>Feature sequence001 247 753 gene locus_tag LOCUS_00010 247 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 797 2665 gene locus_tag LOCUS_00020 797 2665 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077625.1 protein_id gnl|my_center|LOCUS_00020 2717 4351 gene locus_tag LOCUS_00030 2717 4351 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301524.1 protein_id gnl|my_center|LOCUS_00030 4341 4604 gene locus_tag LOCUS_00040 4341 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4604 5917 gene locus_tag LOCUS_00050 4604 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5985 6359 gene locus_tag LOCUS_00060 5985 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6432 7475 gene locus_tag LOCUS_00070 6432 7475 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104533.1 protein_id gnl|my_center|LOCUS_00070 7533 7949 gene locus_tag LOCUS_00080 7533 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7956 8753 gene locus_tag LOCUS_00090 7956 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8750 9265 gene locus_tag LOCUS_00100 8750 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9279 9710 gene locus_tag LOCUS_00110 9279 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9732 10133 gene locus_tag LOCUS_00120 9732 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10138 11031 gene locus_tag LOCUS_00130 10138 11031 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038101.1 protein_id gnl|my_center|LOCUS_00130 11033 11605 gene locus_tag LOCUS_00140 11033 11605 CDS product phage tail protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852584.1 protein_id gnl|my_center|LOCUS_00140 11605 12603 gene locus_tag LOCUS_00150 11605 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12687 13919 gene locus_tag LOCUS_00160 12687 13919 CDS product phage tail sheath protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531063.1 protein_id gnl|my_center|LOCUS_00160 13983 14522 gene locus_tag LOCUS_00170 13983 14522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 14534 14821 gene locus_tag LOCUS_00180 14534 14821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 14973 17366 gene locus_tag LOCUS_00190 14973 17366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 17371 17802 gene locus_tag LOCUS_00200 17371 17802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 17802 18035 gene locus_tag LOCUS_00210 17802 18035 CDS product tail protein X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003609.1 protein_id gnl|my_center|LOCUS_00210 18048 19055 gene locus_tag LOCUS_00220 18048 19055 CDS product phage late control D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038112.1 protein_id gnl|my_center|LOCUS_00220 19071 20213 gene locus_tag LOCUS_00230 19071 20213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 20279 20560 gene locus_tag LOCUS_00240 20279 20560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 20560 20781 gene locus_tag LOCUS_00250 20560 20781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 20778 21176 gene locus_tag LOCUS_00260 20778 21176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 21252 21842 gene locus_tag LOCUS_00270 21252 21842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 21845 22300 gene locus_tag LOCUS_00280 21845 22300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 22323 22739 gene locus_tag LOCUS_00290 22323 22739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 22836 24965 gene locus_tag LOCUS_00300 22836 24965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 26767 24980 gene locus_tag LOCUS_00310 26767 24980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 27317 26802 gene locus_tag LOCUS_00320 27317 26802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 27741 28028 gene locus_tag LOCUS_00330 27741 28028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 28028 30199 gene locus_tag LOCUS_00340 28028 30199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 30201 31502 gene locus_tag LOCUS_00350 30201 31502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32043 32852 gene locus_tag LOCUS_00360 32043 32852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33336 32968 gene locus_tag LOCUS_00370 33336 32968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 >Feature sequence002 <1 605 gene locus_tag LOCUS_00380 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336966.1:phenylalanine--tRNA ligase subunit beta 653 2248 gene locus_tag LOCUS_00390 653 2248 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529566.1 protein_id gnl|my_center|LOCUS_00390 2949 2245 gene locus_tag LOCUS_00400 2949 2245 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526980.1 protein_id gnl|my_center|LOCUS_00400 3036 3467 gene locus_tag LOCUS_00410 gene mscL 3036 3467 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338438.1 protein_id gnl|my_center|LOCUS_00410 