584 3991 gene locus_tag LOCUS_07420 gene yihA 4584 3991 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640795.1 protein_id gnl|my_center|LOCUS_07420 7035 4600 gene locus_tag LOCUS_07430 gene lon 7035 4600 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_07430 7572 8381 gene locus_tag LOCUS_07440 gene speD 7572 8381 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101641.1 protein_id gnl|my_center|LOCUS_07440 8396 9844 gene locus_tag LOCUS_07450 8396 9844 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_07450 9908 10279 gene locus_tag LOCUS_07460 9908 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 10360 10521 gene locus_tag LOCUS_07470 10360 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 10570 11205 gene locus_tag LOCUS_07480 10570 11205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 11435 11911 gene locus_tag LOCUS_07490 11435 11911 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_07490 11942 12805 gene locus_tag LOCUS_07500 gene speE 11942 12805 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_07500 12815 13693 gene locus_tag LOCUS_07510 12815 13693 CDS product YwqG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986634.1 protein_id gnl|my_center|LOCUS_07510 13734 14936 gene locus_tag LOCUS_07520 13734 14936 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_07520 14949 15308 gene locus_tag LOCUS_07530 14949 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 15454 16602 gene locus_tag LOCUS_07540 gene nspC 15454 16602 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_07540 16848 17489 gene locus_tag LOCUS_07550 16848 17489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 18089 17727 gene locus_tag LOCUS_07560 18089 17727 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_07560 19351 18107 gene locus_tag LOCUS_07570 19351 18107 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262686.1 protein_id gnl|my_center|LOCUS_07570 19942 20217 gene locus_tag LOCUS_07580 19942 20217 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_07580 20241 20549 gene locus_tag LOCUS_07590 20241 20549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 21623 20700 gene locus_tag LOCUS_07600 21623 20700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 22014 22772 gene locus_tag LOCUS_07610 22014 22772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 22778 24217 gene locus_tag LOCUS_07620 22778 24217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 27092 24492 gene locus_tag LOCUS_07630 gene clpB 27092 24492 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_07630 27951 27289 gene locus_tag LOCUS_07640 27951 27289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 28885 28139 gene locus_tag LOCUS_07650 28885 28139 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_07650 29657 28878 gene locus_tag LOCUS_07660 29657 28878 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_07660 29939 30172 gene locus_tag LOCUS_07670 29939 30172 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 protein_id gnl|my_center|LOCUS_07670 30474 32231 gene locus_tag LOCUS_07680 gene iorA 30474 32231 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_07680 32228 32830 gene locus_tag LOCUS_07690 32228 32830 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_07690 32836 34470 gene locus_tag LOCUS_07700 32836 34470 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_07700 34473 34889 gene locus_tag LOCUS_07710 34473 34889 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence020 116 646 gene locus_tag LOCUS_07720 116 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07720 682 1113 gene locus_tag LOCUS_07730 682 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07730 1509 3320 gene locus_tag LOCUS_07740 1509 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3342 4091 gene locus_tag LOCUS_07750 3342 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07750 4245 5744 gene locus_tag LOCUS_07760 4245 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07760 5759 6457 gene locus_tag LOCUS_07770 5759 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07770 7018 7386 gene locus_tag LOCUS_07780 7018 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 11965 7718 gene locus_tag LOCUS_07790 11965 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 12292 12489 gene locus_tag LOCUS_07800 12292 12489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 12392 15151 gene locus_tag LOCUS_07810 12392 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 16419 15268 gene locus_tag LOCUS_07820 16419 15268 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_07820 17575 16430 gene locus_tag LOCUS_07830 17575 16430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 17606 17758 gene locus_tag LOCUS_07840 17606 17758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 18451 17888 gene locus_tag LOCUS_07850 18451 17888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 18716 18804 gene locus_tag LOCUS_t00100 18716 18804 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 19149 21641 gene locus_tag LOCUS_07860 19149 21641 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964234.1 protein_id gnl|my_center|LOCUS_07860 20780 20798 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 21681 22187 gene locus_tag LOCUS_07870 21681 22187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 22290 23882 gene locus_tag LOCUS_07880 22290 23882 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_07880 23889 24425 gene locus_tag LOCUS_07890 23889 24425 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_07890 24684 24505 gene locus_tag LOCUS_07900 24684 24505 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_07900 25188 26678 gene locus_tag LOCUS_07910 25188 26678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 26675 27811 gene locus_tag LOCUS_07920 26675 27811 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869908.1 protein_id gnl|my_center|LOCUS_07920 29004 27964 gene locus_tag LOCUS_07930 29004 27964 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_07930 29849 29004 gene locus_tag LOCUS_07940 29849 29004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 31819 29969 gene locus_tag LOCUS_07950 31819 29969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 <33698 32158 gene locus_tag LOCUS_07960 <33698 32158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964237.1:dockerin type I domain-containing protein >Feature sequence021 2489 144 gene locus_tag LOCUS_07970 2489 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3516 2494 gene locus_tag LOCUS_07980 gene galM 3516 2494 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399304.1 protein_id gnl|my_center|LOCUS_07980 3931 3803 gene locus_tag LOCUS_07990 3931 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4712 4137 gene locus_tag LOCUS_08000 gene pgsA 4712 4137 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_08000 6039 4696 gene locus_tag LOCUS_08010 gene rimO 6039 4696 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_08010 7188 6154 gene locus_tag LOCUS_08020 7188 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 7813 7178 gene locus_tag LOCUS_08030 7813 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9060 7828 gene locus_tag LOCUS_08040 gene recA 9060 7828 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_08040 9993 9151 gene locus_tag LOCUS_08050 gene prmC 9993 9151 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_08050 10961 9987 gene locus_tag LOCUS_08060 10961 9987 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_08060 12428 10983 gene locus_tag LOCUS_08070 12428 10983 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948133.1 protein_id gnl|my_center|LOCUS_08070 13116 12418 gene locus_tag LOCUS_08080 13116 12418 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142165.1 protein_id gnl|my_center|LOCUS_08080 14570 13230 gene locus_tag LOCUS_08090 14570 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 15931 14558 gene locus_tag LOCUS_08100 15931 14558 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_08100 16081 17130 gene locus_tag LOCUS_08110 gene spoIID 16081 17130 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243408.1 protein_id gnl|my_center|LOCUS_08110 17740 18711 gene locus_tag LOCUS_08120 17740 18711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 18862 20169 gene locus_tag LOCUS_08130 18862 20169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 20208 20981 gene locus_tag LOCUS_08140 20208 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 21000 21650 gene locus_tag LOCUS_08150 21000 21650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 22143 21838 gene locus_tag LOCUS_08160 22143 21838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 22741 22487 gene locus_tag LOCUS_08170 22741 22487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 23151 23966 gene locus_tag LOCUS_08180 23151 23966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 24021 25355 gene locus_tag LOCUS_08190 24021 25355 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845922.1 protein_id gnl|my_center|LOCUS_08190 27019 25733 gene locus_tag LOCUS_08200 gene serS 27019 25733 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_08200 28036 27200 gene locus_tag LOCUS_08210 gene spo0J 28036 27200 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226832.1 protein_id gnl|my_center|LOCUS_08210 28854 28033 gene locus_tag LOCUS_08220 28854 28033 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288805.1 protein_id gnl|my_center|LOCUS_08220 29532 30353 gene locus_tag LOCUS_08230 gene noc 29532 30353 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_08230 32724 30985 gene locus_tag LOCUS_08240 32724 30985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 33395 32721 gene locus_tag LOCUS_08250 33395 32721 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence022 <1 1030 gene locus_tag LOCUS_08260 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144597911.1:DUF2800 domain-containing protein 1032 1598 gene locus_tag LOCUS_08270 1032 1598 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_08270 1614 1769 gene locus_tag LOCUS_08280 1614 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1830 3821 gene locus_tag LOCUS_08290 1830 3821 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_08290 3903 4568 gene locus_tag LOCUS_08300 3903 4568 CDS product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816482.1 protein_id gnl|my_center|LOCUS_08300 4570 4794 gene locus_tag LOCUS_08310 4570 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4775 5206 gene locus_tag LOCUS_08320 4775 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5199 7529 gene locus_tag LOCUS_08330 5199 7529 CDS product VapE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714181.1 protein_id gnl|my_center|LOCUS_08330 7751 8041 gene locus_tag LOCUS_08340 7751 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 8028 8168 gene locus_tag LOCUS_08350 8028 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 9049 8564 gene locus_tag LOCUS_08360 9049 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 9463 9056 gene locus_tag LOCUS_08370 9463 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 9640 9777 gene locus_tag LOCUS_08380 9640 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 9960 9781 gene locus_tag LOCUS_08390 9960 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 10068 10283 gene locus_tag LOCUS_08400 10068 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 10274 10465 gene locus_tag LOCUS_08410 10274 10465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 10462 10698 gene locus_tag LOCUS_08420 10462 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 10695 10985 gene locus_tag LOCUS_08430 10695 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 11006 11197 gene locus_tag LOCUS_08440 11006 11197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 11194 11451 gene locus_tag LOCUS_08450 11194 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 11534 13537 gene locus_tag LOCUS_08460 11534 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 13541 14461 gene locus_tag LOCUS_08470 13541 14461 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005708986.1 protein_id gnl|my_center|LOCUS_08470 14467 14640 gene locus_tag LOCUS_08480 14467 14640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 14803 15102 gene locus_tag LOCUS_08490 14803 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 15112 15507 gene locus_tag LOCUS_08500 15112 15507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 15504 15806 gene locus_tag LOCUS_08510 15504 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 15751 16530 gene locus_tag LOCUS_08520 15751 16530 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986775.1 protein_id gnl|my_center|LOCUS_08520 16536 17012 gene locus_tag LOCUS_08530 16536 17012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 16999 17295 gene locus_tag LOCUS_08540 16999 17295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 17413 17724 gene locus_tag LOCUS_08550 17413 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 17737 18066 gene locus_tag LOCUS_08560 17737 18066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 18075 18620 gene locus_tag LOCUS_08570 18075 18620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 18617 19108 gene locus_tag LOCUS_08580 18617 19108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 19416 19757 gene locus_tag LOCUS_08590 19416 19757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 19754 21049 gene locus_tag LOCUS_08600 19754 21049 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_08600 21046 22389 gene locus_tag LOCUS_08610 21046 22389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 22389 24053 gene locus_tag LOCUS_08620 22389 24053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 24074 24346 gene locus_tag LOCUS_08630 24074 24346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 24422 24685 gene locus_tag LOCUS_08640 24422 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 24838 25371 gene locus_tag LOCUS_08650 24838 25371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 25624 26481 gene locus_tag LOCUS_08660 25624 26481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 26485 26892 gene locus_tag LOCUS_08670 26485 26892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 27004 27336 gene locus_tag LOCUS_08680 27004 27336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 27333 27668 gene locus_tag LOCUS_08690 27333 27668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 27672 28112 gene locus_tag LOCUS_08700 27672 28112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 28105 28908 gene locus_tag LOCUS_08710 28105 28908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 28993 29358 gene locus_tag LOCUS_08720 28993 29358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 29355 29921 gene locus_tag LOCUS_08730 29355 29921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 30005 32476 gene locus_tag LOCUS_08740 30005 32476 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674640.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence023 612 1940 gene locus_tag LOCUS_08750 612 1940 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_08750 2669 2076 gene locus_tag LOCUS_08760 2669 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2883 3359 gene locus_tag LOCUS_08770 2883 3359 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363192.1 protein_id gnl|my_center|LOCUS_08770 3356 5089 gene locus_tag LOCUS_08780 3356 5089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_08780 5086 6993 gene locus_tag LOCUS_08790 5086 6993 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_08790 7595 7110 gene locus_tag LOCUS_08800 7595 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 8142 7585 gene locus_tag LOCUS_08810 8142 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 8903 8271 gene locus_tag LOCUS_08820 8903 8271 CDS product TIGR04100 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860776.1 protein_id gnl|my_center|LOCUS_08820 9395 8916 gene locus_tag LOCUS_08830 gene rlmH 9395 8916 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_08830 10189 9395 gene locus_tag LOCUS_08840 10189 9395 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_08840 11555 10266 gene locus_tag LOCUS_08850 11555 10266 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_08850 12820 11984 gene locus_tag LOCUS_08860 12820 11984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 14256 12853 gene locus_tag LOCUS_08870 gene cysS 14256 12853 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_08870 14976 14332 gene locus_tag LOCUS_08880 14976 14332 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263756.1 protein_id gnl|my_center|LOCUS_08880 15645 14980 gene locus_tag LOCUS_08890 gene cysE 15645 14980 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071396735.1 protein_id gnl|my_center|LOCUS_08890 17352 16162 gene locus_tag LOCUS_08900 17352 16162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 18723 17521 gene locus_tag LOCUS_08910 18723 17521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 18902 20380 gene locus_tag LOCUS_08920 18902 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 20970 20491 gene locus_tag LOCUS_08930 20970 20491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 21290 20967 gene locus_tag LOCUS_08940 21290 20967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 21930 21484 gene locus_tag LOCUS_08950 21930 21484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 22112 22999 gene locus_tag LOCUS_08960 22112 22999 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102012.1 protein_id gnl|my_center|LOCUS_08960 23170 23179 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23289 24071 gene locus_tag LOCUS_08970 23289 24071 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732982.1 protein_id gnl|my_center|LOCUS_08970 24422 25480 gene locus_tag LOCUS_08980 gene hisC 24422 25480 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905826.1 protein_id gnl|my_center|LOCUS_08980 26066 25617 gene locus_tag LOCUS_08990 26066 25617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 26626 26192 gene locus_tag LOCUS_09000 26626 26192 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 protein_id gnl|my_center|LOCUS_09000 27951 26932 gene locus_tag LOCUS_09010 27951 26932 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_09010 30239 27948 gene locus_tag LOCUS_09020 30239 27948 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_09020 30716 30339 gene locus_tag LOCUS_09030 30716 30339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 31227 30733 gene locus_tag LOCUS_09040 31227 30733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence024 577 80 gene locus_tag LOCUS_09050 577 80 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966865.1 protein_id gnl|my_center|LOCUS_09050 1702 674 gene locus_tag LOCUS_09060 1702 674 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_09060 3148 1862 gene locus_tag LOCUS_09070 3148 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4066 3206 gene locus_tag LOCUS_09080 4066 3206 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_09080 5214 4063 gene locus_tag LOCUS_09090 5214 4063 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_09090 6606 5230 gene locus_tag LOCUS_09100 6606 5230 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_09100 7197 6622 gene locus_tag LOCUS_09110 gene rnmV 7197 6622 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832196.1 protein_id gnl|my_center|LOCUS_09110 8245 7166 gene locus_tag LOCUS_09120 8245 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 9493 8447 gene locus_tag LOCUS_09130 9493 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 10513 9539 gene locus_tag LOCUS_09140 10513 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 11069 10527 gene locus_tag LOCUS_09150 11069 10527 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_09150 11445 11083 gene locus_tag LOCUS_09160 11445 11083 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_09160 14093 11448 gene locus_tag LOCUS_09170 gene alaS 14093 11448 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_09170 15702 14551 gene locus_tag LOCUS_09180 15702 14551 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964137.1 protein_id gnl|my_center|LOCUS_09180 16324 15791 gene locus_tag LOCUS_09190 16324 15791 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_09190 16668 17606 gene locus_tag LOCUS_09200 16668 17606 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030676.1 protein_id gnl|my_center|LOCUS_09200 17612 18730 gene locus_tag LOCUS_09210 17612 18730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 18727 21354 gene locus_tag LOCUS_09220 18727 21354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 21424 22080 gene locus_tag LOCUS_09230 21424 22080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 22097 22873 gene locus_tag LOCUS_09240 22097 22873 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_09240 23039 23239 gene locus_tag LOCUS_09250 23039 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 23279 24058 gene locus_tag LOCUS_09260 23279 24058 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_09260 24071 25237 gene locus_tag LOCUS_09270 gene thiH 24071 25237 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_09270 25234 25824 gene locus_tag LOCUS_09280 25234 25824 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015812.1 protein_id gnl|my_center|LOCUS_09280 25821 26507 gene locus_tag LOCUS_09290 25821 26507 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_09290 27904 26615 gene locus_tag LOCUS_09300 gene clpX 27904 26615 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_09300 28509 27919 gene locus_tag LOCUS_09310 gene clpP 28509 27919 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_09310 29967 28630 gene locus_tag LOCUS_09320 gene tig 29967 28630 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence025 246 73 gene locus_tag LOCUS_09330 246 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 735 1850 gene locus_tag LOCUS_09340 gene aguA 735 1850 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911777.1 protein_id gnl|my_center|LOCUS_09340 1843 2742 gene locus_tag LOCUS_09350 gene aguB 1843 2742 CDS product