>Feature sequence01 271 852 gene locus_tag LOCUS_00010 271 852 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262055.1 protein_id gnl|my_center|LOCUS_00010 849 2057 gene locus_tag LOCUS_00020 gene trpB 849 2057 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262056.1 protein_id gnl|my_center|LOCUS_00020 2061 2843 gene locus_tag LOCUS_00030 gene trpA 2061 2843 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262057.1 protein_id gnl|my_center|LOCUS_00030 2988 3419 gene locus_tag LOCUS_00040 2988 3419 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263708.1 protein_id gnl|my_center|LOCUS_00040 3423 5654 gene locus_tag LOCUS_00050 3423 5654 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263707.1 protein_id gnl|my_center|LOCUS_00050 5728 5931 gene locus_tag LOCUS_00060 gene copZ 5728 5931 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263706.1 protein_id gnl|my_center|LOCUS_00060 6092 7138 gene locus_tag LOCUS_00070 6092 7138 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989146.1 protein_id gnl|my_center|LOCUS_00070 7466 8146 gene locus_tag LOCUS_00080 7466 8146 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384107.1 protein_id gnl|my_center|LOCUS_00080 8106 8783 gene locus_tag LOCUS_00090 8106 8783 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154147.1 protein_id gnl|my_center|LOCUS_00090 8785 9543 gene locus_tag LOCUS_00100 8785 9543 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005008.1 protein_id gnl|my_center|LOCUS_00100 9586 10440 gene locus_tag LOCUS_00110 9586 10440 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765262.1 protein_id gnl|my_center|LOCUS_00110 10897 10679 gene locus_tag LOCUS_00120 10897 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11219 10827 gene locus_tag LOCUS_00130 11219 10827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11781 11188 gene locus_tag LOCUS_00140 11781 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12028 13410 gene locus_tag LOCUS_00150 12028 13410 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778743.1 protein_id gnl|my_center|LOCUS_00150 13556 14155 gene locus_tag LOCUS_00160 13556 14155 CDS product TIGR02206 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836665.1 protein_id gnl|my_center|LOCUS_00160 14505 16049 gene locus_tag LOCUS_00170 14505 16049 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263242.1 protein_id gnl|my_center|LOCUS_00170 17597 16560 gene locus_tag LOCUS_00180 17597 16560 CDS product ryptide export MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071459.1 protein_id gnl|my_center|LOCUS_00180 18577 17714 gene locus_tag LOCUS_00190 18577 17714 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352338.1 protein_id gnl|my_center|LOCUS_00190 19603 19028 gene locus_tag LOCUS_00200 gene thiT 19603 19028 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246588.1 protein_id gnl|my_center|LOCUS_00200 19904 20284 gene locus_tag LOCUS_00210 19904 20284 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510901.1 protein_id gnl|my_center|LOCUS_00210 20298 21206 gene locus_tag LOCUS_00220 20298 21206 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836670.1 protein_id gnl|my_center|LOCUS_00220 21397 22983 gene locus_tag LOCUS_00230 21397 22983 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673090.1 protein_id gnl|my_center|LOCUS_00230 23808 23539 gene locus_tag LOCUS_00240 23808 23539 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000598736.1 protein_id gnl|my_center|LOCUS_00240 24576 23812 gene locus_tag LOCUS_00250 24576 23812 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567425.1 protein_id gnl|my_center|LOCUS_00250 25492 24626 gene locus_tag LOCUS_00260 25492 24626 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261918.1 protein_id gnl|my_center|LOCUS_00260 25691 26446 gene locus_tag LOCUS_00270 25691 26446 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922437.1 protein_id gnl|my_center|LOCUS_00270 26554 27249 gene locus_tag LOCUS_00280 26554 27249 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836677.1 protein_id gnl|my_center|LOCUS_00280 28706 29479 gene locus_tag LOCUS_00290 28706 29479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 29565 30827 gene locus_tag LOCUS_00300 29565 30827 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226242.1 protein_id gnl|my_center|LOCUS_00300 30893 31438 gene locus_tag LOCUS_00310 30893 31438 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028728.1 protein_id gnl|my_center|LOCUS_00310 31431 32711 gene locus_tag LOCUS_00320 gene spxR 31431 32711 CDS product CBS-HotDog domain-containing transcription factor SpxR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262967.1 protein_id gnl|my_center|LOCUS_00320 32755 33615 gene locus_tag LOCUS_00330 32755 33615 CDS product methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631567.1 protein_id gnl|my_center|LOCUS_00330 33635 34576 gene locus_tag LOCUS_00340 33635 34576 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922408.1 protein_id gnl|my_center|LOCUS_00340 34667 35176 gene locus_tag LOCUS_00350 34667 35176 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837173.1 protein_id gnl|my_center|LOCUS_00350 35239 37185 gene locus_tag LOCUS_00360 gene ligA 35239 37185 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880222.1 protein_id gnl|my_center|LOCUS_00360 37195 38208 gene locus_tag LOCUS_00370 37195 38208 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262954.1 protein_id gnl|my_center|LOCUS_00370 38400 38885 gene locus_tag LOCUS_00380 38400 38885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00380 39637 39158 gene locus_tag LOCUS_00390 39637 39158 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027540.1 protein_id gnl|my_center|LOCUS_00390 40537 39710 gene locus_tag LOCUS_00400 40537 39710 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767464.1 protein_id gnl|my_center|LOCUS_00400 42574 41696 gene locus_tag LOCUS_00410 gene tehB 42574 41696 CDS product SAM-dependent methyltransferase TehB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413776.1 protein_id gnl|my_center|LOCUS_00410 43007 43279 gene locus_tag LOCUS_00420 gene rpsP 43007 43279 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268757.1 protein_id gnl|my_center|LOCUS_00420 43291 43539 gene locus_tag LOCUS_00430 43291 43539 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379626.1 protein_id gnl|my_center|LOCUS_00430 43694 44956 gene locus_tag LOCUS_00440 43694 44956 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262831.1 protein_id gnl|my_center|LOCUS_00440 45020 46864 gene locus_tag LOCUS_00450 45020 46864 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045634338.1 protein_id gnl|my_center|LOCUS_00450 47010 47573 gene locus_tag LOCUS_00460 gene folE 47010 47573 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133588.1 protein_id gnl|my_center|LOCUS_00460 47612 48412 gene locus_tag LOCUS_00470 gene folP 47612 48412 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922282.1 protein_id gnl|my_center|LOCUS_00470 49895 48444 gene locus_tag LOCUS_00480 49895 48444 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181049.1 protein_id gnl|my_center|LOCUS_00480 50116 50475 gene locus_tag LOCUS_00490 gene folB 50116 50475 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989868.1 protein_id gnl|my_center|LOCUS_00490 50472 50963 gene locus_tag LOCUS_00500 gene folK 50472 50963 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984757.1 protein_id gnl|my_center|LOCUS_00500 51140 52054 gene locus_tag LOCUS_00510 gene murB 51140 52054 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262836.1 protein_id gnl|my_center|LOCUS_00510 52099 53253 gene locus_tag LOCUS_00520 52099 53253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922284.1 protein_id gnl|my_center|LOCUS_00520 53237 54031 gene locus_tag LOCUS_00530 53237 54031 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984743.1 protein_id gnl|my_center|LOCUS_00530 54028 54807 gene locus_tag LOCUS_00540 54028 54807 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712712.1 protein_id gnl|my_center|LOCUS_00540 54800 55867 gene locus_tag LOCUS_00550 54800 55867 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255373.1 protein_id gnl|my_center|LOCUS_00550 56605 56982 gene locus_tag LOCUS_00560 56605 56982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00560 57421 57026 gene locus_tag LOCUS_00570 57421 57026 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262786.1 protein_id gnl|my_center|LOCUS_00570 57807 58373 gene locus_tag LOCUS_00580 57807 58373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00580 58527 59621 gene locus_tag LOCUS_00590 gene serC 58527 59621 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262688.1 protein_id gnl|my_center|LOCUS_00590 59633 60190 gene locus_tag LOCUS_00600 59633 60190 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262690.1 protein_id gnl|my_center|LOCUS_00600 60209 61387 gene locus_tag LOCUS_00610 60209 61387 CDS product 3-phosphoglycerate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262691.1 protein_id gnl|my_center|LOCUS_00610 61615 61938 gene locus_tag LOCUS_00620 61615 61938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00620 61973 62326 gene locus_tag LOCUS_00630 61973 62326 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287944.1 protein_id gnl|my_center|LOCUS_00630 62383 62456 gene locus_tag LOCUS_t00010 62383 62456 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 62606 62980 gene locus_tag LOCUS_00640 62606 62980 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921846.1 protein_id gnl|my_center|LOCUS_00640 62973 63668 gene locus_tag LOCUS_00650 62973 63668 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001288948.1 protein_id gnl|my_center|LOCUS_00650 63709 64314 gene locus_tag LOCUS_00660 63709 64314 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263166.1 protein_id gnl|my_center|LOCUS_00660 64315 66267 gene locus_tag LOCUS_00670 gene gyrB 64315 66267 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134196.1 protein_id gnl|my_center|LOCUS_00670 66364 68088 gene locus_tag LOCUS_00680 gene ezrA 66364 68088 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922105.1 protein_id gnl|my_center|LOCUS_00680 68200 68847 gene locus_tag LOCUS_00690 gene serB 68200 68847 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263175.1 protein_id gnl|my_center|LOCUS_00690 68831 69004 gene locus_tag LOCUS_00700 68831 69004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 69282 69584 gene locus_tag LOCUS_00710 69282 69584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 69795 71276 gene locus_tag LOCUS_00720 gene malQ 69795 71276 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922661.1 protein_id gnl|my_center|LOCUS_00720 71278 73542 gene locus_tag LOCUS_00730 gene glgP 71278 73542 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774979.1 protein_id gnl|my_center|LOCUS_00730 74088 73648 gene locus_tag LOCUS_00740 74088 73648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 74699 74145 gene locus_tag LOCUS_00750 74699 74145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 74882 75871 gene locus_tag LOCUS_00760 74882 75871 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992006.1 protein_id gnl|my_center|LOCUS_00760 76096 77166 gene locus_tag LOCUS_00770 gene xerS 76096 77166 CDS product tyrosine recombinase XerS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984598.1 protein_id gnl|my_center|LOCUS_00770 79868 77328 gene locus_tag LOCUS_00780 79868 77328 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262212.1 protein_id gnl|my_center|LOCUS_00780 80658 80002 gene locus_tag LOCUS_00790 gene phoU 80658 80002 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262211.1 protein_id gnl|my_center|LOCUS_00790 81441 80683 gene locus_tag LOCUS_00800 gene pstB 81441 80683 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193363.1 protein_id gnl|my_center|LOCUS_00800 82257 81454 gene locus_tag LOCUS_00810 gene pstB 82257 81454 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262209.1 protein_id gnl|my_center|LOCUS_00810 83152 82268 gene locus_tag LOCUS_00820 gene pstA 83152 82268 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543046.1 protein_id gnl|my_center|LOCUS_00820 84056 83142 gene locus_tag LOCUS_00830 gene pstC 84056 83142 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937619.1 protein_id gnl|my_center|LOCUS_00830 84934 84059 gene locus_tag LOCUS_00840 84934 84059 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775159.1 protein_id gnl|my_center|LOCUS_00840 86369 85059 gene locus_tag LOCUS_00850 86369 85059 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775401.1 protein_id gnl|my_center|LOCUS_00850 87219 86452 gene locus_tag LOCUS_00860 87219 86452 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000338948.1 protein_id gnl|my_center|LOCUS_00860 87490 87209 gene locus_tag LOCUS_00870 87490 87209 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984497.1 protein_id gnl|my_center|LOCUS_00870 87839 87483 gene locus_tag LOCUS_00880 gene spx 87839 87483 CDS product transcriptional regulator Spx inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263835.1 protein_id gnl|my_center|LOCUS_00880 88877 87957 gene locus_tag LOCUS_00890 88877 87957 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690921.1 protein_id gnl|my_center|LOCUS_00890 89716 88874 gene locus_tag LOCUS_00900 gene truB 89716 88874 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001873502.1 protein_id gnl|my_center|LOCUS_00900 91166 89922 gene locus_tag LOCUS_00910 91166 89922 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289298.1 protein_id gnl|my_center|LOCUS_00910 91401 91168 gene locus_tag LOCUS_00920 91401 91168 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262193.1 protein_id gnl|my_center|LOCUS_00920 92109 91489 gene locus_tag LOCUS_00930 92109 91489 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922364.1 protein_id gnl|my_center|LOCUS_00930 92726 92232 gene locus_tag LOCUS_00940 gene tpx 92726 92232 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012130838.1 protein_id gnl|my_center|LOCUS_00940 93159 92791 gene locus_tag LOCUS_00950 93159 92791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00950 93546 93337 gene locus_tag LOCUS_00960 93546 93337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00960 94887 93607 gene locus_tag LOCUS_00970 94887 93607 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196324.1 protein_id gnl|my_center|LOCUS_00970 97317 95008 gene locus_tag LOCUS_00980 gene pcrA 97317 95008 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068642.1 protein_id gnl|my_center|LOCUS_00980 97833 99176 gene locus_tag LOCUS_00990 97833 99176 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_00990 99305 100675 gene locus_tag LOCUS_01000 gene mnmE 99305 100675 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264096.1 protein_id gnl|my_center|LOCUS_01000 101149 101757 gene locus_tag LOCUS_01010 101149 101757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01010 102254 101967 gene locus_tag LOCUS_01020 102254 101967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01020 102918 102265 gene locus_tag LOCUS_01030 102918 102265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01030 103494 103264 gene locus_tag LOCUS_01040 103494 103264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 104199 103627 gene locus_tag LOCUS_01050 104199 103627 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263272.1 protein_id gnl|my_center|LOCUS_01050 >Feature sequence02 3356 1389 gene locus_tag LOCUS_01060 gene ftsH 3356 1389 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921768.1 protein_id gnl|my_center|LOCUS_01060 3914 3372 gene locus_tag LOCUS_01070 gene hpt 3914 3372 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892188.1 protein_id gnl|my_center|LOCUS_01070 5261 3996 gene locus_tag LOCUS_01080 gene tilS 5261 3996 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282856.1 protein_id gnl|my_center|LOCUS_01080 6553 5261 gene locus_tag LOCUS_01090 6553 5261 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921766.1 protein_id gnl|my_center|LOCUS_01090 6681 6550 gene locus_tag LOCUS_01100 6681 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7052 6681 gene locus_tag LOCUS_01110 7052 6681 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921765.1 protein_id gnl|my_center|LOCUS_01110 7311 7036 gene locus_tag LOCUS_01120 7311 7036 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234967.1 protein_id gnl|my_center|LOCUS_01120 11003 7497 gene locus_tag LOCUS_01130 gene mfd 11003 7497 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273921.1 protein_id gnl|my_center|LOCUS_01130 11565 10996 gene locus_tag LOCUS_01140 gene pth 11565 10996 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262644.1 protein_id gnl|my_center|LOCUS_01140 12753 11638 gene locus_tag LOCUS_01150 gene ychF 12753 11638 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001218712.1 protein_id gnl|my_center|LOCUS_01150 13157 12966 gene locus_tag LOCUS_01160 13157 12966 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262646.1 protein_id gnl|my_center|LOCUS_01160 14344 13208 gene locus_tag LOCUS_01170 gene dnaN 14344 13208 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262647.1 protein_id gnl|my_center|LOCUS_01170 15863 14499 gene locus_tag LOCUS_01180 gene dnaA 15863 14499 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987659.1 protein_id gnl|my_center|LOCUS_01180 16870 16103 gene locus_tag LOCUS_01190 16870 16103 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074697.1 protein_id gnl|my_center|LOCUS_01190 18171 16936 gene locus_tag LOCUS_01200 18171 16936 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000728358.1 protein_id gnl|my_center|LOCUS_01200 18352 18855 gene locus_tag LOCUS_01210 gene rlmH 18352 18855 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028058.1 protein_id gnl|my_center|LOCUS_01210 18871 19554 gene locus_tag LOCUS_01220 18871 19554 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262652.1 protein_id gnl|my_center|LOCUS_01220 19654 19579 gene locus_tag LOCUS_t00020 19654 19579 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 19841 19914 gene locus_tag LOCUS_t00030 19841 19914 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 19936 20009 gene locus_tag LOCUS_t00040 19936 20009 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 21270 20098 gene locus_tag LOCUS_01230 21270 20098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 24376 22754 gene locus_tag LOCUS_01240 24376 22754 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002981986.1 protein_id gnl|my_center|LOCUS_01240 25315 24443 gene locus_tag LOCUS_01250 25315 24443 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775460.1 protein_id gnl|my_center|LOCUS_01250 25743 26765 gene locus_tag LOCUS_01260 gene trpS 25743 26765 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922803.1 protein_id gnl|my_center|LOCUS_01260 26942 28423 gene locus_tag LOCUS_01270 gene guaB 26942 28423 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262457.1 protein_id gnl|my_center|LOCUS_01270 29692 28592 gene locus_tag LOCUS_01280 gene recF 29692 28592 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000264863.1 protein_id gnl|my_center|LOCUS_01280 30072 29695 gene locus_tag LOCUS_01290 gene yaaA 30072 29695 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028049.1 protein_id gnl|my_center|LOCUS_01290 30151 31401 gene locus_tag LOCUS_01300 30151 31401 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262454.1 protein_id gnl|my_center|LOCUS_01300 31403 32680 gene locus_tag LOCUS_01310 31403 32680 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352377.1 protein_id gnl|my_center|LOCUS_01310 32739 33596 gene locus_tag LOCUS_01320 32739 33596 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262452.1 protein_id gnl|my_center|LOCUS_01320 33609 34151 gene locus_tag LOCUS_01330 gene pgsA 33609 34151 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262451.1 protein_id gnl|my_center|LOCUS_01330 34164 34994 gene locus_tag LOCUS_01340 34164 34994 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262450.1 protein_id gnl|my_center|LOCUS_01340 34970 35812 gene locus_tag LOCUS_01350 34970 35812 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262449.1 protein_id gnl|my_center|LOCUS_01350 35805 36599 gene locus_tag LOCUS_01360 35805 36599 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991426.1 protein_id gnl|my_center|LOCUS_01360 36903 37457 gene locus_tag LOCUS_01370 36903 37457 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029068.1 protein_id gnl|my_center|LOCUS_01370 37697 38326 gene locus_tag LOCUS_01380 37697 38326 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042655.1 protein_id gnl|my_center|LOCUS_01380 38428 40143 gene locus_tag LOCUS_01390 38428 40143 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775361.1 protein_id gnl|my_center|LOCUS_01390 40282 41403 gene locus_tag LOCUS_01400 gene mnmA 40282 41403 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028041.1 protein_id gnl|my_center|LOCUS_01400 41668 42123 gene locus_tag LOCUS_01410 41668 42123 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442218.1 protein_id gnl|my_center|LOCUS_01410 42132 44033 gene locus_tag LOCUS_01420 gene mnmG 42132 44033 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922789.1 protein_id gnl|my_center|LOCUS_01420 44107 46071 gene locus_tag LOCUS_01430 44107 46071 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819771.1 protein_id gnl|my_center|LOCUS_01430 46073 46531 gene locus_tag LOCUS_01440 gene rplI 46073 46531 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864242.1 protein_id gnl|my_center|LOCUS_01440 46575 47936 gene locus_tag LOCUS_01450 gene dnaB 46575 47936 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000230635.1 protein_id gnl|my_center|LOCUS_01450 47960 48262 gene locus_tag LOCUS_01460 47960 48262 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278152.1 protein_id gnl|my_center|LOCUS_01460 48460 49071 gene locus_tag LOCUS_01470 gene rpsD 48460 49071 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938227.1 protein_id gnl|my_center|LOCUS_01470 49486 49319 gene locus_tag LOCUS_01480 49486 49319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287277.1 protein_id gnl|my_center|LOCUS_01480 50581 50042 gene locus_tag LOCUS_01490 50581 50042 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922608.1 protein_id gnl|my_center|LOCUS_01490 50710 53079 gene locus_tag LOCUS_01500 50710 53079 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774941.1 protein_id gnl|my_center|LOCUS_01500 53871 53116 gene locus_tag LOCUS_01510 53871 53116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 53938 54153 gene locus_tag LOCUS_01520 53938 54153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 54693 54532 gene locus_tag LOCUS_01530 54693 54532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01530 54859 54707 gene locus_tag LOCUS_01540 54859 54707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01540 55022 55177 gene locus_tag LOCUS_01550 55022 55177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 56494 56291 gene locus_tag LOCUS_01560 56494 56291 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837579.1 protein_id gnl|my_center|LOCUS_01560 57124 56567 gene locus_tag LOCUS_01570 57124 56567 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907890.1 protein_id gnl|my_center|LOCUS_01570 57888 57322 gene locus_tag LOCUS_01580 gene amaP 57888 57322 CDS product alkaline shock response membrane anchor protein AmaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030213.1 protein_id gnl|my_center|LOCUS_01580 58186 57947 gene locus_tag LOCUS_01590 58186 57947 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893931.1 protein_id gnl|my_center|LOCUS_01590 58656 58856 gene locus_tag LOCUS_01600 58656 58856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 58844 59146 gene locus_tag LOCUS_01610 58844 59146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 59190 59792 gene locus_tag LOCUS_01620 59190 59792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01620 60137 60451 gene locus_tag LOCUS_01630 60137 60451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01630 60839 61018 gene locus_tag LOCUS_01640 60839 61018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01640 61077 61631 gene locus_tag LOCUS_01650 61077 61631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 61936 61787 gene locus_tag LOCUS_01660 gene rpmG 61936 61787 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262412.1 protein_id gnl|my_center|LOCUS_01660 62134 61952 gene locus_tag LOCUS_01670 gene rpmF 62134 61952 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290414.1 protein_id gnl|my_center|LOCUS_01670 62364 62591 gene locus_tag LOCUS_01680 62364 62591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01680 62739 63107 gene locus_tag LOCUS_01690 62739 63107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01690 63159 63476 gene locus_tag LOCUS_01700 63159 63476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01700 63786 65066 gene locus_tag LOCUS_01710 gene hisS 63786 65066 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922777.1 protein_id gnl|my_center|LOCUS_01710 65074 65496 gene locus_tag LOCUS_01720 65074 65496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 65606 67357 gene locus_tag LOCUS_01730 gene aspS 65606 67357 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830929.1 protein_id gnl|my_center|LOCUS_01730 67350 68291 gene locus_tag LOCUS_01740 67350 68291 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857771.1 protein_id gnl|my_center|LOCUS_01740 68315 69118 gene locus_tag LOCUS_01750 gene yaaA 68315 69118 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922748.1 protein_id gnl|my_center|LOCUS_01750 69745 69140 gene locus_tag LOCUS_01760 gene nrdG 69745 69140 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262378.1 protein_id gnl|my_center|LOCUS_01760 70250 69750 gene locus_tag LOCUS_01770 70250 69750 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423414.1 protein_id gnl|my_center|LOCUS_01770 70383 70252 gene locus_tag LOCUS_01780 70383 70252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262380.1 protein_id gnl|my_center|LOCUS_01780 72687 70483 gene locus_tag LOCUS_01790 gene nrdD 72687 70483 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989504.1 protein_id gnl|my_center|LOCUS_01790 74442 72796 gene locus_tag LOCUS_01800 74442 72796 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074689.1 protein_id gnl|my_center|LOCUS_01800 74960 74655 gene locus_tag LOCUS_01810 74960 74655 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982199.1 protein_id gnl|my_center|LOCUS_01810 75488 75069 gene locus_tag LOCUS_01820 gene ruvX 75488 75069 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222109.1 protein_id gnl|my_center|LOCUS_01820 75754 75488 gene locus_tag LOCUS_01830 75754 75488 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262386.1 protein_id gnl|my_center|LOCUS_01830 76069 75881 gene locus_tag LOCUS_01840 gene rpmB 76069 75881 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140948.1 protein_id gnl|my_center|LOCUS_01840 76239 77507 gene locus_tag LOCUS_01850 76239 77507 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262365.1 protein_id gnl|my_center|LOCUS_01850 77790 77862 gene locus_tag LOCUS_t00050 77790 77862 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 77869 77942 gene locus_tag LOCUS_t00060 77869 77942 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 77950 78039 gene locus_tag LOCUS_t00070 77950 78039 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 78049 78122 gene locus_tag LOCUS_t00080 78049 78122 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 78125 78199 gene locus_tag LOCUS_t00090 78125 78199 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 78212 78294 gene locus_tag LOCUS_t00100 78212 78294 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 78298 78370 gene locus_tag LOCUS_t00110 78298 78370 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 78380 78454 gene locus_tag LOCUS_t00120 78380 78454 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 78459 78532 gene locus_tag LOCUS_t00130 78459 78532 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 78540 78625 gene locus_tag LOCUS_t00140 78540 78625 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 78675 83069 gene locus_tag LOCUS_01860 78675 83069 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292137.1 protein_id gnl|my_center|LOCUS_01860 83233 84474 gene locus_tag LOCUS_01870 83233 84474 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243934.1 protein_id gnl|my_center|LOCUS_01870 84494 84724 gene locus_tag LOCUS_01880 84494 84724 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893807.1 protein_id gnl|my_center|LOCUS_01880 84927 85256 gene locus_tag LOCUS_01890 84927 85256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01890 85374 85925 gene locus_tag LOCUS_01900 85374 85925 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039617.