4593 3475 gene locus_tag LOCUS_00420 gene ald 4593 3475 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338437.1 protein_id gnl|my_center|LOCUS_00420 4726 5187 gene locus_tag LOCUS_00430 4726 5187 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338436.1 protein_id gnl|my_center|LOCUS_00430 5271 6371 gene locus_tag LOCUS_00440 5271 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 6705 6499 gene locus_tag LOCUS_00450 gene rpsU 6705 6499 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720900.1 protein_id gnl|my_center|LOCUS_00450 6806 7465 gene locus_tag LOCUS_00460 6806 7465 CDS product COQ9 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720899.1 protein_id gnl|my_center|LOCUS_00460 7462 8454 gene locus_tag LOCUS_00470 7462 8454 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720898.1 protein_id gnl|my_center|LOCUS_00470 8604 9353 gene locus_tag LOCUS_00480 8604 9353 CDS product DUF1013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720896.1 protein_id gnl|my_center|LOCUS_00480 9403 10797 gene locus_tag LOCUS_00490 9403 10797 CDS product glycosyltransferase family 61 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486288.1 protein_id gnl|my_center|LOCUS_00490 13416 10783 gene locus_tag LOCUS_00500 gene mutS 13416 10783 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338798.1 protein_id gnl|my_center|LOCUS_00500 15166 13493 gene locus_tag LOCUS_00510 15166 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 15929 15174 gene locus_tag LOCUS_00520 15929 15174 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307144.1 protein_id gnl|my_center|LOCUS_00520 16137 18419 gene locus_tag LOCUS_00530 16137 18419 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139995.1 protein_id gnl|my_center|LOCUS_00530 18609 19202 gene locus_tag LOCUS_00540 gene pncA 18609 19202 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338913.1 protein_id gnl|my_center|LOCUS_00540 19199 20506 gene locus_tag LOCUS_00550 gene pncB 19199 20506 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338912.1 protein_id gnl|my_center|LOCUS_00550 22240 20582 gene locus_tag LOCUS_00560 22240 20582 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337405.1 protein_id gnl|my_center|LOCUS_00560 >Feature sequence003 21 452 gene locus_tag LOCUS_00570 21 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 835 449 gene locus_tag LOCUS_00580 835 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00580 2427 832 gene locus_tag LOCUS_00590 2427 832 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537791.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00590 3590 2433 gene locus_tag LOCUS_00600 3590 2433 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338467.1 protein_id gnl|my_center|LOCUS_00600 5035 3695 gene locus_tag LOCUS_00610 5035 3695 CDS product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537790.1 protein_id gnl|my_center|LOCUS_00610 5264 5857 gene locus_tag LOCUS_00620 5264 5857 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338466.1 protein_id gnl|my_center|LOCUS_00620 6029 7147 gene locus_tag LOCUS_00630 gene ribB 6029 7147 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561762.1 protein_id gnl|my_center|LOCUS_00630 7149 7691 gene locus_tag LOCUS_00640 7149 7691 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720942.1 protein_id gnl|my_center|LOCUS_00640 7688 8158 gene locus_tag LOCUS_00650 gene nusB 7688 8158 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841646.1 protein_id gnl|my_center|LOCUS_00650 8231 8560 gene locus_tag LOCUS_00660 8231 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338464.1 protein_id gnl|my_center|LOCUS_00660 8886 9836 gene locus_tag LOCUS_00670 8886 9836 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338463.1 protein_id gnl|my_center|LOCUS_00670 10208 10660 gene locus_tag LOCUS_00680 10208 10660 CDS product MmcB family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139947.1 protein_id gnl|my_center|LOCUS_00680 12384 11071 gene locus_tag LOCUS_00690 12384 11071 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085906.1 protein_id gnl|my_center|LOCUS_00690 13046 12381 gene locus_tag LOCUS_00700 gene feuP 13046 12381 CDS product two-component system response regulator FeuP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527364.1 protein_id gnl|my_center|LOCUS_00700 13467 13069 gene locus_tag LOCUS_00710 13467 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 13607 14482 gene locus_tag LOCUS_00720 13607 14482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 15062 14649 gene locus_tag LOCUS_00730 15062 14649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 15379 15161 gene locus_tag LOCUS_00740 15379 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 16673 15984 gene locus_tag LOCUS_00750 gene gph 16673 15984 