N-carbamoylputrescine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246756.1 protein_id gnl|my_center|LOCUS_09350 3105 4964 gene locus_tag LOCUS_09360 3105 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 6547 5321 gene locus_tag LOCUS_09370 6547 5321 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902660.1 protein_id gnl|my_center|LOCUS_09370 6929 6561 gene locus_tag LOCUS_09380 6929 6561 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902663.1 protein_id gnl|my_center|LOCUS_09380 7296 6919 gene locus_tag LOCUS_09390 7296 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 8709 7309 gene locus_tag LOCUS_09400 8709 7309 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_09400 9103 10656 gene locus_tag LOCUS_09410 9103 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 10794 12113 gene locus_tag LOCUS_09420 10794 12113 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_09420 12162 14396 gene locus_tag LOCUS_09430 12162 14396 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546149.1 protein_id gnl|my_center|LOCUS_09430 14565 15749 gene locus_tag LOCUS_09440 14565 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 16253 15879 gene locus_tag LOCUS_09450 16253 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 18649 16283 gene locus_tag LOCUS_09460 18649 16283 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_09460 20223 18646 gene locus_tag LOCUS_09470 gene malQ 20223 18646 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917858.1 protein_id gnl|my_center|LOCUS_09470 20347 20748 gene locus_tag LOCUS_09480 20347 20748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 22146 21061 gene locus_tag LOCUS_09490 gene pyrB 22146 21061 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_09490 22902 22234 gene locus_tag LOCUS_09500 22902 22234 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_09500 24795 22921 gene locus_tag LOCUS_09510 gene asnB 24795 22921 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288533.1 protein_id gnl|my_center|LOCUS_09510 24923 25114 gene locus_tag LOCUS_09520 24923 25114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 25639 25304 gene locus_tag LOCUS_09530 25639 25304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 25607 25616 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 28603 25814 gene locus_tag LOCUS_09540 28603 25814 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247622.1 protein_id gnl|my_center|LOCUS_09540 29736 28600 gene locus_tag LOCUS_09550 29736 28600 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence026 524 183 gene locus_tag LOCUS_09560 gene rplQ 524 183 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_09560 1576 623 gene locus_tag LOCUS_09570 1576 623 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_09570 2330 1734 gene locus_tag LOCUS_09580 gene rpsD 2330 1734 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_09580 2759 2358 gene locus_tag LOCUS_09590 gene rpsK 2759 2358 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_09590 3144 2776 gene locus_tag LOCUS_09600 gene rpsM 3144 2776 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_09600 3632 3414 gene locus_tag LOCUS_09610 gene infA 3632 3414 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_09610 3917 3675 gene locus_tag LOCUS_09620 3917 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4683 3931 gene locus_tag LOCUS_09630 gene map 4683 3931 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_09630 5315 4680 gene locus_tag LOCUS_09640 gene adk 5315 4680 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649108.1 protein_id gnl|my_center|LOCUS_09640 6658 5333 gene locus_tag LOCUS_09650 gene secY 6658 5333 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810127.1 protein_id gnl|my_center|LOCUS_09650 7100 6660 gene locus_tag LOCUS_09660 gene rplO 7100 6660 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_09660 7304 7128 gene locus_tag LOCUS_09670 gene rpmD 7304 7128 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357637.1 protein_id gnl|my_center|LOCUS_09670 7817 7317 gene locus_tag LOCUS_09680 gene rpsE 7817 7317 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_09680 8195 7836 gene locus_tag LOCUS_09690 gene rplR 8195 7836 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003739848.1 protein_id gnl|my_center|LOCUS_09690 8761 8216 gene locus_tag LOCUS_09700 gene rplF 8761 8216 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_09700 9175 8777 gene locus_tag LOCUS_09710 gene rpsH 9175 8777 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_09710 9392 9207 gene locus_tag LOCUS_09720 9392 9207 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_09720 9949 9410 gene locus_tag LOCUS_09730 gene rplE 9949 9410 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_09730 10315 9962 gene locus_tag LOCUS_09740 gene rplX 10315 9962 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357467.1 protein_id gnl|my_center|LOCUS_09740 10699 10331 gene locus_tag LOCUS_09750 gene rplN 10699 10331 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_09750 11033 10776 gene locus_tag LOCUS_09760 gene rpsQ 11033 10776 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_09760 11241 11050 gene locus_tag LOCUS_09770 gene rpmC 11241 11050 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_09770 11663 11241 gene locus_tag LOCUS_09780 gene rplP 11663 11241 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_09780 12457 11663 gene locus_tag LOCUS_09790 gene rpsC 12457 11663 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421163.1 protein_id gnl|my_center|LOCUS_09790 12814 12479 gene locus_tag LOCUS_09800 gene rplV 12814 12479 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_09800 13114 12833 gene locus_tag LOCUS_09810 gene rpsS 13114 12833 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_09810 13968 13135 gene locus_tag LOCUS_09820 gene rplB 13968 13135 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_09820 14366 14043 gene locus_tag LOCUS_09830 gene rplW 14366 14043 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_09830 14989 14363 gene locus_tag LOCUS_09840 gene rplD 14989 14363 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_09840 15639 15007 gene locus_tag LOCUS_09850 gene rplC 15639 15007 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_09850 16063 15749 gene locus_tag LOCUS_09860 gene rpsJ 16063 15749 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284513.1 protein_id gnl|my_center|LOCUS_09860 16854 16648 gene locus_tag LOCUS_09870 16854 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 17904 17113 gene locus_tag LOCUS_09880 17904 17113 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_09880 18371 19519 gene locus_tag LOCUS_09890 gene alr 18371 19519 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_09890 19745 22717 gene locus_tag LOCUS_09900 19745 22717 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_09900 22775 24013 gene locus_tag LOCUS_09910 22775 24013 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_09910 24013 24492 gene locus_tag LOCUS_09920 24013 24492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 24992 25090 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 25229 25390 gene locus_tag LOCUS_09930 25229 25390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 26225 25368 gene locus_tag LOCUS_09940 26225 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 26926 26222 gene locus_tag LOCUS_09950 26926 26222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 27720 26923 gene locus_tag LOCUS_09960 27720 26923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence027 676 2214 gene locus_tag LOCUS_09970 676 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2221 3174 gene locus_tag LOCUS_09980 2221 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 5374 3866 gene locus_tag LOCUS_09990 5374 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6316 5750 gene locus_tag LOCUS_10000 6316 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 6938 6750 gene locus_tag LOCUS_10010 6938 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 7145 6957 gene locus_tag LOCUS_10020 7145 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 8490 7447 gene locus_tag LOCUS_10030 8490 7447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 9507 9319 gene locus_tag LOCUS_10040 9507 9319 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184197.1 protein_id gnl|my_center|LOCUS_10040 9869 11290 gene locus_tag LOCUS_10050 9869 11290 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 protein_id gnl|my_center|LOCUS_10050 11324 12457 gene locus_tag LOCUS_10060 11324 12457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 12768 14177 gene locus_tag LOCUS_10070 12768 14177 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068695.1 protein_id gnl|my_center|LOCUS_10070 14167 14889 gene locus_tag LOCUS_10080 14167 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068694.1 protein_id gnl|my_center|LOCUS_10080 16754 15612 gene locus_tag LOCUS_10090 16754 15612 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861441.1 protein_id gnl|my_center|LOCUS_10090 17125 16823 gene locus_tag LOCUS_10100 17125 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 17442 17125 gene locus_tag LOCUS_10110 17442 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 17704 17576 gene locus_tag LOCUS_10120 17704 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 17899 17714 gene locus_tag LOCUS_10130 17899 17714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 18207 17830 gene locus_tag LOCUS_10140 18207 17830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 18437 19147 gene locus_tag LOCUS_10150 18437 19147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 20011 19244 gene locus_tag LOCUS_10160 20011 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 20502 20008 gene locus_tag LOCUS_10170 20502 20008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 20883 20506 gene locus_tag LOCUS_10180 20883 20506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 21987 21106 gene locus_tag LOCUS_10190 21987 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 23087 22005 gene locus_tag LOCUS_10200 23087 22005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 23247 23522 gene locus_tag LOCUS_10210 23247 23522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 24772 23780 gene locus_tag LOCUS_10220 24772 23780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 24874 26100 gene locus_tag LOCUS_10230 24874 26100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 27481 26150 gene locus_tag LOCUS_10240 27481 26150 CDS product phage/plasmid primase, P4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962558.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence028 879 202 gene locus_tag LOCUS_10250 879 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1347 1105 gene locus_tag LOCUS_10260 gene rpsR 1347 1105 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_10260 1931 1395 gene locus_tag LOCUS_10270 1931 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2247 1957 gene locus_tag LOCUS_10280 gene rpsF 2247 1957 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_10280 3640 2786 gene locus_tag LOCUS_10290 gene gpr 3640 2786 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_10290 3929 4189 gene locus_tag LOCUS_10300 gene rpsT 3929 4189 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_10300 4607 4260 gene locus_tag LOCUS_10310 gene ndoA 4607 4260 CDS product type II toxin-antitoxin system endoribonuclease NdoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635963.1 protein_id gnl|my_center|LOCUS_10310 5374 4952 gene locus_tag LOCUS_10320 5374 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5994 5485 gene locus_tag LOCUS_10330 5994 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 6529 7989 gene locus_tag LOCUS_10340 gene nadB 6529 7989 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764756.1 protein_id gnl|my_center|LOCUS_10340 8034 8876 gene locus_tag LOCUS_10350 gene nadC 8034 8876 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_10350 9653 11239 gene locus_tag LOCUS_10360 gene rny 9653 11239 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_10360 11773 12105 gene locus_tag LOCUS_10370 11773 12105 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_10370 12395 12565 gene locus_tag LOCUS_10380 12395 12565 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_10380 12660 13292 gene locus_tag LOCUS_10390 12660 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 13578 13817 gene locus_tag LOCUS_10400 13578 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 13808 14089 gene locus_tag LOCUS_10410 13808 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 14316 15644 gene locus_tag LOCUS_10420 14316 15644 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243352.1 protein_id gnl|my_center|LOCUS_10420 15656 16624 gene locus_tag LOCUS_10430 gene holB 15656 16624 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_10430 16687 17553 gene locus_tag LOCUS_10440 16687 17553 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427637.1 protein_id gnl|my_center|LOCUS_10440 17600 18487 gene locus_tag LOCUS_10450 17600 18487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 18453 19109 gene locus_tag LOCUS_10460 18453 19109 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_10460 19528 21474 gene locus_tag LOCUS_10470 gene thrS 19528 21474 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229473.1 protein_id gnl|my_center|LOCUS_10470 21639 22448 gene locus_tag LOCUS_10480 21639 22448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 22744 24360 gene locus_tag LOCUS_10490 22744 24360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 24537 27140 gene locus_tag LOCUS_10500 24537 27140 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence029 1115 252 gene locus_tag LOCUS_10510 1115 252 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002932053.1 protein_id gnl|my_center|LOCUS_10510 1448 3427 gene locus_tag LOCUS_10520 1448 3427 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_10520 5328 3430 gene locus_tag LOCUS_10530 5328 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 3573 3582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6384 5560 gene locus_tag LOCUS_10540 gene yidA 6384 5560 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295119.1 protein_id gnl|my_center|LOCUS_10540 6504 7376 gene locus_tag LOCUS_10550 6504 7376 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582695.1 protein_id gnl|my_center|LOCUS_10550 7391 8494 gene locus_tag LOCUS_10560 7391 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 8538 8810 gene locus_tag LOCUS_10570 8538 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 8960 9036 gene locus_tag LOCUS_t00110 8960 9036 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9067 9864 gene locus_tag LOCUS_10580 9067 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9867 10139 gene locus_tag LOCUS_10590 9867 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10590 10098 10107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10157 10744 gene locus_tag LOCUS_10600 10157 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10600 11228 10971 gene locus_tag LOCUS_10610 11228 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 11901 11197 gene locus_tag LOCUS_10620 11901 11197 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_10620 13241 11898 gene locus_tag LOCUS_10630 13241 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 14502 13267 gene locus_tag LOCUS_10640 14502 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 14754 17312 gene locus_tag LOCUS_10650 14754 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 19637 17391 gene locus_tag LOCUS_10660 gene gyrA 19637 17391 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_10660 21631 19652 gene locus_tag LOCUS_10670 gene gyrB 21631 19652 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_10670 21830 21609 gene locus_tag LOCUS_10680 21830 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 21958 23748 gene locus_tag LOCUS_10690 21958 23748 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783199.1 protein_id gnl|my_center|LOCUS_10690 23768 24082 gene locus_tag LOCUS_10700 23768 24082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 24572 24138 gene locus_tag LOCUS_10710 24572 24138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 25200 24994 gene locus_tag LOCUS_10720 25200 24994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 25778 25242 gene locus_tag LOCUS_10730 25778 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence030 2587 80 gene locus_tag LOCUS_10740 2587 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2963 2742 gene locus_tag LOCUS_10750 2963 2742 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_10750 3193 2981 gene locus_tag LOCUS_10760 3193 2981 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_10760 3729 6377 gene locus_tag LOCUS_10770 3729 6377 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674070.1 protein_id gnl|my_center|LOCUS_10770 6575 8218 gene locus_tag LOCUS_10780 6575 8218 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994024.1 protein_id gnl|my_center|LOCUS_10780 8236 8808 gene locus_tag LOCUS_10790 gene casB 8236 8808 CDS product type I-E CRISPR-associated protein Cse2/CasB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003586648.1 protein_id gnl|my_center|LOCUS_10790 8805 9878 gene locus_tag LOCUS_10800 gene cas7e 8805 9878 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138505.1 protein_id gnl|my_center|LOCUS_10800 9899 10522 gene locus_tag LOCUS_10810 gene cas5e 9899 10522 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227611.1 protein_id gnl|my_center|LOCUS_10810 10531 11157 gene locus_tag LOCUS_10820 gene cas6e 10531 11157 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112674.1 protein_id gnl|my_center|LOCUS_10820 11157 12098 gene locus_tag LOCUS_10830 gene cas1e 11157 12098 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440418.1 protein_id gnl|my_center|LOCUS_10830 12095 12991 gene locus_tag LOCUS_10840 gene cas2e 12095 12991 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_10840 13027 25505 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttttccccgcataggcgggggtgatcc 25563 25715 gene locus_tag LOCUS_10850 25563 25715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 25690 25902 gene locus_tag LOCUS_10860 25690 25902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 25919 26146 gene locus_tag LOCUS_10870 25919 26146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 26159 26290 gene locus_tag LOCUS_10880 26159 26290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 26281 26445 gene locus_tag LOCUS_10890 26281 26445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence031 1153 77 gene locus_tag LOCUS_10900 1153 77 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_10900 2583 1150 gene locus_tag LOCUS_10910 2583 1150 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965627.1 protein_id gnl|my_center|LOCUS_10910 5171 2892 gene locus_tag LOCUS_10920 5171 2892 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814523.1 protein_id gnl|my_center|LOCUS_10920 5617 5790 gene locus_tag LOCUS_10930 5617 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 7342 5708 gene locus_tag LOCUS_10940 7342 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 8809 7517 gene locus_tag LOCUS_10950 8809 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 10116 9661 gene locus_tag LOCUS_10960 gene dtd 10116 9661 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_10960 10853 10113 gene locus_tag LOCUS_10970 10853 10113 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_10970 11264 10869 gene locus_tag LOCUS_10980 11264 10869 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393003.1 protein_id gnl|my_center|LOCUS_10980 11518 11606 gene locus_tag LOCUS_t00120 11518 11606 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11666 11755 gene locus_tag LOCUS_t00130 11666 11755 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13336 12200 gene locus_tag LOCUS_10990 gene ugpC 13336 12200 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_10990 14237 13482 gene locus_tag LOCUS_11000 14237 13482 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546764.1 protein_id gnl|my_center|LOCUS_11000 14315 14752 gene locus_tag LOCUS_11010 14315 14752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 15133 14753 gene locus_tag LOCUS_11020 15133 14753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 15630 15175 gene locus_tag LOCUS_11030 gene nrdR 15630 15175 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584044.1 protein_id gnl|my_center|LOCUS_11030 16480 15686 gene locus_tag LOCUS_11040 16480 15686 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048205.1 protein_id gnl|my_center|LOCUS_11040 17656 16655 gene locus_tag LOCUS_11050 gene secF 17656 16655 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048082.1 protein_id gnl|my_center|LOCUS_11050 19064 17640 gene locus_tag LOCUS_11060 gene secD 19064 17640 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965576.1 protein_id gnl|my_center|LOCUS_11060 19391 20059 gene locus_tag LOCUS_11070 19391 20059 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732773.1 protein_id gnl|my_center|LOCUS_11070 20061 21683 gene locus_tag LOCUS_11080 20061 21683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 21818 22693 gene locus_tag LOCUS_11090 gene metF 21818 22693 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_11090 22687 23352 gene locus_tag LOCUS_11100 22687 23352 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_11100 23452 23937 gene locus_tag LOCUS_11110 23452 23937 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461280.1 protein_id gnl|my_center|LOCUS_11110 23976 26369 gene locus_tag LOCUS_11120 23976 26369 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence032 7843 10251 gene locus_tag LOCUS_11130 7843 10251 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_11130 10402 12288 gene locus_tag LOCUS_11140 10402 12288 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437164.1 protein_id gnl|my_center|LOCUS_11140 12499 12575 gene locus_tag LOCUS_t00140 12499 12575 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13990 