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence03 1420 251 gene locus_tag LOCUS_01910 gene rlmN 1420 251 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124990.1 protein_id gnl|my_center|LOCUS_01910 2146 1424 gene locus_tag LOCUS_01920 2146 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 3556 2201 gene locus_tag LOCUS_01930 3556 2201 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262040.1 protein_id gnl|my_center|LOCUS_01930 5748 4405 gene locus_tag LOCUS_01940 5748 4405 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008549.1 protein_id gnl|my_center|LOCUS_01940 6845 5823 gene locus_tag LOCUS_01950 gene mraY 6845 5823 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480020.1 protein_id gnl|my_center|LOCUS_01950 9114 6847 gene locus_tag LOCUS_01960 gene pbp2X 9114 6847 CDS product penicillin-binding protein PBP2X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262089.1 protein_id gnl|my_center|LOCUS_01960 9438 9118 gene locus_tag LOCUS_01970 gene ftsL 9438 9118 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922556.1 protein_id gnl|my_center|LOCUS_01970 10391 9441 gene locus_tag LOCUS_01980 gene rsmH 10391 9441 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180266.1 protein_id gnl|my_center|LOCUS_01980 10984 10556 gene locus_tag LOCUS_01990 10984 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 11207 10950 gene locus_tag LOCUS_02000 11207 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11548 11162 gene locus_tag LOCUS_02010 11548 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 11654 11881 gene locus_tag LOCUS_02020 11654 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 12543 12187 gene locus_tag LOCUS_02030 12543 12187 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198807.1 protein_id gnl|my_center|LOCUS_02030 13032 12763 gene locus_tag LOCUS_02040 13032 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 14643 13393 gene locus_tag LOCUS_02050 14643 13393 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922557.1 protein_id gnl|my_center|LOCUS_02050 15448 14645 gene locus_tag LOCUS_02060 gene proB 15448 14645 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922558.1 protein_id gnl|my_center|LOCUS_02060 17158 15569 gene locus_tag LOCUS_02070 17158 15569 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922559.1 protein_id gnl|my_center|LOCUS_02070 17892 17161 gene locus_tag LOCUS_02080 17892 17161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589162.1 protein_id gnl|my_center|LOCUS_02080 18167 18898 gene locus_tag LOCUS_02090 18167 18898 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286317.1 protein_id gnl|my_center|LOCUS_02090 22903 19250 gene locus_tag LOCUS_02100 gene addA 22903 19250 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262919.1 protein_id gnl|my_center|LOCUS_02100 26213 22893 gene locus_tag LOCUS_02110 gene rexB 26213 22893 CDS product ATP-dependent nuclease subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262920.1 protein_id gnl|my_center|LOCUS_02110 26942 26703 gene locus_tag LOCUS_02120 26942 26703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02120 27306 26902 gene locus_tag LOCUS_02130 27306 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02130 28676 28056 gene locus_tag LOCUS_02140 28676 28056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02140 29093 28953 gene locus_tag LOCUS_02150 29093 28953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 29971 29138 gene locus_tag LOCUS_02160 29971 29138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 30197 29991 gene locus_tag LOCUS_02170 30197 29991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 31700 30315 gene locus_tag LOCUS_02180 31700 30315 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922607.1 protein_id gnl|my_center|LOCUS_02180 31771 32739 gene locus_tag LOCUS_02190 31771 32739 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723059.1 protein_id gnl|my_center|LOCUS_02190 35526 33508 gene locus_tag LOCUS_02200 gene recG 35526 33508 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926633.1 protein_id gnl|my_center|LOCUS_02200 36758 35655 gene locus_tag LOCUS_02210 gene alr 36758 35655 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263464.1 protein_id gnl|my_center|LOCUS_02210 37138 36779 gene locus_tag LOCUS_02220 gene acpS 37138 36779 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922620.1 protein_id gnl|my_center|LOCUS_02220 38173 37142 gene locus_tag LOCUS_02230 38173 37142 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027207.1 protein_id gnl|my_center|LOCUS_02230 39302 38271 gene locus_tag LOCUS_02240 39302 38271 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310594.1 protein_id gnl|my_center|LOCUS_02240 41875 39326 gene locus_tag LOCUS_02250 gene secA 41875 39326 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262654.1 protein_id gnl|my_center|LOCUS_02250 42318 42058 gene locus_tag LOCUS_02260 42318 42058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 43352 42405 gene locus_tag LOCUS_02270 gene manA 43352 42405 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294263.1 protein_id gnl|my_center|LOCUS_02270 44311 43418 gene locus_tag LOCUS_02280 44311 43418 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775682.1 protein_id gnl|my_center|LOCUS_02280 46397 44496 gene locus_tag LOCUS_02290 46397 44496 CDS product sucrose-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836524.1 protein_id gnl|my_center|LOCUS_02290 46646 48088 gene locus_tag LOCUS_02300 46646 48088 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053051.1 protein_id gnl|my_center|LOCUS_02300 48097 49062 gene locus_tag LOCUS_02310 48097 49062 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988504.1 protein_id gnl|my_center|LOCUS_02310 49586 49152 gene locus_tag LOCUS_02320 gene nusB 49586 49152 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204940.1 protein_id gnl|my_center|LOCUS_02320 49968 49579 gene locus_tag LOCUS_02330 49968 49579 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206139.1 protein_id gnl|my_center|LOCUS_02330 50599 50039 gene locus_tag LOCUS_02340 gene efp 50599 50039 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896485.1 protein_id gnl|my_center|LOCUS_02340 51167 50712 gene locus_tag LOCUS_02350 51167 50712 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081097.1 protein_id gnl|my_center|LOCUS_02350 52247 51186 gene locus_tag LOCUS_02360 52247 51186 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775324.1 protein_id gnl|my_center|LOCUS_02360 52864 52436 gene locus_tag LOCUS_02370 52864 52436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 53469 52909 gene locus_tag LOCUS_02380 53469 52909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 53860 53471 gene locus_tag LOCUS_02390 53860 53471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02390 54200 54048 gene locus_tag LOCUS_02400 54200 54048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 57592 54767 gene locus_tag LOCUS_02410 gene uvrA 57592 54767 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922628.1 protein_id gnl|my_center|LOCUS_02410 57901 58845 gene locus_tag LOCUS_02420 57901 58845 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262667.1 protein_id gnl|my_center|LOCUS_02420 58916 59587 gene locus_tag LOCUS_02430 58916 59587 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922629.1 protein_id gnl|my_center|LOCUS_02430 59752 60585 gene locus_tag LOCUS_02440 59752 60585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 60950 60711 gene locus_tag LOCUS_02450 gene rpsR 60950 60711 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068665.1 protein_id gnl|my_center|LOCUS_02450 61510 60992 gene locus_tag LOCUS_02460 61510 60992 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983122.1 protein_id gnl|my_center|LOCUS_02460 61812 61522 gene locus_tag LOCUS_02470 gene rpsF 61812 61522 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983117.1 protein_id gnl|my_center|LOCUS_02470 62031 62984 gene locus_tag LOCUS_02480 62031 62984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775092.1 protein_id gnl|my_center|LOCUS_02480 63649 64800 gene locus_tag LOCUS_02490 gene mutY 63649 64800 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263365.1 protein_id gnl|my_center|LOCUS_02490 65348 65127 gene locus_tag LOCUS_02500 65348 65127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 65708 65481 gene locus_tag LOCUS_02510 65708 65481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 66009 65695 gene locus_tag LOCUS_02520 66009 65695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 69266 66627 gene locus_tag LOCUS_02530 gene polA 69266 66627 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263533.1 protein_id gnl|my_center|LOCUS_02530 69473 71824 gene locus_tag LOCUS_02540 69473 71824 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060323.1 protein_id gnl|my_center|LOCUS_02540 72467 71925 gene locus_tag LOCUS_02550 72467 71925 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263361.1 protein_id gnl|my_center|LOCUS_02550 72781 72464 gene locus_tag LOCUS_02560 72781 72464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448289.1 protein_id gnl|my_center|LOCUS_02560 73095 73985 gene locus_tag LOCUS_02570 gene rnhC 73095 73985 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002271343.1 protein_id gnl|my_center|LOCUS_02570 74004 74627 gene locus_tag LOCUS_02580 gene lepB 74004 74627 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263358.1 protein_id gnl|my_center|LOCUS_02580 74689 77193 gene locus_tag LOCUS_02590 74689 77193 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451609.1 protein_id gnl|my_center|LOCUS_02590 77574 77248 gene locus_tag LOCUS_02600 77574 77248 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610953.1 protein_id gnl|my_center|LOCUS_02600 78253 77561 gene locus_tag LOCUS_02610 78253 77561 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410681.1 protein_id gnl|my_center|LOCUS_02610 79318 78305 gene locus_tag LOCUS_02620 gene tsaD 79318 78305 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655087.1 protein_id gnl|my_center|LOCUS_02620 79758 79318 gene locus_tag LOCUS_02630 gene rimI 79758 79318 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445945.1 protein_id gnl|my_center|LOCUS_02630 80419 79733 gene locus_tag LOCUS_02640 gene tsaB 80419 79733 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262633.1 protein_id gnl|my_center|LOCUS_02640 80683 80913 gene locus_tag LOCUS_02650 80683 80913 CDS product DNA-dependent RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639570.1 protein_id gnl|my_center|LOCUS_02650 80918 82600 gene locus_tag LOCUS_02660 80918 82600 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065498.1 protein_id gnl|my_center|LOCUS_02660 83237 82836 gene locus_tag LOCUS_02670 83237 82836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02670 84771 83428 gene locus_tag LOCUS_02680 gene glnA 84771 83428 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122904.1 protein_id gnl|my_center|LOCUS_02680 85194 84820 gene locus_tag LOCUS_02690 85194 84820 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982895.1 protein_id gnl|my_center|LOCUS_02690 85870 85367 gene locus_tag LOCUS_02700 85870 85367 CDS product aromatic acid exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854121.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence04 147 1079 gene locus_tag LOCUS_02710 147 1079 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262586.1 protein_id gnl|my_center|LOCUS_02710 1106 1792 gene locus_tag LOCUS_02720 1106 1792 CDS product DUF1803 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614471.1 protein_id gnl|my_center|LOCUS_02720 2355 1822 gene locus_tag LOCUS_02730 2355 1822 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263684.1 protein_id gnl|my_center|LOCUS_02730 3202 2426 gene locus_tag LOCUS_02740 gene recX 3202 2426 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837398.1 protein_id gnl|my_center|LOCUS_02740 3237 4601 gene locus_tag LOCUS_02750 gene rlmD 3237 4601 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922532.1 protein_id gnl|my_center|LOCUS_02750 4700 5692 gene locus_tag LOCUS_02760 gene asnA 4700 5692 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922500.1 protein_id gnl|my_center|LOCUS_02760 7202 5844 gene locus_tag LOCUS_02770 7202 5844 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262528.1 protein_id gnl|my_center|LOCUS_02770 7334 7972 gene locus_tag LOCUS_02780 7334 7972 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262529.1 protein_id gnl|my_center|LOCUS_02780 8185 8976 gene locus_tag LOCUS_02790 8185 8976 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893616.1 protein_id gnl|my_center|LOCUS_02790 9080 9514 gene locus_tag LOCUS_02800 9080 9514 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455488.1 protein_id gnl|my_center|LOCUS_02800 9514 10476 gene locus_tag LOCUS_02810 9514 10476 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262532.1 protein_id gnl|my_center|LOCUS_02810 10540 10764 gene locus_tag LOCUS_02820 10540 10764 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262533.1 protein_id gnl|my_center|LOCUS_02820 10870 11835 gene locus_tag LOCUS_02830 gene fabK 10870 11835 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262534.1 protein_id gnl|my_center|LOCUS_02830 11858 12778 gene locus_tag LOCUS_02840 gene fabD 11858 12778 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262535.1 protein_id gnl|my_center|LOCUS_02840 12791 13525 gene locus_tag LOCUS_02850 gene fabG 12791 13525 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176108.1 protein_id gnl|my_center|LOCUS_02850 13587 14819 gene locus_tag LOCUS_02860 gene fabF 13587 14819 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002269672.1 protein_id gnl|my_center|LOCUS_02860 14823 15311 gene locus_tag LOCUS_02870 gene accB 14823 15311 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262538.1 protein_id gnl|my_center|LOCUS_02870 15308 15733 gene locus_tag LOCUS_02880 gene fabZ 15308 15733 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922202.1 protein_id gnl|my_center|LOCUS_02880 15853 17223 gene locus_tag LOCUS_02890 gene accC 15853 17223 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000488679.1 protein_id gnl|my_center|LOCUS_02890 17229 18095 gene locus_tag LOCUS_02900 gene accD 17229 18095 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002280638.1 protein_id gnl|my_center|LOCUS_02900 18092 18862 gene locus_tag LOCUS_02910 18092 18862 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262542.1 protein_id gnl|my_center|LOCUS_02910 19375 18893 gene locus_tag LOCUS_02920 19375 18893 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159885.1 protein_id gnl|my_center|LOCUS_02920 19902 20582 gene locus_tag LOCUS_02930 19902 20582 CDS product IS6-like element IS1216 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015311.1 protein_id gnl|my_center|LOCUS_02930 21317 21814 gene locus_tag LOCUS_02940 21317 21814 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921894.1 protein_id gnl|my_center|LOCUS_02940 22756 21914 gene locus_tag LOCUS_02950 22756 21914 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263423.1 protein_id gnl|my_center|LOCUS_02950 22897 24180 gene locus_tag LOCUS_02960 gene tig 22897 24180 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107750.1 protein_id gnl|my_center|LOCUS_02960 24338 24913 gene locus_tag LOCUS_02970 gene rpoE 24338 24913 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418426.1 protein_id gnl|my_center|LOCUS_02970 25273 25058 gene locus_tag LOCUS_02980 25273 25058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 25164 26768 gene locus_tag LOCUS_02990 25164 26768 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170435.1 protein_id gnl|my_center|LOCUS_02990 26863 27333 gene locus_tag LOCUS_03000 26863 27333 CDS product DUF3013 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051348.1 protein_id gnl|my_center|LOCUS_03000 27349 27795 gene locus_tag LOCUS_03010 27349 27795 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006146286.1 protein_id gnl|my_center|LOCUS_03010 27795 28748 gene locus_tag LOCUS_03020 gene prmA 27795 28748 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099294.1 protein_id gnl|my_center|LOCUS_03020 28749 29492 gene locus_tag LOCUS_03030 28749 29492 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188235.1 protein_id gnl|my_center|LOCUS_03030 29658 30371 gene locus_tag LOCUS_03040 29658 30371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03040 30307 31116 gene locus_tag LOCUS_03050 30307 31116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03050 31128 32201 gene locus_tag LOCUS_03060 31128 32201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03060 32701 32243 gene locus_tag LOCUS_03070 gene nrdI 32701 32243 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125401.1 protein_id gnl|my_center|LOCUS_03070 32870 35089 gene locus_tag LOCUS_03080 32870 35089 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262356.1 protein_id gnl|my_center|LOCUS_03080 35102 35545 gene locus_tag LOCUS_03090 gene dtd 35102 35545 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691419.1 protein_id gnl|my_center|LOCUS_03090 35986 36270 gene locus_tag LOCUS_03100 35986 36270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03100 36200 36697 gene locus_tag LOCUS_03110 36200 36697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03110 36752 37522 gene locus_tag LOCUS_03120 36752 37522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 37823 39073 gene locus_tag LOCUS_03130 gene ilvA 37823 39073 CDS product threonine ammonia-lyase IlvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262759.1 protein_id gnl|my_center|LOCUS_03130 39848 39234 gene locus_tag LOCUS_03140 gene def 39848 39234 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001272875.1 protein_id gnl|my_center|LOCUS_03140 40588 39950 gene locus_tag LOCUS_03150 40588 39950 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263600.1 protein_id gnl|my_center|LOCUS_03150 40695 41858 gene locus_tag LOCUS_03160 40695 41858 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263893.1 protein_id gnl|my_center|LOCUS_03160 42007 42276 gene locus_tag LOCUS_03170 gene rpsO 42007 42276 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018249.1 protein_id gnl|my_center|LOCUS_03170 43376 43495 gene locus_tag LOCUS_03180 43376 43495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 43654 43824 gene locus_tag LOCUS_03190 43654 43824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 44845 44105 gene locus_tag LOCUS_03200 44845 44105 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189496.1 protein_id gnl|my_center|LOCUS_03200 46395 44845 gene locus_tag LOCUS_03210 46395 44845 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837468.1 protein_id gnl|my_center|LOCUS_03210 46598 47452 gene locus_tag LOCUS_03220 46598 47452 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986031.1 protein_id gnl|my_center|LOCUS_03220 48078 48827 gene locus_tag LOCUS_03230 gene mecA 48078 48827 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425371.1 protein_id gnl|my_center|LOCUS_03230 48831 49988 gene locus_tag LOCUS_03240 48831 49988 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612108.1 protein_id gnl|my_center|LOCUS_03240 50148 50918 gene locus_tag LOCUS_03250 gene sufC 50148 50918 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114502.1 protein_id gnl|my_center|LOCUS_03250 50955 52217 gene locus_tag LOCUS_03260 gene sufD 50955 52217 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262746.1 protein_id gnl|my_center|LOCUS_03260 52271 53503 gene locus_tag LOCUS_03270 52271 53503 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262745.1 protein_id gnl|my_center|LOCUS_03270 53490 53924 gene locus_tag LOCUS_03280 53490 53924 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262744.1 protein_id gnl|my_center|LOCUS_03280 54004 55422 gene locus_tag LOCUS_03290 gene sufB 54004 55422 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289834.1 protein_id gnl|my_center|LOCUS_03290 55706 55846 gene locus_tag LOCUS_03300 55706 55846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 55984 56739 gene locus_tag LOCUS_03310 55984 56739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03310 56729 56938 gene locus_tag LOCUS_03320 56729 56938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 56949 57095 gene locus_tag LOCUS_03330 56949 57095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03330 57044 57517 gene locus_tag LOCUS_03340 57044 57517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03340 57554 57982 gene locus_tag LOCUS_03350 57554 57982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03350 57999 58196 gene locus_tag LOCUS_03360 57999 58196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03360 58226 58429 gene locus_tag LOCUS_03370 58226 58429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03370 58392 58805 gene locus_tag LOCUS_03380 58392 58805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03380 58700 59038 gene locus_tag LOCUS_03390 58700 59038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03390 59040 59978 gene locus_tag LOCUS_03400 59040 59978 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138506.1 protein_id gnl|my_center|LOCUS_03400 60200 60388 gene locus_tag LOCUS_03410 60200 60388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 60535 61401 gene locus_tag LOCUS_03420 gene hslO 60535 61401 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921808.1 protein_id gnl|my_center|LOCUS_03420 61394 62371 gene locus_tag LOCUS_03430 gene dusB 61394 62371 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987812.1 protein_id gnl|my_center|LOCUS_03430 62600 63868 gene locus_tag LOCUS_03440 62600 63868 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770614.1 protein_id gnl|my_center|LOCUS_03440 63974 64417 gene locus_tag LOCUS_03450 63974 64417 CDS product zinc-dependent MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921790.1 protein_id gnl|my_center|LOCUS_03450 64419 65126 gene locus_tag LOCUS_03460 64419 65126 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921791.1 protein_id gnl|my_center|LOCUS_03460 65119 65931 gene locus_tag LOCUS_03470 65119 65931 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923270.1 protein_id gnl|my_center|LOCUS_03470 66093 67031 gene locus_tag LOCUS_03480 66093 67031 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476237.1 protein_id gnl|my_center|LOCUS_03480 67182 67577 gene locus_tag LOCUS_03490 67182 67577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03490 67823 68749 gene locus_tag LOCUS_03500 67823 68749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03500 68742 69368 gene locus_tag LOCUS_03510 68742 69368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03510 69370 70281 gene locus_tag LOCUS_03520 69370 70281 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670818.1 protein_id gnl|my_center|LOCUS_03520 70390 71739 gene locus_tag LOCUS_03530 70390 71739 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018268.1 protein_id gnl|my_center|LOCUS_03530 71927 72643 gene locus_tag LOCUS_03540 71927 72643 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000532903.1 protein_id gnl|my_center|LOCUS_03540 72769 73107 gene locus_tag LOCUS_03550 gene yajC 72769 73107 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011285724.1 protein_id gnl|my_center|LOCUS_03550 73236 73985 gene locus_tag LOCUS_03560 73236 73985 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469563.1 protein_id gnl|my_center|LOCUS_03560 73998 74792 gene locus_tag LOCUS_03570 73998 74792 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664686.1 protein_id gnl|my_center|LOCUS_03570 74809 76071 gene locus_tag LOCUS_03580 gene rseP 74809 76071 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000900647.1 protein_id gnl|my_center|LOCUS_03580 76142 78004 gene locus_tag LOCUS_03590 76142 78004 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814045.1 protein_id gnl|my_center|LOCUS_03590 78620 80560 gene locus_tag LOCUS_03600 78620 80560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 80560 81363 gene locus_tag LOCUS_03610 80560 81363 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054430.1 protein_id gnl|my_center|LOCUS_03610 81535 81822 gene locus_tag LOCUS_03620 gene groES 81535 81822 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917302.1 protein_id gnl|my_center|LOCUS_03620 81871 83490 gene locus_tag LOCUS_03630 gene groL 81871 83490 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922731.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence05 553 188 gene locus_tag LOCUS_03640 gene rplL 553 188 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196960.1 protein_id gnl|my_center|LOCUS_03640 1131 628 gene locus_tag LOCUS_03650 gene rplJ 1131 628 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287288.1 protein_id gnl|my_center|LOCUS_03650 1626 1423 gene locus_tag LOCUS_03660 1626 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03660 2141 1635 gene locus_tag LOCUS_03670 2141 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03670 2701 2456 gene locus_tag LOCUS_03680 2701 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03680 3192 2941 gene locus_tag LOCUS_03690 3192 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4319 3561 gene locus_tag LOCUS_03700 4319 3561 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775077.1 protein_id gnl|my_center|LOCUS_03700 7875 4696 gene locus_tag LOCUS_03710 gene carB 7875 4696 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262009.1 protein_id gnl|my_center|LOCUS_03710 9308 8220 gene locus_tag LOCUS_03720 9308 8220 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262008.1 protein_id gnl|my_center|LOCUS_03720 10387 9461 gene locus_tag LOCUS_03730 10387 9461 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262007.1 protein_id gnl|my_center|LOCUS_03730 11689 10412 gene locus_tag LOCUS_03740 11689 10412 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837071.1 protein_id gnl|my_center|LOCUS_03740 12558 12037 gene locus_tag LOCUS_03750 gene pyrR 12558 12037 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823056.1 protein_id gnl|my_center|LOCUS_03750 13677 12787 gene locus_tag LOCUS_03760 13677 12787 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403233.1 protein_id gnl|my_center|LOCUS_03760 14122 13661 gene locus_tag LOCUS_03770 gene lspA 14122 13661 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226253.1 protein_id gnl|my_center|LOCUS_03770 15036 14131 gene locus_tag LOCUS_03780 15036 14131 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262001.1 protein_id gnl|my_center|LOCUS_03780 15522 15151 gene locus_tag LOCUS_03790 15522 15151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 15995 15519 gene locus_tag LOCUS_03800 15995 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03800 16216 15992 gene locus_tag LOCUS_03810 16216 15992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 16239 16475 gene locus_tag LOCUS_03820 16239 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 16800 16465 gene locus_tag LOCUS_03830 16800 16465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 17088 17846 gene locus_tag LOCUS_03840 17088 17846 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921960.1 protein_id gnl|my_center|LOCUS_03840 19120 18065 gene locus_tag LOCUS_03850 19120 18065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03850 19599 19165 gene locus_tag LOCUS_03860 19599 19165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03860 20089 20724 gene locus_tag LOCUS_03870 20089 20724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 22186 20795 gene locus_tag LOCUS_03880 22186 20795 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263094.1 protein_id gnl|my_center|LOCUS_03880 22613 22356 gene locus_tag LOCUS_03890 22613 22356 CDS product DUF896 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000371287.1 protein_id gnl|my_center|LOCUS_03890 24662 22626 gene locus_tag LOCUS_03900 gene glyS 24662 22626 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922564.1 protein_id gnl|my_center|LOCUS_03900 25863 24946 gene locus_tag LOCUS_03910 gene glyQ 25863 24946 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922565.1 protein_id gnl|my_center|LOCUS_03910 26593 26135 gene locus_tag LOCUS_03920 26593 26135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03920 26906 26538 gene locus_tag LOCUS_03930 26906 26538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 27087 26890 gene locus_tag LOCUS_03940 27087 26890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03940 27388 27065 gene locus_tag LOCUS_03950 27388 27065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03950 28641 27493 gene locus_tag LOCUS_03960 gene nagA 28641 27493 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074509.1 protein_id gnl|my_center|LOCUS_03960 29316 28726 gene locus_tag LOCUS_03970 29316 28726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 29495 29304 gene locus_tag LOCUS_03980 29495 29304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 30878 30021 gene locus_tag LOCUS_03990 30878 30021 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593336.1 protein_id gnl|my_center|LOCUS_03990 31521 30865 gene locus_tag LOCUS_04000 31521 30865 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990206.1 protein_id gnl|my_center|LOCUS_04000 31960 31619 gene locus_tag LOCUS_04010 31960 31619 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717797.1 protein_id gnl|my_center|LOCUS_04010 33206 31971 gene locus_tag LOCUS_04020 33206 31971 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379419.1 protein_id gnl|my_center|LOCUS_04020 34209 33343 gene locus_tag LOCUS_04030 gene rsmI 34209 33343 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935362.1 protein_id gnl|my_center|LOCUS_04030 34532 34212 gene locus_tag LOCUS_04040 gene yabA 34532 34212 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775637.1 protein_id gnl|my_center|LOCUS_04040 35325 34519 gene locus_tag LOCUS_04050 gene ricT 35325 34519 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262683.1 protein_id gnl|my_center|LOCUS_04050 36197 35322 gene locus_tag LOCUS_04060 36197 35322 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262682.1 protein_id gnl|my_center|LOCUS_04060 36835 36206 gene locus_tag LOCUS_04070 gene tmk 36835 36206 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715592.1 protein_id gnl|my_center|LOCUS_04070 37831 37073 gene locus_tag LOCUS_04080 gene tpiA 37831 37073 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087897.1 protein_id gnl|my_center|LOCUS_04080 39276 38080 gene locus_tag LOCUS_04090 gene tuf 39276 38080 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040724.1 protein_id gnl|my_center|LOCUS_04090 40794 39514 gene locus_tag LOCUS_04100 40794 39514 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687014.1 protein_id gnl|my_center|LOCUS_04100 41494 41048 gene locus_tag LOCUS_04110 41494 41048 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262939.1 protein_id gnl|my_center|LOCUS_04110 42913 41507 gene locus_tag LOCUS_04120 gene atpD 42913 41507 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922119.1 protein_id gnl|my_center|LOCUS_04120 43868 42990 gene locus_tag LOCUS_04130 43868 42990 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919085.1 protein_id gnl|my_center|LOCUS_04130 45392 43887 gene locus_tag LOCUS_04140 gene atpA 45392 43887 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996613.1 protein_id gnl|my_center|LOCUS_04140 45944 45408 gene locus_tag LOCUS_04150 45944 45408 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262943.1 protein_id gnl|my_center|LOCUS_04150 46441 45944 gene locus_tag LOCUS_04160 gene atpF 46441 45944 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025478.1 protein_id gnl|my_center|LOCUS_04160 47169 46462 gene locus_tag LOCUS_04170 gene atpB 47169 46462 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446421.1 protein_id gnl|my_center|LOCUS_04170 47401 47204 gene locus_tag LOCUS_04180 47401 47204 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046538.1 protein_id gnl|my_center|LOCUS_04180 50283 47578 gene locus_tag LOCUS_04190 50283 47578 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899695.1 protein_id gnl|my_center|LOCUS_04190 50728 50348 gene locus_tag LOCUS_04200 50728 50348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04200 51394 50804 gene locus_tag LOCUS_04210 51394 50804 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813807.1 protein_id gnl|my_center|LOCUS_04210 52061 51858 gene locus_tag LOCUS_04220 52061 51858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 52813 52196 gene locus_tag LOCUS_04230 52813 52196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 53810 52926 gene locus_tag LOCUS_04240 gene rarD 53810 52926 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224293.1 protein_id gnl|my_center|LOCUS_04240 54663 53803 gene locus_tag LOCUS_04250 gene thrB 54663 53803 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262830.1 protein_id gnl|my_center|LOCUS_04250 56033 54747 gene locus_tag LOCUS_04260 56033 54747 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262829.1 protein_id gnl|my_center|LOCUS_04260 56308 57084 gene locus_tag LOCUS_04270 56308 57084 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262828.1 protein_id gnl|my_center|LOCUS_04270 58255 57125 gene locus_tag LOCUS_04280 58255 57125 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261875.1 protein_id gnl|my_center|LOCUS_04280 58996 58259 gene locus_tag LOCUS_04290 gene argB 58996 58259 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261876.1 protein_id gnl|my_center|LOCUS_04290 60216 59023 gene locus_tag LOCUS_04300 gene argJ 60216 59023 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261877.1 protein_id gnl|my_center|LOCUS_04300 61267 60245 gene locus_tag LOCUS_04310 gene argC 61267 60245 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261878.1 protein_id gnl|my_center|LOCUS_04310 62577 61396 gene locus_tag LOCUS_04320 62577 61396 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703454.1 protein_id gnl|my_center|LOCUS_04320 63375 62587 gene locus_tag LOCUS_04330 63375 62587 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262133.1 protein_id gnl|my_center|LOCUS_04330 64376 63507 gene locus_tag LOCUS_04340 64376 63507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04340 65768 64767 gene locus_tag LOCUS_04350 65768 64767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 66011 65832 gene locus_tag LOCUS_04360 66011 65832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 66263 66042 gene locus_tag LOCUS_04370 66263 66042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 69043 66425 gene locus_tag LOCUS_04380 gene alaS 69043 66425 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261891.1 protein_id gnl|my_center|LOCUS_04380 70500 69385 gene locus_tag LOCUS_04390 70500 69385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 71269 70562 gene locus_tag LOCUS_04400 71269 70562 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972506.1 protein_id gnl|my_center|LOCUS_04400 73256 71451 gene locus_tag LOCUS_04410 gene pepF 73256 71451 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282902.1 protein_id gnl|my_center|LOCUS_04410 74226 73267 gene locus_tag LOCUS_04420 74226 73267 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261897.1 protein_id gnl|my_center|LOCUS_04420 75007 74828 gene locus_tag LOCUS_04430 75007 74828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 75524 76420 gene locus_tag LOCUS_04440 75524 76420 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263650.1 protein_id gnl|my_center|LOCUS_04440 78701 76698 gene locus_tag LOCUS_04450 gene metG 78701 76698 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291361.1 protein_id gnl|my_center|LOCUS_04450 79302 78895 gene locus_tag LOCUS_04460 79302 78895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 79534 79295 gene locus_tag LOCUS_04470 79534 79295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 80388 79975 gene locus_tag LOCUS_04480 80388 79975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 81318 81160 gene locus_tag LOCUS_04490 81318 81160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 82657 81596 gene locus_tag LOCUS_04500 82657 81596 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921967.