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338841.1 protein_id gnl|my_center|LOCUS_00750 17230 16676 gene locus_tag LOCUS_00760 17230 16676 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532060.1 protein_id gnl|my_center|LOCUS_00760 17988 18536 gene locus_tag LOCUS_00770 17988 18536 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967909.1 protein_id gnl|my_center|LOCUS_00770 19768 20091 gene locus_tag LOCUS_00780 19768 20091 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336987.1 protein_id gnl|my_center|LOCUS_00780 20157 21044 gene locus_tag LOCUS_00790 20157 21044 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338243.1 protein_id gnl|my_center|LOCUS_00790 22996 21395 gene locus_tag LOCUS_00800 22996 21395 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165448192.1 protein_id gnl|my_center|LOCUS_00800 >Feature sequence004 275 1288 gene locus_tag LOCUS_00810 275 1288 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_00810 1557 1300 gene locus_tag LOCUS_00820 1557 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 1663 2604 gene locus_tag LOCUS_00830 1663 2604 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055083367.1 protein_id gnl|my_center|LOCUS_00830 2986 2612 gene locus_tag LOCUS_00840 2986 2612 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139977.1 protein_id gnl|my_center|LOCUS_00840 4574 2997 gene locus_tag LOCUS_00850 4574 2997 CDS product DUF5928 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537864.1 protein_id gnl|my_center|LOCUS_00850 4735 5553 gene locus_tag LOCUS_00860 4735 5553 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383017.1 protein_id gnl|my_center|LOCUS_00860 7011 5656 gene locus_tag LOCUS_00870 gene hemN 7011 5656 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338424.1 protein_id gnl|my_center|LOCUS_00870 7048 7812 gene locus_tag LOCUS_00880 gene fnrL 7048 7812 CDS product Crp/Fnr family transcriptional regulator FnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720880.1 protein_id gnl|my_center|LOCUS_00880 8703 7864 gene locus_tag LOCUS_00890 8703 7864 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720879.1 protein_id gnl|my_center|LOCUS_00890 8935 10539 gene locus_tag LOCUS_00900 gene ccoN 8935 10539 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338423.1 protein_id gnl|my_center|LOCUS_00900 10555 11280 gene locus_tag LOCUS_00910 gene ccoO 10555 11280 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720877.1 protein_id gnl|my_center|LOCUS_00910 11294 11497 gene locus_tag LOCUS_00920 11294 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 11497 12603 gene locus_tag LOCUS_00930 gene ccoP 11497 12603 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338422.1 protein_id gnl|my_center|LOCUS_00930 12872 14344 gene locus_tag LOCUS_00940 gene ccoG 12872 14344 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338421.1 protein_id gnl|my_center|LOCUS_00940 14334 14798 gene locus_tag LOCUS_00950 14334 14798 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338420.1 protein_id gnl|my_center|LOCUS_00950 14795 16996 gene locus_tag LOCUS_00960 14795 16996 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338419.1 protein_id gnl|my_center|LOCUS_00960 16996 17181 gene locus_tag LOCUS_00970 gene ccoS 16996 17181 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720871.1 protein_id gnl|my_center|LOCUS_00970 19224 17629 gene locus_tag LOCUS_00980 19224 17629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 19429 19776 gene locus_tag LOCUS_00990 gene clpS 19429 19776 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338417.1 protein_id gnl|my_center|LOCUS_00990 19778 20767 gene locus_tag LOCUS_01000 19778 20767 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338416.1 protein_id gnl|my_center|LOCUS_01000 21174 20764 gene locus_tag LOCUS_01010 21174 20764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338415.1 protein_id gnl|my_center|LOCUS_01010 >Feature sequence005 1031 384 gene locus_tag LOCUS_01020 1031 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 1341 1123 gene locus_tag LOCUS_01030 1341 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1621 1959 gene locus_tag LOCUS_01040 1621 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 1883 2653 gene locus_tag LOCUS_01050 1883 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 2669 2971 gene locus_tag LOCUS_01060 2669 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3009 3224 gene locus_tag LOCUS_01070 3009 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3217 5568 gene locus_tag LOCUS_01080 3217 5568 CDS product VirB4 family type IV secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920277.1 protein_id gnl|my_center|LOCUS_01080 5694 6848 gene locus_tag LOCUS_01090 5694 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 6845 7636 gene locus_tag LOCUS_01100 6845 