15174 gene locus_tag LOCUS_11150 13990 15174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 15171 15626 gene locus_tag LOCUS_11160 15171 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 15630 16118 gene locus_tag LOCUS_11170 15630 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 16442 17626 gene locus_tag LOCUS_11180 16442 17626 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_11180 18120 18515 gene locus_tag LOCUS_11190 18120 18515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 18552 20243 gene locus_tag LOCUS_11200 18552 20243 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11200 20338 20736 gene locus_tag LOCUS_11210 20338 20736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 20874 21860 gene locus_tag LOCUS_11220 20874 21860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 21884 22387 gene locus_tag LOCUS_11230 21884 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 22692 22408 gene locus_tag LOCUS_11240 22692 22408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 23093 23455 gene locus_tag LOCUS_11250 23093 23455 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_11250 23452 23724 gene locus_tag LOCUS_11260 23452 23724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 24534 24040 gene locus_tag LOCUS_11270 24534 24040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence033 378 2417 gene locus_tag LOCUS_11280 378 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2440 3417 gene locus_tag LOCUS_11290 2440 3417 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_11290 3876 4808 gene locus_tag LOCUS_11300 3876 4808 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812720.1 protein_id gnl|my_center|LOCUS_11300 4783 5682 gene locus_tag LOCUS_11310 4783 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 5679 6119 gene locus_tag LOCUS_11320 5679 6119 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722849.1 protein_id gnl|my_center|LOCUS_11320 6129 6629 gene locus_tag LOCUS_11330 6129 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 6613 6939 gene locus_tag LOCUS_11340 6613 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7000 7341 gene locus_tag LOCUS_11350 7000 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7488 7889 gene locus_tag LOCUS_11360 7488 7889 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_11360 7997 9751 gene locus_tag LOCUS_11370 7997 9751 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890790.1 protein_id gnl|my_center|LOCUS_11370 9964 10046 gene locus_tag LOCUS_t00150 9964 10046 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10077 10168 gene locus_tag LOCUS_t00160 10077 10168 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10500 11822 gene locus_tag LOCUS_11380 10500 11822 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475463.1 protein_id gnl|my_center|LOCUS_11380 12513 12770 gene locus_tag LOCUS_11390 12513 12770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 12770 14884 gene locus_tag LOCUS_11400 12770 14884 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808998.1 protein_id gnl|my_center|LOCUS_11400 15097 15915 gene locus_tag LOCUS_11410 15097 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 15848 16783 gene locus_tag LOCUS_11420 15848 16783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11420 16790 17236 gene locus_tag LOCUS_11430 16790 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 17229 18083 gene locus_tag LOCUS_11440 17229 18083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 20984 18339 gene locus_tag LOCUS_11450 20984 18339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 21744 21199 gene locus_tag LOCUS_11460 21744 21199 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_11460 22108 21728 gene locus_tag LOCUS_11470 22108 21728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 23184 22105 gene locus_tag LOCUS_11480 23184 22105 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948151.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence034 229 651 gene locus_tag LOCUS_11490 gene rpsL 229 651 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_11490 880 1350 gene locus_tag LOCUS_11500 gene rpsG 880 1350 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_11500 1384 3459 gene locus_tag LOCUS_11510 gene fusA 1384 3459 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_11510 3593 4792 gene locus_tag LOCUS_11520 gene tuf 3593 4792 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_11520 5003 4782 gene locus_tag LOCUS_11530 5003 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 5042 5470 gene locus_tag LOCUS_11540 gene mraZ 5042 5470 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_11540 5480 6406 gene locus_tag LOCUS_11550 gene rsmH 5480 6406 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_11550 6410 6874 gene locus_tag LOCUS_11560 6410 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 7161 9302 gene locus_tag LOCUS_11570 7161 9302 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965429.1 protein_id gnl|my_center|LOCUS_11570 9307 9459 gene locus_tag LOCUS_11580 9307 9459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 9508 10950 gene locus_tag LOCUS_11590 9508 10950 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_11590 10969 12357 gene locus_tag LOCUS_11600 10969 12357 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272578.1 protein_id gnl|my_center|LOCUS_11600 12341 13369 gene locus_tag LOCUS_11610 gene mraY 12341 13369 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731978.1 protein_id gnl|my_center|LOCUS_11610 13388 14638 gene locus_tag LOCUS_11620 gene spoVE 13388 14638 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753510.1 protein_id gnl|my_center|LOCUS_11620 14635 15768 gene locus_tag LOCUS_11630 gene murG 14635 15768 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110342.1 protein_id gnl|my_center|LOCUS_11630 15864 17183 gene locus_tag LOCUS_11640 gene murA 15864 17183 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_11640 17246 18172 gene locus_tag LOCUS_11650 17246 18172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 18407 19597 gene locus_tag LOCUS_11660 18407 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 22062 19900 gene locus_tag LOCUS_11670 gene rnr 22062 19900 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_11670 22531 22274 gene locus_tag LOCUS_11680 22531 22274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence035 234 932 gene locus_tag LOCUS_11690 234 932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461283.1 protein_id gnl|my_center|LOCUS_11690 936 3203 gene locus_tag LOCUS_11700 936 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 4186 3299 gene locus_tag LOCUS_11710 4186 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 5661 4270 gene locus_tag LOCUS_11720 5661 4270 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627442.1 protein_id gnl|my_center|LOCUS_11720 6094 7467 gene locus_tag LOCUS_11730 6094 7467 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392614.1 protein_id gnl|my_center|LOCUS_11730 7461 8033 gene locus_tag LOCUS_11740 gene cobU 7461 8033 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680310.1 protein_id gnl|my_center|LOCUS_11740 7987 8763 gene locus_tag LOCUS_11750 gene cobS 7987 8763 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392616.1 protein_id gnl|my_center|LOCUS_11750 8760 9140 gene locus_tag LOCUS_11760 8760 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 9151 10119 gene locus_tag LOCUS_11770 gene cbiB 9151 10119 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989705.1 protein_id gnl|my_center|LOCUS_11770 10618 11700 gene locus_tag LOCUS_11780 gene cobD 10618 11700 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168408.1 protein_id gnl|my_center|LOCUS_11780 11682 13199 gene locus_tag LOCUS_11790 11682 13199 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_11790 13196 14287 gene locus_tag LOCUS_11800 gene cbiD 13196 14287 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168467.1 protein_id gnl|my_center|LOCUS_11800 14272 15477 gene locus_tag LOCUS_11810 14272 15477 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631406.1 protein_id gnl|my_center|LOCUS_11810 15481 16179 gene locus_tag LOCUS_11820 gene cobI 15481 16179 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626293.1 protein_id gnl|my_center|LOCUS_11820 16180 16935 gene locus_tag LOCUS_11830 gene cobM 16180 16935 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_11830 16932 17951 gene locus_tag LOCUS_11840 gene cbiG 16932 17951 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721596.1 protein_id gnl|my_center|LOCUS_11840 17948 18700 gene locus_tag LOCUS_11850 gene cobJ 17948 18700 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931509.1 protein_id gnl|my_center|LOCUS_11850 18697 19470 gene locus_tag LOCUS_11860 gene cobK 18697 19470 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721598.1 protein_id gnl|my_center|LOCUS_11860 19436 20065 gene locus_tag LOCUS_11870 19436 20065 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948611.1 protein_id gnl|my_center|LOCUS_11870 20133 20810 gene locus_tag LOCUS_11880 gene pnuC 20133 20810 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992863.1 protein_id gnl|my_center|LOCUS_11880 22073 21066 gene locus_tag LOCUS_11890 gene dusB 22073 21066 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence036 134 658 gene locus_tag LOCUS_11900 134 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 680 1504 gene locus_tag LOCUS_11910 680 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1491 1736 gene locus_tag LOCUS_11920 1491 1736 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567635.1 protein_id gnl|my_center|LOCUS_11920 2282 2989 gene locus_tag LOCUS_11930 2282 2989 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_11930 3969 3250 gene locus_tag LOCUS_11940 3969 3250 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692438.1 protein_id gnl|my_center|LOCUS_11940 4082 4729 gene locus_tag LOCUS_11950 4082 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 5025 4762 gene locus_tag LOCUS_11960 5025 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 5179 5104 gene locus_tag LOCUS_t00170 5179 5104 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5462 6760 gene locus_tag LOCUS_11970 5462 6760 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675942.1 protein_id gnl|my_center|LOCUS_11970 6781 7866 gene locus_tag LOCUS_11980 6781 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379688.1 protein_id gnl|my_center|LOCUS_11980 7863 8792 gene locus_tag LOCUS_11990 7863 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 8789 9247 gene locus_tag LOCUS_12000 8789 9247 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_12000 9993 9361 gene locus_tag LOCUS_12010 9993 9361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11437 10274 gene locus_tag LOCUS_12020 11437 10274 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490229.1 protein_id gnl|my_center|LOCUS_12020 12538 11453 gene locus_tag LOCUS_12030 gene serC 12538 11453 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_12030 13457 12780 gene locus_tag LOCUS_12040 13457 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 14267 13572 gene locus_tag LOCUS_12050 14267 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 16180 14360 gene locus_tag LOCUS_12060 gene typA 16180 14360 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_12060 16445 16361 gene locus_tag LOCUS_t00180 16445 16361 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 16548 16473 gene locus_tag LOCUS_t00190 16548 16473 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19442 17247 gene locus_tag LOCUS_12070 19442 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 19594 19439 gene locus_tag LOCUS_12080 19594 19439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 20510 19581 gene locus_tag LOCUS_12090 20510 19581 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385582.1 protein_id gnl|my_center|LOCUS_12090 20905 20507 gene locus_tag LOCUS_12100 gene ytrA 20905 20507 CDS product GntR family transcriptional regulator YtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229121.1 protein_id gnl|my_center|LOCUS_12100 21254 21793 gene locus_tag LOCUS_12110 gene spoVT 21254 21793 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence037 113 799 gene locus_tag LOCUS_12120 113 799 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_12120 802 2019 gene locus_tag LOCUS_12130 802 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2074 3705 gene locus_tag LOCUS_12140 2074 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 5081 3888 gene locus_tag LOCUS_12150 5081 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 8980 5357 gene locus_tag LOCUS_12160 8980 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 9603 11420 gene locus_tag LOCUS_12170 9603 11420 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287397.1 protein_id gnl|my_center|LOCUS_12170 12062 11526 gene locus_tag LOCUS_12180 12062 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 13128 12118 gene locus_tag LOCUS_12190 gene galE 13128 12118 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996539.1 protein_id gnl|my_center|LOCUS_12190 14531 13242 gene locus_tag LOCUS_12200 gene galK 14531 13242 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_12200 19261 14855 gene locus_tag LOCUS_12210 19261 14855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 15647 15743 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 20353 19394 gene locus_tag LOCUS_12220 20353 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence038 398 3013 gene locus_tag LOCUS_12230 398 3013 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_12230 3052 4332 gene locus_tag LOCUS_12240 3052 4332 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_12240 4558 5013 gene locus_tag LOCUS_12250 4558 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 5016 6347 gene locus_tag LOCUS_12260 5016 6347 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902958.1 protein_id gnl|my_center|LOCUS_12260 8227 6437 gene locus_tag LOCUS_12270 8227 6437 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_12270 10003 8687 gene locus_tag LOCUS_12280 10003 8687 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809868.1 protein_id gnl|my_center|LOCUS_12280 10566 12614 gene locus_tag LOCUS_12290 gene fusA 10566 12614 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_12290 13205 13360 gene locus_tag LOCUS_12300 13205 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 13360 13935 gene locus_tag LOCUS_12310 13360 13935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 14531 14845 gene locus_tag LOCUS_12320 14531 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 14878 15423 gene locus_tag LOCUS_12330 14878 15423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 15642 16661 gene locus_tag LOCUS_12340 15642 16661 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356351.1 protein_id gnl|my_center|LOCUS_12340 16996 18411 gene locus_tag LOCUS_12350 16996 18411 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166879.1 protein_id gnl|my_center|LOCUS_12350 18428 19879 gene locus_tag LOCUS_12360 gene sacA 18428 19879 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_12360 20057 20569 gene locus_tag LOCUS_12370 20057 20569 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706547.1 protein_id gnl|my_center|LOCUS_12370 >Feature sequence039 917 81 gene locus_tag LOCUS_12380 917 81 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_12380 1027 1827 gene locus_tag LOCUS_12390 1027 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4143 1843 gene locus_tag LOCUS_12400 4143 1843 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_12400 4555 4764 gene locus_tag LOCUS_12410 4555 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4954 6093 gene locus_tag LOCUS_12420 4954 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6140 6379 gene locus_tag LOCUS_12430 6140 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 7690 6521 gene locus_tag LOCUS_12440 7690 6521 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_12440 8239 9843 gene locus_tag LOCUS_12450 8239 9843 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_12450 9933 10643 gene locus_tag LOCUS_12460 9933 10643 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_12460 10603 12105 gene locus_tag LOCUS_12470 10603 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 12347 12979 gene locus_tag LOCUS_12480 12347 12979 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083848.1 protein_id gnl|my_center|LOCUS_12480 12957 14315 gene locus_tag LOCUS_12490 12957 14315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 14578 16083 gene locus_tag LOCUS_12500 14578 16083 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020940.1 protein_id gnl|my_center|LOCUS_12500 16669 16253 gene locus_tag LOCUS_12510 16669 16253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 17432 16794 gene locus_tag LOCUS_12520 17432 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 17727 18086 gene locus_tag LOCUS_12530 17727 18086 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041362228.1 protein_id gnl|my_center|LOCUS_12530 18112 19527 gene locus_tag LOCUS_12540 gene ffh 18112 19527 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_12540 19598 19840 gene locus_tag LOCUS_12550 gene rpsP 19598 19840 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_12550 20035 20268 gene locus_tag LOCUS_12560 20035 20268 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence040 2777 87 gene locus_tag LOCUS_12570 2777 87 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989971.1 protein_id gnl|my_center|LOCUS_12570 3075 3689 gene locus_tag LOCUS_12580 3075 3689 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_12580 4637 3915 gene locus_tag LOCUS_12590 4637 3915 CDS product DUF1911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942841.1 protein_id gnl|my_center|LOCUS_12590 4779 4615 gene locus_tag LOCUS_12600 4779 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5120 4782 gene locus_tag LOCUS_12610 5120 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5623 5276 gene locus_tag LOCUS_12620 5623 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 5819 5610 gene locus_tag LOCUS_12630 5819 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6236 5844 gene locus_tag LOCUS_12640 6236 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6899 6384 gene locus_tag LOCUS_12650 6899 6384 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141969.1 protein_id gnl|my_center|LOCUS_12650 7562 6915 gene locus_tag LOCUS_12660 7562 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 8130 7531 gene locus_tag LOCUS_12670 8130 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 8398 8832 gene locus_tag LOCUS_12680 8398 8832 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439566.1 protein_id gnl|my_center|LOCUS_12680 8838 9560 gene locus_tag LOCUS_12690 8838 9560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 11346 9673 gene locus_tag LOCUS_12700 11346 9673 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_12700 12005 12160 gene locus_tag LOCUS_12710 12005 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 12398 14071 gene locus_tag LOCUS_12720 gene ilvB 12398 14071 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_12720 14086 14592 gene locus_tag LOCUS_12730 gene ilvN 14086 14592 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_12730 14702 15736 gene locus_tag LOCUS_12740 gene ilvC 14702 15736 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_12740 15914 17581 gene locus_tag LOCUS_12750 gene ilvD 15914 17581 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966447.1 protein_id gnl|my_center|LOCUS_12750 17628 18890 gene locus_tag LOCUS_12760 gene leuC 17628 18890 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_12760 18893 19387 gene locus_tag LOCUS_12770 gene leuD 18893 19387 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_12770 <20017 19495 gene locus_tag LOCUS_12780 <20017 19495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583636.1:ThuA domain-containing protein >Feature sequence041 208 1626 gene locus_tag LOCUS_12790 gene hydG 208 1626 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203501.1 protein_id gnl|my_center|LOCUS_12790 1639 2844 gene locus_tag LOCUS_12800 gene hydF 1639 2844 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_12800 5608 2999 gene locus_tag LOCUS_12810 5608 2999 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949094.1 protein_id gnl|my_center|LOCUS_12810 7540 5939 gene locus_tag LOCUS_12820 7540 5939 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_12820 8229 7555 gene locus_tag LOCUS_12830 8229 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 9108 8248 gene locus_tag LOCUS_12840 9108 8248 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392335.1 protein_id gnl|my_center|LOCUS_12840 10139 9105 gene locus_tag LOCUS_12850 10139 9105 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_12850 11113 10139 gene locus_tag LOCUS_12860 11113 10139 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392333.1 protein_id gnl|my_center|LOCUS_12860 11538 11098 gene locus_tag LOCUS_12870 11538 11098 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_12870 12995 11529 gene locus_tag LOCUS_12880 12995 11529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 13536 13234 gene locus_tag LOCUS_12890 13536 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 13256 13265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13929 13549 gene locus_tag LOCUS_12900 13929 13549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 14724 13942 gene locus_tag LOCUS_12910 14724 13942 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_12910 16150 14774 gene locus_tag LOCUS_12920 gene fumC 16150 14774 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456610.1 protein_id gnl|my_center|LOCUS_12920 17037 17675 gene locus_tag LOCUS_12930 17037 17675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 19268 17739 gene locus_tag LOCUS_12940 gene cls 19268 17739 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence042 1292 183 gene locus_tag LOCUS_12950 1292 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 2694 