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence06 397 735 gene locus_tag LOCUS_04510 397 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 748 1308 gene locus_tag LOCUS_04520 748 1308 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263422.1 protein_id gnl|my_center|LOCUS_04520 1484 1729 gene locus_tag LOCUS_04530 1484 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2074 1916 gene locus_tag LOCUS_04540 2074 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04540 2420 2785 gene locus_tag LOCUS_04550 2420 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04550 3010 3156 gene locus_tag LOCUS_04560 3010 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04560 3324 3677 gene locus_tag LOCUS_04570 3324 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04570 3628 4101 gene locus_tag LOCUS_04580 3628 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04580 4115 4375 gene locus_tag LOCUS_04590 4115 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04590 4456 6351 gene locus_tag LOCUS_04600 4456 6351 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262350.1 protein_id gnl|my_center|LOCUS_04600 6490 6885 gene locus_tag LOCUS_04610 6490 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04610 7079 8020 gene locus_tag LOCUS_04620 7079 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04620 8021 8467 gene locus_tag LOCUS_04630 8021 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04630 8451 8684 gene locus_tag LOCUS_04640 8451 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04640 8629 9015 gene locus_tag LOCUS_04650 8629 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04650 9324 9584 gene locus_tag LOCUS_04660 9324 9584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 9672 11156 gene locus_tag LOCUS_04670 gene thrC 9672 11156 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_04670 11214 12503 gene locus_tag LOCUS_04680 11214 12503 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002271314.1 protein_id gnl|my_center|LOCUS_04680 12613 12978 gene locus_tag LOCUS_04690 12613 12978 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262764.1 protein_id gnl|my_center|LOCUS_04690 12978 14645 gene locus_tag LOCUS_04700 12978 14645 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001868429.1 protein_id gnl|my_center|LOCUS_04700 14815 14979 gene locus_tag LOCUS_04710 14815 14979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 15045 16535 gene locus_tag LOCUS_04720 gene ilvD 15045 16535 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255780.1 protein_id gnl|my_center|LOCUS_04720 16669 18369 gene locus_tag LOCUS_04730 16669 18369 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411735.1 protein_id gnl|my_center|LOCUS_04730 18362 18838 gene locus_tag LOCUS_04740 gene ilvN 18362 18838 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001253803.1 protein_id gnl|my_center|LOCUS_04740 18914 19936 gene locus_tag LOCUS_04750 gene ilvC 18914 19936 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290683.1 protein_id gnl|my_center|LOCUS_04750 21318 20062 gene locus_tag LOCUS_04760 gene tyrS 21318 20062 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922558.1 protein_id gnl|my_center|LOCUS_04760 21516 23795 gene locus_tag LOCUS_04770 gene pbp1b 21516 23795 CDS product penicillin-binding protein PBP1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263431.1 protein_id gnl|my_center|LOCUS_04770 24158 27739 gene locus_tag LOCUS_04780 gene rpoB 24158 27739 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907191.1 protein_id gnl|my_center|LOCUS_04780 27840 31478 gene locus_tag LOCUS_04790 gene rpoC 27840 31478 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921797.1 protein_id gnl|my_center|LOCUS_04790 31655 31999 gene locus_tag LOCUS_04800 31655 31999 CDS product DUF1033 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000286392.1 protein_id gnl|my_center|LOCUS_04800 32080 33021 gene locus_tag LOCUS_04810 gene comGA 32080 33021 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263435.1 protein_id gnl|my_center|LOCUS_04810 33179 34003 gene locus_tag LOCUS_04820 gene comGB 33179 34003 CDS product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914479.1 protein_id gnl|my_center|LOCUS_04820 34000 34326 gene locus_tag LOCUS_04830 gene comGC 34000 34326 CDS product competence type IV pilus major pilin ComGC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836360.1 protein_id gnl|my_center|LOCUS_04830 34352 34714 gene locus_tag LOCUS_04840 gene comGD 34352 34714 CDS product competence type IV pilus minor pilin ComGD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921721.1 protein_id gnl|my_center|LOCUS_04840 34779 34979 gene locus_tag LOCUS_04850 34779 34979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 34963 35400 gene locus_tag LOCUS_04860 gene comGF 34963 35400 CDS product competence type IV pilus minor pilin ComGF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263440.1 protein_id gnl|my_center|LOCUS_04860 35378 35695 gene locus_tag LOCUS_04870 gene comGG 35378 35695 CDS product competence type IV pilus minor pilin ComGG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263441.1 protein_id gnl|my_center|LOCUS_04870 35740 36696 gene locus_tag LOCUS_04880 35740 36696 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008574.1 protein_id gnl|my_center|LOCUS_04880 36752 37945 gene locus_tag LOCUS_04890 36752 37945 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911070.1 protein_id gnl|my_center|LOCUS_04890 38194 38391 gene locus_tag LOCUS_04900 38194 38391 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263444.1 protein_id gnl|my_center|LOCUS_04900 38634 39059 gene locus_tag LOCUS_04910 38634 39059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 39133 39576 gene locus_tag LOCUS_04920 39133 39576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263445.1 protein_id gnl|my_center|LOCUS_04920 39673 40335 gene locus_tag LOCUS_04930 39673 40335 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775187.1 protein_id gnl|my_center|LOCUS_04930 41135 40365 gene locus_tag LOCUS_04940 gene proC 41135 40365 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001865901.1 protein_id gnl|my_center|LOCUS_04940 42218 41151 gene locus_tag LOCUS_04950 gene pepA 42218 41151 CDS product glutamyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921806.1 protein_id gnl|my_center|LOCUS_04950 42309 42602 gene locus_tag LOCUS_04960 42309 42602 CDS product DUF4651 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791272.1 protein_id gnl|my_center|LOCUS_04960 42599 42913 gene locus_tag LOCUS_04970 42599 42913 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000602781.1 protein_id gnl|my_center|LOCUS_04970 42923 43546 gene locus_tag LOCUS_04980 42923 43546 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921734.1 protein_id gnl|my_center|LOCUS_04980 43684 44715 gene locus_tag LOCUS_04990 43684 44715 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829995.1 protein_id gnl|my_center|LOCUS_04990 44730 44957 gene locus_tag LOCUS_05000 44730 44957 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581076.1 protein_id gnl|my_center|LOCUS_05000 45163 45555 gene locus_tag LOCUS_05010 45163 45555 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000282447.1 protein_id gnl|my_center|LOCUS_05010 46314 46832 gene locus_tag LOCUS_05020 gene tadA 46314 46832 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027934.1 protein_id gnl|my_center|LOCUS_05020 47176 46913 gene locus_tag LOCUS_05030 47176 46913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 47790 48623 gene locus_tag LOCUS_05040 47790 48623 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027409.1 protein_id gnl|my_center|LOCUS_05040 48741 49094 gene locus_tag LOCUS_05050 48741 49094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05050 49118 49492 gene locus_tag LOCUS_05060 49118 49492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05060 49578 50276 gene locus_tag LOCUS_05070 gene dapD 49578 50276 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262903.1 protein_id gnl|my_center|LOCUS_05070 50355 51488 gene locus_tag LOCUS_05080 50355 51488 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262527.1 protein_id gnl|my_center|LOCUS_05080 51557 52084 gene locus_tag LOCUS_05090 51557 52084 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412414.1 protein_id gnl|my_center|LOCUS_05090 52075 52749 gene locus_tag LOCUS_05100 52075 52749 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262525.1 protein_id gnl|my_center|LOCUS_05100 53709 52795 gene locus_tag LOCUS_05110 gene galU 53709 52795 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262524.1 protein_id gnl|my_center|LOCUS_05110 54753 53728 gene locus_tag LOCUS_05120 54753 53728 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986123.1 protein_id gnl|my_center|LOCUS_05120 55438 54983 gene locus_tag LOCUS_05130 55438 54983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05130 55821 55447 gene locus_tag LOCUS_05140 55821 55447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05140 56148 55966 gene locus_tag LOCUS_05150 56148 55966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 57183 56458 gene locus_tag LOCUS_05160 57183 56458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05160 57606 57250 gene locus_tag LOCUS_05170 57606 57250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05170 58074 57625 gene locus_tag LOCUS_05180 58074 57625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05180 58227 58075 gene locus_tag LOCUS_05190 58227 58075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05190 58441 58887 gene locus_tag LOCUS_05200 58441 58887 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837586.1 protein_id gnl|my_center|LOCUS_05200 59209 60426 gene locus_tag LOCUS_05210 gene radA 59209 60426 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085195.1 protein_id gnl|my_center|LOCUS_05210 60700 60996 gene locus_tag LOCUS_05220 60700 60996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05220 60990 61211 gene locus_tag LOCUS_05230 60990 61211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05230 61354 61851 gene locus_tag LOCUS_05240 61354 61851 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922537.1 protein_id gnl|my_center|LOCUS_05240 62296 61943 gene locus_tag LOCUS_05250 62296 61943 CDS product DUF3397 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266609.1 protein_id gnl|my_center|LOCUS_05250 62468 62893 gene locus_tag LOCUS_05260 gene rplK 62468 62893 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263607.1 protein_id gnl|my_center|LOCUS_05260 62993 63682 gene locus_tag LOCUS_05270 gene rplA 62993 63682 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352344.1 protein_id gnl|my_center|LOCUS_05270 63775 64224 gene locus_tag LOCUS_05280 63775 64224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05280 64221 64694 gene locus_tag LOCUS_05290 64221 64694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05290 65035 66489 gene locus_tag LOCUS_05300 gene gltX 65035 66489 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031057.1 protein_id gnl|my_center|LOCUS_05300 67392 68591 gene locus_tag LOCUS_05310 67392 68591 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262513.1 protein_id gnl|my_center|LOCUS_05310 68920 70305 gene locus_tag LOCUS_05320 gene argH 68920 70305 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262512.1 protein_id gnl|my_center|LOCUS_05320 70390 70725 gene locus_tag LOCUS_05330 gene rnpA 70390 70725 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262511.1 protein_id gnl|my_center|LOCUS_05330 70840 71646 gene locus_tag LOCUS_05340 gene yidC1 70840 71646 CDS product membrane protein insertase YidC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264887.1 protein_id gnl|my_center|LOCUS_05340 71658 72707 gene locus_tag LOCUS_05350 71658 72707 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837573.1 protein_id gnl|my_center|LOCUS_05350 73594 73728 gene locus_tag LOCUS_05360 73594 73728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 >Feature sequence07 521 1597 gene locus_tag LOCUS_05370 521 1597 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000542465.1 protein_id gnl|my_center|LOCUS_05370 1935 2870 gene locus_tag LOCUS_05380 gene dapA 1935 2870 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935444.1 protein_id gnl|my_center|LOCUS_05380 3025 3714 gene locus_tag LOCUS_05390 gene rnc 3025 3714 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262927.1 protein_id gnl|my_center|LOCUS_05390 3717 7250 gene locus_tag LOCUS_05400 gene smc 3717 7250 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478794.1 protein_id gnl|my_center|LOCUS_05400 7871 8914 gene locus_tag LOCUS_05410 gene pheS 7871 8914 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262925.1 protein_id gnl|my_center|LOCUS_05410 8931 9449 gene locus_tag LOCUS_05420 8931 9449 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775170.1 protein_id gnl|my_center|LOCUS_05420 9708 12158 gene locus_tag LOCUS_05430 gene pheT 9708 12158 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352339.1 protein_id gnl|my_center|LOCUS_05430 12225 12461 gene locus_tag LOCUS_05440 12225 12461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 12890 13228 gene locus_tag LOCUS_05450 12890 13228 CDS product ATP cone domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030126669.1 protein_id gnl|my_center|LOCUS_05450 14537 13272 gene locus_tag LOCUS_05460 14537 13272 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922340.1 protein_id gnl|my_center|LOCUS_05460 14695 15225 gene locus_tag LOCUS_05470 14695 15225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 15363 15872 gene locus_tag LOCUS_05480 15363 15872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 15873 16199 gene locus_tag LOCUS_05490 15873 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05490 16192 16731 gene locus_tag LOCUS_05500 16192 16731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05500 16721 17251 gene locus_tag LOCUS_05510 16721 17251 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262822.1 protein_id gnl|my_center|LOCUS_05510 17390 18928 gene locus_tag LOCUS_05520 17390 18928 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025410.1 protein_id gnl|my_center|LOCUS_05520 19244 20617 gene locus_tag LOCUS_05530 19244 20617 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836937.1 protein_id gnl|my_center|LOCUS_05530 21696 20710 gene locus_tag LOCUS_05540 21696 20710 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204727.1 protein_id gnl|my_center|LOCUS_05540 21915 24368 gene locus_tag LOCUS_05550 gene gyrA 21915 24368 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197090491.1 protein_id gnl|my_center|LOCUS_05550 24383 25144 gene locus_tag LOCUS_05560 24383 25144 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984641.1 protein_id gnl|my_center|LOCUS_05560 25187 25498 gene locus_tag LOCUS_05570 25187 25498 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767937.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05570 25695 26663 gene locus_tag LOCUS_05580 25695 26663 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289313.1 protein_id gnl|my_center|LOCUS_05580 27293 26928 gene locus_tag LOCUS_05590 27293 26928 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212086.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05590 27795 27382 gene locus_tag LOCUS_05600 27795 27382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05600 28315 28187 gene locus_tag LOCUS_05610 28315 28187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 29423 28461 gene locus_tag LOCUS_05620 gene nrdF 29423 28461 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214845.1 protein_id gnl|my_center|LOCUS_05620 31742 29583 gene locus_tag LOCUS_05630 gene nrdE 31742 29583 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922420.1 protein_id gnl|my_center|LOCUS_05630 32053 31829 gene locus_tag LOCUS_05640 32053 31829 CDS product redoxin NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261872.1 protein_id gnl|my_center|LOCUS_05640 32385 35048 gene locus_tag LOCUS_05650 gene acnA 32385 35048 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836671.1 protein_id gnl|my_center|LOCUS_05650 35050 36174 gene locus_tag LOCUS_05660 35050 36174 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261870.1 protein_id gnl|my_center|LOCUS_05660 36189 37364 gene locus_tag LOCUS_05670 gene icd 36189 37364 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261869.1 protein_id gnl|my_center|LOCUS_05670 37626 37889 gene locus_tag LOCUS_05680 37626 37889 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146945.1 protein_id gnl|my_center|LOCUS_05680 37894 39627 gene locus_tag LOCUS_05690 gene ptsP 37894 39627 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027161.1 protein_id gnl|my_center|LOCUS_05690 39846 41279 gene locus_tag LOCUS_05700 39846 41279 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922418.1 protein_id gnl|my_center|LOCUS_05700 41409 41609 gene locus_tag LOCUS_05710 41409 41609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 42650 41568 gene locus_tag LOCUS_05720 42650 41568 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628861.1 protein_id gnl|my_center|LOCUS_05720 42749 43384 gene locus_tag LOCUS_05730 gene udk 42749 43384 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181374.1 protein_id gnl|my_center|LOCUS_05730 43421 45340 gene locus_tag LOCUS_05740 43421 45340 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775248.1 protein_id gnl|my_center|LOCUS_05740 45866 46585 gene locus_tag LOCUS_05750 45866 46585 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000138570.1 protein_id gnl|my_center|LOCUS_05750 46582 49137 gene locus_tag LOCUS_05760 gene mprF 46582 49137 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733236.1 protein_id gnl|my_center|LOCUS_05760 49976 49188 gene locus_tag LOCUS_05770 49976 49188 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263110.1 protein_id gnl|my_center|LOCUS_05770 51319 49976 gene locus_tag LOCUS_05780 51319 49976 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263111.1 protein_id gnl|my_center|LOCUS_05780 51565 52272 gene locus_tag LOCUS_05790 gene cdaA 51565 52272 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263112.1 protein_id gnl|my_center|LOCUS_05790 52269 53234 gene locus_tag LOCUS_05800 52269 53234 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263113.1 protein_id gnl|my_center|LOCUS_05800 53457 54809 gene locus_tag LOCUS_05810 gene glmM 53457 54809 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521427.1 protein_id gnl|my_center|LOCUS_05810 54812 55252 gene locus_tag LOCUS_05820 54812 55252 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837174.1 protein_id gnl|my_center|LOCUS_05820 55350 56036 gene locus_tag LOCUS_05830 55350 56036 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990104.1 protein_id gnl|my_center|LOCUS_05830 56026 56814 gene locus_tag LOCUS_05840 56026 56814 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984887.1 protein_id gnl|my_center|LOCUS_05840 57214 57654 gene locus_tag LOCUS_05850 57214 57654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05850 57721 58812 gene locus_tag LOCUS_05860 57721 58812 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904722.1 protein_id gnl|my_center|LOCUS_05860 59044 59913 gene locus_tag LOCUS_05870 gene rfbA 59044 59913 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027249.1 protein_id gnl|my_center|LOCUS_05870 59913 60506 gene locus_tag LOCUS_05880 59913 60506 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027248.1 protein_id gnl|my_center|LOCUS_05880 60935 61696 gene locus_tag LOCUS_05890 60935 61696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05890 61409 61418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 61693 61989 gene locus_tag LOCUS_05900 61693 61989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 62386 62646 gene locus_tag LOCUS_05910 62386 62646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 62825 63148 gene locus_tag LOCUS_05920 62825 63148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 63517 63263 gene locus_tag LOCUS_05930 63517 63263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 63676 63846 gene locus_tag LOCUS_05940 63676 63846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 64115 65251 gene locus_tag LOCUS_05950 gene hemW 64115 65251 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922247.1 protein_id gnl|my_center|LOCUS_05950 65252 65995 gene locus_tag LOCUS_05960 65252 65995 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263557.1 protein_id gnl|my_center|LOCUS_05960 65997 66770 gene locus_tag LOCUS_05970 65997 66770 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263555.1 protein_id gnl|my_center|LOCUS_05970 66760 67404 gene locus_tag LOCUS_05980 66760 67404 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000653357.1 protein_id gnl|my_center|LOCUS_05980 67407 68147 gene locus_tag LOCUS_05990 67407 68147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263062.1 protein_id gnl|my_center|LOCUS_05990 68235 68450 gene locus_tag LOCUS_06000 68235 68450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence08 1108 431 gene locus_tag LOCUS_06010 1108 431 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263659.1 protein_id gnl|my_center|LOCUS_06010 2996 1725 gene locus_tag LOCUS_06020 2996 1725 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074567.1 protein_id gnl|my_center|LOCUS_06020 4164 2989 gene locus_tag LOCUS_06030 4164 2989 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001874012.1 protein_id gnl|my_center|LOCUS_06030 4486 5346 gene locus_tag LOCUS_06040 4486 5346 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158639.1 protein_id gnl|my_center|LOCUS_06040 5454 5957 gene locus_tag LOCUS_06050 5454 5957 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262814.1 protein_id gnl|my_center|LOCUS_06050 5962 6132 gene locus_tag LOCUS_06060 5962 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262815.1 protein_id gnl|my_center|LOCUS_06060 6150 7376 gene locus_tag LOCUS_06070 gene clpX 6150 7376 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262816.1 protein_id gnl|my_center|LOCUS_06070 7386 7985 gene locus_tag LOCUS_06080 gene yihA 7386 7985 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796925.1 protein_id gnl|my_center|LOCUS_06080 8115 9491 gene locus_tag LOCUS_06090 8115 9491 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427485.1 protein_id gnl|my_center|LOCUS_06090 9503 10453 gene locus_tag LOCUS_06100 gene mmuM 9503 10453 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262819.1 protein_id gnl|my_center|LOCUS_06100 10566 10820 gene locus_tag LOCUS_06110 10566 10820 CDS product DUF1912 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983750.1 protein_id gnl|my_center|LOCUS_06110 10892 11251 gene locus_tag LOCUS_06120 10892 11251 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989018.1 protein_id gnl|my_center|LOCUS_06120 12006 11365 gene locus_tag LOCUS_06130 gene plsY 12006 11365 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984911.1 protein_id gnl|my_center|LOCUS_06130 12144 14093 gene locus_tag LOCUS_06140 gene parE 12144 14093 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165915.1 protein_id gnl|my_center|LOCUS_06140 14766 17186 gene locus_tag LOCUS_06150 gene parC 14766 17186 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775433.1 protein_id gnl|my_center|LOCUS_06150 17350 18372 gene locus_tag LOCUS_06160 17350 18372 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263260.1 protein_id gnl|my_center|LOCUS_06160 18491 18721 gene locus_tag LOCUS_06170 18491 18721 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037098.1 protein_id gnl|my_center|LOCUS_06170 18782 18862 gene locus_tag LOCUS_t00150 18782 18862 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 18930 19004 gene locus_tag LOCUS_t00160 18930 19004 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19123 20325 gene locus_tag LOCUS_06180 gene rpsA 19123 20325 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001001614.1 protein_id gnl|my_center|LOCUS_06180 20394 20465 gene locus_tag LOCUS_t00170 20394 20465 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20760 21106 gene locus_tag LOCUS_tm00010 20760 21106 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 21153 21389 gene locus_tag LOCUS_06190 21153 21389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 21553 21774 gene locus_tag LOCUS_06200 21553 21774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 22507 23742 gene locus_tag LOCUS_06210 22507 23742 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263312.1 protein_id gnl|my_center|LOCUS_06210 23841 24176 gene locus_tag LOCUS_06220 23841 24176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06220 24435 24803 gene locus_tag LOCUS_06230 24435 24803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06230 25146 24844 gene locus_tag LOCUS_06240 25146 24844 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263571.1 protein_id gnl|my_center|LOCUS_06240 25614 25156 gene locus_tag LOCUS_06250 25614 25156 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074528.1 protein_id gnl|my_center|LOCUS_06250 28015 25757 gene locus_tag LOCUS_06260 28015 25757 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263569.1 protein_id gnl|my_center|LOCUS_06260 28256 29236 gene locus_tag LOCUS_06270 gene argF 28256 29236 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263568.1 protein_id gnl|my_center|LOCUS_06270 29305 29535 gene locus_tag LOCUS_06280 29305 29535 CDS product DUF1797 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000443582.1 protein_id gnl|my_center|LOCUS_06280 29806 30486 gene locus_tag LOCUS_06290 29806 30486 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263566.1 protein_id gnl|my_center|LOCUS_06290 30486 31220 gene locus_tag LOCUS_06300 30486 31220 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943067.1 protein_id gnl|my_center|LOCUS_06300 31394 31870 gene locus_tag LOCUS_06310 31394 31870 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263564.1 protein_id gnl|my_center|LOCUS_06310 31867 34005 gene locus_tag LOCUS_06320 gene feoB 31867 34005 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263563.1 protein_id