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7633 8463 gene locus_tag LOCUS_01110 7633 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 8463 9494 gene locus_tag LOCUS_01120 8463 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 9528 10214 gene locus_tag LOCUS_01130 9528 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 10211 10942 gene locus_tag LOCUS_01140 gene virB9 10211 10942 CDS product P-type conjugative transfer protein VirB9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971094.1 protein_id gnl|my_center|LOCUS_01140 10942 12324 gene locus_tag LOCUS_01150 10942 12324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 12324 13322 gene locus_tag LOCUS_01160 12324 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 15442 13319 gene locus_tag LOCUS_01170 15442 13319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 17287 15455 gene locus_tag LOCUS_01180 17287 15455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 17828 17280 gene locus_tag LOCUS_01190 17828 17280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 18512 19237 gene locus_tag LOCUS_01200 18512 19237 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804567.1 protein_id gnl|my_center|LOCUS_01200 19237 20022 gene locus_tag LOCUS_01210 19237 20022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 20378 20593 gene locus_tag LOCUS_01220 20378 20593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 20790 20590 gene locus_tag LOCUS_01230 20790 20590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 >Feature sequence006 2946 1747 gene locus_tag LOCUS_01240 2946 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 3902 2937 gene locus_tag LOCUS_01250 3902 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 4368 3895 gene locus_tag LOCUS_01260 4368 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4694 4365 gene locus_tag LOCUS_01270 4694 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 4936 4691 gene locus_tag LOCUS_01280 4936 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 5942 5334 gene locus_tag LOCUS_01290 5942 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 6085 6441 gene locus_tag LOCUS_01300 6085 6441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 6434 6832 gene locus_tag LOCUS_01310 6434 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 6990 7298 gene locus_tag LOCUS_01320 6990 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 7295 7825 gene locus_tag LOCUS_01330 7295 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 7886 10117 gene locus_tag LOCUS_01340 7886 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 10114 10578 gene locus_tag LOCUS_01350 10114 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 10575 10823 gene locus_tag LOCUS_01360 10575 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 10820 11062 gene locus_tag LOCUS_01370 10820 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 11301 12338 gene locus_tag LOCUS_01380 11301 12338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 12335 13153 gene locus_tag LOCUS_01390 12335 13153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 13150 14277 gene locus_tag LOCUS_01400 13150 14277 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173081.1 protein_id gnl|my_center|LOCUS_01400 14292 14837 gene locus_tag LOCUS_01410 14292 14837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 15077 15433 gene locus_tag LOCUS_01420 15077 15433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 15433 15621 gene locus_tag LOCUS_01430 15433 15621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 15618 18260 gene locus_tag LOCUS_01440 15618 18260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 18257 18436 gene locus_tag LOCUS_01450 18257 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 18433 19278 gene locus_tag LOCUS_01460 18433 19278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 19242 19703 gene locus_tag LOCUS_01470 19242 19703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence007 439 191 gene locus_tag LOCUS_01480 439 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 541 1431 gene locus_tag LOCUS_01490 gene gcvA 541 1431 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528412.1 protein_id gnl|my_center|LOCUS_01490 2275 1493 gene locus_tag LOCUS_01500 2275 1493 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140204.1 protein_id gnl|my_center|LOCUS_01500 2421 2957 gene locus_tag LOCUS_01510 2421 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 3263 5122 gene locus_tag LOCUS_01520 3263 5122 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337750.1 protein_id gnl|my_center|LOCUS_01520 5213 5569 gene locus_tag LOCUS_01530 5213 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 5929 5591 gene locus_tag LOCUS_01540 5929 5591 CDS product DUF2794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721547.1 protein_id