1294 gene locus_tag LOCUS_12960 gene radA 2694 1294 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085212.1 protein_id gnl|my_center|LOCUS_12960 2946 5252 gene locus_tag LOCUS_12970 2946 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 6091 5354 gene locus_tag LOCUS_12980 gene cwlD 6091 5354 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822439.1 protein_id gnl|my_center|LOCUS_12980 7473 6439 gene locus_tag LOCUS_12990 7473 6439 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964805.1 protein_id gnl|my_center|LOCUS_12990 8821 7460 gene locus_tag LOCUS_13000 8821 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 9546 8818 gene locus_tag LOCUS_13010 9546 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 10408 9644 gene locus_tag LOCUS_13020 10408 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 10849 11793 gene locus_tag LOCUS_13030 10849 11793 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_13030 12198 11908 gene locus_tag LOCUS_13040 12198 11908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 12448 13452 gene locus_tag LOCUS_13050 12448 13452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 13469 14176 gene locus_tag LOCUS_13060 13469 14176 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_13060 14173 15018 gene locus_tag LOCUS_13070 14173 15018 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_13070 17228 15285 gene locus_tag LOCUS_13080 gene htpG 17228 15285 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243561.1 protein_id gnl|my_center|LOCUS_13080 18302 17451 gene locus_tag LOCUS_13090 18302 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 19152 18502 gene locus_tag LOCUS_13100 19152 18502 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005485135.1 protein_id gnl|my_center|LOCUS_13100 19338 19262 gene locus_tag LOCUS_t00200 19338 19262 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence043 1276 77 gene locus_tag LOCUS_13110 1276 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 2586 1555 gene locus_tag LOCUS_13120 gene hydE 2586 1555 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_13120 2762 3793 gene locus_tag LOCUS_13130 2762 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4874 3909 gene locus_tag LOCUS_13140 4874 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 5695 4886 gene locus_tag LOCUS_13150 5695 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 8078 6402 gene locus_tag LOCUS_13160 8078 6402 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_13160 10240 8378 gene locus_tag LOCUS_13170 10240 8378 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13170 10537 10316 gene locus_tag LOCUS_13180 10537 10316 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_13180 12310 10739 gene locus_tag LOCUS_13190 12310 10739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 14715 12394 gene locus_tag LOCUS_13200 14715 12394 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027033.1 protein_id gnl|my_center|LOCUS_13200 14899 14717 gene locus_tag LOCUS_13210 14899 14717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 15957 15571 gene locus_tag LOCUS_13220 15957 15571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 16491 16246 gene locus_tag LOCUS_13230 16491 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 16821 17879 gene locus_tag LOCUS_13240 16821 17879 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_13240 18299 17874 gene locus_tag LOCUS_13250 18299 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 18450 19220 gene locus_tag LOCUS_13260 gene udp 18450 19220 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence044 185 1618 gene locus_tag LOCUS_13270 185 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 2445 1687 gene locus_tag LOCUS_13280 2445 1687 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963439.1 protein_id gnl|my_center|LOCUS_13280 3110 2457 gene locus_tag LOCUS_13290 3110 2457 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120830.1 protein_id gnl|my_center|LOCUS_13290 3935 3132 gene locus_tag LOCUS_13300 3935 3132 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_13300 4278 5018 gene locus_tag LOCUS_13310 4278 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 5034 5735 gene locus_tag LOCUS_13320 5034 5735 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_13320 5722 6447 gene locus_tag LOCUS_13330 5722 6447 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_13330 6451 6870 gene locus_tag LOCUS_13340 6451 6870 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721534.1 protein_id gnl|my_center|LOCUS_13340 7204 7917 gene locus_tag LOCUS_13350 7204 7917 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_13350 7935 8378 gene locus_tag LOCUS_13360 7935 8378 CDS product RbsD/FucU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912113.1 protein_id gnl|my_center|LOCUS_13360 8375 9829 gene locus_tag LOCUS_13370 8375 9829 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_13370 9840 11684 gene locus_tag LOCUS_13380 9840 11684 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614258.1 protein_id gnl|my_center|LOCUS_13380 12245 12952 gene locus_tag LOCUS_13390 12245 12952 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_13390 12949 13473 gene locus_tag LOCUS_13400 gene cobO 12949 13473 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812021.1 protein_id gnl|my_center|LOCUS_13400 14370 13519 gene locus_tag LOCUS_13410 14370 13519 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965720.1 protein_id gnl|my_center|LOCUS_13410 14733 15416 gene locus_tag LOCUS_13420 gene rpe 14733 15416 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106173.1 protein_id gnl|my_center|LOCUS_13420 15506 16456 gene locus_tag LOCUS_13430 15506 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 16577 17536 gene locus_tag LOCUS_13440 gene hprK 16577 17536 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_13440 17658 18611 gene locus_tag LOCUS_13450 gene murB 17658 18611 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence045 1471 80 gene locus_tag LOCUS_13460 1471 80 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_13460 2915 1680 gene locus_tag LOCUS_13470 2915 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3404 2961 gene locus_tag LOCUS_13480 3404 2961 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674368.1 protein_id gnl|my_center|LOCUS_13480 4095 6188 gene locus_tag LOCUS_13490 4095 6188 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_13490 6394 7149 gene locus_tag LOCUS_13500 6394 7149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 7133 9736 gene locus_tag LOCUS_13510 7133 9736 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200226.1 protein_id gnl|my_center|LOCUS_13510 9993 9778 gene locus_tag LOCUS_13520 9993 9778 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_13520 10137 11030 gene locus_tag LOCUS_13530 10137 11030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 11054 11464 gene locus_tag LOCUS_13540 11054 11464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 13705 11582 gene locus_tag LOCUS_13550 gene pnp 13705 11582 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_13550 14154 13888 gene locus_tag LOCUS_13560 gene rpsO 14154 13888 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_13560 15285 14320 gene locus_tag LOCUS_13570 15285 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 15961 15374 gene locus_tag LOCUS_13580 15961 15374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 16896 16096 gene locus_tag LOCUS_13590 gene proC 16896 16096 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546562.1 protein_id gnl|my_center|LOCUS_13590 18121 17159 gene locus_tag LOCUS_13600 gene pfkA 18121 17159 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence046 1980 535 gene locus_tag LOCUS_13610 1980 535 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 protein_id gnl|my_center|LOCUS_13610 3352 1994 gene locus_tag LOCUS_13620 gene trkA 3352 1994 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_13620 3591 3379 gene locus_tag LOCUS_13630 3591 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4366 3602 gene locus_tag LOCUS_13640 4366 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13640 6417 4516 gene locus_tag LOCUS_13650 6417 4516 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437073.1 protein_id gnl|my_center|LOCUS_13650 9381 6781 gene locus_tag LOCUS_13660 9381 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 10201 9476 gene locus_tag LOCUS_13670 10201 9476 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392585.1 protein_id gnl|my_center|LOCUS_13670 10279 10416 gene locus_tag LOCUS_13680 10279 10416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 11226 10633 gene locus_tag LOCUS_13690 11226 10633 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_13690 11656 13182 gene locus_tag LOCUS_13700 11656 13182 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767764.1 protein_id gnl|my_center|LOCUS_13700 13494 13742 gene locus_tag LOCUS_13710 13494 13742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 14190 14975 gene locus_tag LOCUS_13720 gene rlmB 14190 14975 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724085.1 protein_id gnl|my_center|LOCUS_13720 15543 18005 gene locus_tag LOCUS_13730 15543 18005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence047 316 765 gene locus_tag LOCUS_13740 gene spoVAC 316 765 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_13740 1586 741 gene locus_tag LOCUS_13750 1586 741 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966060.1 protein_id gnl|my_center|LOCUS_13750 4397 1728 gene locus_tag LOCUS_13760 gene gyrA 4397 1728 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_13760 5168 4635 gene locus_tag LOCUS_13770 5168 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 7127 5181 gene locus_tag LOCUS_13780 gene gyrB 7127 5181 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_13780 8448 7297 gene locus_tag LOCUS_13790 gene recF 8448 7297 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_13790 8678 8445 gene locus_tag LOCUS_13800 gene yaaA 8678 8445 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_13800 10666 9560 gene locus_tag LOCUS_13810 gene dnaN 10666 9560 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963331.1 protein_id gnl|my_center|LOCUS_13810 12780 11404 gene locus_tag LOCUS_13820 gene dnaA 12780 11404 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_13820 13924 14292 gene locus_tag LOCUS_13830 13924 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 14289 14564 gene locus_tag LOCUS_13840 gene yidD 14289 14564 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172533.1 protein_id gnl|my_center|LOCUS_13840 14573 15727 gene locus_tag LOCUS_13850 14573 15727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 15803 16846 gene locus_tag LOCUS_13860 15803 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence048 533 219 gene locus_tag LOCUS_13870 533 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1587 682 gene locus_tag LOCUS_13880 gene argF 1587 682 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_13880 2863 1697 gene locus_tag LOCUS_13890 2863 1697 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_13890 3273 2878 gene locus_tag LOCUS_13900 3273 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3731 3270 gene locus_tag LOCUS_13910 3731 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 4619 3753 gene locus_tag LOCUS_13920 gene argB 4619 3753 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435171.1 protein_id gnl|my_center|LOCUS_13920 5891 4635 gene locus_tag LOCUS_13930 gene argJ 5891 4635 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_13930 6869 5922 gene locus_tag LOCUS_13940 gene argC 6869 5922 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197909.1 protein_id gnl|my_center|LOCUS_13940 7383 6880 gene locus_tag LOCUS_13950 7383 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 7606 7424 gene locus_tag LOCUS_13960 7606 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 8979 7603 gene locus_tag LOCUS_13970 gene argH 8979 7603 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808617.1 protein_id gnl|my_center|LOCUS_13970 9369 9016 gene locus_tag LOCUS_13980 9369 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 10753 9515 gene locus_tag LOCUS_13990 10753 9515 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_13990 11558 11034 gene locus_tag LOCUS_14000 11558 11034 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_14000 12546 11776 gene locus_tag LOCUS_14010 gene spo0A 12546 11776 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_14010 13307 12747 gene locus_tag LOCUS_14020 13307 12747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 13697 14905 gene locus_tag LOCUS_14030 gene spoIVB 13697 14905 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986434.1 protein_id gnl|my_center|LOCUS_14030 15309 15046 gene locus_tag LOCUS_14040 15309 15046 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_14040 16361 15666 gene locus_tag LOCUS_14050 gene trmD 16361 15666 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256255.1 protein_id gnl|my_center|LOCUS_14050 16860 16351 gene locus_tag LOCUS_14060 gene rimM 16860 16351 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence049 2880 244 gene locus_tag LOCUS_14070 gene ppdK 2880 244 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_14070 3238 4632 gene locus_tag LOCUS_14080 gene glmU 3238 4632 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966498.1 protein_id gnl|my_center|LOCUS_14080 4871 5503 gene locus_tag LOCUS_14090 gene pth 4871 5503 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_14090 5561 9025 gene locus_tag LOCUS_14100 gene mfd 5561 9025 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243453.1 protein_id gnl|my_center|LOCUS_14100 9187 10179 gene locus_tag LOCUS_14110 9187 10179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 10766 10329 gene locus_tag LOCUS_14120 gene rnhA 10766 10329 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003511799.1 protein_id gnl|my_center|LOCUS_14120 11007 12473 gene locus_tag LOCUS_14130 11007 12473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 12627 14672 gene locus_tag LOCUS_14140 gene recG 12627 14672 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_14140 14848 14923 gene locus_tag LOCUS_t00210 14848 14923 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14927 15003 gene locus_tag LOCUS_t00220 14927 15003 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15025 15100 gene locus_tag LOCUS_t00230 15025 15100 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15130 15205 gene locus_tag LOCUS_t00240 15130 15205 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15466 16230 gene locus_tag LOCUS_14150 gene ymdB 15466 16230 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_14150 16453 16713 gene locus_tag LOCUS_14160 gene spoVS 16453 16713 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence050 89 490 gene locus_tag LOCUS_14170 89 490 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976767.1 protein_id gnl|my_center|LOCUS_14170 3144 610 gene locus_tag LOCUS_14180 3144 610 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_14180 3473 3159 gene locus_tag LOCUS_14190 3473 3159 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_14190 3697 4389 gene locus_tag LOCUS_14200 3697 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 4389 5012 gene locus_tag LOCUS_14210 4389 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 5480 6064 gene locus_tag LOCUS_14220 5480 6064 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057070.1 protein_id gnl|my_center|LOCUS_14220 6074 7309 gene locus_tag LOCUS_14230 gene hemA 6074 7309 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460182.1 protein_id gnl|my_center|LOCUS_14230 7314 8189 gene locus_tag LOCUS_14240 gene hemC 7314 8189 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_14240 8206 9189 gene locus_tag LOCUS_14250 gene hemB 8206 9189 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963427.1 protein_id gnl|my_center|LOCUS_14250 9189 10493 gene locus_tag LOCUS_14260 gene hemL 9189 10493 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707264.1 protein_id gnl|my_center|LOCUS_14260 10557 11696 gene locus_tag LOCUS_14270 10557 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 11713 12546 gene locus_tag LOCUS_14280 gene cbiQ 11713 12546 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392734.1 protein_id gnl|my_center|LOCUS_14280 12531 13373 gene locus_tag LOCUS_14290 12531 13373 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345602.1 protein_id gnl|my_center|LOCUS_14290 13386 14873 gene locus_tag LOCUS_14300 gene cobA 13386 14873 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460180.1 protein_id gnl|my_center|LOCUS_14300 14877 16304 gene locus_tag LOCUS_14310 14877 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 16304 16483 gene locus_tag LOCUS_14320 16304 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence051 268 1275 gene locus_tag LOCUS_14330 268 1275 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072773820.1 protein_id gnl|my_center|LOCUS_14330 1285 2118 gene locus_tag LOCUS_14340 gene cysT 1285 2118 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227884.1 protein_id gnl|my_center|LOCUS_14340 2121 2945 gene locus_tag LOCUS_14350 gene cysW 2121 2945 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942001.1 protein_id gnl|my_center|LOCUS_14350 2945 4003 gene locus_tag LOCUS_14360 2945 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4059 4991 gene locus_tag LOCUS_14370 gene cysK 4059 4991 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117534.1 protein_id gnl|my_center|LOCUS_14370 5153 5485 gene locus_tag LOCUS_14380 5153 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 5947 7185 gene locus_tag LOCUS_14390 5947 7185 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963429.1 protein_id gnl|my_center|LOCUS_14390 7186 8046 gene locus_tag LOCUS_14400 7186 8046 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460728.1 protein_id gnl|my_center|LOCUS_14400 8039 8284 gene locus_tag LOCUS_14410 8039 8284 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816171.1 protein_id gnl|my_center|LOCUS_14410 8285 8602 gene locus_tag LOCUS_14420 gene trxA 8285 8602 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855302.1 protein_id gnl|my_center|LOCUS_14420 8624 8830 gene locus_tag LOCUS_14430 gene thiS 8624 8830 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945026.1 protein_id gnl|my_center|LOCUS_14430 8832 9644 gene locus_tag LOCUS_14440 gene moeB 8832 9644 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_14440 9674 10054 gene locus_tag LOCUS_14450 9674 10054 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816173.1 protein_id gnl|my_center|LOCUS_14450 10058 10963 gene locus_tag LOCUS_14460 gene trxB 10058 10963 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869571.1 protein_id gnl|my_center|LOCUS_14460 10977 12656 gene locus_tag LOCUS_14470 10977 12656 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_14470 12640 12954 gene locus_tag LOCUS_14480 12640 12954 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963432.1 protein_id gnl|my_center|LOCUS_14480 12967 13866 gene locus_tag LOCUS_14490 gene cysD 12967 13866 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_14490 13866 15554 gene locus_tag LOCUS_14500 gene cysN 13866 15554 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021169.1 protein_id gnl|my_center|LOCUS_14500 16258 15683 gene locus_tag LOCUS_14510 16258 15683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence052 132 208 gene locus_tag LOCUS_t00250 132 208 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 376 687 gene locus_tag LOCUS_14520 gene rplU 376 687 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000270907.1 protein_id gnl|my_center|LOCUS_14520 778 1014 gene locus_tag LOCUS_14530 778 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 1019 1300 gene locus_tag LOCUS_14540 gene rpmA 1019 1300 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564659.1 protein_id gnl|my_center|LOCUS_14540 1427 2698 gene locus_tag LOCUS_14550 gene obgE 1427 2698 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_14550 2711 3115 gene locus_tag LOCUS_14560 2711 3115 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_14560 3130 3867 gene locus_tag LOCUS_14570 3130 3867 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_14570 4357 6081 gene locus_tag LOCUS_14580 4357 6081 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 protein_id gnl|my_center|LOCUS_14580 7343 6273 gene locus_tag LOCUS_14590 7343 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 7821 7294 gene locus_tag LOCUS_14600 7821 7294 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_14600 8128 7886 gene locus_tag LOCUS_14610 8128 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 9742 8567 gene locus_tag LOCUS_14620 9742 8567 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_14620 10391 9993 gene locus_tag LOCUS_14630 10391 9993 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104332.1 protein_id gnl|my_center|LOCUS_14630 12759 10375 gene locus_tag LOCUS_14640 12759 10375 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048130.1 protein_id gnl|my_center|LOCUS_14640 13574 12807 gene locus_tag LOCUS_14650 13574 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 13689 13510 gene locus_tag LOCUS_14660 13689 13510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 14669 13773 gene locus_tag LOCUS_14670 gene era 14669 13773 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_14670 15181 14666 gene locus_tag LOCUS_14680 15181 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence053 1976 477 gene locus_tag LOCUS_14690 gene thrC 1976 477 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_14690 2392 2009 gene locus_tag LOCUS_14700 2392 2009 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938134.1 protein_id gnl|my_center|LOCUS_14700 3023 2373 gene locus_tag LOCUS_14710 gene rnhB 3023 2373 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163155.1 protein_id gnl|my_center|LOCUS_14710 3910 3023 gene locus_tag LOCUS_14720 gene ylqF 3910 3023 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965068.1 protein_id gnl|my_center|LOCUS_14720 4753 4112 gene locus_tag LOCUS_14730 gene lepB 4753 4112 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861178.1 protein_id gnl|my_center|LOCUS_14730 5274 4930 gene locus_tag LOCUS_14740 gene rplS 5274 4930 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_14740 6219 5560 gene locus_tag LOCUS_14750 6219 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14750 8066 6216 gene locus_tag LOCUS_14760 8066 6216 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_14760 8960 8133 gene locus_tag LOCUS_14770 8960 8133 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695943.1 protein_id gnl|my_center|LOCUS_14770 9922 9077 gene locus_tag LOCUS_14780 gene nudC 9922 9077 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102051.1 protein_id gnl|my_center|LOCUS_14780 9938 9947 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10200 10565 gene locus_tag LOCUS_14790 10200 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 10496 10843 gene locus_tag LOCUS_14800 10496 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 11624 10959 gene locus_tag LOCUS_14810 gene sigF 11624 10959 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965603.1 protein_id gnl|my_center|LOCUS_14810 12055 11609 gene locus_tag LOCUS_14820 gene spoIIAB 12055 11609 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_14820 12414 12052 gene locus_tag LOCUS_14830 12414 12052 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393007.1 protein_id gnl|my_center|LOCUS_14830 13400 12600 gene locus_tag LOCUS_14840 13400 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 13857 14411 gene locus_tag LOCUS_14850 13857 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 15176 14763 gene locus_tag LOCUS_14860 15176 14763 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889129.