gnl|my_center|LOCUS_06320 34017 34157 gene locus_tag LOCUS_06330 34017 34157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027975737.1 protein_id gnl|my_center|LOCUS_06330 34404 34616 gene locus_tag LOCUS_06340 34404 34616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 34864 35055 gene locus_tag LOCUS_06350 34864 35055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 35243 36097 gene locus_tag LOCUS_06360 35243 36097 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263561.1 protein_id gnl|my_center|LOCUS_06360 36101 36937 gene locus_tag LOCUS_06370 36101 36937 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263560.1 protein_id gnl|my_center|LOCUS_06370 37059 39173 gene locus_tag LOCUS_06380 gene pbp2b 37059 39173 CDS product penicillin-binding protein PBP2B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263251.1 protein_id gnl|my_center|LOCUS_06380 39283 39879 gene locus_tag LOCUS_06390 gene recR 39283 39879 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000966735.1 protein_id gnl|my_center|LOCUS_06390 40020 40391 gene locus_tag LOCUS_06400 40020 40391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06400 40499 40816 gene locus_tag LOCUS_06410 40499 40816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06410 41035 41532 gene locus_tag LOCUS_06420 gene ybeY 41035 41532 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001867191.1 protein_id gnl|my_center|LOCUS_06420 41513 41917 gene locus_tag LOCUS_06430 gene dagK 41513 41917 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262772.1 protein_id gnl|my_center|LOCUS_06430 41936 42835 gene locus_tag LOCUS_06440 gene era 41936 42835 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894867.1 protein_id gnl|my_center|LOCUS_06440 42882 43703 gene locus_tag LOCUS_06450 gene mutM 42882 43703 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921975.1 protein_id gnl|my_center|LOCUS_06450 43700 44293 gene locus_tag LOCUS_06460 gene coaE 43700 44293 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921976.1 protein_id gnl|my_center|LOCUS_06460 44344 45567 gene locus_tag LOCUS_06470 44344 45567 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921978.1 protein_id gnl|my_center|LOCUS_06470 45749 45985 gene locus_tag LOCUS_06480 gene secG 45749 45985 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985700.1 protein_id gnl|my_center|LOCUS_06480 46044 48497 gene locus_tag LOCUS_06490 gene rnr 46044 48497 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659926.1 protein_id gnl|my_center|LOCUS_06490 48519 48983 gene locus_tag LOCUS_06500 gene smpB 48519 48983 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238456.1 protein_id gnl|my_center|LOCUS_06500 49137 50543 gene locus_tag LOCUS_06510 49137 50543 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263035.1 protein_id gnl|my_center|LOCUS_06510 50545 50910 gene locus_tag LOCUS_06520 50545 50910 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263034.1 protein_id gnl|my_center|LOCUS_06520 52098 51013 gene locus_tag LOCUS_06530 52098 51013 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000040811.1 protein_id gnl|my_center|LOCUS_06530 52412 53413 gene locus_tag LOCUS_06540 gene ccpA 52412 53413 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985680.1 protein_id gnl|my_center|LOCUS_06540 53472 53639 gene locus_tag LOCUS_06550 53472 53639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 53775 54539 gene locus_tag LOCUS_06560 53775 54539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06560 54552 55667 gene locus_tag LOCUS_06570 54552 55667 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836773.1 protein_id gnl|my_center|LOCUS_06570 56169 55714 gene locus_tag LOCUS_06580 56169 55714 CDS product YueI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263193.1 protein_id gnl|my_center|LOCUS_06580 56378 57682 gene locus_tag LOCUS_06590 gene eno 56378 57682 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022818.1 protein_id gnl|my_center|LOCUS_06590 58019 57834 gene locus_tag LOCUS_06600 58019 57834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836777.1 protein_id gnl|my_center|LOCUS_06600 60223 58181 gene locus_tag LOCUS_06610 60223 58181 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922138.1 protein_id gnl|my_center|LOCUS_06610 60538 61692 gene locus_tag LOCUS_06620 60538 61692 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263895.1 protein_id gnl|my_center|LOCUS_06620 61689 62366 gene locus_tag LOCUS_06630 gene aroD 61689 62366 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261931.1 protein_id gnl|my_center|LOCUS_06630 62356 63213 gene locus_tag LOCUS_06640 62356 63213 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000762502.1 protein_id gnl|my_center|LOCUS_06640 63226 64293 gene locus_tag LOCUS_06650 gene aroB 63226 64293 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261933.1 protein_id gnl|my_center|LOCUS_06650 64294 65460 gene locus_tag LOCUS_06660 gene aroC 64294 65460 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001269854.1 protein_id gnl|my_center|LOCUS_06660 65490 66596 gene locus_tag LOCUS_06670 65490 66596 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261935.1 protein_id gnl|my_center|LOCUS_06670 66606 66944 gene locus_tag LOCUS_06680 66606 66944 CDS product YlbF/YmcA family competence regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922140.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence09 1669 1403 gene locus_tag LOCUS_06690 1669 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3458 1710 gene locus_tag LOCUS_06700 3458 1710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837093.1 protein_id gnl|my_center|LOCUS_06700 5187 3448 gene locus_tag LOCUS_06710 5187 3448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837094.1 protein_id gnl|my_center|LOCUS_06710 5807 5220 gene locus_tag LOCUS_06720 5807 5220 CDS product lysozyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897579.1 protein_id gnl|my_center|LOCUS_06720 6744 5833 gene locus_tag LOCUS_06730 6744 5833 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968655.1 protein_id gnl|my_center|LOCUS_06730 8067 6817 gene locus_tag LOCUS_06740 8067 6817 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575515.1 protein_id gnl|my_center|LOCUS_06740 8767 8162 gene locus_tag LOCUS_06750 8767 8162 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984663.1 protein_id gnl|my_center|LOCUS_06750 9587 8754 gene locus_tag LOCUS_06760 gene prmC 9587 8754 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922371.1 protein_id gnl|my_center|LOCUS_06760 10663 9584 gene locus_tag LOCUS_06770 gene prfA 10663 9584 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028827.1 protein_id gnl|my_center|LOCUS_06770 11296 10700 gene locus_tag LOCUS_06780 11296 10700 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000068109.1 protein_id gnl|my_center|LOCUS_06780 12535 11525 gene locus_tag LOCUS_06790 gene add 12535 11525 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074606.1 protein_id gnl|my_center|LOCUS_06790 12705 13493 gene locus_tag LOCUS_06800 gene yghU 12705 13493 CDS product glutathione-dependent disulfide-bond oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837122.1 protein_id gnl|my_center|LOCUS_06800 13574 14551 gene locus_tag LOCUS_06810 13574 14551 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000583238.1 protein_id gnl|my_center|LOCUS_06810 14505 15437 gene locus_tag LOCUS_06820 14505 15437 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836936.1 protein_id gnl|my_center|LOCUS_06820 15543 15785 gene locus_tag LOCUS_06830 15543 15785 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710764.1 protein_id gnl|my_center|LOCUS_06830 17170 15908 gene locus_tag LOCUS_06840 17170 15908 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075798.1 protein_id gnl|my_center|LOCUS_06840 17764 17982 gene locus_tag LOCUS_06850 17764 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06850 21175 18386 gene locus_tag LOCUS_06860 gene ileS 21175 18386 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768092.1 protein_id gnl|my_center|LOCUS_06860 22298 21423 gene locus_tag LOCUS_06870 22298 21423 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262074.1 protein_id gnl|my_center|LOCUS_06870 23342 22542 gene locus_tag LOCUS_06880 23342 22542 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922492.1 protein_id gnl|my_center|LOCUS_06880 23599 23342 gene locus_tag LOCUS_06890 23599 23342 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262072.1 protein_id gnl|my_center|LOCUS_06890 24172 23603 gene locus_tag LOCUS_06900 24172 23603 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262071.1 protein_id gnl|my_center|LOCUS_06900 24860 24177 gene locus_tag LOCUS_06910 24860 24177 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262070.1 protein_id gnl|my_center|LOCUS_06910 26185 24863 gene locus_tag LOCUS_06920 gene ftsZ 26185 24863 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983862.1 protein_id gnl|my_center|LOCUS_06920 27590 26214 gene locus_tag LOCUS_06930 gene ftsA 27590 26214 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262068.1 protein_id gnl|my_center|LOCUS_06930 28838 27714 gene locus_tag LOCUS_06940 28838 27714 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262067.1 protein_id gnl|my_center|LOCUS_06940 29918 28848 gene locus_tag LOCUS_06950 29918 28848 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516700.1 protein_id gnl|my_center|LOCUS_06950 31274 29922 gene locus_tag LOCUS_06960 gene murD 31274 29922 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262065.1 protein_id gnl|my_center|LOCUS_06960 31670 31398 gene locus_tag LOCUS_06970 31670 31398 CDS product DUF3165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499533.1 protein_id gnl|my_center|LOCUS_06970 33540 31690 gene locus_tag LOCUS_06980 gene typA 33540 31690 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983847.1 protein_id gnl|my_center|LOCUS_06980 34646 33678 gene locus_tag LOCUS_06990 34646 33678 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038547.1 protein_id gnl|my_center|LOCUS_06990 34845 34639 gene locus_tag LOCUS_07000 34845 34639 CDS product DUF910 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262060.1 protein_id gnl|my_center|LOCUS_07000 35393 34956 gene locus_tag LOCUS_07010 35393 34956 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896119.1 protein_id gnl|my_center|LOCUS_07010 36003 35482 gene locus_tag LOCUS_07020 gene dpr 36003 35482 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262059.1 protein_id gnl|my_center|LOCUS_07020 38188 36800 gene locus_tag LOCUS_07030 38188 36800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 38883 38278 gene locus_tag LOCUS_07040 gene sodA 38883 38278 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261912.1 protein_id gnl|my_center|LOCUS_07040 40012 38978 gene locus_tag LOCUS_07050 gene holA 40012 38978 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560292.1 protein_id gnl|my_center|LOCUS_07050 42911 40080 gene locus_tag LOCUS_07060 gene ppc 42911 40080 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019267.1 protein_id gnl|my_center|LOCUS_07060 43481 43086 gene locus_tag LOCUS_07070 43481 43086 CDS product DUF4430 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759944.1 protein_id gnl|my_center|LOCUS_07070 43951 43478 gene locus_tag LOCUS_07080 43951 43478 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263318.1 protein_id gnl|my_center|LOCUS_07080 44968 44069 gene locus_tag LOCUS_07090 gene htpX 44968 44069 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895736.1 protein_id gnl|my_center|LOCUS_07090 45530 44970 gene locus_tag LOCUS_07100 45530 44970 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219822.1 protein_id gnl|my_center|LOCUS_07100 46682 45681 gene locus_tag LOCUS_07110 46682 45681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 48111 47026 gene locus_tag LOCUS_07120 48111 47026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 48344 48111 gene locus_tag LOCUS_07130 48344 48111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 49107 48409 gene locus_tag LOCUS_07140 49107 48409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 50960 49347 gene locus_tag LOCUS_07150 50960 49347 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889732.1 protein_id gnl|my_center|LOCUS_07150 52708 50960 gene locus_tag LOCUS_07160 52708 50960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 54015 52744 gene locus_tag LOCUS_07170 54015 52744 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922229.1 protein_id gnl|my_center|LOCUS_07170 55612 54008 gene locus_tag LOCUS_07180 55612 54008 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_07180 55743 55612 gene locus_tag LOCUS_07190 55743 55612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 58680 55777 gene locus_tag LOCUS_07200 58680 55777 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922226.1 protein_id gnl|my_center|LOCUS_07200 59436 59221 gene locus_tag LOCUS_07210 59436 59221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07210 59636 59454 gene locus_tag LOCUS_07220 59636 59454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 59748 60374 gene locus_tag LOCUS_07230 59748 60374 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262713.1 protein_id gnl|my_center|LOCUS_07230 60630 61019 gene locus_tag LOCUS_07240 60630 61019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 61211 62158 gene locus_tag LOCUS_07250 61211 62158 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254339.1 protein_id gnl|my_center|LOCUS_07250 62273 62746 gene locus_tag LOCUS_07260 62273 62746 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922070.1 protein_id gnl|my_center|LOCUS_07260 62749 63387 gene locus_tag LOCUS_07270 62749 63387 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263325.1 protein_id gnl|my_center|LOCUS_07270 64713 63811 gene locus_tag LOCUS_07280 64713 63811 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633102.1 protein_id gnl|my_center|LOCUS_07280 65516 65037 gene locus_tag LOCUS_07290 65516 65037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 66072 65530 gene locus_tag LOCUS_07300 66072 65530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 66047 66295 gene locus_tag LOCUS_07310 66047 66295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 66804 66280 gene locus_tag LOCUS_07320 66804 66280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence10 511 8 gene locus_tag LOCUS_07330 511 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1512 508 gene locus_tag LOCUS_07340 gene trpD 1512 508 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262053.1 protein_id gnl|my_center|LOCUS_07340 2169 1603 gene locus_tag LOCUS_07350 2169 1603 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601926.1 protein_id gnl|my_center|LOCUS_07350 3521 2166 gene locus_tag LOCUS_07360 gene trpE 3521 2166 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262051.1 protein_id gnl|my_center|LOCUS_07360 3879 3598 gene locus_tag LOCUS_07370 3879 3598 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262050.1 protein_id gnl|my_center|LOCUS_07370 4806 4474 gene locus_tag LOCUS_07380 4806 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 7293 4906 gene locus_tag LOCUS_07390 7293 4906 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775561.1 protein_id gnl|my_center|LOCUS_07390 7921 7526 gene locus_tag LOCUS_07400 7921 7526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 8230 8529 gene locus_tag LOCUS_07410 8230 8529 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919734.1 protein_id gnl|my_center|LOCUS_07410 8977 8687 gene locus_tag LOCUS_07420 8977 8687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205008888.1 protein_id gnl|my_center|LOCUS_07420 9787 9083 gene locus_tag LOCUS_07430 9787 9083 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922644.1 protein_id gnl|my_center|LOCUS_07430 10577 9987 gene locus_tag LOCUS_07440 10577 9987 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014612583.1 protein_id gnl|my_center|LOCUS_07440 11163 10627 gene locus_tag LOCUS_07450 11163 10627 CDS product DUF536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014612584.1 protein_id gnl|my_center|LOCUS_07450 11668 12027 gene locus_tag LOCUS_07460 11668 12027 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206379.1 protein_id gnl|my_center|LOCUS_07460 13893 12175 gene locus_tag LOCUS_07470 gene ilvD 13893 12175 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937428.1 protein_id gnl|my_center|LOCUS_07470 14006 15187 gene locus_tag LOCUS_07480 14006 15187 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972544.1 protein_id gnl|my_center|LOCUS_07480 15363 15277 gene locus_tag LOCUS_t00180 15363 15277 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16064 15423 gene locus_tag LOCUS_07490 gene trmB 16064 15423 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983387.1 protein_id gnl|my_center|LOCUS_07490 16865 16074 gene locus_tag LOCUS_07500 16865 16074 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983385.1 protein_id gnl|my_center|LOCUS_07500 17960 16923 gene locus_tag LOCUS_07510 17960 16923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279713.1 protein_id gnl|my_center|LOCUS_07510 18688 17957 gene locus_tag LOCUS_07520 18688 17957 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262608.1 protein_id gnl|my_center|LOCUS_07520 18753 19172 gene locus_tag LOCUS_07530 18753 19172 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368097.1 protein_id gnl|my_center|LOCUS_07530 19169 19477 gene locus_tag LOCUS_07540 19169 19477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690175.1 protein_id gnl|my_center|LOCUS_07540 20250 20029 gene locus_tag LOCUS_07550 20250 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 20904 20269 gene locus_tag LOCUS_07560 20904 20269 CDS product DUF4230 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263503.1 protein_id gnl|my_center|LOCUS_07560 23553 21454 gene locus_tag LOCUS_07570 23553 21454 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063353.1 protein_id gnl|my_center|LOCUS_07570 25360 24269 gene locus_tag LOCUS_07580 25360 24269 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000156355.1 protein_id gnl|my_center|LOCUS_07580 26113 25367 gene locus_tag LOCUS_07590 26113 25367 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972581.1 protein_id gnl|my_center|LOCUS_07590 26785 26432 gene locus_tag LOCUS_07600 gene rsfS 26785 26432 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266441.1 protein_id gnl|my_center|LOCUS_07600 27399 26809 gene locus_tag LOCUS_07610 gene yqeK 27399 26809 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836603.1 protein_id gnl|my_center|LOCUS_07610 28028 27396 gene locus_tag LOCUS_07620 28028 27396 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162767.1 protein_id gnl|my_center|LOCUS_07620 28449 28132 gene locus_tag LOCUS_07630 gene yhbY 28449 28132 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991094.1 protein_id gnl|my_center|LOCUS_07630 29806 28688 gene locus_tag LOCUS_07640 gene yqeH 29806 28688 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991828.1 protein_id gnl|my_center|LOCUS_07640 30333 29806 gene locus_tag LOCUS_07650 30333 29806 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001879564.1 protein_id gnl|my_center|LOCUS_07650 31384 30470 gene locus_tag LOCUS_07660 31384 30470 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263499.1 protein_id gnl|my_center|LOCUS_07660 31799 31491 gene locus_tag LOCUS_07670 31799 31491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031996.1 protein_id gnl|my_center|LOCUS_07670 33384 31942 gene locus_tag LOCUS_07680 gene gatB 33384 31942 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008652.1 protein_id gnl|my_center|LOCUS_07680 34850 33384 gene locus_tag LOCUS_07690 gene gatA 34850 33384 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143702.1 protein_id gnl|my_center|LOCUS_07690 35152 34850 gene locus_tag LOCUS_07700 gene gatC 35152 34850 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000705421.1 protein_id gnl|my_center|LOCUS_07700 35546 35292 gene locus_tag LOCUS_07710 35546 35292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 35768 35559 gene locus_tag LOCUS_07720 35768 35559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07720 37412 36084 gene locus_tag LOCUS_07730 37412 36084 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836484.1 protein_id gnl|my_center|LOCUS_07730 38148 37678 gene locus_tag LOCUS_07740 gene msrA 38148 37678 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921964.1 protein_id gnl|my_center|LOCUS_07740 39047 38199 gene locus_tag LOCUS_07750 39047 38199 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694283.1 protein_id gnl|my_center|LOCUS_07750 39729 39172 gene locus_tag LOCUS_07760 39729 39172 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263473.1 protein_id gnl|my_center|LOCUS_07760 40577 39792 gene locus_tag LOCUS_07770 gene codY 40577 39792 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133183.1 protein_id gnl|my_center|LOCUS_07770 42050 40836 gene locus_tag LOCUS_07780 42050 40836 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263471.1 protein_id gnl|my_center|LOCUS_07780 42405 42857 gene locus_tag LOCUS_07790 42405 42857 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992571.1 protein_id gnl|my_center|LOCUS_07790 43853 43680 gene locus_tag LOCUS_07800 43853 43680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 44288 43914 gene locus_tag LOCUS_07810 44288 43914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 45300 44500 gene locus_tag LOCUS_07820 gene pflA 45300 44500 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921923.1 protein_id gnl|my_center|LOCUS_07820 45845 46018 gene locus_tag LOCUS_07830 45845 46018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 47627 46296 gene locus_tag LOCUS_07840 47627 46296 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262579.1 protein_id gnl|my_center|LOCUS_07840 47739 48521 gene locus_tag LOCUS_07850 47739 48521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262577.1 protein_id gnl|my_center|LOCUS_07850 51209 49143 gene locus_tag LOCUS_07860 51209 49143 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421637.1 protein_id gnl|my_center|LOCUS_07860 51460 51218 gene locus_tag LOCUS_07870 51460 51218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 52005 51457 gene locus_tag LOCUS_07880 52005 51457 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921921.1 protein_id gnl|my_center|LOCUS_07880 52946 52002 gene locus_tag LOCUS_07890 52946 52002 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747784.1 protein_id gnl|my_center|LOCUS_07890 54068 53031 gene locus_tag LOCUS_07900 gene sepM 54068 53031 CDS product S16 family serine protease SepM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262039.1 protein_id gnl|my_center|LOCUS_07900 54582 54085 gene locus_tag LOCUS_07910 gene coaD 54582 54085 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161892.1 protein_id gnl|my_center|LOCUS_07910 55155 54616 gene locus_tag LOCUS_07920 gene rsmD 55155 54616 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266829.1 protein_id gnl|my_center|LOCUS_07920 56226 55306 gene locus_tag LOCUS_07930 gene trxB 56226 55306 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262096.1 protein_id gnl|my_center|LOCUS_07930 56516 56292 gene locus_tag LOCUS_07940 56516 56292 CDS product DUF4059 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478229.1 protein_id gnl|my_center|LOCUS_07940 57474 56731 gene locus_tag LOCUS_07950 57474 56731 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262094.1 protein_id gnl|my_center|LOCUS_07950 58397 57474 gene locus_tag LOCUS_07960 58397 57474 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071299.1 protein_id gnl|my_center|LOCUS_07960 59438 58608 gene locus_tag LOCUS_07970 59438 58608 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473468.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence11 <1 710 gene locus_tag LOCUS_07980 <1 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262556.1:glutamate racemase 703 1677 gene locus_tag LOCUS_07990 703 1677 CDS product nucleoside-triphosphate diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167813.1 protein_id gnl|my_center|LOCUS_07990 1659 2180 gene locus_tag LOCUS_08000 1659 2180 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007722.1 protein_id gnl|my_center|LOCUS_08000 2177 2659 gene locus_tag LOCUS_08010 2177 2659 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985900.1 protein_id gnl|my_center|LOCUS_08010 2601 3374 gene locus_tag LOCUS_08020 gene xerD 2601 3374 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001178439.1 protein_id gnl|my_center|LOCUS_08020 3374 4087 gene locus_tag LOCUS_08030 3374 4087 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262561.1 protein_id gnl|my_center|LOCUS_08030 4080 4661 gene locus_tag LOCUS_08040 gene scpB 4080 4661 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262562.1 protein_id gnl|my_center|LOCUS_08040 4712 5479 gene locus_tag LOCUS_08050 4712 5479 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222207.1 protein_id gnl|my_center|LOCUS_08050 7189 5750 gene locus_tag LOCUS_08060 7189 5750 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043409.1 protein_id gnl|my_center|LOCUS_08060 8545 7196 gene locus_tag LOCUS_08070 gene trkA 8545 7196 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262566.1 protein_id gnl|my_center|LOCUS_08070 8834 9343 gene locus_tag LOCUS_08080 8834 9343 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002939238.1 protein_id gnl|my_center|LOCUS_08080 9655 10212 gene locus_tag LOCUS_08090 9655 10212 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185837.1 protein_id gnl|my_center|LOCUS_08090 10215 10865 gene locus_tag LOCUS_08100 10215 10865 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985882.1 protein_id gnl|my_center|LOCUS_08100 11060 11959 gene locus_tag LOCUS_08110 11060 11959 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262469.1 protein_id gnl|my_center|LOCUS_08110 12134 12358 gene locus_tag LOCUS_08120 12134 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08120 12389 12628 gene locus_tag LOCUS_08130 12389 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08130 12643 13053 gene locus_tag LOCUS_08140 12643 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08140 13135 13323 gene locus_tag LOCUS_08150 13135 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08150 13411 13605 gene locus_tag LOCUS_08160 13411 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 13627 13830 gene locus_tag LOCUS_08170 13627 13830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08170 13809 14228 gene locus_tag LOCUS_08180 13809 14228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08180 14459 14647 gene locus_tag LOCUS_08190 14459 14647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 14899 14615 gene locus_tag LOCUS_08200 14899 14615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08200 15442 15140 gene locus_tag LOCUS_08210 15442 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 16034 15666 gene locus_tag LOCUS_08220 16034 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 16442 16957 gene locus_tag LOCUS_08230 gene ureI 16442 16957 CDS product acid-activated urea channel protein UreI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901247.1 protein_id gnl|my_center|LOCUS_08230 16982 17284 gene locus_tag LOCUS_08240 16982 17284 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525618.1 protein_id gnl|my_center|LOCUS_08240 17296 17607 gene locus_tag LOCUS_08250 17296 17607 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066609.1 protein_id gnl|my_center|LOCUS_08250 17623 19341 gene locus_tag LOCUS_08260 gene ureC 17623 19341 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206084.1 protein_id gnl|my_center|LOCUS_08260 19482 19934 gene locus_tag LOCUS_08270 gene ureE 19482 19934 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832382.1 protein_id gnl|my_center|LOCUS_08270 19924 20637 gene locus_tag LOCUS_08280 19924 20637 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565254.1 protein_id gnl|my_center|LOCUS_08280 20667 21281 gene locus_tag LOCUS_08290 gene ureG 20667 21281 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857703.1 protein_id gnl|my_center|LOCUS_08290 21283 22122 gene locus_tag LOCUS_08300 21283 22122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 22126 23103 gene locus_tag LOCUS_08310 gene cbiM 22126 23103 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641709.1 protein_id gnl|my_center|LOCUS_08310 23349 23879 gene locus_tag LOCUS_08320 23349 23879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 23881 24594 gene locus_tag LOCUS_08330 23881 24594 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964091.1 protein_id gnl|my_center|LOCUS_08330 24759 25607 gene locus_tag LOCUS_08340 24759 25607 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880638.1 protein_id gnl|my_center|LOCUS_08340 25767 26669 gene locus_tag LOCUS_08350 25767 26669 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262137.1 protein_id gnl|my_center|LOCUS_08350 26731 27213 gene locus_tag LOCUS_08360 26731 27213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08360 27271 27636 gene locus_tag LOCUS_08370 27271 27636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08370 27733 28104 gene locus_tag LOCUS_08380 27733 28104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08380 28097 29164 gene locus_tag LOCUS_08390 28097 29164 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985970.1 protein_id gnl|my_center|LOCUS_08390 29164 29856 gene locus_tag LOCUS_08400 29164 29856 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898357.1 protein_id gnl|my_center|LOCUS_08400 29979 31187 gene locus_tag LOCUS_08410 gene sstT 29979 31187 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819596.1 protein_id gnl|my_center|LOCUS_08410 31340 32188 gene locus_tag LOCUS_08420 31340 32188 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262132.1 protein_id gnl|my_center|LOCUS_08420 32198 32743 gene locus_tag LOCUS_08430 32198 32743 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262131.1 protein_id gnl|my_center|LOCUS_08430 32809 34485 gene locus_tag LOCUS_08440 32809 34485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262130.1 protein_id gnl|my_center|LOCUS_08440 34478 35308 gene locus_tag LOCUS_08450 34478 35308 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262129.1 protein_id gnl|my_center|LOCUS_08450 35518 37494 gene locus_tag LOCUS_08460 gene tkt 35518 37494 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837536.1 protein_id gnl|my_center|LOCUS_08460 37544 37807 gene locus_tag LOCUS_08470 37544 37807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 38414 37743 gene locus_tag LOCUS_08480 38414 37743 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850144.1 protein_id gnl|my_center|LOCUS_08480 39818 38454 gene locus_tag LOCUS_08490 gene ktrB 39818 38454 CDS product potassium uptake transporter channel subunit KtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032459855.1 protein_id gnl|my_center|LOCUS_08490 40601 39888 gene locus_tag LOCUS_08500 gene rsmG 40601 39888 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921904.1 protein_id gnl|my_center|LOCUS_08500 40898 41434 gene locus_tag LOCUS_08510 40898 41434 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900960.1 protein_id gnl|my_center|LOCUS_08510 41590 42279 gene locus_tag LOCUS_08520 41590 42279 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516681.1 protein_id gnl|my_center|LOCUS_08520 42276 43793 gene locus_tag LOCUS_08530 gene covS 42276 43793 CDS product two-component system sensor histidine kinase CovS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991036.1 protein_id gnl|my_center|LOCUS_08530 43915 44394 gene locus_tag LOCUS_08540 gene nrdR 43915 44394 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985941.1 protein_id gnl|my_center|LOCUS_08540 44391 45566 gene locus_tag LOCUS_08550 44391 45566 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262119.1 protein_id gnl|my_center|LOCUS_08550 45570 46472 gene locus_tag LOCUS_08560 gene dnaI 45570 46472 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991016.1 protein_id gnl|my_center|LOCUS_08560 46578 47888 gene locus_tag LOCUS_08570 gene der 46578 47888 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244022.