gnl|my_center|LOCUS_01540 6313 6041 gene locus_tag LOCUS_01550 6313 6041 CDS product I78 family peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722114.1 protein_id gnl|my_center|LOCUS_01550 6660 6325 gene locus_tag LOCUS_01560 6660 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 7411 6806 gene locus_tag LOCUS_01570 7411 6806 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338540.1 protein_id gnl|my_center|LOCUS_01570 7561 9078 gene locus_tag LOCUS_01580 7561 9078 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_01580 10611 9358 gene locus_tag LOCUS_01590 10611 9358 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060563250.1 protein_id gnl|my_center|LOCUS_01590 11273 10608 gene locus_tag LOCUS_01600 gene bioD 11273 10608 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973493.1 protein_id gnl|my_center|LOCUS_01600 12409 11258 gene locus_tag LOCUS_01610 12409 11258 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533325.1 protein_id gnl|my_center|LOCUS_01610 13449 12406 gene locus_tag LOCUS_01620 gene bioB 13449 12406 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533324.1 protein_id gnl|my_center|LOCUS_01620 13620 14609 gene locus_tag LOCUS_01630 13620 14609 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719369.1 protein_id gnl|my_center|LOCUS_01630 14620 16185 gene locus_tag LOCUS_01640 14620 16185 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337315.1 protein_id gnl|my_center|LOCUS_01640 16251 16469 gene locus_tag LOCUS_01650 16251 16469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 16489 17571 gene locus_tag LOCUS_01660 16489 17571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337314.1 protein_id gnl|my_center|LOCUS_01660 17571 18536 gene locus_tag LOCUS_01670 17571 18536 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669233.1 protein_id gnl|my_center|LOCUS_01670 18520 19314 gene locus_tag LOCUS_01680 18520 19314 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719365.1 protein_id gnl|my_center|LOCUS_01680 >Feature sequence008 3316 2423 gene locus_tag LOCUS_01690 3316 2423 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337872.1 protein_id gnl|my_center|LOCUS_01690 3455 6865 gene locus_tag LOCUS_01700 3455 6865 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337871.1 protein_id gnl|my_center|LOCUS_01700 6956 7768 gene locus_tag LOCUS_01710 6956 7768 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337870.1 protein_id gnl|my_center|LOCUS_01710 7796 8230 gene locus_tag LOCUS_01720 gene ccmE 7796 8230 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720104.1 protein_id gnl|my_center|LOCUS_01720 8306 8917 gene locus_tag LOCUS_01730 8306 8917 CDS product holin-associated N-acetylmuramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337867.1 protein_id gnl|my_center|LOCUS_01730 8908 9399 gene locus_tag LOCUS_01740 8908 9399 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337866.1 protein_id gnl|my_center|LOCUS_01740 9491 11443 gene locus_tag LOCUS_01750 9491 11443 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337621.1 protein_id gnl|my_center|LOCUS_01750 11440 11907 gene locus_tag LOCUS_01760 11440 11907 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337622.1 protein_id gnl|my_center|LOCUS_01760 12542 11895 gene locus_tag LOCUS_01770 12542 11895 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338219.1 protein_id gnl|my_center|LOCUS_01770 12973 12539 gene locus_tag LOCUS_01780 12973 12539 CDS product DUF983 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720584.1 protein_id gnl|my_center|LOCUS_01780 14352 13075 gene locus_tag LOCUS_01790 gene eno 14352 13075 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719649.1 protein_id gnl|my_center|LOCUS_01790 15104 14415 gene locus_tag LOCUS_01800 15104 14415 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975064.1 protein_id gnl|my_center|LOCUS_01800 16555 15143 gene locus_tag LOCUS_01810 16555 15143 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086915.1 protein_id gnl|my_center|LOCUS_01810 16667 17695 gene locus_tag LOCUS_01820 gene obgE 16667 17695 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723388.1 protein_id gnl|my_center|LOCUS_01820 17683 18801 gene locus_tag LOCUS_01830 gene proB 17683 18801 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338952.1 protein_id gnl|my_center|LOCUS_01830 19852 18896 gene locus_tag LOCUS_01840 19852 18896 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669137.1 protein_id gnl|my_center|LOCUS_01840 <20447 19883 gene locus_tag LOCUS_01850 <20447 19883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337133.1:aminopeptidase N >Feature sequence009 394 1953 gene locus_tag LOCUS_01860 gene guaA 394 1953 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565333.1 protein_id gnl|my_center|LOCUS_01860 1950 2315 gene locus_tag