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence054 2782 164 gene locus_tag LOCUS_14870 2782 164 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_14870 3749 3270 gene locus_tag LOCUS_14880 3749 3270 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_14880 5612 3762 gene locus_tag LOCUS_14890 5612 3762 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964230.1 protein_id gnl|my_center|LOCUS_14890 6881 5769 gene locus_tag LOCUS_14900 6881 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 7002 7253 gene locus_tag LOCUS_14910 7002 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 7225 8388 gene locus_tag LOCUS_14920 7225 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 9515 8436 gene locus_tag LOCUS_14930 gene rpoD 9515 8436 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_14930 11269 9533 gene locus_tag LOCUS_14940 11269 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 12290 11298 gene locus_tag LOCUS_14950 12290 11298 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_14950 13053 12415 gene locus_tag LOCUS_14960 13053 12415 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965593.1 protein_id gnl|my_center|LOCUS_14960 13343 13143 gene locus_tag LOCUS_14970 gene rpmE 13343 13143 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_14970 14000 13482 gene locus_tag LOCUS_14980 14000 13482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 15040 13997 gene locus_tag LOCUS_14990 15040 13997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence055 364 83 gene locus_tag LOCUS_15000 364 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 376 385 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1108 719 gene locus_tag LOCUS_15010 1108 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1951 1181 gene locus_tag LOCUS_15020 1951 1181 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_15020 2287 2697 gene locus_tag LOCUS_15030 2287 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4798 2855 gene locus_tag LOCUS_15040 4798 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6360 4795 gene locus_tag LOCUS_15050 6360 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 7087 6365 gene locus_tag LOCUS_15060 gene rgaR 7087 6365 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_15060 7359 8249 gene locus_tag LOCUS_15070 7359 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 8466 8663 gene locus_tag LOCUS_15080 8466 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 8814 10775 gene locus_tag LOCUS_15090 8814 10775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 11212 12558 gene locus_tag LOCUS_15100 11212 12558 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_15100 12715 12790 gene locus_tag LOCUS_t00260 12715 12790 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13747 12983 gene locus_tag LOCUS_15110 13747 12983 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_15110 14940 13747 gene locus_tag LOCUS_15120 14940 13747 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094666698.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence056 1062 127 gene locus_tag LOCUS_15130 1062 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1510 3876 gene locus_tag LOCUS_15140 gene pcrA 1510 3876 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_15140 3880 4689 gene locus_tag LOCUS_15150 3880 4689 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_15150 4851 6269 gene locus_tag LOCUS_15160 gene pyk 4851 6269 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_15160 7350 6406 gene locus_tag LOCUS_15170 7350 6406 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_15170 8170 7556 gene locus_tag LOCUS_15180 8170 7556 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_15180 9001 8174 gene locus_tag LOCUS_15190 9001 8174 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_15190 9415 9005 gene locus_tag LOCUS_15200 9415 9005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643513.1 protein_id gnl|my_center|LOCUS_15200 9714 10211 gene locus_tag LOCUS_15210 9714 10211 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454674.1 protein_id gnl|my_center|LOCUS_15210 10463 11443 gene locus_tag LOCUS_15220 10463 11443 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389346.1 protein_id gnl|my_center|LOCUS_15220 11444 12397 gene locus_tag LOCUS_15230 11444 12397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 12500 13000 gene locus_tag LOCUS_15240 gene purE 12500 13000 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393549.1 protein_id gnl|my_center|LOCUS_15240 13043 13762 gene locus_tag LOCUS_15250 13043 13762 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964700.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence057 417 2339 gene locus_tag LOCUS_15260 417 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2365 4881 gene locus_tag LOCUS_15270 2365 4881 CDS product sensor domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495585.1 protein_id gnl|my_center|LOCUS_15270 7407 5605 gene locus_tag LOCUS_15280 gene lepA 7407 5605 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030952.1 protein_id gnl|my_center|LOCUS_15280 9474 7531 gene locus_tag LOCUS_15290 9474 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 10748 9693 gene locus_tag LOCUS_15300 gene cobT 10748 9693 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_15300 10988 12490 gene locus_tag LOCUS_15310 10988 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 12686 13615 gene locus_tag LOCUS_15320 12686 13615 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_15320 13612 14496 gene locus_tag LOCUS_15330 13612 14496 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence058 1450 326 gene locus_tag LOCUS_15340 1450 326 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811640.1 protein_id gnl|my_center|LOCUS_15340 2633 1890 gene locus_tag LOCUS_15350 2633 1890 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_15350 5294 2658 gene locus_tag LOCUS_15360 gene adhE 5294 2658 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_15360 5725 6534 gene locus_tag LOCUS_15370 gene spoIIGA 5725 6534 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_15370 6550 7293 gene locus_tag LOCUS_15380 gene sigE 6550 7293 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976948.1 protein_id gnl|my_center|LOCUS_15380 10018 7370 gene locus_tag LOCUS_15390 10018 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 11800 10388 gene locus_tag LOCUS_15400 11800 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 12686 11733 gene locus_tag LOCUS_15410 gene cdaA 12686 11733 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360232.1 protein_id gnl|my_center|LOCUS_15410 14035 12857 gene locus_tag LOCUS_15420 14035 12857 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_15420 14259 14032 gene locus_tag LOCUS_15430 14259 14032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence059 519 743 gene locus_tag LOCUS_15440 519 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1145 1759 gene locus_tag LOCUS_15450 1145 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1775 3172 gene locus_tag LOCUS_15460 1775 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15460 3272 3796 gene locus_tag LOCUS_15470 3272 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 4353 3874 gene locus_tag LOCUS_15480 4353 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 5426 4356 gene locus_tag LOCUS_15490 5426 4356 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_15490 5844 5578 gene locus_tag LOCUS_15500 5844 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 6954 5929 gene locus_tag LOCUS_15510 6954 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 7357 10182 gene locus_tag LOCUS_15520 7357 10182 CDS product dockerin type I domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964237.1 protein_id gnl|my_center|LOCUS_15520 12901 10469 gene locus_tag LOCUS_15530 12901 10469 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964231.1 protein_id gnl|my_center|LOCUS_15530 13846 13073 gene locus_tag LOCUS_15540 13846 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 14262 14011 gene locus_tag LOCUS_15550 14262 14011 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965971.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence060 683 15 gene locus_tag LOCUS_15560 683 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 894 1247 gene locus_tag LOCUS_15570 894 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2519 1260 gene locus_tag LOCUS_15580 2519 1260 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_15580 2737 2516 gene locus_tag LOCUS_15590 2737 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3304 2744 gene locus_tag LOCUS_15600 3304 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4360 3947 gene locus_tag LOCUS_15610 4360 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5721 4357 gene locus_tag LOCUS_15620 5721 4357 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113850176.1 protein_id gnl|my_center|LOCUS_15620 6195 5983 gene locus_tag LOCUS_15630 6195 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8588 6366 gene locus_tag LOCUS_15640 8588 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 9013 8585 gene locus_tag LOCUS_15650 9013 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 9218 9000 gene locus_tag LOCUS_15660 9218 9000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 11227 9230 gene locus_tag LOCUS_15670 11227 9230 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399687.1 protein_id gnl|my_center|LOCUS_15670 11817 11254 gene locus_tag LOCUS_15680 11817 11254 CDS product DUF2815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399690.1 protein_id gnl|my_center|LOCUS_15680 12940 11831 gene locus_tag LOCUS_15690 12940 11831 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_15690 13253 12930 gene locus_tag LOCUS_15700 13253 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 13604 13260 gene locus_tag LOCUS_15710 13604 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence061 636 10 gene locus_tag LOCUS_15720 636 10 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966000.1 protein_id gnl|my_center|LOCUS_15720 1897 683 gene locus_tag LOCUS_15730 1897 683 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812388.1 protein_id gnl|my_center|LOCUS_15730 2563 2201 gene locus_tag LOCUS_15740 2563 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 3271 2564 gene locus_tag LOCUS_15750 3271 2564 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895510.1 protein_id gnl|my_center|LOCUS_15750 3534 3268 gene locus_tag LOCUS_15760 3534 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 5475 3535 gene locus_tag LOCUS_15770 5475 3535 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_15770 7482 5782 gene locus_tag LOCUS_15780 7482 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 7904 8866 gene locus_tag LOCUS_15790 7904 8866 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172553.1 protein_id gnl|my_center|LOCUS_15790 8946 9191 gene locus_tag LOCUS_15800 8946 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 9339 9758 gene locus_tag LOCUS_15810 9339 9758 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_15810 10259 9765 gene locus_tag LOCUS_15820 10259 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 11428 10442 gene locus_tag LOCUS_15830 11428 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 12304 13587 gene locus_tag LOCUS_15840 gene glnA 12304 13587 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807771.1 protein_id gnl|my_center|LOCUS_15840 13632 14204 gene locus_tag LOCUS_15850 13632 14204 CDS product ANTAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807769.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence062 759 88 gene locus_tag LOCUS_15860 gene plsY 759 88 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_15860 2102 774 gene locus_tag LOCUS_15870 gene der 2102 774 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965018.1 protein_id gnl|my_center|LOCUS_15870 2795 2607 gene locus_tag LOCUS_15880 gene rpmF 2795 2607 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_15880 3267 2812 gene locus_tag LOCUS_15890 3267 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 3796 3389 gene locus_tag LOCUS_15900 3796 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_15900 5228 3888 gene locus_tag LOCUS_15910 5228 3888 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831993.1 protein_id gnl|my_center|LOCUS_15910 6589 5444 gene locus_tag LOCUS_15920 6589 5444 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_15920 7572 7342 gene locus_tag LOCUS_15930 7572 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 7944 9257 gene locus_tag LOCUS_15940 gene mtaB 7944 9257 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048000.1 protein_id gnl|my_center|LOCUS_15940 9662 13366 gene locus_tag LOCUS_15950 9662 13366 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence063 2337 538 gene locus_tag LOCUS_15960 2337 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 3877 2324 gene locus_tag LOCUS_15970 3877 2324 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_15970 5365 4139 gene locus_tag LOCUS_15980 5365 4139 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_15980 5902 5759 gene locus_tag LOCUS_15990 5902 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 6720 6103 gene locus_tag LOCUS_16000 gene cobC 6720 6103 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964694.1 protein_id gnl|my_center|LOCUS_16000 6949 7908 gene locus_tag LOCUS_16010 6949 7908 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583459.1 protein_id gnl|my_center|LOCUS_16010 8257 9543 gene locus_tag LOCUS_16020 gene rsxC 8257 9543 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_16020 9869 10864 gene locus_tag LOCUS_16030 9869 10864 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428487.1 protein_id gnl|my_center|LOCUS_16030 10866 11435 gene locus_tag LOCUS_16040 10866 11435 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015690.1 protein_id gnl|my_center|LOCUS_16040 11432 12097 gene locus_tag LOCUS_16050 11432 12097 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_16050 12094 12678 gene locus_tag LOCUS_16060 12094 12678 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869099.1 protein_id gnl|my_center|LOCUS_16060 12691 13539 gene locus_tag LOCUS_16070 12691 13539 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence064 125 637 gene locus_tag LOCUS_16080 125 637 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 protein_id gnl|my_center|LOCUS_16080 989 1486 gene locus_tag LOCUS_16090 989 1486 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_16090 1608 1889 gene locus_tag LOCUS_16100 1608 1889 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_16100 2239 2451 gene locus_tag LOCUS_16110 2239 2451 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809809.1 protein_id gnl|my_center|LOCUS_16110 2767 3420 gene locus_tag LOCUS_16120 2767 3420 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917062.1 protein_id gnl|my_center|LOCUS_16120 3633 4427 gene locus_tag LOCUS_16130 3633 4427 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338546.1 protein_id gnl|my_center|LOCUS_16130 4424 5254 gene locus_tag LOCUS_16140 gene rlmA 4424 5254 CDS product 23S rRNA (guanine(745)-N(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072721.1 protein_id gnl|my_center|LOCUS_16140 5768 7495 gene locus_tag LOCUS_16150 5768 7495 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_16150 8106 8627 gene locus_tag LOCUS_16160 8106 8627 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207579.1 protein_id gnl|my_center|LOCUS_16160 10696 8744 gene locus_tag LOCUS_16170 10696 8744 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811135.1 protein_id gnl|my_center|LOCUS_16170 11449 10703 gene locus_tag LOCUS_16180 11449 10703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 12332 11664 gene locus_tag LOCUS_16190 gene cmk 12332 11664 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644391.1 protein_id gnl|my_center|LOCUS_16190 13604 12369 gene locus_tag LOCUS_16200 13604 12369 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence065 1729 89 gene locus_tag LOCUS_16210 1729 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3129 1768 gene locus_tag LOCUS_16220 3129 1768 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_16220 3532 3837 gene locus_tag LOCUS_16230 3532 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 5128 3854 gene locus_tag LOCUS_16240 5128 3854 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964978.1 protein_id gnl|my_center|LOCUS_16240 6388 5132 gene locus_tag LOCUS_16250 6388 5132 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199036.1 protein_id gnl|my_center|LOCUS_16250 6695 6507 gene locus_tag LOCUS_16260 6695 6507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 6799 7023 gene locus_tag LOCUS_16270 6799 7023 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_16270 7023 7253 gene locus_tag LOCUS_16280 7023 7253 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459191.1 protein_id gnl|my_center|LOCUS_16280 7698 7321 gene locus_tag LOCUS_16290 7698 7321 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707699.1 protein_id gnl|my_center|LOCUS_16290 9107 7911 gene locus_tag LOCUS_16300 gene ilvA 9107 7911 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890721.1 protein_id gnl|my_center|LOCUS_16300 10498 9311 gene locus_tag LOCUS_16310 10498 9311 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_16310 11632 10547 gene locus_tag LOCUS_16320 gene leuB 11632 10547 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_16320 12343 12660 gene locus_tag LOCUS_16330 12343 12660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 12792 13313 gene locus_tag LOCUS_16340 12792 13313 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429214.1 protein_id gnl|my_center|LOCUS_16340 13448 13639 gene locus_tag LOCUS_16350 13448 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence066 887 285 gene locus_tag LOCUS_16360 gene recR 887 285 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_16360 1244 897 gene locus_tag LOCUS_16370 1244 897 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_16370 2898 1345 gene locus_tag LOCUS_16380 2898 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4656 3253 gene locus_tag LOCUS_16390 4656 3253 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_16390 6122 7351 gene locus_tag LOCUS_16400 6122 7351 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557280.1 protein_id gnl|my_center|LOCUS_16400 7678 8937 gene locus_tag LOCUS_16410 7678 8937 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224310.1 protein_id gnl|my_center|LOCUS_16410 9252 11591 gene locus_tag LOCUS_16420 gene yicI 9252 11591 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582725.1 protein_id gnl|my_center|LOCUS_16420 11798 12220 gene locus_tag LOCUS_16430 11798 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 12287 13369 gene locus_tag LOCUS_16440 12287 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence067 178 1356 gene locus_tag LOCUS_16450 gene thiI 178 1356 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_16450 1467 2048 gene locus_tag LOCUS_16460 1467 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2021 3370 gene locus_tag LOCUS_16470 2021 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3407 4216 gene locus_tag LOCUS_16480 3407 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 4349 5458 gene locus_tag LOCUS_16490 4349 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 5669 6232 gene locus_tag LOCUS_16500 5669 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 6367 7665 gene locus_tag LOCUS_16510 6367 7665 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_16510 7689 7916 gene locus_tag LOCUS_16520 7689 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 7933 8625 gene locus_tag LOCUS_16530 7933 8625 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504032.1 protein_id gnl|my_center|LOCUS_16530 8638 8787 gene locus_tag LOCUS_16540 8638 8787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 10716 9043 gene locus_tag LOCUS_16550 10716 9043 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048148.1 protein_id gnl|my_center|LOCUS_16550 10970 11497 gene locus_tag LOCUS_16560 10970 11497 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760496.1 protein_id gnl|my_center|LOCUS_16560 11717 12358 gene locus_tag LOCUS_16570 gene thiE 11717 12358 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963817.1 protein_id gnl|my_center|LOCUS_16570 12355 13203 gene locus_tag LOCUS_16580 12355 13203 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812154.