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence12 1796 900 gene locus_tag LOCUS_08580 1796 900 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667475.1 protein_id gnl|my_center|LOCUS_08580 2629 1793 gene locus_tag LOCUS_08590 2629 1793 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002993124.1 protein_id gnl|my_center|LOCUS_08590 3275 2601 gene locus_tag LOCUS_08600 3275 2601 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061344.1 protein_id gnl|my_center|LOCUS_08600 3371 3946 gene locus_tag LOCUS_08610 3371 3946 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000149079.1 protein_id gnl|my_center|LOCUS_08610 4309 5280 gene locus_tag LOCUS_08620 4309 5280 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840698.1 protein_id gnl|my_center|LOCUS_08620 5284 6396 gene locus_tag LOCUS_08630 5284 6396 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000639605.1 protein_id gnl|my_center|LOCUS_08630 6398 6745 gene locus_tag LOCUS_08640 6398 6745 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262287.1 protein_id gnl|my_center|LOCUS_08640 6889 7548 gene locus_tag LOCUS_08650 6889 7548 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262286.1 protein_id gnl|my_center|LOCUS_08650 7541 8236 gene locus_tag LOCUS_08660 7541 8236 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262285.1 protein_id gnl|my_center|LOCUS_08660 8975 8289 gene locus_tag LOCUS_08670 gene radC 8975 8289 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000274751.1 protein_id gnl|my_center|LOCUS_08670 10632 9154 gene locus_tag LOCUS_08680 10632 9154 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905205.1 protein_id gnl|my_center|LOCUS_08680 12388 10643 gene locus_tag LOCUS_08690 gene rgpF 12388 10643 CDS product rhamnose-glucose polysaccharide assembly protein RgpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261980.1 protein_id gnl|my_center|LOCUS_08690 14057 12390 gene locus_tag LOCUS_08700 14057 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 15310 14108 gene locus_tag LOCUS_08710 15310 14108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261978.1 protein_id gnl|my_center|LOCUS_08710 16116 15310 gene locus_tag LOCUS_08720 16116 15310 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985178.1 protein_id gnl|my_center|LOCUS_08720 17057 16116 gene locus_tag LOCUS_08730 17057 16116 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837185.1 protein_id gnl|my_center|LOCUS_08730 18202 17054 gene locus_tag LOCUS_08740 18202 17054 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837186.1 protein_id gnl|my_center|LOCUS_08740 19097 18321 gene locus_tag LOCUS_08750 19097 18321 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_08750 19443 19087 gene locus_tag LOCUS_08760 19443 19087 CDS product DUF2304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002916999.1 protein_id gnl|my_center|LOCUS_08760 20159 19443 gene locus_tag LOCUS_08770 20159 19443 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899987.1 protein_id gnl|my_center|LOCUS_08770 21128 20160 gene locus_tag LOCUS_08780 21128 20160 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837191.1 protein_id gnl|my_center|LOCUS_08780 22122 21139 gene locus_tag LOCUS_08790 22122 21139 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837192.1 protein_id gnl|my_center|LOCUS_08790 23378 22119 gene locus_tag LOCUS_08800 23378 22119 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895005.1 protein_id gnl|my_center|LOCUS_08800 24350 23499 gene locus_tag LOCUS_08810 gene rfbD 24350 23499 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600899.1 protein_id gnl|my_center|LOCUS_08810 25394 24468 gene locus_tag LOCUS_08820 25394 24468 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261983.1 protein_id gnl|my_center|LOCUS_08820 25769 25404 gene locus_tag LOCUS_08830 25769 25404 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005640.1 protein_id gnl|my_center|LOCUS_08830 26902 25793 gene locus_tag LOCUS_08840 gene rpoD 26902 25793 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818341.1 protein_id gnl|my_center|LOCUS_08840 28717 26906 gene locus_tag LOCUS_08850 gene dnaG 28717 26906 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074552.1 protein_id gnl|my_center|LOCUS_08850 29264 29088 gene locus_tag LOCUS_08860 29264 29088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 30253 29459 gene locus_tag LOCUS_08870 30253 29459 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261968.1 protein_id gnl|my_center|LOCUS_08870 31424 30315 gene locus_tag LOCUS_08880 31424 30315 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027527.1 protein_id gnl|my_center|LOCUS_08880 32568 31771 gene locus_tag LOCUS_08890 32568 31771 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261966.1 protein_id gnl|my_center|LOCUS_08890 33395 32565 gene locus_tag LOCUS_08900 33395 32565 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261966.1 protein_id gnl|my_center|LOCUS_08900 34073 33609 gene locus_tag LOCUS_08910 34073 33609 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261965.1 protein_id gnl|my_center|LOCUS_08910 36109 34118 gene locus_tag LOCUS_08920 gene uvrB 36109 34118 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261961.1 protein_id gnl|my_center|LOCUS_08920 37064 36876 gene locus_tag LOCUS_08930 37064 36876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08930 37733 37452 gene locus_tag LOCUS_08940 37733 37452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 37932 40142 gene locus_tag LOCUS_08950 37932 40142 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681005.1 protein_id gnl|my_center|LOCUS_08950 40142 40882 gene locus_tag LOCUS_08960 40142 40882 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818887.1 protein_id gnl|my_center|LOCUS_08960 41151 40954 gene locus_tag LOCUS_08970 41151 40954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984154.1 protein_id gnl|my_center|LOCUS_08970 42631 41318 gene locus_tag LOCUS_08980 gene obgE 42631 41318 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000061665.1 protein_id gnl|my_center|LOCUS_08980 43666 42935 gene locus_tag LOCUS_08990 43666 42935 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028519.1 protein_id gnl|my_center|LOCUS_08990 43900 43667 gene locus_tag LOCUS_09000 43900 43667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 44481 44038 gene locus_tag LOCUS_09010 44481 44038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence13 2524 110 gene locus_tag LOCUS_09020 2524 110 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921961.1 protein_id gnl|my_center|LOCUS_09020 3675 2677 gene locus_tag LOCUS_09030 3675 2677 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262017.1 protein_id gnl|my_center|LOCUS_09030 4396 3677 gene locus_tag LOCUS_09040 gene trmD 4396 3677 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262016.1 protein_id gnl|my_center|LOCUS_09040 4904 4386 gene locus_tag LOCUS_09050 gene rimM 4904 4386 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922346.1 protein_id gnl|my_center|LOCUS_09050 5192 5119 gene locus_tag LOCUS_t00190 5192 5119 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5293 5220 gene locus_tag LOCUS_t00200 5293 5220 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6220 5576 gene locus_tag LOCUS_09060 6220 5576 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263036.1 protein_id gnl|my_center|LOCUS_09060 7220 6210 gene locus_tag LOCUS_09070 7220 6210 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263037.1 protein_id gnl|my_center|LOCUS_09070 7915 7217 gene locus_tag LOCUS_09080 gene liaF 7915 7217 CDS product cell wall-active antibiotics response protein LiaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714456.1 protein_id gnl|my_center|LOCUS_09080 10846 8975 gene locus_tag LOCUS_09090 gene pknB 10846 8975 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263039.1 protein_id gnl|my_center|LOCUS_09090 11583 10846 gene locus_tag LOCUS_09100 11583 10846 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406233.1 protein_id gnl|my_center|LOCUS_09100 12955 11627 gene locus_tag LOCUS_09110 gene rsmB 12955 11627 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922539.1 protein_id gnl|my_center|LOCUS_09110 13874 12939 gene locus_tag LOCUS_09120 gene fmt 13874 12939 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163893.1 protein_id gnl|my_center|LOCUS_09120 16288 13892 gene locus_tag LOCUS_09130 16288 13892 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101528.1 protein_id gnl|my_center|LOCUS_09130 16744 16430 gene locus_tag LOCUS_09140 gene rpoZ 16744 16430 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983650.1 protein_id gnl|my_center|LOCUS_09140 17395 16766 gene locus_tag LOCUS_09150 gene gmk 17395 16766 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003861.1 protein_id gnl|my_center|LOCUS_09150 19019 17628 gene locus_tag LOCUS_09160 gene ftsY 19019 17628 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522267.1 protein_id gnl|my_center|LOCUS_09160 19848 19033 gene locus_tag LOCUS_09170 19848 19033 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263635.1 protein_id gnl|my_center|LOCUS_09170 20635 19841 gene locus_tag LOCUS_09180 20635 19841 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352239.1 protein_id gnl|my_center|LOCUS_09180 20820 21197 gene locus_tag LOCUS_09190 gene stsR 20820 21197 CDS product GntR family transcriptional regulator StsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262158.1 protein_id gnl|my_center|LOCUS_09190 21202 21900 gene locus_tag LOCUS_09200 21202 21900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984437.1 protein_id gnl|my_center|LOCUS_09200 21912 22697 gene locus_tag LOCUS_09210 21912 22697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922087.1 protein_id gnl|my_center|LOCUS_09210 22989 22747 gene locus_tag LOCUS_09220 22989 22747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09220 23676 23002 gene locus_tag LOCUS_09230 23676 23002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09230 24754 23669 gene locus_tag LOCUS_09240 24754 23669 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159554.1 protein_id gnl|my_center|LOCUS_09240 25690 24764 gene locus_tag LOCUS_09250 25690 24764 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_09250 27183 25690 gene locus_tag LOCUS_09260 27183 25690 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000759901.1 protein_id gnl|my_center|LOCUS_09260 29212 27245 gene locus_tag LOCUS_09270 29212 27245 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000749702.1 protein_id gnl|my_center|LOCUS_09270 30033 29512 gene locus_tag LOCUS_09280 30033 29512 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 protein_id gnl|my_center|LOCUS_09280 30358 30062 gene locus_tag LOCUS_09290 30358 30062 CDS product DUF4298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052251.1 protein_id gnl|my_center|LOCUS_09290 31065 31424 gene locus_tag LOCUS_09300 31065 31424 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592531.1 protein_id gnl|my_center|LOCUS_09300 31421 33538 gene locus_tag LOCUS_09310 31421 33538 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989665.1 protein_id gnl|my_center|LOCUS_09310 34730 33945 gene locus_tag LOCUS_09320 34730 33945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 34930 34664 gene locus_tag LOCUS_09330 34930 34664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 36181 34961 gene locus_tag LOCUS_09340 36181 34961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 37769 36174 gene locus_tag LOCUS_09350 37769 36174 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819001.1 protein_id gnl|my_center|LOCUS_09350 40846 37769 gene locus_tag LOCUS_09360 40846 37769 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287735.1 protein_id gnl|my_center|LOCUS_09360 41168 40857 gene locus_tag LOCUS_09370 41168 40857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 41294 41482 gene locus_tag LOCUS_09380 41294 41482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence14 674 126 gene locus_tag LOCUS_09390 gene raiA 674 126 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988974.1 protein_id gnl|my_center|LOCUS_09390 1415 753 gene locus_tag LOCUS_09400 1415 753 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649962.1 protein_id gnl|my_center|LOCUS_09400 2715 1396 gene locus_tag LOCUS_09410 2715 1396 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432961.1 protein_id gnl|my_center|LOCUS_09410 2770 3396 gene locus_tag LOCUS_09420 2770 3396 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001108147.1 protein_id gnl|my_center|LOCUS_09420 3498 4424 gene locus_tag LOCUS_09430 gene cysK 3498 4424 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774985.1 protein_id gnl|my_center|LOCUS_09430 4869 4591 gene locus_tag LOCUS_09440 4869 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09440 5233 4814 gene locus_tag LOCUS_09450 5233 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09450 6097 5387 gene locus_tag LOCUS_09460 6097 5387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027478.1 protein_id gnl|my_center|LOCUS_09460 6861 6097 gene locus_tag LOCUS_09470 6861 6097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_09470 7814 6864 gene locus_tag LOCUS_09480 7814 6864 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262677.1 protein_id gnl|my_center|LOCUS_09480 8702 7818 gene locus_tag LOCUS_09490 8702 7818 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897070.1 protein_id gnl|my_center|LOCUS_09490 9921 8746 gene locus_tag LOCUS_09500 9921 8746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262675.1 protein_id gnl|my_center|LOCUS_09500 10359 10078 gene locus_tag LOCUS_09510 10359 10078 CDS product YlbG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262674.1 protein_id gnl|my_center|LOCUS_09510 10801 10352 gene locus_tag LOCUS_09520 10801 10352 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262673.1 protein_id gnl|my_center|LOCUS_09520 11478 10888 gene locus_tag LOCUS_09530 gene clpP 11478 10888 CDS product ATP-dependent Clp protease proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000613477.1 protein_id gnl|my_center|LOCUS_09530 12245 11616 gene locus_tag LOCUS_09540 gene upp 12245 11616 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262598.1 protein_id gnl|my_center|LOCUS_09540 12650 12375 gene locus_tag LOCUS_09550 12650 12375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 12858 12691 gene locus_tag LOCUS_09560 12858 12691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 14097 12934 gene locus_tag LOCUS_09570 14097 12934 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352351.1 protein_id gnl|my_center|LOCUS_09570 15202 14108 gene locus_tag LOCUS_09580 15202 14108 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262596.1 protein_id gnl|my_center|LOCUS_09580 16058 15609 gene locus_tag LOCUS_09590 16058 15609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09590 17716 16142 gene locus_tag LOCUS_09600 17716 16142 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264036.1 protein_id gnl|my_center|LOCUS_09600 17868 19313 gene locus_tag LOCUS_09610 17868 19313 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922188.1 protein_id gnl|my_center|LOCUS_09610 20617 19382 gene locus_tag LOCUS_09620 gene fmhC 20617 19382 CDS product FemA/FemB family glycyltransferase FmhC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672869.1 protein_id gnl|my_center|LOCUS_09620 21216 21016 gene locus_tag LOCUS_09630 21216 21016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09630 21471 21298 gene locus_tag LOCUS_09640 21471 21298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09640 21889 21536 gene locus_tag LOCUS_09650 gene rbfA 21889 21536 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893555.1 protein_id gnl|my_center|LOCUS_09650 24814 21983 gene locus_tag LOCUS_09660 gene infB 24814 21983 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262600.1 protein_id gnl|my_center|LOCUS_09660 25135 24833 gene locus_tag LOCUS_09670 25135 24833 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262601.1 protein_id gnl|my_center|LOCUS_09670 25424 25128 gene locus_tag LOCUS_09680 25424 25128 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263922.1 protein_id gnl|my_center|LOCUS_09680 26620 25445 gene locus_tag LOCUS_09690 gene nusA 26620 25445 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380478.1 protein_id gnl|my_center|LOCUS_09690 27171 26698 gene locus_tag LOCUS_09700 gene rimP 27171 26698 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041971671.1 protein_id gnl|my_center|LOCUS_09700 28538 27312 gene locus_tag LOCUS_09710 28538 27312 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708156.1 protein_id gnl|my_center|LOCUS_09710 29068 28547 gene locus_tag LOCUS_09720 29068 28547 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455529.1 protein_id gnl|my_center|LOCUS_09720 29504 29061 gene locus_tag LOCUS_09730 gene tsaE 29504 29061 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000964341.1 protein_id gnl|my_center|LOCUS_09730 31197 29776 gene locus_tag LOCUS_09740 31197 29776 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410400.1 protein_id gnl|my_center|LOCUS_09740 31406 32218 gene locus_tag LOCUS_09750 31406 32218 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922586.1 protein_id gnl|my_center|LOCUS_09750 32994 32263 gene locus_tag LOCUS_09760 32994 32263 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837198.1 protein_id gnl|my_center|LOCUS_09760 33370 34362 gene locus_tag LOCUS_09770 33370 34362 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922587.1 protein_id gnl|my_center|LOCUS_09770 34430 35257 gene locus_tag LOCUS_09780 34430 35257 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280328.1 protein_id gnl|my_center|LOCUS_09780 35272 36183 gene locus_tag LOCUS_09790 35272 36183 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136858.1 protein_id gnl|my_center|LOCUS_09790 36262 36636 gene locus_tag LOCUS_09800 36262 36636 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027688.1 protein_id gnl|my_center|LOCUS_09800 36845 38122 gene locus_tag LOCUS_09810 gene serS 36845 38122 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263348.1 protein_id gnl|my_center|LOCUS_09810 38485 38718 gene locus_tag LOCUS_09820 38485 38718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence15 97 1704 gene locus_tag LOCUS_09830 97 1704 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988954.1 protein_id gnl|my_center|LOCUS_09830 2455 2033 gene locus_tag LOCUS_09840 2455 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09840 3131 3877 gene locus_tag LOCUS_09850 3131 3877 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902853.1 protein_id gnl|my_center|LOCUS_09850 3874 4785 gene locus_tag LOCUS_09860 gene pfkB 3874 4785 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262019.1 protein_id gnl|my_center|LOCUS_09860 4815 5357 gene locus_tag LOCUS_09870 4815 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09870 5350 6450 gene locus_tag LOCUS_09880 5350 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09880 6443 6766 gene locus_tag LOCUS_09890 6443 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09890 6916 8268 gene locus_tag LOCUS_09900 gene gorA 6916 8268 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261988.1 protein_id gnl|my_center|LOCUS_09900 8603 8370 gene locus_tag LOCUS_09910 8603 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09910 9626 8784 gene locus_tag LOCUS_09920 9626 8784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09920 10214 9672 gene locus_tag LOCUS_09930 10214 9672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 10323 11468 gene locus_tag LOCUS_09940 10323 11468 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638895.1 protein_id gnl|my_center|LOCUS_09940 11523 12746 gene locus_tag LOCUS_09950 gene thiI 11523 12746 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200061.1 protein_id gnl|my_center|LOCUS_09950 12852 14363 gene locus_tag LOCUS_09960 gene gtfA 12852 14363 CDS product accessory Sec system glycosyltransferase GtfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219532.1 protein_id gnl|my_center|LOCUS_09960 14356 15675 gene locus_tag LOCUS_09970 gene gtfB 14356 15675 CDS product accessory Sec system glycosylation chaperone GtfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609042.1 protein_id gnl|my_center|LOCUS_09970 15988 16215 gene locus_tag LOCUS_09980 15988 16215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 16445 16759 gene locus_tag LOCUS_09990 gene rplU 16445 16759 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985116.1 protein_id gnl|my_center|LOCUS_09990 16796 17086 gene locus_tag LOCUS_10000 gene rpmA 16796 17086 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000916509.1 protein_id gnl|my_center|LOCUS_10000 17145 17840 gene locus_tag LOCUS_10010 17145 17840 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261999.1 protein_id gnl|my_center|LOCUS_10010 18041 18415 gene locus_tag LOCUS_10020 18041 18415 CDS product DUF1149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000452063.1 protein_id gnl|my_center|LOCUS_10020 18417 19259 gene locus_tag LOCUS_10030 18417 19259 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922161.1 protein_id gnl|my_center|LOCUS_10030 19320 20087 gene locus_tag LOCUS_10040 gene dapB 19320 20087 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262893.1 protein_id gnl|my_center|LOCUS_10040 20084 21292 gene locus_tag LOCUS_10050 20084 21292 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262894.1 protein_id gnl|my_center|LOCUS_10050 21370 23250 gene locus_tag LOCUS_10060 21370 23250 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262895.1 protein_id gnl|my_center|LOCUS_10060 23835 23332 gene locus_tag LOCUS_10070 23835 23332 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870956.1 protein_id gnl|my_center|LOCUS_10070 24664 23912 gene locus_tag LOCUS_10080 24664 23912 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140989.1 protein_id gnl|my_center|LOCUS_10080 25834 24728 gene locus_tag LOCUS_10090 25834 24728 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837610.1 protein_id gnl|my_center|LOCUS_10090 26178 27530 gene locus_tag LOCUS_10100 gene gdhA 26178 27530 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263849.1 protein_id gnl|my_center|LOCUS_10100 27789 28199 gene locus_tag LOCUS_10110 27789 28199 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836525.1 protein_id gnl|my_center|LOCUS_10110 28390 28833 gene locus_tag LOCUS_10120 28390 28833 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263292.1 protein_id gnl|my_center|LOCUS_10120 28837 30651 gene locus_tag LOCUS_10130 28837 30651 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263293.1 protein_id gnl|my_center|LOCUS_10130 30641 32419 gene locus_tag LOCUS_10140 30641 32419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263294.1 protein_id gnl|my_center|LOCUS_10140 32575 32946 gene locus_tag LOCUS_10150 32575 32946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 33332 33817 gene locus_tag LOCUS_10160 33332 33817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10160 33834 34037 gene locus_tag LOCUS_10170 33834 34037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10170 34369 35106 gene locus_tag LOCUS_10180 gene pyrH 34369 35106 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433491.1 protein_id gnl|my_center|LOCUS_10180 35121 35678 gene locus_tag LOCUS_10190 gene frr 35121 35678 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985763.1 protein_id gnl|my_center|LOCUS_10190 35727 36626 gene locus_tag LOCUS_10200 gene cvfB 35727 36626 CDS product RNA-binding virulence regulatory protein CvfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094275.1 protein_id gnl|my_center|LOCUS_10200 36635 36850 gene locus_tag LOCUS_10210 36635 36850 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985757.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence16 689 276 gene locus_tag LOCUS_10220 689 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10220 1216 851 gene locus_tag LOCUS_10230 1216 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10230 3212 1266 gene locus_tag LOCUS_10240 gene thrS 3212 1266 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608336.1 protein_id gnl|my_center|LOCUS_10240 5246 3924 gene locus_tag LOCUS_10250 5246 3924 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904960.1 protein_id gnl|my_center|LOCUS_10250 6251 5247 gene locus_tag LOCUS_10260 6251 5247 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027312.1 protein_id gnl|my_center|LOCUS_10260 6666 6376 gene locus_tag LOCUS_10270 6666 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 6837 6667 gene locus_tag LOCUS_10280 6837 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 7267 6797 gene locus_tag LOCUS_10290 7267 6797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 7690 7538 gene locus_tag LOCUS_10300 7690 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 8878 8186 gene locus_tag LOCUS_10310 8878 8186 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689757.1 protein_id gnl|my_center|LOCUS_10310 9206 8946 gene locus_tag LOCUS_10320 gene macP 9206 8946 CDS product cell wall synthase accessory phosphoprotein MacP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517852.1 protein_id gnl|my_center|LOCUS_10320 9758 9210 gene locus_tag LOCUS_10330 9758 9210 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263613.1 protein_id gnl|my_center|LOCUS_10330 11216 9834 gene locus_tag LOCUS_10340 gene glmU 11216 9834 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073770.1 protein_id gnl|my_center|LOCUS_10340 12772 11765 gene locus_tag LOCUS_10350 gene fni 12772 11765 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922169.1 protein_id gnl|my_center|LOCUS_10350 13817 12822 gene locus_tag LOCUS_10360 13817 12822 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836443.1 protein_id gnl|my_center|LOCUS_10360 14754 13810 gene locus_tag LOCUS_10370 gene mvaD 14754 13810 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836442.1 protein_id gnl|my_center|LOCUS_10370 15614 14736 gene locus_tag LOCUS_10380 gene mvk 15614 14736 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163300.1 protein_id gnl|my_center|LOCUS_10380 15877 16440 gene locus_tag LOCUS_10390 15877 16440 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161851.1 protein_id gnl|my_center|LOCUS_10390 17975 16659 gene locus_tag LOCUS_10400 17975 16659 CDS product FAD-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836731.1 protein_id gnl|my_center|LOCUS_10400 18970 18632 gene locus_tag LOCUS_10410 18970 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 19082 18945 gene locus_tag LOCUS_10420 19082 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 20660 19515 gene locus_tag LOCUS_10430 20660 19515 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263589.1 protein_id gnl|my_center|LOCUS_10430 21615 20896 gene locus_tag LOCUS_10440 21615 20896 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261903.1 protein_id gnl|my_center|LOCUS_10440 22378 21695 gene locus_tag LOCUS_10450 22378 21695 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000005264.1 protein_id gnl|my_center|LOCUS_10450 23239 22469 gene locus_tag LOCUS_10460 23239 22469 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_10460 23812 23318 gene locus_tag LOCUS_10470 23812 23318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 24044 23826 gene locus_tag LOCUS_10480 24044 23826 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001843884.1 protein_id gnl|my_center|LOCUS_10480 25185 24202 gene locus_tag LOCUS_10490 25185 24202 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030024.1 protein_id gnl|my_center|LOCUS_10490 26096 25374 gene locus_tag LOCUS_10500 26096 25374 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010819358.1 protein_id gnl|my_center|LOCUS_10500 27045 26098 gene locus_tag LOCUS_10510 27045 26098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379390.1 protein_id gnl|my_center|LOCUS_10510 27218 27006 gene locus_tag LOCUS_10520 27218 27006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10520 28138 27215 gene locus_tag LOCUS_10530 28138 27215 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379387.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10530 28471 29181 gene locus_tag LOCUS_10540 28471 29181 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399975.1 protein_id gnl|my_center|LOCUS_10540 29181 30476 gene locus_tag LOCUS_10550 29181 30476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 31373 30642 gene locus_tag LOCUS_10560 31373 30642 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263956.1 protein_id gnl|my_center|LOCUS_10560 31493 32536 gene locus_tag LOCUS_10570 gene queA 31493 32536 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095273.1 protein_id gnl|my_center|LOCUS_10570 34421 32634 gene locus_tag LOCUS_10580 34421 32634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836926.1 protein_id gnl|my_center|LOCUS_10580 36170 34434 gene locus_tag LOCUS_10590 36170 34434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836925.