LOCUS_01870 1950 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 3535 2597 gene locus_tag LOCUS_01880 3535 2597 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339442.1 protein_id gnl|my_center|LOCUS_01880 4075 3545 gene locus_tag LOCUS_01890 gene ybeY 4075 3545 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339443.1 protein_id gnl|my_center|LOCUS_01890 5189 4068 gene locus_tag LOCUS_01900 5189 4068 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339444.1 protein_id gnl|my_center|LOCUS_01900 6029 5301 gene locus_tag LOCUS_01910 6029 5301 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719612.1 protein_id gnl|my_center|LOCUS_01910 6787 6026 gene locus_tag LOCUS_01920 6787 6026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719613.1 protein_id gnl|my_center|LOCUS_01920 7818 6784 gene locus_tag LOCUS_01930 gene alr 7818 6784 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384180.1 protein_id gnl|my_center|LOCUS_01930 7999 9531 gene locus_tag LOCUS_01940 7999 9531 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719342.1 protein_id gnl|my_center|LOCUS_01940 9531 10217 gene locus_tag LOCUS_01950 9531 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10396 10527 gene locus_tag LOCUS_01960 10396 10527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 10603 11007 gene locus_tag LOCUS_01970 10603 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719345.1 protein_id gnl|my_center|LOCUS_01970 11138 11380 gene locus_tag LOCUS_01980 11138 11380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 11477 11689 gene locus_tag LOCUS_01990 11477 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 11789 13834 gene locus_tag LOCUS_02000 11789 13834 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140126.1 protein_id gnl|my_center|LOCUS_02000 13963 14631 gene locus_tag LOCUS_02010 13963 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 14779 14597 gene locus_tag LOCUS_02020 14779 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 15397 14876 gene locus_tag LOCUS_02030 15397 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 15452 17590 gene locus_tag LOCUS_02040 gene scpA 15452 17590 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_02040 18440 17637 gene locus_tag LOCUS_02050 18440 17637 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096568.1 protein_id gnl|my_center|LOCUS_02050 18607 19422 gene locus_tag LOCUS_02060 18607 19422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337106.1 protein_id gnl|my_center|LOCUS_02060 19410 19928 gene locus_tag LOCUS_02070 19410 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 >Feature sequence010 <1 1245 gene locus_tag LOCUS_02080 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972360.1:Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha 1256 2773 gene locus_tag LOCUS_02090 1256 2773 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720403.1 protein_id gnl|my_center|LOCUS_02090 3405 2896 gene locus_tag LOCUS_02100 3405 2896 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721677.1 protein_id gnl|my_center|LOCUS_02100 3436 4893 gene locus_tag LOCUS_02110 3436 4893 CDS product DUF3422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565719.1 protein_id gnl|my_center|LOCUS_02110 5061 5387 gene locus_tag LOCUS_02120 5061 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720551.1 protein_id gnl|my_center|LOCUS_02120 5995 5384 gene locus_tag LOCUS_02130 5995 5384 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338232.1 protein_id gnl|my_center|LOCUS_02130 7008 6061 gene locus_tag LOCUS_02140 7008 6061 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337842.1 protein_id gnl|my_center|LOCUS_02140 8212 7211 gene locus_tag LOCUS_02150 8212 7211 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337841.1 protein_id gnl|my_center|LOCUS_02150 8365 9411 gene locus_tag LOCUS_02160 8365 9411 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389005.1 protein_id gnl|my_center|LOCUS_02160 9423 11228 gene locus_tag LOCUS_02170 9423 11228 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337683.1 protein_id gnl|my_center|LOCUS_02170 11407 12483 gene locus_tag LOCUS_02180 11407 12483 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031180.1 protein_id gnl|my_center|LOCUS_02180 12657 13136 gene locus_tag LOCUS_02190 12657 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 13140 13409 gene locus_tag LOCUS_02200 gene rpmA 13140 13409 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723383.1 protein_id gnl|my_center|LOCUS_02200 13523 14065 gene locus_tag LOCUS_02210 13523 14065 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723384.1 protein_id gnl|my_center|LOCUS_02210 14613 14116 gene locus_tag LOCUS_02220 14613 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 14759 15175 gene locus_tag LOCUS_02230 14759 15175 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337126.1 protein_id gnl|my_center|LOCUS_02230 15711 15172 gene locus_tag LOCUS_02240 15711 15172 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039274.1 protein_id gnl|my_center|LOCUS_02240 16874 15708 gene locus_tag LOCUS_02250 gene mnmA 16874 15708 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384335.1 protein_id gnl|my_center|LOCUS_02250 17026 17289 gene locus_tag LOCUS_02260 17026 17289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 17394 18107 gene locus_tag LOCUS_02270 17394 18107 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719770.