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence068 674 6220 gene locus_tag LOCUS_16590 674 6220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 6217 7284 gene locus_tag LOCUS_16600 6217 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 7685 7362 gene locus_tag LOCUS_16610 7685 7362 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943224.1 protein_id gnl|my_center|LOCUS_16610 7947 7678 gene locus_tag LOCUS_16620 7947 7678 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595964.1 protein_id gnl|my_center|LOCUS_16620 8559 7960 gene locus_tag LOCUS_16630 gene thrH 8559 7960 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_16630 8975 11560 gene locus_tag LOCUS_16640 gene polA 8975 11560 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459637.1 protein_id gnl|my_center|LOCUS_16640 11544 11990 gene locus_tag LOCUS_16650 gene rimI 11544 11990 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368389.1 protein_id gnl|my_center|LOCUS_16650 11987 13117 gene locus_tag LOCUS_16660 11987 13117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence069 414 1139 gene locus_tag LOCUS_16670 414 1139 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963629.1 protein_id gnl|my_center|LOCUS_16670 1420 2796 gene locus_tag LOCUS_16680 1420 2796 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680439.1 protein_id gnl|my_center|LOCUS_16680 2937 5039 gene locus_tag LOCUS_16690 gene feoB 2937 5039 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_16690 5265 5420 gene locus_tag LOCUS_16700 5265 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 7628 5697 gene locus_tag LOCUS_16710 7628 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 8709 7879 gene locus_tag LOCUS_16720 gene rsmI 8709 7879 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530019.1 protein_id gnl|my_center|LOCUS_16720 9411 8755 gene locus_tag LOCUS_16730 9411 8755 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_16730 11094 9502 gene locus_tag LOCUS_16740 11094 9502 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_16740 11876 11289 gene locus_tag LOCUS_16750 11876 11289 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_16750 12037 12843 gene locus_tag LOCUS_16760 12037 12843 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence070 <1 1012 gene locus_tag LOCUS_16770 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475723.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 1222 2007 gene locus_tag LOCUS_16780 1222 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3266 2139 gene locus_tag LOCUS_16790 3266 2139 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_16790 6028 3509 gene locus_tag LOCUS_16800 6028 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6361 6690 gene locus_tag LOCUS_16810 6361 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 7385 6678 gene locus_tag LOCUS_16820 gene sfsA 7385 6678 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_16820 8747 7395 gene locus_tag LOCUS_16830 8747 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 10171 8738 gene locus_tag LOCUS_16840 10171 8738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 10941 10210 gene locus_tag LOCUS_16850 10941 10210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 12175 11312 gene locus_tag LOCUS_16860 12175 11312 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_16860 12580 12188 gene locus_tag LOCUS_16870 12580 12188 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence071 658 104 gene locus_tag LOCUS_16880 658 104 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_16880 1649 672 gene locus_tag LOCUS_16890 gene bsh 1649 672 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317802.1 protein_id gnl|my_center|LOCUS_16890 1793 2008 gene locus_tag LOCUS_16900 1793 2008 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525227.1 protein_id gnl|my_center|LOCUS_16900 2005 2472 gene locus_tag LOCUS_16910 2005 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 2574 3812 gene locus_tag LOCUS_16920 2574 3812 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288208.1 protein_id gnl|my_center|LOCUS_16920 4607 6085 gene locus_tag LOCUS_16930 4607 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 6478 7926 gene locus_tag LOCUS_16940 6478 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 7916 8626 gene locus_tag LOCUS_16950 7916 8626 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895848.1 protein_id gnl|my_center|LOCUS_16950 8623 10434 gene locus_tag LOCUS_16960 8623 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 10447 11718 gene locus_tag LOCUS_16970 10447 11718 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244568.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence072 738 118 gene locus_tag LOCUS_16980 738 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1536 2381 gene locus_tag LOCUS_16990 gene licT 1536 2381 CDS product transcriptional antiterminator LicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242598.1 protein_id gnl|my_center|LOCUS_16990 2503 4671 gene locus_tag LOCUS_17000 gene ptsG 2503 4671 CDS product PTS glucose transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473177.1 protein_id gnl|my_center|LOCUS_17000 4781 5038 gene locus_tag LOCUS_17010 4781 5038 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_17010 5075 5617 gene locus_tag LOCUS_17020 5075 5617 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_17020 5633 7267 gene locus_tag LOCUS_17030 gene ptsP 5633 7267 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_17030 7387 7800 gene locus_tag LOCUS_17040 7387 7800 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774977.1 protein_id gnl|my_center|LOCUS_17040 7996 8451 gene locus_tag LOCUS_17050 7996 8451 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840640.1 protein_id gnl|my_center|LOCUS_17050 8465 9514 gene locus_tag LOCUS_17060 8465 9514 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476131.1 protein_id gnl|my_center|LOCUS_17060 9535 10053 gene locus_tag LOCUS_17070 9535 10053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 10055 10342 gene locus_tag LOCUS_17080 10055 10342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 10494 11063 gene locus_tag LOCUS_17090 10494 11063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 11253 12368 gene locus_tag LOCUS_17100 11253 12368 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence073 863 540 gene locus_tag LOCUS_17110 863 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 2608 1022 gene locus_tag LOCUS_17120 2608 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4233 2716 gene locus_tag LOCUS_17130 4233 2716 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_17130 6869 4323 gene locus_tag LOCUS_17140 6869 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 8268 6946 gene locus_tag LOCUS_17150 8268 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 9569 8532 gene locus_tag LOCUS_17160 gene gap 9569 8532 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_17160 9902 10984 gene locus_tag LOCUS_17170 9902 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 11215 12222 gene locus_tag LOCUS_17180 11215 12222 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence074 277 2112 gene locus_tag LOCUS_17190 277 2112 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391166.1 protein_id gnl|my_center|LOCUS_17190 3082 2198 gene locus_tag LOCUS_17200 3082 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2550 2559 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4077 3079 gene locus_tag LOCUS_17210 4077 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 5539 4070 gene locus_tag LOCUS_17220 5539 4070 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890705.1 protein_id gnl|my_center|LOCUS_17220 5703 6995 gene locus_tag LOCUS_17230 5703 6995 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887601.1 protein_id gnl|my_center|LOCUS_17230 7014 7619 gene locus_tag LOCUS_17240 7014 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 8413 7667 gene locus_tag LOCUS_17250 8413 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 8621 10357 gene locus_tag LOCUS_17260 8621 10357 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_17260 10371 12128 gene locus_tag LOCUS_17270 10371 12128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence075 232 1365 gene locus_tag LOCUS_17280 232 1365 CDS product tyramine oxidase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014462.1 protein_id gnl|my_center|LOCUS_17280 1385 1711 gene locus_tag LOCUS_17290 1385 1711 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869719.1 protein_id gnl|my_center|LOCUS_17290 1708 3297 gene locus_tag LOCUS_17300 1708 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17300 3294 3614 gene locus_tag LOCUS_17310 3294 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3611 4723 gene locus_tag LOCUS_17320 3611 4723 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267598.1 protein_id gnl|my_center|LOCUS_17320 4882 5244 gene locus_tag LOCUS_17330 4882 5244 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964000.1 protein_id gnl|my_center|LOCUS_17330 5286 6761 gene locus_tag LOCUS_17340 5286 6761 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084045.1 protein_id gnl|my_center|LOCUS_17340 7200 8030 gene locus_tag LOCUS_17350 7200 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 9353 8076 gene locus_tag LOCUS_17360 9353 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 10132 9359 gene locus_tag LOCUS_17370 10132 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 10654 11823 gene locus_tag LOCUS_17380 10654 11823 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence076 1524 106 gene locus_tag LOCUS_17390 gene glgA 1524 106 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_17390 3048 1924 gene locus_tag LOCUS_17400 gene glgD 3048 1924 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965536.1 protein_id gnl|my_center|LOCUS_17400 4266 3064 gene locus_tag LOCUS_17410 gene glgC 4266 3064 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057619.1 protein_id gnl|my_center|LOCUS_17410 6412 4358 gene locus_tag LOCUS_17420 gene glgB 6412 4358 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_17420 8829 6583 gene locus_tag LOCUS_17430 gene spoIIE 8829 6583 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966481.1 protein_id gnl|my_center|LOCUS_17430 10188 9274 gene locus_tag LOCUS_17440 10188 9274 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813143.1 protein_id gnl|my_center|LOCUS_17440 10880 10200 gene locus_tag LOCUS_17450 10880 10200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 <11493 10896 gene locus_tag LOCUS_17460 <11493 10896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814376.1:ModD protein >Feature sequence077 2985 142 gene locus_tag LOCUS_17470 2985 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 4246 3302 gene locus_tag LOCUS_17480 gene glcK 4246 3302 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_17480 5266 4289 gene locus_tag LOCUS_17490 gene manA 5266 4289 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287262.1 protein_id gnl|my_center|LOCUS_17490 6055 5279 gene locus_tag LOCUS_17500 6055 5279 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727676.1 protein_id gnl|my_center|LOCUS_17500 8244 6052 gene locus_tag LOCUS_17510 8244 6052 CDS product dockerin type I domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964237.1 protein_id gnl|my_center|LOCUS_17510 9156 8602 gene locus_tag LOCUS_17520 9156 8602 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_17520 10773 9337 gene locus_tag LOCUS_17530 gene purB 10773 9337 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence078 2186 351 gene locus_tag LOCUS_17540 gene ftsH 2186 351 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_17540 4178 2379 gene locus_tag LOCUS_17550 4178 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 4689 4195 gene locus_tag LOCUS_17560 4689 4195 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_17560 6734 4899 gene locus_tag LOCUS_17570 gene asnB 6734 4899 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392813.1 protein_id gnl|my_center|LOCUS_17570 10199 6873 gene locus_tag LOCUS_17580 10199 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 11176 10727 gene locus_tag LOCUS_17590 11176 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence079 1579 143 gene locus_tag LOCUS_17600 1579 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2346 1648 gene locus_tag LOCUS_17610 2346 1648 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_17610 2852 3142 gene locus_tag LOCUS_17620 gene groES 2852 3142 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567052.1 protein_id gnl|my_center|LOCUS_17620 3191 4822 gene locus_tag LOCUS_17630 gene groL 3191 4822 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_17630 6405 5002 gene locus_tag LOCUS_17640 6405 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6773 8389 gene locus_tag LOCUS_17650 6773 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 8924 8469 gene locus_tag LOCUS_17660 8924 8469 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100899.1 protein_id gnl|my_center|LOCUS_17660 9377 8937 gene locus_tag LOCUS_17670 9377 8937 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868208.1 protein_id gnl|my_center|LOCUS_17670 9654 10928 gene locus_tag LOCUS_17680 9654 10928 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048438.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence080 2027 84 gene locus_tag LOCUS_17690 2027 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 3476 2094 gene locus_tag LOCUS_17700 gene tilS 3476 2094 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_17700 4815 3466 gene locus_tag LOCUS_17710 4815 3466 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966975.1 protein_id gnl|my_center|LOCUS_17710 5506 5060 gene locus_tag LOCUS_17720 gene rplI 5506 5060 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226915.1 protein_id gnl|my_center|LOCUS_17720 7691 5727 gene locus_tag LOCUS_17730 7691 5727 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_17730 9606 7759 gene locus_tag LOCUS_17740 9606 7759 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence081 492 809 gene locus_tag LOCUS_17750 492 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2075 912 gene locus_tag LOCUS_17760 gene dnaJ 2075 912 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142730484.1 protein_id gnl|my_center|LOCUS_17760 4319 2451 gene locus_tag LOCUS_17770 gene dnaK 4319 2451 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_17770 5041 4424 gene locus_tag LOCUS_17780 5041 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5662 5057 gene locus_tag LOCUS_17790 5662 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 6758 5679 gene locus_tag LOCUS_17800 gene hrcA 6758 5679 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_17800 7098 7697 gene locus_tag LOCUS_17810 7098 7697 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009924525.1 protein_id gnl|my_center|LOCUS_17810 7690 8064 gene locus_tag LOCUS_17820 7690 8064 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966724.1 protein_id gnl|my_center|LOCUS_17820 8268 8855 gene locus_tag LOCUS_17830 8268 8855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 8979 10367 gene locus_tag LOCUS_17840 8979 10367 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence082 2045 195 gene locus_tag LOCUS_17850 2045 195 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281991.1 protein_id gnl|my_center|LOCUS_17850 3047 2064 gene locus_tag LOCUS_17860 3047 2064 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_17860 3721 3257 gene locus_tag LOCUS_17870 3721 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 4471 3794 gene locus_tag LOCUS_17880 4471 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 4961 4689 gene locus_tag LOCUS_17890 4961 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 4960 6123 gene locus_tag LOCUS_17900 gene ribD 4960 6123 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_17900 6125 6760 gene locus_tag LOCUS_17910 6125 6760 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459819.1 protein_id gnl|my_center|LOCUS_17910 6772 7254 gene locus_tag LOCUS_17920 6772 7254 CDS product NADAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_17920 7268 8470 gene locus_tag LOCUS_17930 7268 8470 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_17930 8483 9010 gene locus_tag LOCUS_17940 8483 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 9130 9888 gene locus_tag LOCUS_17950 9130 9888 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769562.1 protein_id gnl|my_center|LOCUS_17950 9885 10346 gene locus_tag LOCUS_17960 gene ribE 9885 10346 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence083 2443 4638 gene locus_tag LOCUS_17970 2443 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 5224 6396 gene locus_tag LOCUS_17980 5224 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 6393 6908 gene locus_tag LOCUS_17990 gene tadA 6393 6908 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254132.1 protein_id gnl|my_center|LOCUS_17990 9851 7056 gene locus_tag LOCUS_18000 9851 7056 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582726.1 protein_id gnl|my_center|LOCUS_18000 >Feature sequence084 868 452 gene locus_tag LOCUS_18010 868 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1076 1351 gene locus_tag LOCUS_18020 1076 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1825 1532 gene locus_tag LOCUS_18030 1825 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 4255 1856 gene locus_tag LOCUS_18040 gene pheT 4255 1856 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_18040 5292 4273 gene locus_tag LOCUS_18050 gene pheS 5292 4273 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_18050 5771 5935 gene locus_tag LOCUS_18060 5771 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 5953 6471 gene locus_tag LOCUS_18070 5953 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 6468 6758 gene locus_tag LOCUS_18080 6468 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 6942 8285 gene locus_tag LOCUS_18090 6942 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 9484 8690 gene locus_tag LOCUS_18100 9484 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence085 207 665 gene locus_tag LOCUS_18110 207 665 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459496.1 protein_id gnl|my_center|LOCUS_18110 1130 831 gene locus_tag LOCUS_18120 1130 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 4713 1135 gene locus_tag LOCUS_18130 gene rpoC 4713 1135 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966420.1 protein_id gnl|my_center|LOCUS_18130 8755 4829 gene locus_tag LOCUS_18140 gene rpoB 8755 4829 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence086 340 807 gene locus_tag LOCUS_18150 gene greA 340 807 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_18150 828 2453 gene locus_tag LOCUS_18160 gene lysS 828 2453 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048371.1 protein_id gnl|my_center|LOCUS_18160 2625 3620 gene locus_tag LOCUS_18170 2625 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3621 4454 gene locus_tag LOCUS_18180 3621 4454 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_18180 4451 4858 gene locus_tag LOCUS_18190 4451 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461799.1 protein_id gnl|my_center|LOCUS_18190 5154 6644 gene locus_tag LOCUS_18200 gene glgA 5154 6644 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_18200 7896 7324 gene locus_tag LOCUS_18210 gene pdxT 7896 7324 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_18210 8768 7896 gene locus_tag LOCUS_18220 gene pdxS 8768 7896 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence087 519 1919 gene locus_tag LOCUS_18230 gene purF 519 1919 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047942.1 protein_id gnl|my_center|LOCUS_18230 1998 3032 gene locus_tag LOCUS_18240 gene purM 1998 3032 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_18240 3052 3678 gene locus_tag LOCUS_18250 gene purN 3052 3678 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_18250 3703 4416 gene locus_tag LOCUS_18260 3703 4416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 4429 5610 gene locus_tag LOCUS_18270 4429 5610 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_18270 5629 6909 gene locus_tag LOCUS_18280 gene purD 5629 6909 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_18280 6951 8795 gene locus_tag LOCUS_18290 gene uvrC 6951 8795 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence088 957 73 gene locus_tag LOCUS_18300 957 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1725 970 gene locus_tag LOCUS_18310 1725 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2103 2028 gene locus_tag LOCUS_t00270 2103 2028 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2940 2865 gene locus_tag LOCUS_t00280 2940 2865 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4355 3249 gene locus_tag LOCUS_18320 4355 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 4672 4588 gene locus_tag LOCUS_t00290 4672 4588 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5112 4699 gene locus_tag LOCUS_18330 5112 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 4883 4892 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5463 5263 gene locus_tag LOCUS_18340 5463 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5628 5479 gene locus_tag LOCUS_18350 5628 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 5950 6822 gene locus_tag LOCUS_18360 5950 6822 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_18360 6819 7826 gene locus_tag LOCUS_18370 gene prmA 6819 7826 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_18370 7829 8713 gene locus_tag LOCUS_18380 7829 8713 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421907.