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence17 2050 50 gene locus_tag LOCUS_10600 2050 50 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000489404.1 protein_id gnl|my_center|LOCUS_10600 2810 2052 gene locus_tag LOCUS_10610 2810 2052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173372.1 protein_id gnl|my_center|LOCUS_10610 3926 2955 gene locus_tag LOCUS_10620 3926 2955 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887954.1 protein_id gnl|my_center|LOCUS_10620 4599 3919 gene locus_tag LOCUS_10630 4599 3919 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000548991.1 protein_id gnl|my_center|LOCUS_10630 5151 5621 gene locus_tag LOCUS_10640 5151 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10640 5700 6152 gene locus_tag LOCUS_10650 5700 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10650 6174 6878 gene locus_tag LOCUS_10660 6174 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10660 7006 8355 gene locus_tag LOCUS_10670 7006 8355 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836944.1 protein_id gnl|my_center|LOCUS_10670 9670 8720 gene locus_tag LOCUS_10680 gene msrB 9670 8720 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998594.1 protein_id gnl|my_center|LOCUS_10680 11135 9807 gene locus_tag LOCUS_10690 gene brnQ 11135 9807 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836927.1 protein_id gnl|my_center|LOCUS_10690 11801 11349 gene locus_tag LOCUS_10700 11801 11349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10700 12036 11710 gene locus_tag LOCUS_10710 12036 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10710 12193 12387 gene locus_tag LOCUS_10720 12193 12387 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262704.1 protein_id gnl|my_center|LOCUS_10720 14643 13258 gene locus_tag LOCUS_10730 14643 13258 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020328.1 protein_id gnl|my_center|LOCUS_10730 15671 15069 gene locus_tag LOCUS_10740 15671 15069 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775695.1 protein_id gnl|my_center|LOCUS_10740 16629 15850 gene locus_tag LOCUS_10750 16629 15850 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109290238.1 protein_id gnl|my_center|LOCUS_10750 17245 16796 gene locus_tag LOCUS_10760 17245 16796 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166793.1 protein_id gnl|my_center|LOCUS_10760 18290 17427 gene locus_tag LOCUS_10770 18290 17427 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476036.1 protein_id gnl|my_center|LOCUS_10770 19569 18277 gene locus_tag LOCUS_10780 19569 18277 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476037.1 protein_id gnl|my_center|LOCUS_10780 20390 19758 gene locus_tag LOCUS_10790 20390 19758 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358386.1 protein_id gnl|my_center|LOCUS_10790 20875 20483 gene locus_tag LOCUS_10800 20875 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10800 22077 21235 gene locus_tag LOCUS_10810 22077 21235 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451355.1 protein_id gnl|my_center|LOCUS_10810 23166 22210 gene locus_tag LOCUS_10820 gene galE 23166 22210 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262881.1 protein_id gnl|my_center|LOCUS_10820 23547 25031 gene locus_tag LOCUS_10830 23547 25031 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000743599.1 protein_id gnl|my_center|LOCUS_10830 25595 25251 gene locus_tag LOCUS_10840 25595 25251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 26553 26341 gene locus_tag LOCUS_10850 26553 26341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10850 26994 26632 gene locus_tag LOCUS_10860 26994 26632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10860 27324 27079 gene locus_tag LOCUS_10870 27324 27079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 27535 27287 gene locus_tag LOCUS_10880 27535 27287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10880 27582 27791 gene locus_tag LOCUS_10890 27582 27791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 28195 27836 gene locus_tag LOCUS_10900 28195 27836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567215.1 protein_id gnl|my_center|LOCUS_10900 29607 28192 gene locus_tag LOCUS_10910 29607 28192 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540278.1 protein_id gnl|my_center|LOCUS_10910 30130 29780 gene locus_tag LOCUS_10920 30130 29780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 30809 30135 gene locus_tag LOCUS_10930 30809 30135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 31047 31334 gene locus_tag LOCUS_10940 31047 31334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10940 31583 32041 gene locus_tag LOCUS_10950 31583 32041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10950 32043 32660 gene locus_tag LOCUS_10960 32043 32660 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971922.1 protein_id gnl|my_center|LOCUS_10960 33360 33001 gene locus_tag LOCUS_10970 33360 33001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 35490 33919 gene locus_tag LOCUS_10980 35490 33919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10980 36011 35664 gene locus_tag LOCUS_10990 36011 35664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10990 >Feature sequence18 536 354 gene locus_tag LOCUS_11000 536 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 2165 663 gene locus_tag LOCUS_11010 gene pyk 2165 663 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895918.1 protein_id gnl|my_center|LOCUS_11010 3254 2235 gene locus_tag LOCUS_11020 gene pfkA 3254 2235 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262160.1 protein_id gnl|my_center|LOCUS_11020 6458 3348 gene locus_tag LOCUS_11030 6458 3348 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262159.1 protein_id gnl|my_center|LOCUS_11030 7396 6611 gene locus_tag LOCUS_11040 7396 6611 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263642.1 protein_id gnl|my_center|LOCUS_11040 8083 7493 gene locus_tag LOCUS_11050 gene leuD 8083 7493 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909937.1 protein_id gnl|my_center|LOCUS_11050 9475 8093 gene locus_tag LOCUS_11060 gene leuC 9475 8093 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907585.1 protein_id gnl|my_center|LOCUS_11060 10829 9792 gene locus_tag LOCUS_11070 gene leuB 10829 9792 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262707.1 protein_id gnl|my_center|LOCUS_11070 12404 10842 gene locus_tag LOCUS_11080 12404 10842 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262708.1 protein_id gnl|my_center|LOCUS_11080 13443 12751 gene locus_tag LOCUS_11090 13443 12751 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240129.1 protein_id gnl|my_center|LOCUS_11090 13698 14636 gene locus_tag LOCUS_11100 13698 14636 CDS product dihydroorotate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263253.1 protein_id gnl|my_center|LOCUS_11100 14900 14700 gene locus_tag LOCUS_11110 14900 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 15234 14959 gene locus_tag LOCUS_11120 15234 14959 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284640.1 protein_id gnl|my_center|LOCUS_11120 15940 15371 gene locus_tag LOCUS_11130 15940 15371 CDS product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806954.1 protein_id gnl|my_center|LOCUS_11130 16670 15933 gene locus_tag LOCUS_11140 16670 15933 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035227.1 protein_id gnl|my_center|LOCUS_11140 17637 16801 gene locus_tag LOCUS_11150 17637 16801 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262102.1 protein_id gnl|my_center|LOCUS_11150 19378 17708 gene locus_tag LOCUS_11160 gene recN 19378 17708 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923621.1 protein_id gnl|my_center|LOCUS_11160 19833 19387 gene locus_tag LOCUS_11170 19833 19387 CDS product ArgR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262104.1 protein_id gnl|my_center|LOCUS_11170 20647 19781 gene locus_tag LOCUS_11180 20647 19781 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262105.1 protein_id gnl|my_center|LOCUS_11180 21512 20640 gene locus_tag LOCUS_11190 21512 20640 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262106.1 protein_id gnl|my_center|LOCUS_11190 21727 21512 gene locus_tag LOCUS_11200 21727 21512 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280900.1 protein_id gnl|my_center|LOCUS_11200 23045 21705 gene locus_tag LOCUS_11210 gene xseA 23045 21705 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992349.1 protein_id gnl|my_center|LOCUS_11210 23479 23234 gene locus_tag LOCUS_11220 23479 23234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 24783 24139 gene locus_tag LOCUS_11230 gene nth 24783 24139 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922193.1 protein_id gnl|my_center|LOCUS_11230 25481 24783 gene locus_tag LOCUS_11240 25481 24783 CDS product DnaD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922192.1 protein_id gnl|my_center|LOCUS_11240 26497 25553 gene locus_tag LOCUS_11250 gene metA 26497 25553 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263079.1 protein_id gnl|my_center|LOCUS_11250 27186 26668 gene locus_tag LOCUS_11260 27186 26668 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263078.1 protein_id gnl|my_center|LOCUS_11260 29511 27301 gene locus_tag LOCUS_11270 gene recJ 29511 27301 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263074.1 protein_id gnl|my_center|LOCUS_11270 30291 29524 gene locus_tag LOCUS_11280 30291 29524 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984893.1 protein_id gnl|my_center|LOCUS_11280 31220 30291 gene locus_tag LOCUS_11290 gene rnz 31220 30291 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405386.1 protein_id gnl|my_center|LOCUS_11290 31893 31252 gene locus_tag LOCUS_11300 31893 31252 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263071.1 protein_id gnl|my_center|LOCUS_11300 33124 31886 gene locus_tag LOCUS_11310 gene hflX 33124 31886 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573348.1 protein_id gnl|my_center|LOCUS_11310 <33864 33244 gene locus_tag LOCUS_11320 <33864 33244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263164.1:FtsW/RodA/SpoVE family cell cycle protein >Feature sequence19 430 179 gene locus_tag LOCUS_11330 430 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11330 777 1982 gene locus_tag LOCUS_11340 777 1982 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841575.1 protein_id gnl|my_center|LOCUS_11340 2636 2028 gene locus_tag LOCUS_11350 2636 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11350 2930 3136 gene locus_tag LOCUS_11360 2930 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 3867 3406 gene locus_tag LOCUS_11370 3867 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11370 4361 3843 gene locus_tag LOCUS_11380 4361 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11380 4499 4569 gene locus_tag LOCUS_t00210 4499 4569 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 4884 5651 gene locus_tag LOCUS_11390 gene rpsB 4884 5651 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268454.1 protein_id gnl|my_center|LOCUS_11390 5762 6802 gene locus_tag LOCUS_11400 gene tsf 5762 6802 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000808070.1 protein_id gnl|my_center|LOCUS_11400 7382 6912 gene locus_tag LOCUS_11410 7382 6912 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106578.1 protein_id gnl|my_center|LOCUS_11410 7626 8081 gene locus_tag LOCUS_11420 gene ctsR 7626 8081 CDS product transcriptional regulator CtsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262345.1 protein_id gnl|my_center|LOCUS_11420 8082 10532 gene locus_tag LOCUS_11430 8082 10532 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020289.1 protein_id gnl|my_center|LOCUS_11430 11598 10660 gene locus_tag LOCUS_11440 11598 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11440 11959 11498 gene locus_tag LOCUS_11450 11959 11498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11450 13315 12062 gene locus_tag LOCUS_11460 gene pbp3 13315 12062 CDS product D-alanyl-D-alanine carboxypeptidase PBP3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273614.1 protein_id gnl|my_center|LOCUS_11460 13518 15743 gene locus_tag LOCUS_11470 gene pnp 13518 15743 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922673.1 protein_id gnl|my_center|LOCUS_11470 15752 16522 gene locus_tag LOCUS_11480 15752 16522 CDS product SseB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204782.1 protein_id gnl|my_center|LOCUS_11480 16595 17215 gene locus_tag LOCUS_11490 gene cysE 16595 17215 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899011.1 protein_id gnl|my_center|LOCUS_11490 17597 18940 gene locus_tag LOCUS_11500 gene cysS 17597 18940 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000591131.1 protein_id gnl|my_center|LOCUS_11500 18933 19334 gene locus_tag LOCUS_11510 18933 19334 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263003.1 protein_id gnl|my_center|LOCUS_11510 19617 19772 gene locus_tag LOCUS_11520 19617 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 19848 20036 gene locus_tag LOCUS_11530 19848 20036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 20107 20349 gene locus_tag LOCUS_11540 20107 20349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 20397 21140 gene locus_tag LOCUS_11550 gene rlmB 20397 21140 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027787.1 protein_id gnl|my_center|LOCUS_11550 21143 21658 gene locus_tag LOCUS_11560 21143 21658 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716636.1 protein_id gnl|my_center|LOCUS_11560 21667 22527 gene locus_tag LOCUS_11570 21667 22527 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262997.1 protein_id gnl|my_center|LOCUS_11570 22828 23328 gene locus_tag LOCUS_11580 22828 23328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 23476 24432 gene locus_tag LOCUS_11590 23476 24432 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644739.1 protein_id gnl|my_center|LOCUS_11590 24641 25087 gene locus_tag LOCUS_11600 gene rplM 24641 25087 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001865567.1 protein_id gnl|my_center|LOCUS_11600 25115 25507 gene locus_tag LOCUS_11610 gene rpsI 25115 25507 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982716.1 protein_id gnl|my_center|LOCUS_11610 26834 25614 gene locus_tag LOCUS_11620 26834 25614 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219078.1 protein_id gnl|my_center|LOCUS_11620 27119 26847 gene locus_tag LOCUS_11630 27119 26847 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196077.1 protein_id gnl|my_center|LOCUS_11630 28414 27302 gene locus_tag LOCUS_11640 28414 27302 CDS product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310786.1 protein_id gnl|my_center|LOCUS_11640 28660 28433 gene locus_tag LOCUS_11650 28660 28433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 30548 28647 gene locus_tag LOCUS_11660 30548 28647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357668.1 protein_id gnl|my_center|LOCUS_11660 <32579 30563 gene locus_tag LOCUS_11670 <32579 30563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001279020.1:ATP-binding protein >Feature sequence20 1283 180 gene locus_tag LOCUS_11680 gene dinB 1283 180 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904560.1 protein_id gnl|my_center|LOCUS_11680 1562 3871 gene locus_tag LOCUS_11690 gene pflB 1562 3871 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260646.1 protein_id gnl|my_center|LOCUS_11690 4138 4920 gene locus_tag LOCUS_11700 4138 4920 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268260.1 protein_id gnl|my_center|LOCUS_11700 4938 5423 gene locus_tag LOCUS_11710 4938 5423 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262620.1 protein_id gnl|my_center|LOCUS_11710 6059 5757 gene locus_tag LOCUS_11720 6059 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 6278 6099 gene locus_tag LOCUS_11730 6278 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 7813 7058 gene locus_tag LOCUS_11740 gene fetB 7813 7058 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643458.1 protein_id gnl|my_center|LOCUS_11740 8460 7810 gene locus_tag LOCUS_11750 8460 7810 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642453.1 protein_id gnl|my_center|LOCUS_11750 8687 8457 gene locus_tag LOCUS_11760 8687 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 9618 8662 gene locus_tag LOCUS_11770 9618 8662 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836440.1 protein_id gnl|my_center|LOCUS_11770 10373 9618 gene locus_tag LOCUS_11780 10373 9618 CDS product CppA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262622.1 protein_id gnl|my_center|LOCUS_11780 11967 11104 gene locus_tag LOCUS_11790 11967 11104 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570241.1 protein_id gnl|my_center|LOCUS_11790 12088 14355 gene locus_tag LOCUS_11800 12088 14355 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921783.1 protein_id gnl|my_center|LOCUS_11800 15203 14940 gene locus_tag LOCUS_11810 15203 14940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 15821 15525 gene locus_tag LOCUS_11820 15821 15525 CDS product bacteriocin immunity protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162496604.1 protein_id gnl|my_center|LOCUS_11820 16192 15986 gene locus_tag LOCUS_11830 16192 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 16912 16223 gene locus_tag LOCUS_11840 16912 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 17278 17099 gene locus_tag LOCUS_11850 17278 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 17950 17711 gene locus_tag LOCUS_11860 17950 17711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 19099 18932 gene locus_tag LOCUS_11870 19099 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 19837 19607 gene locus_tag LOCUS_11880 gene blpU 19837 19607 CDS product bacteriocin-like peptide BlpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093075.1 protein_id gnl|my_center|LOCUS_11880 20394 20194 gene locus_tag LOCUS_11890 20394 20194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 20589 20413 gene locus_tag LOCUS_11900 20589 20413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 20840 21577 gene locus_tag LOCUS_11910 20840 21577 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262114.1 protein_id gnl|my_center|LOCUS_11910 22192 22911 gene locus_tag LOCUS_11920 22192 22911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 23090 22929 gene locus_tag LOCUS_11930 23090 22929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 24472 23105 gene locus_tag LOCUS_11940 gene comB 24472 23105 CDS product competence pheromone export protein ComB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801613.1 protein_id gnl|my_center|LOCUS_11940 25399 24488 gene locus_tag LOCUS_11950 25399 24488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 26579 25359 gene locus_tag LOCUS_11960 26579 25359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11960 29401 27656 gene locus_tag LOCUS_11970 29401 27656 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001180039.1 protein_id gnl|my_center|LOCUS_11970 31151 29394 gene locus_tag LOCUS_11980 31151 29394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022594.1 protein_id gnl|my_center|LOCUS_11980 31403 31200 gene locus_tag LOCUS_11990 31403 31200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 31545 31339 gene locus_tag LOCUS_12000 31545 31339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence21 238 1689 gene locus_tag LOCUS_12010 238 1689 CDS product oligopeptide:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416074.1 protein_id gnl|my_center|LOCUS_12010 1865 1740 gene locus_tag LOCUS_12020 1865 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 2301 1846 gene locus_tag LOCUS_12030 2301 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 3021 2386 gene locus_tag LOCUS_12040 gene pyrE 3021 2386 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263221.1 protein_id gnl|my_center|LOCUS_12040 3799 3104 gene locus_tag LOCUS_12050 gene pyrF 3799 3104 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263220.1 protein_id gnl|my_center|LOCUS_12050 4790 3999 gene locus_tag LOCUS_12060 4790 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6062 4989 gene locus_tag LOCUS_12070 gene csm5 6062 4989 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917169.1 protein_id gnl|my_center|LOCUS_12070 6964 6065 gene locus_tag LOCUS_12080 gene csm4 6964 6065 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837016.1 protein_id gnl|my_center|LOCUS_12080 7628 6966 gene locus_tag LOCUS_12090 gene csm3 7628 6966 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917166.1 protein_id gnl|my_center|LOCUS_12090 8008 7628 gene locus_tag LOCUS_12100 8008 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 10282 8012 gene locus_tag LOCUS_12110 gene cas10 10282 8012 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917163.1 protein_id gnl|my_center|LOCUS_12110 10994 10263 gene locus_tag LOCUS_12120 gene cas6 10994 10263 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 protein_id gnl|my_center|LOCUS_12120 11125 11450 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgtcccctctcgaggtaattaggtttatatc 11880 11551 gene locus_tag LOCUS_12130 gene cas2 11880 11551 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037618070.1 protein_id gnl|my_center|LOCUS_12130 12884 11880 gene locus_tag LOCUS_12140 gene cas1 12884 11880 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837018.1 protein_id gnl|my_center|LOCUS_12140 13970 13023 gene locus_tag LOCUS_12150 13970 13023 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909666.1 protein_id gnl|my_center|LOCUS_12150 14762 13989 gene locus_tag LOCUS_12160 14762 13989 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263218.1 protein_id gnl|my_center|LOCUS_12160 15582 15034 gene locus_tag LOCUS_12170 15582 15034 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775259.1 protein_id gnl|my_center|LOCUS_12170 16457 15849 gene locus_tag LOCUS_12180 16457 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 16752 16570 gene locus_tag LOCUS_12190 16752 16570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 16723 18381 gene locus_tag LOCUS_12200 16723 18381 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006730.1 protein_id gnl|my_center|LOCUS_12200 18966 18802 gene locus_tag LOCUS_12210 18966 18802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 19408 19563 gene locus_tag LOCUS_12220 19408 19563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 20698 20540 gene locus_tag LOCUS_12230 20698 20540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 21075 20935 gene locus_tag LOCUS_12240 21075 20935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 21308 21943 gene locus_tag LOCUS_12250 21308 21943 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200897.1 protein_id gnl|my_center|LOCUS_12250 22769 22005 gene locus_tag LOCUS_12260 22769 22005 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 protein_id gnl|my_center|LOCUS_12260 23543 23196 gene locus_tag LOCUS_12270 23543 23196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 23819 23565 gene locus_tag LOCUS_12280 23819 23565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12280 24473 24030 gene locus_tag LOCUS_12290 24473 24030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12290 24737 24558 gene locus_tag LOCUS_12300 24737 24558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12300 26188 25151 gene locus_tag LOCUS_12310 26188 25151 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836798.1 protein_id gnl|my_center|LOCUS_12310 27358 26285 gene locus_tag LOCUS_12320 gene hemH 27358 26285 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709260.1 protein_id gnl|my_center|LOCUS_12320 28387 27491 gene locus_tag LOCUS_12330 gene czcD 28387 27491 CDS product cation diffusion facilitator family transporter CzcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645093.1 protein_id gnl|my_center|LOCUS_12330 28485 29060 gene locus_tag LOCUS_12340 28485 29060 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181706.1 protein_id gnl|my_center|LOCUS_12340 30198 29488 gene locus_tag LOCUS_12350 30198 29488 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921899.1 protein_id gnl|my_center|LOCUS_12350 30462 31205 gene locus_tag LOCUS_12360 30462 31205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence22 956 447 gene locus_tag LOCUS_12370 956 447 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002278685.1 protein_id gnl|my_center|LOCUS_12370 1350 1192 gene locus_tag LOCUS_12380 1350 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2015 1503 gene locus_tag LOCUS_12390 2015 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775531.1 protein_id gnl|my_center|LOCUS_12390 5594 2415 gene locus_tag LOCUS_12400 5594 2415 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101461.1 protein_id gnl|my_center|LOCUS_12400 6817 5591 gene locus_tag LOCUS_12410 6817 5591 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905886.1 protein_id gnl|my_center|LOCUS_12410 10734 7654 gene locus_tag LOCUS_12420 10734 7654 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475723.1 protein_id gnl|my_center|LOCUS_12420 12642 10738 gene locus_tag LOCUS_12430 12642 10738 CDS product glycoside-pentoside-hexuronide (GPH):cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643065.1 protein_id gnl|my_center|LOCUS_12430 13791 12745 gene locus_tag LOCUS_12440 13791 12745 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476378.1 protein_id gnl|my_center|LOCUS_12440 14862 13861 gene locus_tag LOCUS_12450 gene galE 14862 13861 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262881.1 protein_id gnl|my_center|LOCUS_12450 16373 14892 gene locus_tag LOCUS_12460 gene galT 16373 14892 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836862.1 protein_id gnl|my_center|LOCUS_12460 17559 16393 gene locus_tag LOCUS_12470 17559 16393 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836861.1 protein_id gnl|my_center|LOCUS_12470 17702 18697 gene locus_tag LOCUS_12480 gene galR 17702 18697 CDS product DNA-binding transcriptional regulator GalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212502.1 protein_id gnl|my_center|LOCUS_12480 19680 19492 gene locus_tag LOCUS_12490 19680 19492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12490 21175 19853 gene locus_tag LOCUS_12500 21175 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12500 21347 21189 gene locus_tag LOCUS_12510 21347 21189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 21823 22104 gene locus_tag LOCUS_12520 21823 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 22746 22291 gene locus_tag LOCUS_12530 22746 22291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12530 23015 22743 gene locus_tag LOCUS_12540 23015 22743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 23700 25964 gene locus_tag LOCUS_12550 gene gshAB 23700 25964 CDS product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910596.1 protein_id gnl|my_center|LOCUS_12550 26180 26686 gene locus_tag LOCUS_12560 26180 26686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12560 >Feature sequence23 887 501 gene locus_tag LOCUS_12570 gene rplQ 887 501 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331493.1 protein_id gnl|my_center|LOCUS_12570 1843 905 gene locus_tag LOCUS_12580 1843 905 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568977.1 protein_id gnl|my_center|LOCUS_12580 2275 1892 gene locus_tag LOCUS_12590 gene rpsK 2275 1892 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195509.1 protein_id gnl|my_center|LOCUS_12590 2668 2303 gene locus_tag LOCUS_12600 gene rpsM 2668 2303 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936622.1 protein_id gnl|my_center|LOCUS_12600 3046 2828 gene locus_tag LOCUS_12610 gene infA 3046 2828 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040189.1 protein_id gnl|my_center|LOCUS_12610 3820 3164 gene locus_tag LOCUS_12620 3820 3164 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921787.1 protein_id gnl|my_center|LOCUS_12620 5247 3952 gene locus_tag LOCUS_12630 gene secY 5247 3952 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000478891.1 protein_id gnl|my_center|LOCUS_12630 5704 5264 gene locus_tag LOCUS_12640 gene rplO 5704 5264 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766093.1 protein_id gnl|my_center|LOCUS_12640 6014 5832 gene locus_tag LOCUS_12650 gene rpmD 6014 5832 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986624.1 protein_id gnl|my_center|LOCUS_12650 6523 6029 gene locus_tag LOCUS_12660 gene rpsE 6523 6029 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000874200.1 protein_id gnl|my_center|LOCUS_12660 6898 6542 gene locus_tag LOCUS_12670 gene rplR 6898 6542 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262324.1 protein_id gnl|my_center|LOCUS_12670 7524 6988 gene locus_tag LOCUS_12680 gene rplF 7524 6988 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262325.1 protein_id gnl|my_center|LOCUS_12680 8049 7651 gene locus_tag LOCUS_12690 gene rpsH 8049 7651 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987748.1 protein_id gnl|my_center|LOCUS_12690 8357 8172 gene locus_tag LOCUS_12700 8357 8172 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085697.1 protein_id gnl|my_center|LOCUS_12700 8917 8375 gene locus_tag LOCUS_12710 gene rplE 8917 8375 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013545.1 protein_id gnl|my_center|LOCUS_12710 9249 8944 gene locus_tag LOCUS_12720 gene rplX 9249 8944 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000497687.1 protein_id gnl|my_center|LOCUS_12720 9698 9330 gene locus_tag LOCUS_12730 gene rplN 9698 9330 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615920.1 protein_id gnl|my_center|LOCUS_12730 9983 9723 gene locus_tag LOCUS_12740 gene rpsQ 9983 9723 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440811.1 protein_id gnl|my_center|LOCUS_12740 10217 10011 gene locus_tag LOCUS_12750 gene rpmC 10217 10011 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262332.1 protein_id gnl|my_center|LOCUS_12750 10640 10227 gene locus_tag LOCUS_12760 gene rplP 10640 10227 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960950.1 protein_id gnl|my_center|LOCUS_12760 11297 10644 gene locus_tag LOCUS_12770 gene rpsC 11297 10644 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529929.1 protein_id gnl|my_center|LOCUS_12770 11654 11310 gene locus_tag LOCUS_12780 gene rplV 11654 11310 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818141.1 protein_id gnl|my_center|LOCUS_12780 11948 11670 gene locus_tag LOCUS_12790 gene rpsS 11948 11670 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533765.1 protein_id gnl|my_center|LOCUS_12790 12875 12042 gene locus_tag LOCUS_12800 gene rplB 12875 12042 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986654.1 protein_id gnl|my_center|LOCUS_12800 13189 12893 gene locus_tag LOCUS_12810 13189 12893 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055343.1 protein_id gnl|my_center|LOCUS_12810 13812 13189 gene locus_tag LOCUS_12820 gene rplD 13812 13189 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986657.1 protein_id gnl|my_center|LOCUS_12820 14463 13837 gene locus_tag LOCUS_12830 gene rplC 14463 13837 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160205.1 protein_id gnl|my_center|LOCUS_12830 14888 14580 gene locus_tag LOCUS_12840 gene rpsJ 14888 14580 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284518.1 protein_id gnl|my_center|LOCUS_12840 16133 15132 gene locus_tag LOCUS_12850 gene ruvB 16133 15132 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002908428.1 protein_id gnl|my_center|LOCUS_12850 18039 16216 gene locus_tag LOCUS_12860 18039 16216 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002310757.1 protein_id gnl|my_center|LOCUS_12860 18446 18036 gene locus_tag LOCUS_12870 18446 18036 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429312.1 protein_id gnl|my_center|LOCUS_12870 18877 18443 gene locus_tag LOCUS_12880 18877 18443 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000754813.1 protein_id gnl|my_center|LOCUS_12880 20453 19161 gene locus_tag LOCUS_12890 20453 19161 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921827.1 protein_id gnl|my_center|LOCUS_12890 21222 20707 gene locus_tag LOCUS_12900 21222 20707 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922704.1 protein_id gnl|my_center|LOCUS_12900 21951 22145 gene locus_tag LOCUS_12910 21951 22145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12910 22111 22809 gene locus_tag LOCUS_12920 22111 22809 CDS product Rgg/GadR/MutR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352338.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12920 23051 23185 gene locus_tag LOCUS_12930 23051 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 23254 24249 gene locus_tag LOCUS_12940 23254 24249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 24242 25783 gene locus_tag LOCUS_12950 24242 25783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946120.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence24 442 98 gene locus_tag LOCUS_12960 442 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12960 774 589 gene locus_tag LOCUS_12970 774 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12970 1145 867 gene locus_tag LOCUS_12980 1145 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12980 1875 1222 gene locus_tag LOCUS_12990 1875 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12990 2329 1904 gene locus_tag LOCUS_13000 2329 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13000 3359 2508 gene locus_tag LOCUS_13010 3359 2508 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024379094.1 protein_id gnl|my_center|LOCUS_13010 4001 3372 gene locus_tag LOCUS_13020 4001 3372 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262171.1 protein_id gnl|my_center|LOCUS_13020 4651 4010 gene locus_tag LOCUS_13030 4651 4010 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262170.1 protein_id gnl|my_center|LOCUS_13030 5176 4847 gene locus_tag LOCUS_13040 5176 4847 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056777.1 protein_id gnl|my_center|LOCUS_13040 7101 5293 gene locus_tag LOCUS_13050 gene glmS 7101 5293 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334246.1 protein_id gnl|my_center|LOCUS_13050 7308 8216 gene locus_tag LOCUS_13060 7308 8216 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_13060 9123 8392 gene locus_tag LOCUS_13070 9123 8392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13070 12069 9433 gene locus_tag LOCUS_13080 12069 9433 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108345.1 protein_id gnl|my_center|LOCUS_13080 13964 12246 gene locus_tag LOCUS_13090 gene pabB 13964 12246 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554830.1 protein_id gnl|my_center|LOCUS_13090 14111 14446 gene locus_tag LOCUS_13100 14111 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 14774 17023 gene locus_tag LOCUS_13110 gene metE 14774 17023 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108255.1 protein_id gnl|my_center|LOCUS_13110 17212 18087 gene locus_tag LOCUS_13120 gene metF 17212 18087 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089967.1 protein_id gnl|my_center|LOCUS_13120 19944 18226 gene locus_tag LOCUS_13130 19944 18226 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262263.1 protein_id gnl|my_center|LOCUS_13130 20599 20027 gene locus_tag LOCUS_13140 20599 20027 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262264.1 protein_id gnl|my_center|LOCUS_13140 21172 20627 gene locus_tag LOCUS_13150 gene coaC 21172 20627 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922347.1 protein_id gnl|my_center|LOCUS_13150 21848 21165 gene locus_tag LOCUS_13160 21848 21165 CDS product phosphopantothenate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262266.1 protein_id gnl|my_center|LOCUS_13160 22042 23712 gene locus_tag LOCUS_13170 22042 23712 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775633.1 protein_id gnl|my_center|LOCUS_13170 23899 24573 gene locus_tag LOCUS_13180 23899 24573 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897753.1 protein_id gnl|my_center|LOCUS_13180 24665 24862 gene locus_tag LOCUS_13190 24665 24862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 24940 25263 gene locus_tag LOCUS_13200 24940 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13200 25467 25982 gene locus_tag LOCUS_13210 25467 25982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13210 >Feature sequence25 2301 439 gene locus_tag LOCUS_13220 2301 439 CDS product cell division site-positioning protein MapZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263048.1 protein_id gnl|my_center|LOCUS_13220 3470 2304 gene locus_tag LOCUS_13230 3470 2304 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664849.1 protein_id gnl|my_center|LOCUS_13230 4336 4004 gene locus_tag LOCUS_13240 gene gpsB 4336 4004 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263050.1 protein_id gnl|my_center|LOCUS_13240 4960 4445 gene locus_tag LOCUS_13250 4960 4445 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263051.1 protein_id gnl|my_center|LOCUS_13250 5037 5633 gene locus_tag LOCUS_13260 gene recU 5037 5633 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248792.1 protein_id gnl|my_center|LOCUS_13260 5633 7951 gene locus_tag LOCUS_13270 gene pbp1a 5633 7951 CDS product penicillin-binding protein PBP1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628368.1 protein_id gnl|my_center|LOCUS_13270 9398 8061 gene locus_tag LOCUS_13280 gene pepC 9398 8061 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263054.1 protein_id gnl|my_center|LOCUS_13280 9940 9500 gene locus_tag LOCUS_13290 9940 9500 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131354.1 protein_id gnl|my_center|LOCUS_13290 10777 9956 gene locus_tag LOCUS_13300 gene nadE 10777 9956 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262098.1 protein_id gnl|my_center|LOCUS_13300 12243 10789 gene locus_tag LOCUS_13310 12243 10789 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276183.1 protein_id gnl|my_center|LOCUS_13310 13403 12537 gene locus_tag LOCUS_13320 13403 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 13772 13560 gene locus_tag LOCUS_13330 13772 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 14158 13817 gene locus_tag LOCUS_13340 14158 13817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13340 16970 14469 gene locus_tag LOCUS_13350 gene leuS 16970 14469 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011806.1 protein_id gnl|my_center|LOCUS_13350 17144 17452 gene locus_tag LOCUS_13360 17144 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 17452 17910 gene locus_tag LOCUS_13370 17452 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13370 17885 18121 gene locus_tag LOCUS_13380 17885 18121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13380 18157 18459 gene locus_tag LOCUS_13390 18157 18459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13390 18419 18715 gene locus_tag LOCUS_13400 18419 18715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13400 19158 18847 gene locus_tag LOCUS_13410 19158 18847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 19192 19380 gene locus_tag LOCUS_13420 19192 19380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 19996 19457 gene locus_tag LOCUS_13430 gene nusG 19996 19457 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887149.1 protein_id gnl|my_center|LOCUS_13430 20369 20193 gene locus_tag LOCUS_13440 gene secE 20369 20193 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982348.1 protein_id gnl|my_center|LOCUS_13440 22906 20579 gene locus_tag LOCUS_13450 gene pbp2a 22906 20579 CDS product penicillin-binding protein PBP2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922727.1 protein_id gnl|my_center|LOCUS_13450 22972 23844 gene locus_tag LOCUS_13460 22972 23844 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002914141.1 protein_id gnl|my_center|LOCUS_13460 24024 24356 gene locus_tag LOCUS_13470 24024 24356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 25174 25482 gene locus_tag LOCUS_13480 25174 25482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence26 3470 1908 gene locus_tag LOCUS_13490 gene guaA 3470 1908 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129872.1 protein_id gnl|my_center|LOCUS_13490 3638 4336 gene locus_tag LOCUS_13500 3638 4336 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262275.1 protein_id gnl|my_center|LOCUS_13500 4402 4734 gene locus_tag LOCUS_13510 4402 4734 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032910500.1 protein_id gnl|my_center|LOCUS_13510 4767 6329 gene locus_tag LOCUS_13520 gene ffh 4767 6329 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863589.1 protein_id gnl|my_center|LOCUS_13520 6431 6958 gene locus_tag LOCUS_13530 6431 6958 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097402.1 protein_id gnl|my_center|LOCUS_13530 6982 7497 gene locus_tag LOCUS_13540 6982 7497 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159176.1 protein_id gnl|my_center|LOCUS_13540 7592 8281 gene locus_tag LOCUS_13550 7592 8281 CDS product S24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262342.1 protein_id gnl|my_center|LOCUS_13550 8409 9263 gene locus_tag LOCUS_13560 gene ylqF 8409 9263 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201282.1 protein_id gnl|my_center|LOCUS_13560 9250 10017 gene locus_tag LOCUS_13570 9250 10017 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922484.1 protein_id gnl|my_center|LOCUS_13570 10028 10948 gene locus_tag LOCUS_13580 10028 10948 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948840.1 protein_id gnl|my_center|LOCUS_13580 11016 11855 gene locus_tag LOCUS_13590 gene dprA 11016 11855 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262865.1 protein_id gnl|my_center|LOCUS_13590 12023 14167 gene locus_tag LOCUS_13600 gene topA 12023 14167 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262866.1 protein_id gnl|my_center|LOCUS_13600 15145 15804 gene locus_tag LOCUS_13610 15145 15804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261882.1 protein_id gnl|my_center|LOCUS_13610 15930 17189 gene locus_tag LOCUS_13620 15930 17189 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261881.1 protein_id gnl|my_center|LOCUS_13620 17290 18633 gene locus_tag LOCUS_13630 gene trmFO 17290 18633 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922319.1 protein_id gnl|my_center|LOCUS_13630 19689 18898 gene locus_tag LOCUS_13640 19689 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13640 20000 20428 gene locus_tag LOCUS_13650 gene ndk 20000 20428 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028095.1 protein_id gnl|my_center|LOCUS_13650 20430 20723 gene locus_tag LOCUS_13660 20430 20723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 20934 21275 gene locus_tag LOCUS_13670 20934 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13670 21551 21697 gene locus_tag LOCUS_13680 21551 21697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13680 >Feature sequence27 1552 413 gene locus_tag LOCUS_13690 gene recA 1552 413 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085741.1 protein_id gnl|my_center|LOCUS_13690 2859 1588 gene locus_tag LOCUS_13700 2859 1588 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922754.1 protein_id gnl|my_center|LOCUS_13700 3509 2955 gene locus_tag LOCUS_13710 3509 2955 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922755.1 protein_id gnl|my_center|LOCUS_13710 4106 3516 gene locus_tag LOCUS_13720 gene ruvA 4106 3516 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992186.1 protein_id gnl|my_center|LOCUS_13720 4479 4258 gene locus_tag LOCUS_13730 4479 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 6552 4609 gene locus_tag LOCUS_13740 gene mutL 6552 4609 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262396.1 protein_id gnl|my_center|LOCUS_13740 7133 7507 gene locus_tag LOCUS_13750 7133 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 7521 7763 gene locus_tag LOCUS_13760 7521 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 10568 8010 gene locus_tag LOCUS_13770 gene mutS 10568 8010 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279585.1 protein_id gnl|my_center|LOCUS_13770 10920 10561 gene locus_tag LOCUS_13780 10920 10561 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002264540.1 protein_id gnl|my_center|LOCUS_13780 11345 10920 gene locus_tag LOCUS_13790 gene argR 11345 10920 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982171.1 protein_id gnl|my_center|LOCUS_13790 11503 13194 gene locus_tag LOCUS_13800 gene argS 11503 13194 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991367.1 protein_id gnl|my_center|LOCUS_13800 13904 13734 gene locus_tag LOCUS_13810 13904 13734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 15356 14058 gene locus_tag LOCUS_13820 gene purB 15356 14058 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972422.1 protein_id gnl|my_center|LOCUS_13820 15799 15635 gene locus_tag LOCUS_13830 15799 15635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13830 16626 15871 gene locus_tag LOCUS_13840 16626 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13840 17910 16819 gene locus_tag LOCUS_13850 gene purK 17910 16819 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002926478.1 protein_id gnl|my_center|LOCUS_13850 18334 17897 gene locus_tag LOCUS_13860 gene purE 18334 17897 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805601.1 protein_id gnl|my_center|LOCUS_13860 19993 18731 gene locus_tag LOCUS_13870 gene purD 19993 18731 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772240.1 protein_id gnl|my_center|LOCUS_13870 20302 21141 gene locus_tag LOCUS_13880 20302 21141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence28 754 275 gene locus_tag LOCUS_13890 754 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13890 1184 870 gene locus_tag LOCUS_13900 1184 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3214 1460 gene locus_tag LOCUS_13910 gene lpdA 3214 1460 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922240.1 protein_id gnl|my_center|LOCUS_13910 4385 3372 gene locus_tag LOCUS_13920 4385 3372 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989981.1 protein_id gnl|my_center|LOCUS_13920 5366 4395 gene locus_tag LOCUS_13930 5366 4395 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922238.1 protein_id gnl|my_center|LOCUS_13930 6123 5854 gene locus_tag LOCUS_13940 6123 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 6966 6445 gene locus_tag LOCUS_13950 6966 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13950 8426 7158 gene locus_tag LOCUS_13960 8426 7158 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352291.1 protein_id gnl|my_center|LOCUS_13960 9099 8446 gene locus_tag LOCUS_13970 9099 8446 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000401337.1 protein_id gnl|my_center|LOCUS_13970 9313 10509 gene locus_tag LOCUS_13980 9313 10509 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235899.1 protein_id gnl|my_center|LOCUS_13980 10783 10950 gene locus_tag LOCUS_13990 10783 10950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13990 10937 11113 gene locus_tag LOCUS_14000 10937 11113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14000 11135 11323 gene locus_tag LOCUS_14010 11135 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14010 11377 11607 gene locus_tag LOCUS_14020 11377 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14020 11604 12083 gene locus_tag LOCUS_14030 11604 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14030 12974 12123 gene locus_tag LOCUS_14040 12974 12123 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_14040 13591 12971 gene locus_tag LOCUS_14050 13591 12971 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267815.1 protein_id gnl|my_center|LOCUS_14050 15172 13595 gene locus_tag LOCUS_14060 15172 13595 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947909.1 protein_id gnl|my_center|LOCUS_14060 15468 15190 gene locus_tag LOCUS_14070 15468 15190 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963363.1 protein_id gnl|my_center|LOCUS_14070 16767 16090 gene locus_tag LOCUS_14080 16767 16090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14080 17107 16958 gene locus_tag LOCUS_14090 17107 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14090 18365 17229 gene locus_tag LOCUS_14100 18365 17229 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667244.1 protein_id gnl|my_center|LOCUS_14100 18959 18444 gene locus_tag LOCUS_14110 18959 18444 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265474.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14110 19626 19054 gene locus_tag LOCUS_14120 19626 19054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence29 1350 157 gene locus_tag LOCUS_14130 gene metK 1350 157 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837180.1 protein_id gnl|my_center|LOCUS_14130 1631 2569 gene locus_tag LOCUS_14140 gene birA 1631 2569 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262808.1 protein_id gnl|my_center|LOCUS_14140 2741 2556 gene locus_tag LOCUS_14150 2741 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4620 2968 gene locus_tag LOCUS_14160 gene dnaX 4620 2968 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262806.1 protein_id gnl|my_center|LOCUS_14160 5129 4620 gene locus_tag LOCUS_14170 5129 4620 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262805.1 protein_id gnl|my_center|LOCUS_14170 6070 5165 gene locus_tag LOCUS_14180 gene miaA 6070 5165 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922190.1 protein_id gnl|my_center|LOCUS_14180 6140 6316 gene locus_tag LOCUS_14190 6140 6316 CDS product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263068.1 protein_id gnl|my_center|LOCUS_14190 7199 7128 gene locus_tag LOCUS_t00220 7199 7128 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7597 7250 gene locus_tag LOCUS_14200 gene rplS 7597 7250 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921928.1 protein_id gnl|my_center|LOCUS_14200 8951 7725 gene locus_tag LOCUS_14210 8951 7725 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263157.1 protein_id gnl|my_center|LOCUS_14210 9233 8961 gene locus_tag LOCUS_14220 9233 8961 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263155.1 protein_id gnl|my_center|LOCUS_14220 10843 9308 gene locus_tag LOCUS_14230 10843 9308 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427427.1 protein_id gnl|my_center|LOCUS_14230 11337 10894 gene locus_tag LOCUS_14240 11337 10894 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263152.1 protein_id gnl|my_center|LOCUS_14240 11793 11422 gene locus_tag LOCUS_14250 11793 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 12524 11805 gene locus_tag LOCUS_14260 12524 11805 CDS product M57 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263103.1 protein_id gnl|my_center|LOCUS_14260 13426 12644 gene locus_tag LOCUS_14270 13426 12644 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263101.1 protein_id gnl|my_center|LOCUS_14270 15212 13551 gene locus_tag LOCUS_14280 15212 13551 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280077.1 protein_id gnl|my_center|LOCUS_14280 16151 15393 gene locus_tag LOCUS_14290 16151 15393 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263098.1 protein_id gnl|my_center|LOCUS_14290 17017 16148 gene locus_tag LOCUS_14300 17017 16148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263097.1 protein_id gnl|my_center|LOCUS_14300 18028 17027 gene locus_tag LOCUS_14310 gene trpX 18028 17027 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790865.1 protein_id gnl|my_center|LOCUS_14310 18386 18165 gene locus_tag LOCUS_14320 18386 18165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 18797 18588 gene locus_tag LOCUS_14330 18797 18588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 19278 18799 gene locus_tag LOCUS_14340 19278 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14340 19663 19373 gene locus_tag LOCUS_14350 19663 19373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 20043 19912 gene locus_tag LOCUS_14360 20043 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 20216 20049 gene locus_tag LOCUS_14370 20216 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence30 317 1600 gene locus_tag LOCUS_14380 gene aroA 317 1600 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837158.1 protein_id gnl|my_center|LOCUS_14380 1593 2084 gene locus_tag LOCUS_14390 1593 2084 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922406.1 protein_id gnl|my_center|LOCUS_14390 2075 2899 gene locus_tag LOCUS_14400 gene pheA 2075 2899 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686443.1 protein_id gnl|my_center|LOCUS_14400 2911 4341 gene locus_tag LOCUS_14410 2911 4341 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261941.1 protein_id gnl|my_center|LOCUS_14410 5293 4379 gene locus_tag LOCUS_14420 5293 4379 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262433.1 protein_id gnl|my_center|LOCUS_14420 6374 5310 gene locus_tag LOCUS_14430 6374 5310 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262827.1 protein_id gnl|my_center|LOCUS_14430 6962 6414 gene locus_tag LOCUS_14440 6962 6414 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262826.1 protein_id gnl|my_center|LOCUS_14440 7177 8538 gene locus_tag LOCUS_14450 gene rlmD 7177 8538 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922404.1 protein_id gnl|my_center|LOCUS_14450 8748 9437 gene locus_tag LOCUS_14460 8748 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 9746 9967 gene locus_tag LOCUS_14470 9746 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 9964 10425 gene locus_tag LOCUS_14480 9964 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 10619 10924 gene locus_tag LOCUS_14490 10619 10924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 11020 11631 gene locus_tag LOCUS_14500 11020 11631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 11888 15316 gene locus_tag LOCUS_14510 11888 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 15493 16404 gene locus_tag LOCUS_14520 gene cas1 15493 16404 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929489.1 protein_id gnl|my_center|LOCUS_14520 16406 16729 gene locus_tag LOCUS_14530 16406 16729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 16726 17778 gene locus_tag LOCUS_14540 16726 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 17841 19262 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttttgtactctcaagatttaagtaactgtacaac >Feature sequence31 330 85 gene locus_tag LOCUS_14550 330 85 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364990.1 protein_id gnl|my_center|LOCUS_14550 571 1110 gene locus_tag LOCUS_14560 571 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2393 1140 gene locus_tag LOCUS_14570 2393 1140 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262554.1 protein_id gnl|my_center|LOCUS_14570 2580 2918 gene locus_tag LOCUS_14580 2580 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3311 3526 gene locus_tag LOCUS_14590 3311 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4391 3702 gene locus_tag LOCUS_14600 4391 3702 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262553.1 protein_id gnl|my_center|LOCUS_14600 4919 4425 gene locus_tag LOCUS_14610 4919 4425 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760496.1 protein_id gnl|my_center|LOCUS_14610 5758 5021 gene locus_tag LOCUS_14620 5758 5021 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027626.1 protein_id gnl|my_center|LOCUS_14620 5861 6139 gene locus_tag LOCUS_14630 5861 6139 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262550.1 protein_id gnl|my_center|LOCUS_14630 6226 7143 gene locus_tag LOCUS_14640 gene yidC 6226 7143 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751931.1 protein_id gnl|my_center|LOCUS_14640 7417 7199 gene locus_tag LOCUS_14650 7417 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 8575 8093 gene locus_tag LOCUS_14660 gene greA 8575 8093 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990993.1 protein_id gnl|my_center|LOCUS_14660 10635 8659 gene locus_tag LOCUS_14670 gene mltG 10635 8659 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000134324.1 protein_id gnl|my_center|LOCUS_14670 11202 10843 gene locus_tag LOCUS_14680 11202 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14680 12616 11288 gene locus_tag LOCUS_14690 gene murC 12616 11288 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262545.1 protein_id gnl|my_center|LOCUS_14690 13308 12643 gene locus_tag LOCUS_14700 13308 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079334.1 protein_id gnl|my_center|LOCUS_14700 16610 13515 gene locus_tag LOCUS_14710 16610 13515 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089135.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence32 1802 255 gene locus_tag LOCUS_14720 gene purH 1802 255 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166538.1 protein_id gnl|my_center|LOCUS_14720 2425 1871 gene locus_tag LOCUS_14730 gene purN 2425 1871 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836289.1 protein_id gnl|my_center|LOCUS_14730 3444 2425 gene locus_tag LOCUS_14740 gene purM 3444 2425 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000182582.1 protein_id gnl|my_center|LOCUS_14740 4914 3475 gene locus_tag LOCUS_14750 gene purF 4914 3475 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000220650.1 protein_id gnl|my_center|LOCUS_14750 8808 5083 gene locus_tag LOCUS_14760 8808 5083 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361236.1 protein_id gnl|my_center|LOCUS_14760 9571 8864 gene locus_tag LOCUS_14770 9571 8864 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043282.1 protein_id gnl|my_center|LOCUS_14770 10101 9856 gene locus_tag LOCUS_14780 10101 9856 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263135.1 protein_id gnl|my_center|LOCUS_14780 11105 10101 gene locus_tag LOCUS_14790 gene plsX 11105 10101 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263136.1 protein_id gnl|my_center|LOCUS_14790 12094 11321 gene locus_tag LOCUS_14800 gene recO 12094 11321 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775465.1 protein_id gnl|my_center|LOCUS_14800 13256 12081 gene locus_tag LOCUS_14810 13256 12081 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263138.1 protein_id gnl|my_center|LOCUS_14810 14348 14169 gene locus_tag LOCUS_14820 14348 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 15328 14363 gene locus_tag LOCUS_14830 15328 14363 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000122450.