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence089 122 883 gene locus_tag LOCUS_18390 122 883 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_18390 1270 4761 gene locus_tag LOCUS_18400 gene xynA 1270 4761 CDS product endo-1,4-beta-xylanase XynA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082550.1 protein_id gnl|my_center|LOCUS_18400 5927 5052 gene locus_tag LOCUS_18410 5927 5052 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681080.1 protein_id gnl|my_center|LOCUS_18410 7235 5943 gene locus_tag LOCUS_18420 7235 5943 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267047.1 protein_id gnl|my_center|LOCUS_18420 7918 7376 gene locus_tag LOCUS_18430 7918 7376 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_18430 8419 7979 gene locus_tag LOCUS_18440 8419 7979 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357560.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence090 1764 481 gene locus_tag LOCUS_18450 gene galK 1764 481 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_18450 3999 1813 gene locus_tag LOCUS_18460 3999 1813 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111154492.1 protein_id gnl|my_center|LOCUS_18460 4968 4120 gene locus_tag LOCUS_18470 4968 4120 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_18470 5846 4965 gene locus_tag LOCUS_18480 5846 4965 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_18480 7138 5843 gene locus_tag LOCUS_18490 7138 5843 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 protein_id gnl|my_center|LOCUS_18490 7379 8260 gene locus_tag LOCUS_18500 7379 8260 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909131.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence091 231 2387 gene locus_tag LOCUS_18510 231 2387 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_18510 2391 3611 gene locus_tag LOCUS_18520 2391 3611 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086845922.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence092 419 1333 gene locus_tag LOCUS_18530 419 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 4253 1488 gene locus_tag LOCUS_18540 4253 1488 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964234.1 protein_id gnl|my_center|LOCUS_18540 4756 4451 gene locus_tag LOCUS_18550 4756 4451 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720075.1 protein_id gnl|my_center|LOCUS_18550 6900 5179 gene locus_tag LOCUS_18560 6900 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 7981 7148 gene locus_tag LOCUS_18570 7981 7148 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence093 209 757 gene locus_tag LOCUS_18580 209 757 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_18580 1720 842 gene locus_tag LOCUS_18590 1720 842 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963818.1 protein_id gnl|my_center|LOCUS_18590 3474 1903 gene locus_tag LOCUS_18600 3474 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3783 4124 gene locus_tag LOCUS_18610 3783 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4649 4119 gene locus_tag LOCUS_18620 4649 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4773 5204 gene locus_tag LOCUS_18630 4773 5204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 5220 5390 gene locus_tag LOCUS_18640 5220 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 5841 5431 gene locus_tag LOCUS_18650 5841 5431 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_18650 6527 6054 gene locus_tag LOCUS_18660 6527 6054 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_18660 7389 8015 gene locus_tag LOCUS_18670 7389 8015 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence094 245 691 gene locus_tag LOCUS_18680 245 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 879 1343 gene locus_tag LOCUS_18690 gene smpB 879 1343 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_18690 1357 1729 gene locus_tag LOCUS_tm00010 1357 1729 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3162 1708 gene locus_tag LOCUS_18700 3162 1708 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389524.1 protein_id gnl|my_center|LOCUS_18700 3525 3298 gene locus_tag LOCUS_18710 3525 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 3842 3522 gene locus_tag LOCUS_18720 3842 3522 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_18720 4522 3929 gene locus_tag LOCUS_18730 4522 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 4853 4515 gene locus_tag LOCUS_18740 4853 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 4996 5208 gene locus_tag LOCUS_18750 4996 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 5241 5927 gene locus_tag LOCUS_18760 5241 5927 CDS product Rha family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816482.1 protein_id gnl|my_center|LOCUS_18760 6016 6195 gene locus_tag LOCUS_18770 6016 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 6874 6119 gene locus_tag LOCUS_18780 6874 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 7008 7199 gene locus_tag LOCUS_18790 7008 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 7241 7450 gene locus_tag LOCUS_18800 7241 7450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 7686 7865 gene locus_tag LOCUS_18810 7686 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 7867 8022 gene locus_tag LOCUS_18820 7867 8022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence095 791 1081 gene locus_tag LOCUS_18830 791 1081 CDS product DUF960 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296262.1 protein_id gnl|my_center|LOCUS_18830 1894 1247 gene locus_tag LOCUS_18840 1894 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 1922 2932 gene locus_tag LOCUS_18850 1922 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2868 3047 gene locus_tag LOCUS_18860 2868 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 3116 4657 gene locus_tag LOCUS_18870 3116 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 4654 4974 gene locus_tag LOCUS_18880 4654 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 4989 5261 gene locus_tag LOCUS_18890 4989 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 5417 6982 gene locus_tag LOCUS_18900 5417 6982 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence096 2401 131 gene locus_tag LOCUS_18910 2401 131 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_18910 4368 2947 gene locus_tag LOCUS_18920 4368 2947 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461705.1 protein_id gnl|my_center|LOCUS_18920 7480 4334 gene locus_tag LOCUS_18930 7480 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 7557 7566 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence097 243 2294 gene locus_tag LOCUS_18940 243 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2816 2328 gene locus_tag LOCUS_18950 2816 2328 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_18950 3648 2944 gene locus_tag LOCUS_18960 gene deoD 3648 2944 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_18960 5101 3680 gene locus_tag LOCUS_18970 5101 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 6307 6810 gene locus_tag LOCUS_18980 6307 6810 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_18980 6791 7681 gene locus_tag LOCUS_18990 6791 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 >Feature sequence098 612 61 gene locus_tag LOCUS_19000 612 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 904 671 gene locus_tag LOCUS_19010 904 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 995 810 gene locus_tag LOCUS_19020 995 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2077 1118 gene locus_tag LOCUS_19030 2077 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 3209 2079 gene locus_tag LOCUS_19040 3209 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3560 3276 gene locus_tag LOCUS_19050 3560 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 4397 6673 gene locus_tag LOCUS_19060 4397 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 6807 6986 gene locus_tag LOCUS_19070 6807 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 >Feature sequence099 1286 1663 gene locus_tag LOCUS_19080 1286 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1785 2795 gene locus_tag LOCUS_19090 1785 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2806 2997 gene locus_tag LOCUS_19100 2806 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 3028 3171 gene locus_tag LOCUS_19110 3028 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3616 4581 gene locus_tag LOCUS_19120 3616 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 4581 5003 gene locus_tag LOCUS_19130 4581 5003 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510187.1 protein_id gnl|my_center|LOCUS_19130 5011 6567 gene locus_tag LOCUS_19140 5011 6567 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence100 535 176 gene locus_tag LOCUS_19150 535 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3869 1065 gene locus_tag LOCUS_19160 3869 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 5326 4424 gene locus_tag LOCUS_19170 5326 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 5808 5362 gene locus_tag LOCUS_19180 5808 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7254 6268 gene locus_tag LOCUS_19190 7254 6268 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519082.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence101 855 208 gene locus_tag LOCUS_19200 gene phoU 855 208 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_19200 1604 855 gene locus_tag LOCUS_19210 gene pstB 1604 855 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_19210 3384 2380 gene locus_tag LOCUS_19220 gene pstA 3384 2380 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_19220 4229 3381 gene locus_tag LOCUS_19230 gene pstC 4229 3381 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_19230 5616 4765 gene locus_tag LOCUS_19240 5616 4765 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_19240 6821 5910 gene locus_tag LOCUS_19250 6821 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence102 97 897 gene locus_tag LOCUS_19260 97 897 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973229.1 protein_id gnl|my_center|LOCUS_19260 1591 953 gene locus_tag LOCUS_19270 1591 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2022 1861 gene locus_tag LOCUS_19280 2022 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2171 2019 gene locus_tag LOCUS_19290 2171 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 2155 2164 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2828 2214 gene locus_tag LOCUS_19300 2828 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 3820 3221 gene locus_tag LOCUS_19310 3820 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 4839 3898 gene locus_tag LOCUS_19320 4839 3898 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_19320 5987 4836 gene locus_tag LOCUS_19330 5987 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 7131 5980 gene locus_tag LOCUS_19340 7131 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence103 521 1468 gene locus_tag LOCUS_19350 gene dpsA 521 1468 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392578.1 protein_id gnl|my_center|LOCUS_19350 1699 3939 gene locus_tag LOCUS_19360 1699 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 4057 4797 gene locus_tag LOCUS_19370 4057 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 6370 4892 gene locus_tag LOCUS_19380 6370 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 6523 7104 gene locus_tag LOCUS_19390 6523 7104 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392579.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence104 119 1462 gene locus_tag LOCUS_19400 gene pepV 119 1462 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016277.1 protein_id gnl|my_center|LOCUS_19400 1465 1695 gene locus_tag LOCUS_19410 1465 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965331.1 protein_id gnl|my_center|LOCUS_19410 1768 2235 gene locus_tag LOCUS_19420 1768 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2250 2795 gene locus_tag LOCUS_19430 2250 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 2890 3339 gene locus_tag LOCUS_19440 2890 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3987 3451 gene locus_tag LOCUS_19450 3987 3451 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357379.1 protein_id gnl|my_center|LOCUS_19450 4742 3984 gene locus_tag LOCUS_19460 4742 3984 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_19460 5803 4742 gene locus_tag LOCUS_19470 5803 4742 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_19470 6027 5821 gene locus_tag LOCUS_19480 6027 5821 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357528.1 protein_id gnl|my_center|LOCUS_19480 6855 6199 gene locus_tag LOCUS_19490 6855 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357453.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence105 189 371 gene locus_tag LOCUS_19500 189 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 415 927 gene locus_tag LOCUS_19510 415 927 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019758.1 protein_id gnl|my_center|LOCUS_19510 924 1427 gene locus_tag LOCUS_19520 gene atpH 924 1427 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142900.1 protein_id gnl|my_center|LOCUS_19520 1437 2945 gene locus_tag LOCUS_19530 gene atpA 1437 2945 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_19530 2947 3843 gene locus_tag LOCUS_19540 gene atpG 2947 3843 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272788.1 protein_id gnl|my_center|LOCUS_19540 4048 5442 gene locus_tag LOCUS_19550 gene atpD 4048 5442 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_19550 5453 5869 gene locus_tag LOCUS_19560 gene atpC 5453 5869 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 protein_id gnl|my_center|LOCUS_19560 6324 5923 gene locus_tag LOCUS_19570 6324 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 6554 6321 gene locus_tag LOCUS_19580 6554 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence106 1530 49 gene locus_tag LOCUS_19590 1530 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5303 1671 gene locus_tag LOCUS_19600 5303 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 5471 6262 gene locus_tag LOCUS_19610 gene sigG 5471 6262 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416101.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence107 471 638 gene locus_tag LOCUS_19620 471 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 620 2434 gene locus_tag LOCUS_19630 gene iorA 620 2434 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392452.1 protein_id gnl|my_center|LOCUS_19630 2427 2999 gene locus_tag LOCUS_19640 2427 2999 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392451.1 protein_id gnl|my_center|LOCUS_19640 3012 4247 gene locus_tag LOCUS_19650 3012 4247 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021729.1 protein_id gnl|my_center|LOCUS_19650 4705 4905 gene locus_tag LOCUS_19660 4705 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 5152 5724 gene locus_tag LOCUS_19670 5152 5724 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_19670 5800 6210 gene locus_tag LOCUS_19680 5800 6210 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence108 250 903 gene locus_tag LOCUS_19690 250 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 900 2297 gene locus_tag LOCUS_19700 900 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2301 3629 gene locus_tag LOCUS_19710 2301 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 3630 4259 gene locus_tag LOCUS_19720 3630 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 4272 4469 gene locus_tag LOCUS_19730 4272 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 4469 4729 gene locus_tag LOCUS_19740 4469 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 4734 5948 gene locus_tag LOCUS_19750 4734 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence109 146 310 gene locus_tag LOCUS_19760 146 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 3396 724 gene locus_tag LOCUS_19770 3396 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 4164 4042 gene locus_tag LOCUS_19780 4164 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 4517 4765 gene locus_tag LOCUS_19790 4517 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 5062 6363 gene locus_tag LOCUS_19800 5062 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence110 102 1571 gene locus_tag LOCUS_19810 102 1571 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143455604.1 protein_id gnl|my_center|LOCUS_19810 2447 2316 gene locus_tag LOCUS_19820 2447 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3423 2422 gene locus_tag LOCUS_19830 3423 2422 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_19830 4380 3427 gene locus_tag LOCUS_19840 4380 3427 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905676.1 protein_id gnl|my_center|LOCUS_19840 6121 4514 gene locus_tag LOCUS_19850 6121 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence111 1735 197 gene locus_tag LOCUS_19860 gene guaA 1735 197 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_19860 2298 2023 gene locus_tag LOCUS_19870 2298 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 2975 2295 gene locus_tag LOCUS_19880 2975 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4638 3472 gene locus_tag LOCUS_19890 gene rodA 4638 3472 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_19890 6203 4668 gene locus_tag LOCUS_19900 6203 4668 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence112 834 70 gene locus_tag LOCUS_19910 834 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 1698 1180 gene locus_tag LOCUS_19920 1698 1180 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252838.1 protein_id gnl|my_center|LOCUS_19920 2489 1695 gene locus_tag LOCUS_19930 2489 1695 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_19930 3405 2491 gene locus_tag LOCUS_19940 3405 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 3656 4366 gene locus_tag LOCUS_19950 3656 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 5676 4462 gene locus_tag LOCUS_19960 5676 4462 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence113 948 43 gene locus_tag LOCUS_19970 948 43 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775137.1 protein_id gnl|my_center|LOCUS_19970 1607 945 gene locus_tag LOCUS_19980 1607 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 2163 1645 gene locus_tag LOCUS_19990 2163 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 1685 1697 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2815 2243 gene locus_tag LOCUS_20000 2815 2243 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_20000 3048 2815 gene locus_tag LOCUS_20010 3048 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3346 4413 gene locus_tag LOCUS_20020 gene trpS 3346 4413 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_20020 4504 5001 gene locus_tag LOCUS_20030 4504 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 5224 6306 gene locus_tag LOCUS_20040 5224 6306 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767561.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence114 661 1356 gene locus_tag LOCUS_20050 661 1356 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_20050 1358 2956 gene locus_tag LOCUS_20060 gene hcp 1358 2956 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_20060 6066 3052 gene locus_tag LOCUS_20070 6066 3052 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054447.1 protein_id gnl|my_center|LOCUS_20070 >Feature sequence115 661 1101 gene locus_tag LOCUS_20080 661 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 1500 2420 gene locus_tag LOCUS_20090 1500 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 4287 3340 gene locus_tag LOCUS_20100 4287 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4485 4399 gene locus_tag LOCUS_t00300 4485 4399 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4659 4573 gene locus_tag LOCUS_t00310 4659 4573 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4900 6030 gene locus_tag LOCUS_20110 4900 6030 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_20110 >Feature sequence116 241 420 gene locus_tag LOCUS_20120 241 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 527 1891 gene locus_tag LOCUS_20130 gene mnmE 527 1891 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_20130 2725 4608 gene locus_tag LOCUS_20140 gene mnmG 2725 4608 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966993.1 protein_id gnl|my_center|LOCUS_20140 4605 5315 gene locus_tag LOCUS_20150 gene rsmG 4605 5315 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence117 169 2091 gene locus_tag LOCUS_20160 169 2091 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602146.1 protein_id gnl|my_center|LOCUS_20160 3535 2234 gene locus_tag LOCUS_20170 3535 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 3842 3917 gene locus_tag LOCUS_t00320 3842 3917 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3977 4050 gene locus_tag LOCUS_t00330 3977 4050 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4521 5300 gene locus_tag LOCUS_20180 4521 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5462 5537 gene locus_tag LOCUS_t00340 5462 5537 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5874 5949 gene locus_tag LOCUS_t00350 5874 5949 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence118 2284 1211 gene locus_tag LOCUS_20190 2284 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 3160 2288 gene locus_tag LOCUS_20200 3160 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3248 4093 gene locus_tag LOCUS_20210 3248 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 <5934 4166 gene locus_tag LOCUS_20220 <5934 4166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010714197.1:tail protein >Feature sequence119 495 208 gene locus_tag LOCUS_20230 gene spoIIID 495 208 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_20230 749 1609 gene locus_tag LOCUS_20240 749 1609 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_20240 2561 1683 gene locus_tag LOCUS_20250 2561 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 3991 2585 gene locus_tag LOCUS_20260 3991 2585 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_20260 5791 4205 gene locus_tag LOCUS_20270 5791 4205 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence120 1282 188 gene locus_tag LOCUS_20280 gene ychF 1282 188 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_20280 1609 2118 gene locus_tag LOCUS_20290 1609 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 2347 3024 gene locus_tag LOCUS_20300 gene sigK 2347 3024 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_20300 3536 3090 gene locus_tag LOCUS_20310 3536 3090 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_20310 5729 3633 gene locus_tag LOCUS_20320 5729 3633 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423561.