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence33 1058 48 gene locus_tag LOCUS_14840 gene gap 1058 48 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260670.1 protein_id gnl|my_center|LOCUS_14840 3327 1246 gene locus_tag LOCUS_14850 gene fusA 3327 1246 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090357.1 protein_id gnl|my_center|LOCUS_14850 4018 3548 gene locus_tag LOCUS_14860 gene rpsG 4018 3548 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992078.1 protein_id gnl|my_center|LOCUS_14860 4450 4037 gene locus_tag LOCUS_14870 gene rpsL 4450 4037 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142332.1 protein_id gnl|my_center|LOCUS_14870 5491 4667 gene locus_tag LOCUS_14880 gene purR 5491 4667 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002992072.1 protein_id gnl|my_center|LOCUS_14880 6526 5585 gene locus_tag LOCUS_14890 6526 5585 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700694.1 protein_id gnl|my_center|LOCUS_14890 7790 6516 gene locus_tag LOCUS_14900 7790 6516 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960187.1 protein_id gnl|my_center|LOCUS_14900 8424 7792 gene locus_tag LOCUS_14910 8424 7792 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921882.1 protein_id gnl|my_center|LOCUS_14910 9076 8417 gene locus_tag LOCUS_14920 gene rpe 9076 8417 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000106173.1 protein_id gnl|my_center|LOCUS_14920 9956 9084 gene locus_tag LOCUS_14930 gene rsgA 9956 9084 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921881.1 protein_id gnl|my_center|LOCUS_14930 10091 10175 gene locus_tag LOCUS_t00230 10091 10175 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11085 10213 gene locus_tag LOCUS_14940 gene rsmA 11085 10213 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991156.1 protein_id gnl|my_center|LOCUS_14940 11790 11230 gene locus_tag LOCUS_14950 gene rnmV 11790 11230 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267314.1 protein_id gnl|my_center|LOCUS_14950 12559 11783 gene locus_tag LOCUS_14960 12559 11783 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267315.1 protein_id gnl|my_center|LOCUS_14960 13044 12613 gene locus_tag LOCUS_14970 13044 12613 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986334.1 protein_id gnl|my_center|LOCUS_14970 13418 13104 gene locus_tag LOCUS_14980 gene trxA 13418 13104 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263363.1 protein_id gnl|my_center|LOCUS_14980 13614 14396 gene locus_tag LOCUS_14990 13614 14396 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449069.1 protein_id gnl|my_center|LOCUS_14990 15192 14857 gene locus_tag LOCUS_15000 15192 14857 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263516.1 protein_id gnl|my_center|LOCUS_15000 15371 15298 gene locus_tag LOCUS_t00240 15371 15298 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence34 788 420 gene locus_tag LOCUS_15010 788 420 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814955.1 protein_id gnl|my_center|LOCUS_15010 1640 879 gene locus_tag LOCUS_15020 1640 879 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837489.1 protein_id gnl|my_center|LOCUS_15020 2379 1633 gene locus_tag LOCUS_15030 gene truA 2379 1633 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199167.1 protein_id gnl|my_center|LOCUS_15030 3618 2485 gene locus_tag LOCUS_15040 gene dnaJ 3618 2485 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263418.1 protein_id gnl|my_center|LOCUS_15040 5869 4046 gene locus_tag LOCUS_15050 gene dnaK 5869 4046 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034682.1 protein_id gnl|my_center|LOCUS_15050 6569 5997 gene locus_tag LOCUS_15060 gene grpE 6569 5997 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000046026.1 protein_id gnl|my_center|LOCUS_15060 7644 6562 gene locus_tag LOCUS_15070 gene hrcA 7644 6562 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988568.1 protein_id gnl|my_center|LOCUS_15070 8418 7834 gene locus_tag LOCUS_15080 8418 7834 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263412.1 protein_id gnl|my_center|LOCUS_15080 9212 8415 gene locus_tag LOCUS_15090 9212 8415 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263411.1 protein_id gnl|my_center|LOCUS_15090 9618 9199 gene locus_tag LOCUS_15100 9618 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15100 9904 9554 gene locus_tag LOCUS_15110 9904 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15110 11358 10021 gene locus_tag LOCUS_15120 11358 10021 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263409.1 protein_id gnl|my_center|LOCUS_15120 11642 11376 gene locus_tag LOCUS_15130 11642 11376 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921874.1 protein_id gnl|my_center|LOCUS_15130 13180 11963 gene locus_tag LOCUS_15140 13180 11963 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834638.1 protein_id gnl|my_center|LOCUS_15140 13330 13824 gene locus_tag LOCUS_15150 13330 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15150 14289 14783 gene locus_tag LOCUS_15160 14289 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence35 868 446 gene locus_tag LOCUS_15170 868 446 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390747.1 protein_id gnl|my_center|LOCUS_15170 1094 870 gene locus_tag LOCUS_15180 1094 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055037.1 protein_id gnl|my_center|LOCUS_15180 2080 1100 gene locus_tag LOCUS_15190 2080 1100 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565539.1 protein_id gnl|my_center|LOCUS_15190 2644 2093 gene locus_tag LOCUS_15200 2644 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2895 2665 gene locus_tag LOCUS_15210 2895 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3295 2960 gene locus_tag LOCUS_15220 3295 2960 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221464.1 protein_id gnl|my_center|LOCUS_15220 3569 3288 gene locus_tag LOCUS_15230 3569 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4879 3626 gene locus_tag LOCUS_15240 4879 3626 CDS product replication initiation factor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006738730.1 protein_id gnl|my_center|LOCUS_15240 6779 5088 gene locus_tag LOCUS_15250 6779 5088 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074490.1 protein_id gnl|my_center|LOCUS_15250 7250 6795 gene locus_tag LOCUS_15260 7250 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001062569.1 protein_id gnl|my_center|LOCUS_15260 7565 7269 gene locus_tag LOCUS_15270 7565 7269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 7852 7604 gene locus_tag LOCUS_15280 7852 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 8465 8812 gene locus_tag LOCUS_15290 8465 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 8802 8975 gene locus_tag LOCUS_15300 8802 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8981 9940 gene locus_tag LOCUS_15310 8981 9940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 10354 9992 gene locus_tag LOCUS_15320 10354 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 10729 11409 gene locus_tag LOCUS_15330 10729 11409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 11412 12089 gene locus_tag LOCUS_15340 11412 12089 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284674.1 protein_id gnl|my_center|LOCUS_15340 12287 12781 gene locus_tag LOCUS_15350 12287 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence36 16 225 gene locus_tag LOCUS_15360 16 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 380 694 gene locus_tag LOCUS_15370 380 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15370 1113 928 gene locus_tag LOCUS_15380 1113 928 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262253.1 protein_id gnl|my_center|LOCUS_15380 1344 2750 gene locus_tag LOCUS_15390 gene pepV 1344 2750 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922267.1 protein_id gnl|my_center|LOCUS_15390 2763 3371 gene locus_tag LOCUS_15400 2763 3371 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263204.1 protein_id gnl|my_center|LOCUS_15400 3540 3313 gene locus_tag LOCUS_15410 3540 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3727 4041 gene locus_tag LOCUS_15420 3727 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4363 4536 gene locus_tag LOCUS_15430 4363 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4604 4762 gene locus_tag LOCUS_15440 4604 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 4842 4979 gene locus_tag LOCUS_15450 4842 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 5390 6070 gene locus_tag LOCUS_15460 gene rpiA 5390 6070 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263209.1 protein_id gnl|my_center|LOCUS_15460 6196 7407 gene locus_tag LOCUS_15470 6196 7407 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000033130.1 protein_id gnl|my_center|LOCUS_15470 7968 8777 gene locus_tag LOCUS_15480 7968 8777 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000143443.1 protein_id gnl|my_center|LOCUS_15480 9190 9582 gene locus_tag LOCUS_15490 9190 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15490 9993 10484 gene locus_tag LOCUS_15500 9993 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15500 10726 10520 gene locus_tag LOCUS_15510 10726 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 11057 11767 gene locus_tag LOCUS_15520 gene deoD 11057 11767 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972499.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence37 1007 192 gene locus_tag LOCUS_15530 1007 192 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617813.1 protein_id gnl|my_center|LOCUS_15530 1909 1007 gene locus_tag LOCUS_15540 1909 1007 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263631.1 protein_id gnl|my_center|LOCUS_15540 2046 1915 gene locus_tag LOCUS_15550 2046 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2273 4405 gene locus_tag LOCUS_15560 2273 4405 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991935.1 protein_id gnl|my_center|LOCUS_15560 4898 5161 gene locus_tag LOCUS_15570 4898 5161 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985568.1 protein_id gnl|my_center|LOCUS_15570 5291 6220 gene locus_tag LOCUS_15580 gene hprK 5291 6220 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301753.1 protein_id gnl|my_center|LOCUS_15580 6220 7011 gene locus_tag LOCUS_15590 gene lgt 6220 7011 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000609732.1 protein_id gnl|my_center|LOCUS_15590 7134 7532 gene locus_tag LOCUS_15600 7134 7532 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569599.1 protein_id gnl|my_center|LOCUS_15600 7545 7979 gene locus_tag LOCUS_15610 7545 7979 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039971.1 protein_id gnl|my_center|LOCUS_15610 8302 8006 gene locus_tag LOCUS_15620 8302 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 8536 9465 gene locus_tag LOCUS_15630 8536 9465 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411174.1 protein_id gnl|my_center|LOCUS_15630 9562 10848 gene locus_tag LOCUS_15640 9562 10848 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922022.1 protein_id gnl|my_center|LOCUS_15640 11760 11221 gene locus_tag LOCUS_15650 11760 11221 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837199.1 protein_id gnl|my_center|LOCUS_15650 12145 11855 gene locus_tag LOCUS_15660 12145 11855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 12265 12477 gene locus_tag LOCUS_15670 12265 12477 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897227.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence38 <1 770 gene locus_tag LOCUS_15680 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000351633.1:tRNA epoxyqueuosine(34) reductase QueG 908 1921 gene locus_tag LOCUS_15690 gene prfB 908 1921 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096466706.1 protein_id gnl|my_center|LOCUS_15690 1994 2701 gene locus_tag LOCUS_15700 gene ftsE 1994 2701 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263537.1 protein_id gnl|my_center|LOCUS_15700 2694 3623 gene locus_tag LOCUS_15710 gene ftsX 2694 3623 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895888.1 protein_id gnl|my_center|LOCUS_15710 3779 4261 gene locus_tag LOCUS_15720 3779 4261 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163512.1 protein_id gnl|my_center|LOCUS_15720 4272 5450 gene locus_tag LOCUS_15730 4272 5450 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263090.1 protein_id gnl|my_center|LOCUS_15730 5458 6669 gene locus_tag LOCUS_15740 5458 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934874.1 protein_id gnl|my_center|LOCUS_15740 6792 7349 gene locus_tag LOCUS_15750 gene lepB 6792 7349 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984449.1 protein_id gnl|my_center|LOCUS_15750 7556 8779 gene locus_tag LOCUS_15760 gene pepT 7556 8779 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222027.1 protein_id gnl|my_center|LOCUS_15760 8836 9336 gene locus_tag LOCUS_15770 8836 9336 CDS product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263332.1 protein_id gnl|my_center|LOCUS_15770 9563 10192 gene locus_tag LOCUS_15780 9563 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 10213 10893 gene locus_tag LOCUS_15790 gene cmk 10213 10893 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918748.1 protein_id gnl|my_center|LOCUS_15790 11053 11583 gene locus_tag LOCUS_15800 gene infC 11053 11583 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691023.1 protein_id gnl|my_center|LOCUS_15800 11622 11822 gene locus_tag LOCUS_15810 gene rpmI 11622 11822 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263327.1 protein_id gnl|my_center|LOCUS_15810 11879 12238 gene locus_tag LOCUS_15820 11879 12238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence39 348 97 gene locus_tag LOCUS_15830 348 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1878 532 gene locus_tag LOCUS_15840 gene asnS 1878 532 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000038470.1 protein_id gnl|my_center|LOCUS_15840 3096 1915 gene locus_tag LOCUS_15850 3096 1915 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922154.1 protein_id gnl|my_center|LOCUS_15850 3583 3101 gene locus_tag LOCUS_15860 3583 3101 CDS product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922751.1 protein_id gnl|my_center|LOCUS_15860 6214 3728 gene locus_tag LOCUS_15870 6214 3728 CDS product bifunctional DnaQ family exonuclease/ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002274023.1 protein_id gnl|my_center|LOCUS_15870 6310 6945 gene locus_tag LOCUS_15880 6310 6945 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263539.1 protein_id gnl|my_center|LOCUS_15880 8005 7049 gene locus_tag LOCUS_15890 8005 7049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029122.1 protein_id gnl|my_center|LOCUS_15890 9074 8007 gene locus_tag LOCUS_15900 9074 8007 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036988.1 protein_id gnl|my_center|LOCUS_15900 10605 9067 gene locus_tag LOCUS_15910 10605 9067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935272.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence40 3337 1550 gene locus_tag LOCUS_15920 gene uvrC 3337 1550 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003952.1 protein_id gnl|my_center|LOCUS_15920 4092 3397 gene locus_tag LOCUS_15930 4092 3397 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499433.1 protein_id gnl|my_center|LOCUS_15930 4370 5041 gene locus_tag LOCUS_15940 gene sdaAB 4370 5041 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838912.1 protein_id gnl|my_center|LOCUS_15940 5054 5923 gene locus_tag LOCUS_15950 gene sdaAA 5054 5923 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028043.1 protein_id gnl|my_center|LOCUS_15950 7215 6646 gene locus_tag LOCUS_15960 7215 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 8142 7351 gene locus_tag LOCUS_15970 8142 7351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760733.1 protein_id gnl|my_center|LOCUS_15970 8962 8390 gene locus_tag LOCUS_15980 8962 8390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15980 9511 9344 gene locus_tag LOCUS_15990 9511 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15990 9781 9527 gene locus_tag LOCUS_16000 9781 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16000 >Feature sequence41 178 1011 gene locus_tag LOCUS_16010 178 1011 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262932.1 protein_id gnl|my_center|LOCUS_16010 1029 1727 gene locus_tag LOCUS_16020 1029 1727 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262933.1 protein_id gnl|my_center|LOCUS_16020 1739 2389 gene locus_tag LOCUS_16030 1739 2389 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262934.1 protein_id gnl|my_center|LOCUS_16030 3342 2461 gene locus_tag LOCUS_16040 3342 2461 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262935.1 protein_id gnl|my_center|LOCUS_16040 3592 3404 gene locus_tag LOCUS_16050 3592 3404 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262936.1 protein_id gnl|my_center|LOCUS_16050 4865 3594 gene locus_tag LOCUS_16060 gene murA 4865 3594 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262937.1 protein_id gnl|my_center|LOCUS_16060 6372 5359 gene locus_tag LOCUS_16070 gene galE 6372 5359 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_16070 7967 6387 gene locus_tag LOCUS_16080 7967 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 8337 7924 gene locus_tag LOCUS_16090 8337 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 8745 8365 gene locus_tag LOCUS_16100 8745 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16100 <10368 8735 gene locus_tag LOCUS_16110 <10368 8735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003159093.1:spore coat protein CotH >Feature sequence42 144 524 gene locus_tag LOCUS_16120 144 524 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140422.1 protein_id gnl|my_center|LOCUS_16120 699 1352 gene locus_tag LOCUS_16130 gene queC 699 1352 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828762.1 protein_id gnl|my_center|LOCUS_16130 1352 1795 gene locus_tag LOCUS_16140 gene queD 1352 1795 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464576.1 protein_id gnl|my_center|LOCUS_16140 1788 2504 gene locus_tag LOCUS_16150 gene queE 1788 2504 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196451.1 protein_id gnl|my_center|LOCUS_16150 2624 3115 gene locus_tag LOCUS_16160 gene queF 2624 3115 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000082587.1 protein_id gnl|my_center|LOCUS_16160 3936 4124 gene locus_tag LOCUS_16170 3936 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4329 5099 gene locus_tag LOCUS_16180 4329 5099 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227144.1 protein_id gnl|my_center|LOCUS_16180 5080 5970 gene locus_tag LOCUS_16190 gene rapZ 5080 5970 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278848.1 protein_id gnl|my_center|LOCUS_16190 5967 6941 gene locus_tag LOCUS_16200 5967 6941 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985431.1 protein_id gnl|my_center|LOCUS_16200 6938 7849 gene locus_tag LOCUS_16210 gene whiA 6938 7849 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011316.1 protein_id gnl|my_center|LOCUS_16210 7867 8088 gene locus_tag LOCUS_16220 7867 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16220 8138 8860 gene locus_tag LOCUS_16230 8138 8860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16230 9160 9360 gene locus_tag LOCUS_16240 9160 9360 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_16240 9565 9840 gene locus_tag LOCUS_16250 9565 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence43 735 409 gene locus_tag LOCUS_16260 735 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16260 1109 732 gene locus_tag LOCUS_16270 1109 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16270 1364 1137 gene locus_tag LOCUS_16280 1364 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16280 1467 1649 gene locus_tag LOCUS_16290 1467 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16290 1843 2730 gene locus_tag LOCUS_16300 1843 2730 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906424.1 protein_id gnl|my_center|LOCUS_16300 3152 2997 gene locus_tag LOCUS_16310 3152 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3347 3541 gene locus_tag LOCUS_16320 3347 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3610 4053 gene locus_tag LOCUS_16330 3610 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16330 4864 4364 gene locus_tag LOCUS_16340 4864 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16340 5215 6759 gene locus_tag LOCUS_16350 5215 6759 CDS product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263144.1 protein_id gnl|my_center|LOCUS_16350 6975 7373 gene locus_tag LOCUS_16360 6975 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 7534 7833 gene locus_tag LOCUS_16370 7534 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 8895 7888 gene locus_tag LOCUS_16380 8895 7888 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922256.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence44 421 1260 gene locus_tag LOCUS_16390 421 1260 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002281358.1 protein_id gnl|my_center|LOCUS_16390 2030 1284 gene locus_tag LOCUS_16400 2030 1284 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566209.1 protein_id gnl|my_center|LOCUS_16400 4823 2139 gene locus_tag LOCUS_16410 4823 2139 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910746.1 protein_id gnl|my_center|LOCUS_16410 5475 5089 gene locus_tag LOCUS_16420 5475 5089 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764120.1 protein_id gnl|my_center|LOCUS_16420 5884 5567 gene locus_tag LOCUS_16430 5884 5567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16430 6181 5936 gene locus_tag LOCUS_16440 6181 5936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16440 6653 7462 gene locus_tag LOCUS_16450 gene yidA 6653 7462 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000023518.1 protein_id gnl|my_center|LOCUS_16450 7464 8678 gene locus_tag LOCUS_16460 7464 8678 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900648.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence45 1121 513 gene locus_tag LOCUS_16470 gene hisH 1121 513 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263178.1 protein_id gnl|my_center|LOCUS_16470 1735 1118 gene locus_tag LOCUS_16480 gene hisB 1735 1118 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263176.1 protein_id gnl|my_center|LOCUS_16480 3005 1722 gene locus_tag LOCUS_16490 gene hisD 3005 1722 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263174.1 protein_id gnl|my_center|LOCUS_16490 3652 3002 gene locus_tag LOCUS_16500 gene hisG 3652 3002 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263173.1 protein_id gnl|my_center|LOCUS_16500 4625 3645 gene locus_tag LOCUS_16510 4625 3645 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263172.1 protein_id gnl|my_center|LOCUS_16510 5674 4622 gene locus_tag LOCUS_16520 gene hisC 5674 4622 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837142.1 protein_id gnl|my_center|LOCUS_16520 6166 6029 gene locus_tag LOCUS_16530 6166 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence46 641 156 gene locus_tag LOCUS_16540 641 156 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_16540 1090 641 gene locus_tag LOCUS_16550 1090 641 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_16550 1594 1187 gene locus_tag LOCUS_16560 1594 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16560 2033 1536 gene locus_tag LOCUS_16570 2033 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16570 2302 2090 gene locus_tag LOCUS_16580 2302 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3702 2335 gene locus_tag LOCUS_16590 3702 2335 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936357.1 protein_id gnl|my_center|LOCUS_16590 4499 3759 gene locus_tag LOCUS_16600 4499 3759 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197405.1 protein_id gnl|my_center|LOCUS_16600 5201 4509 gene locus_tag LOCUS_16610 5201 4509 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001033073.1 protein_id gnl|my_center|LOCUS_16610 5938 5210 gene locus_tag LOCUS_16620 5938 5210 CDS product tyrosine-protein phosphatase CpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565383.1 protein_id gnl|my_center|LOCUS_16620 5842 5851 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence47 1494 1802 gene locus_tag LOCUS_16630 1494 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837265.1 protein_id gnl|my_center|LOCUS_16630 1904 2293 gene locus_tag LOCUS_16640 1904 2293 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811442.1 protein_id gnl|my_center|LOCUS_16640 5201 2316 gene locus_tag LOCUS_16650 5201 2316 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476344.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence48 1293 961 gene locus_tag LOCUS_16660 1293 961 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262221.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16660 1675 1280 gene locus_tag LOCUS_16670 1675 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16670 1899 1687 gene locus_tag LOCUS_16680 1899 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 2815 2015 gene locus_tag LOCUS_16690 2815 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 3206 2796 gene locus_tag LOCUS_16700 3206 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16700 3835 3245 gene locus_tag LOCUS_16710 3835 3245 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002661.1 protein_id gnl|my_center|LOCUS_16710 4160 5080 gene locus_tag LOCUS_16720 gene coaA 4160 5080 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001058331.1 protein_id gnl|my_center|LOCUS_16720 5149 5385 gene locus_tag LOCUS_16730 gene rpsT 5149 5385 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274000.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence49 387 1265 gene locus_tag LOCUS_16740 387 1265 CDS product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836939.1 protein_id gnl|my_center|LOCUS_16740 1271 2476 gene locus_tag LOCUS_16750 gene efeB 1271 2476 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836940.1 protein_id gnl|my_center|LOCUS_16750 2454 4139 gene locus_tag LOCUS_16760 2454 4139 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900389.1 protein_id gnl|my_center|LOCUS_16760 4147 4854 gene locus_tag LOCUS_16770 gene tatC 4147 4854 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375157.1 protein_id gnl|my_center|LOCUS_16770 4867 5055 gene locus_tag LOCUS_16780 4867 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence50 243 1385 gene locus_tag LOCUS_16790 gene tgt 243 1385 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027316.1 protein_id gnl|my_center|LOCUS_16790 1743 1928 gene locus_tag LOCUS_16800 1743 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16800 2025 2420 gene locus_tag LOCUS_16810 2025 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16810 2478 3083 gene locus_tag LOCUS_16820 2478 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16820 3268 3353 gene locus_tag LOCUS_t00250 3268 3353 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3500 4381 gene locus_tag LOCUS_16830 3500 4381 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263577.1 protein_id gnl|my_center|LOCUS_16830 5238 4465 gene locus_tag LOCUS_16840 5238 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence51 583 789 gene locus_tag LOCUS_16850 583 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 789 1859 gene locus_tag LOCUS_16860 789 1859 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922335.1 protein_id gnl|my_center|LOCUS_16860 1977 3515 gene locus_tag LOCUS_16870 1977 3515 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922336.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence52 <1 1360 gene locus_tag LOCUS_16880 <1 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000771251.1:oligosaccharide flippase family protein 1371 2471 gene locus_tag LOCUS_16890 gene glf 1371 2471 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272526.1 protein_id gnl|my_center|LOCUS_16890 2568 3461 gene locus_tag LOCUS_16900 2568 3461 CDS product stealth family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225420236.1 protein_id gnl|my_center|LOCUS_16900 3472 4524 gene locus_tag LOCUS_16910 3472 4524 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence53 1506 769 gene locus_tag LOCUS_16920 1506 769 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262960.1 protein_id gnl|my_center|LOCUS_16920 2384 1503 gene locus_tag LOCUS_16930 2384 1503 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262961.1 protein_id gnl|my_center|LOCUS_16930 2556 2377 gene locus_tag LOCUS_16940 2556 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 2776 2567 gene locus_tag LOCUS_16950 2776 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262964.1 protein_id gnl|my_center|LOCUS_16950 3177 2926 gene locus_tag LOCUS_16960 3177 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence54 1584 133 gene locus_tag LOCUS_16970 gene pelG 1584 133 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091283.1 protein_id gnl|my_center|LOCUS_16970 2987 1584 gene locus_tag LOCUS_16980 gene pelF 2987 1584 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964052.1 protein_id gnl|my_center|LOCUS_16980 <4133 3010 gene locus_tag LOCUS_16990 <4133 3010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964051.1:DUF2194 domain-containing protein >Feature sequence55 683 1390 gene locus_tag LOCUS_17000 gene yycF 683 1390 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985645.1 protein_id gnl|my_center|LOCUS_17000 1383 2723 gene locus_tag LOCUS_17010 gene vicK 1383 2723 CDS product cell wall metabolism sensor histidine kinase VicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065468.1 protein_id gnl|my_center|LOCUS_17010 2711 3541 gene locus_tag LOCUS_17020 2711 3541 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004959.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence56 <3418 1042 gene locus_tag LOCUS_17030 <3418 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263395.1:HsdR family type I site-specific deoxyribonuclease >Feature sequence57 1269 130 gene locus_tag LOCUS_17040 1269 130 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002911106.1 protein_id gnl|my_center|LOCUS_17040 1459 1271 gene locus_tag LOCUS_17050 1459 1271 CDS product DUF3173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184042.1 protein_id gnl|my_center|LOCUS_17050 2088 1471 gene locus_tag LOCUS_17060 2088 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17060 2448 2092 gene locus_tag LOCUS_17070 2448 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence58 1406 138 gene locus_tag LOCUS_17080 gene dltD 1406 138 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002919976.1 protein_id gnl|my_center|LOCUS_17080 1638 1399 gene locus_tag LOCUS_17090 gene dltC 1638 1399 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894204.1 protein_id gnl|my_center|LOCUS_17090 <2674 1656 gene locus_tag LOCUS_17100 <2674 1656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009659556.1:D-alanyl-lipoteichoic acid biosynthesis protein DltB >Feature sequence59 1608 1294 gene locus_tag LOCUS_17110 gene hisE 1608 1294 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265591.1 protein_id gnl|my_center|LOCUS_17110 1955 1617 gene locus_tag LOCUS_17120 gene hisI 1955 1617 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263181.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence60 41 1813 gene locus_tag LOCUS_17130 41 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence61 704 1348 gene locus_tag LOCUS_17140 704 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1437 1559 gene locus_tag LOCUS_17150 1437 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17150 1578 1871 gene locus_tag LOCUS_17160 1578 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17160 >Feature sequence62 1280 81 gene locus_tag LOCUS_17170 1280 81 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896645.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence63 >Feature sequence64 475 1404 gene locus_tag LOCUS_17180 475 1404 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143046.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence65 <1 1007 gene locus_tag LOCUS_17190 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002937767.1:dihydrolipoamide acetyltransferase >Feature sequence66 <1194 483 gene locus_tag LOCUS_17200 <1194 483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109317.1:type I restriction-modification system subunit M >Feature sequence67 322 182 gene locus_tag LOCUS_17210 322 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 470 294 gene locus_tag LOCUS_17220 470 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 695 516 gene locus_tag LOCUS_17230 695 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence68 >Feature sequence69 659 348 gene locus_tag LOCUS_17240 659 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence70 >Feature sequence71 >Feature sequence72