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence121 721 293 gene locus_tag LOCUS_20330 721 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2646 724 gene locus_tag LOCUS_20340 2646 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 3391 2657 gene locus_tag LOCUS_20350 3391 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3821 3405 gene locus_tag LOCUS_20360 3821 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 5262 3823 gene locus_tag LOCUS_20370 5262 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 5609 5271 gene locus_tag LOCUS_20380 5609 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 >Feature sequence122 948 79 gene locus_tag LOCUS_20390 gene sdaAA 948 79 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_20390 1618 950 gene locus_tag LOCUS_20400 gene sdaAB 1618 950 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460514.1 protein_id gnl|my_center|LOCUS_20400 2911 1892 gene locus_tag LOCUS_20410 2911 1892 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_20410 3624 2932 gene locus_tag LOCUS_20420 3624 2932 CDS product nitrogen-fixing protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677723.1 protein_id gnl|my_center|LOCUS_20420 4536 4012 gene locus_tag LOCUS_20430 4536 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 5567 4536 gene locus_tag LOCUS_20440 gene tsaD 5567 4536 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence123 3576 121 gene locus_tag LOCUS_20450 3576 121 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_20450 4477 3560 gene locus_tag LOCUS_20460 4477 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 5386 4493 gene locus_tag LOCUS_20470 gene rapZ 5386 4493 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000369722.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence124 417 238 gene locus_tag LOCUS_20480 417 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 522 1790 gene locus_tag LOCUS_20490 522 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2364 1972 gene locus_tag LOCUS_20500 2364 1972 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357588.1 protein_id gnl|my_center|LOCUS_20500 4263 2377 gene locus_tag LOCUS_20510 4263 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 5239 4517 gene locus_tag LOCUS_20520 gene efpI 5239 4517 CDS product EF-P-5 aminopentanone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244676.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence125 <1 927 gene locus_tag LOCUS_20530 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461907.1:amidoligase family protein 1018 1482 gene locus_tag LOCUS_20540 1018 1482 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458833.1 protein_id gnl|my_center|LOCUS_20540 1469 1669 gene locus_tag LOCUS_20550 1469 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 1982 2362 gene locus_tag LOCUS_20560 1982 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 2672 2896 gene locus_tag LOCUS_20570 2672 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3188 4753 gene locus_tag LOCUS_20580 3188 4753 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443313.1 protein_id gnl|my_center|LOCUS_20580 >Feature sequence126 1509 91 gene locus_tag LOCUS_20590 1509 91 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440276.1 protein_id gnl|my_center|LOCUS_20590 2261 1764 gene locus_tag LOCUS_20600 gene queF 2261 1764 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918896.1 protein_id gnl|my_center|LOCUS_20600 2949 2263 gene locus_tag LOCUS_20610 gene queC 2949 2263 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_20610 3522 2962 gene locus_tag LOCUS_20620 gene folE 3522 2962 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966889.1 protein_id gnl|my_center|LOCUS_20620 4200 3535 gene locus_tag LOCUS_20630 gene queE 4200 3535 CDS product putative 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966888.1 protein_id gnl|my_center|LOCUS_20630 4624 4205 gene locus_tag LOCUS_20640 gene queD 4624 4205 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949100.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence127 666 2834 gene locus_tag LOCUS_20650 666 2834 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964231.1 protein_id gnl|my_center|LOCUS_20650 3409 4734 gene locus_tag LOCUS_20660 3409 4734 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987123.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence128 292 711 gene locus_tag LOCUS_20670 292 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 708 1124 gene locus_tag LOCUS_20680 708 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1121 2056 gene locus_tag LOCUS_20690 1121 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2139 3107 gene locus_tag LOCUS_20700 2139 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 3332 4222 gene locus_tag LOCUS_20710 3332 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence129 786 1025 gene locus_tag LOCUS_20720 786 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 1049 1336 gene locus_tag LOCUS_20730 1049 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 1605 1910 gene locus_tag LOCUS_20740 1605 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 2618 3760 gene locus_tag LOCUS_20750 2618 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 3701 3710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence130 238 510 gene locus_tag LOCUS_20760 238 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 510 857 gene locus_tag LOCUS_20770 510 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 844 1212 gene locus_tag LOCUS_20780 844 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 1209 1526 gene locus_tag LOCUS_20790 1209 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1532 2149 gene locus_tag LOCUS_20800 1532 2149 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905720.1 protein_id gnl|my_center|LOCUS_20800 2162 2539 gene locus_tag LOCUS_20810 2162 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2584 2703 gene locus_tag LOCUS_20820 2584 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 3062 2706 gene locus_tag LOCUS_20830 3062 2706 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791443.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence131 1089 412 gene locus_tag LOCUS_20840 1089 412 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_20840 2130 1135 gene locus_tag LOCUS_20850 2130 1135 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_20850 3846 2386 gene locus_tag LOCUS_20860 gene proS 3846 2386 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence132 1561 1136 gene locus_tag LOCUS_20870 1561 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2071 2170 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2222 3784 gene locus_tag LOCUS_20880 2222 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence133 374 24 gene locus_tag LOCUS_20890 374 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 747 358 gene locus_tag LOCUS_20900 747 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 1293 889 gene locus_tag LOCUS_20910 1293 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1490 1290 gene locus_tag LOCUS_20920 1490 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 <3922 1747 gene locus_tag LOCUS_20930 <3922 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962558.1:phage/plasmid primase, P4 family >Feature sequence134 538 720 gene locus_tag LOCUS_20940 538 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 799 2043 gene locus_tag LOCUS_20950 799 2043 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081586538.1 protein_id gnl|my_center|LOCUS_20950 1962 3608 gene locus_tag LOCUS_20960 1962 3608 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence135 2200 452 gene locus_tag LOCUS_20970 2200 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 <3766 2827 gene locus_tag LOCUS_20980 <3766 2827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399577.1:DNA modification methylase >Feature sequence136 98 1624 gene locus_tag LOCUS_20990 gene xylB 98 1624 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_20990 1770 2441 gene locus_tag LOCUS_21000 1770 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2464 3270 gene locus_tag LOCUS_21010 2464 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3371 3622 gene locus_tag LOCUS_21020 3371 3622 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357396.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence137 1097 111 gene locus_tag LOCUS_21030 1097 111 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107870.1 protein_id gnl|my_center|LOCUS_21030 1586 1122 gene locus_tag LOCUS_21040 1586 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2205 3152 gene locus_tag LOCUS_21050 2205 3152 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_21050 >Feature sequence138 1348 125 gene locus_tag LOCUS_21060 1348 125 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_21060 1607 2800 gene locus_tag LOCUS_21070 1607 2800 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_21070 2890 3294 gene locus_tag LOCUS_21080 2890 3294 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_21080 3556 3338 gene locus_tag LOCUS_21090 3556 3338 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071351.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence139 3541 305 gene locus_tag LOCUS_21100 3541 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence140 757 464 gene locus_tag LOCUS_21110 757 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 1275 754 gene locus_tag LOCUS_21120 1275 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1544 1416 gene locus_tag LOCUS_21130 1544 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2519 1554 gene locus_tag LOCUS_21140 2519 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 3612 2521 gene locus_tag LOCUS_21150 3612 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 >Feature sequence141 632 123 gene locus_tag LOCUS_21160 gene feR 632 123 CDS product ferric-chelate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878333.1 protein_id gnl|my_center|LOCUS_21160 2878 647 gene locus_tag LOCUS_21170 2878 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 3414 3124 gene locus_tag LOCUS_21180 3414 3124 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence142 2208 541 gene locus_tag LOCUS_21190 2208 541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_21190 2885 2205 gene locus_tag LOCUS_21200 2885 2205 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence143 1676 201 gene locus_tag LOCUS_21210 gene spoIVA 1676 201 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_21210 3251 1695 gene locus_tag LOCUS_21220 3251 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 >Feature sequence144 495 250 gene locus_tag LOCUS_21230 495 250 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965244.1 protein_id gnl|my_center|LOCUS_21230 899 974 gene locus_tag LOCUS_t00360 899 974 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1293 2492 gene locus_tag LOCUS_21240 1293 2492 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_21240 3162 3025 gene locus_tag LOCUS_21250 3162 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence145 1779 157 gene locus_tag LOCUS_21260 1779 157 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964334.1 protein_id gnl|my_center|LOCUS_21260 2118 3314 gene locus_tag LOCUS_21270 2118 3314 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429271.1 protein_id gnl|my_center|LOCUS_21270 >Feature sequence146 335 1819 gene locus_tag LOCUS_21280 335 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 1835 3340 gene locus_tag LOCUS_21290 gene galT 1835 3340 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_21290 >Feature sequence147 1749 241 gene locus_tag LOCUS_21300 1749 241 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_21300 2527 2210 gene locus_tag LOCUS_21310 gene trxA 2527 2210 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528326.1 protein_id gnl|my_center|LOCUS_21310 3223 2606 gene locus_tag LOCUS_21320 3223 2606 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence148 231 1517 gene locus_tag LOCUS_21330 231 1517 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_21330 1749 2138 gene locus_tag LOCUS_21340 1749 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 3213 2272 gene locus_tag LOCUS_21350 3213 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence149 145 1446 gene locus_tag LOCUS_21360 145 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 1766 1488 gene locus_tag LOCUS_21370 1766 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence150 2450 132 gene locus_tag LOCUS_21380 2450 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence151 598 735 gene locus_tag LOCUS_21390 598 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 2669 993 gene locus_tag LOCUS_21400 gene tndX 2669 993 CDS product site-specific resolvase TndX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002324544.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence152 332 195 gene locus_tag LOCUS_21410 332 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 1096 599 gene locus_tag LOCUS_21420 1096 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009911276.1 protein_id gnl|my_center|LOCUS_21420 2090 1371 gene locus_tag LOCUS_21430 2090 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 2885 2310 gene locus_tag LOCUS_21440 2885 2310 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence153 533 45 gene locus_tag LOCUS_21450 gene ispF 533 45 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_21450 1235 534 gene locus_tag LOCUS_21460 gene ispD 1235 534 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_21460 3058 1514 gene locus_tag LOCUS_21470 3058 1514 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_21470 >Feature sequence154 112 1491 gene locus_tag LOCUS_21480 112 1491 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682366.1 protein_id gnl|my_center|LOCUS_21480 1638 2009 gene locus_tag LOCUS_21490 1638 2009 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948112.1 protein_id gnl|my_center|LOCUS_21490 2002 2694 gene locus_tag LOCUS_21500 2002 2694 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963931.1 protein_id gnl|my_center|LOCUS_21500 >Feature sequence155 439 1389 gene locus_tag LOCUS_21510 439 1389 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_21510 1464 2726 gene locus_tag LOCUS_21520 1464 2726 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence156 1246 98 gene locus_tag LOCUS_21530 gene fucO 1246 98 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288246.1 protein_id gnl|my_center|LOCUS_21530 2798 1896 gene locus_tag LOCUS_21540 2798 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence157 123 1427 gene locus_tag LOCUS_21550 123 1427 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_21550 2781 1546 gene locus_tag LOCUS_21560 gene rmuC 2781 1546 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793488.1 protein_id gnl|my_center|LOCUS_21560 >Feature sequence158 355 230 gene locus_tag LOCUS_21570 355 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 1016 2896 gene locus_tag LOCUS_21580 1016 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 >Feature sequence159 2614 158 gene locus_tag LOCUS_21590 2614 158 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_21590 >Feature sequence160 1301 39 gene locus_tag LOCUS_21600 1301 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2207 1821 gene locus_tag LOCUS_21610 2207 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 >Feature sequence161 165 929 gene locus_tag LOCUS_21620 165 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 985 2148 gene locus_tag LOCUS_21630 985 2148 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028649.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence162 895 161 gene locus_tag LOCUS_21640 895 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 1242 1577 gene locus_tag LOCUS_21650 1242 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2325 1789 gene locus_tag LOCUS_21660 2325 1789 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964793.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence163 319 245 gene locus_tag LOCUS_t00370 319 245 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 399 323 gene locus_tag LOCUS_t00380 399 323 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 951 592 gene locus_tag LOCUS_21670 gene spoVAE 951 592 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_21670 2168 1134 gene locus_tag LOCUS_21680 gene spoVAD 2168 1134 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence164 2362 230 gene locus_tag LOCUS_21690 2362 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence165 1953 160 gene locus_tag LOCUS_21700 1953 160 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence166 995 75 gene locus_tag LOCUS_21710 995 75 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183854.1 protein_id gnl|my_center|LOCUS_21710 1367 1041 gene locus_tag LOCUS_21720 1367 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence167 1953 172 gene locus_tag LOCUS_21730 1953 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence168 130 297 gene locus_tag LOCUS_21740 130 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 290 1390 gene locus_tag LOCUS_21750 290 1390 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_21750 1391 1873 gene locus_tag LOCUS_21760 1391 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence169 340 1746 gene locus_tag LOCUS_21770 340 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence170 816 253 gene locus_tag LOCUS_21780 816 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1781 897 gene locus_tag LOCUS_21790 1781 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence171 1513 1220 gene locus_tag LOCUS_21800 1513 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence172 1093 110 gene locus_tag LOCUS_21810 1093 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 1173 1259 gene locus_tag LOCUS_t00390 1173 1259 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence173 152 1015 gene locus_tag LOCUS_21820 152 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence174 1288 188 gene locus_tag LOCUS_21830 1288 188 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460717.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21830 >Feature sequence175 <1268 15 gene locus_tag LOCUS_21840 <1268 15 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082185.1:xylose isomerase >Feature sequence176 <1 832 gene locus_tag LOCUS_21850 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861402.1:HAMP domain-containing sensor histidine kinase >Feature sequence177 407 1075 gene locus_tag LOCUS_21860 407 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 901 910 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 405 67 gene locus_tag LOCUS_21870 405 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21870 <990 429 gene locus_tag LOCUS_21880 <990 429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787476.1:F0F1 ATP synthase subunit beta note possible pseudo, frameshifted 449 458 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence179 >Feature sequence180 461 267 gene locus_tag LOCUS_21890 461 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 744 385 gene locus_tag LOCUS_21900 744 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 843 852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence181 >Feature sequence182 >Feature sequence183 >Feature sequence184 <1 753 gene locus_tag LOCUS_21910 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861119.1:DUF6017 domain-containing protein >Feature sequence185 >Feature sequence186 318 327 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 375 451 gene locus_tag LOCUS_t00400 375 451 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence187 >Feature sequence188 163 672 gene locus_tag LOCUS_21920 163 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 >Feature sequence189 321 175 gene locus_tag LOCUS_21930 321 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 637 461 gene locus_tag LOCUS_21940 637 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence190 383 392 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence191 453 268 gene locus_tag LOCUS_21950 453 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 634 425 gene locus_tag LOCUS_21960 634 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 >Feature sequence192 >Feature sequence193 >Feature sequence194 >Feature sequence195 19 372 gene locus_tag LOCUS_21970 19 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 >Feature sequence196 551 75 gene locus_tag LOCUS_21980 gene mscL 551 75 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence197 >Feature sequence198 559 161 gene locus_tag LOCUS_21990 559 161 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355907.1 protein_id gnl|my_center|LOCUS_21990 >Feature sequence199 >Feature sequence200 >Feature sequence201 >Feature sequence202 >Feature sequence203 261 270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence204 >Feature sequence205 332 213 gene locus_tag LOCUS_22000 332 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence206 >Feature sequence207 579 382 gene locus_tag LOCUS_22010 579 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence208 >Feature sequence209 284 153 gene locus_tag LOCUS_22020 284 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 247 256 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence210 >Feature sequence211 >Feature sequence212 >Feature sequence213 >Feature sequence214 >Feature sequence215 >Feature sequence216 136 276 gene locus_tag LOCUS_22030 136 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence217 >Feature sequence218 >Feature sequence219 445 218 gene locus_tag LOCUS_22040 445 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence220 >Feature sequence221 >Feature sequence222 417 178 gene locus_tag LOCUS_22050 417 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence223 >Feature sequence224 >Feature sequence225 >Feature sequence226 272 281 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence227 >Feature sequence228