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence011 222 1202 gene locus_tag LOCUS_02280 222 1202 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975404.1 protein_id gnl|my_center|LOCUS_02280 1267 2175 gene locus_tag LOCUS_02290 1267 2175 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927237.1 protein_id gnl|my_center|LOCUS_02290 3651 2179 gene locus_tag LOCUS_02300 3651 2179 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531218.1 protein_id gnl|my_center|LOCUS_02300 4418 3708 gene locus_tag LOCUS_02310 4418 3708 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561962.1 protein_id gnl|my_center|LOCUS_02310 5000 4503 gene locus_tag LOCUS_02320 5000 4503 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722912.1 protein_id gnl|my_center|LOCUS_02320 5113 5445 gene locus_tag LOCUS_02330 5113 5445 CDS product DUF2849 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337101.1 protein_id gnl|my_center|LOCUS_02330 5438 7096 gene locus_tag LOCUS_02340 5438 7096 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337100.1 protein_id gnl|my_center|LOCUS_02340 7089 8285 gene locus_tag LOCUS_02350 7089 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 8327 9178 gene locus_tag LOCUS_02360 8327 9178 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337097.1 protein_id gnl|my_center|LOCUS_02360 9462 12104 gene locus_tag LOCUS_02370 gene topA 9462 12104 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719330.1 protein_id gnl|my_center|LOCUS_02370 13908 12955 gene locus_tag LOCUS_02380 13908 12955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 14357 15061 gene locus_tag LOCUS_02390 14357 15061 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722857.1 protein_id gnl|my_center|LOCUS_02390 15063 15287 gene locus_tag LOCUS_02400 15063 15287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 15287 15916 gene locus_tag LOCUS_02410 15287 15916 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722856.1 protein_id gnl|my_center|LOCUS_02410 15991 16557 gene locus_tag LOCUS_02420 15991 16557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384896.1 protein_id gnl|my_center|LOCUS_02420 16696 17109 gene locus_tag LOCUS_02430 gene ybgC 16696 17109 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 protein_id gnl|my_center|LOCUS_02430 17551 17727 gene locus_tag LOCUS_02440 17551 17727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 17837 18529 gene locus_tag LOCUS_02450 gene tolQ 17837 18529 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720852.1 protein_id gnl|my_center|LOCUS_02450 18529 18981 gene locus_tag LOCUS_02460 gene tolR 18529 18981 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720851.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence012 631 1719 gene locus_tag LOCUS_02470 631 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 3087 1795 gene locus_tag LOCUS_02480 3087 1795 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719586.1 protein_id gnl|my_center|LOCUS_02480 3239 5071 gene locus_tag LOCUS_02490 3239 5071 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337471.1 protein_id gnl|my_center|LOCUS_02490 5088 6266 gene locus_tag LOCUS_02500 5088 6266 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 protein_id gnl|my_center|LOCUS_02500 6706 6269 gene locus_tag LOCUS_02510 6706 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 7751 6693 gene locus_tag LOCUS_02520 7751 6693 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336844.1 protein_id gnl|my_center|LOCUS_02520 8229 7744 gene locus_tag LOCUS_02530 gene purE 8229 7744 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722311.1 protein_id gnl|my_center|LOCUS_02530 8504 8286 gene locus_tag LOCUS_02540 8504 8286 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336845.1 protein_id gnl|my_center|LOCUS_02540 8675 9085 gene locus_tag LOCUS_02550 8675 9085 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921793.1 protein_id gnl|my_center|LOCUS_02550 9097 9324 gene locus_tag LOCUS_02560 9097 9324 CDS product DUF1150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722317.1 protein_id gnl|my_center|LOCUS_02560 10285 9311 gene locus_tag LOCUS_02570 10285 9311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 11067 10282 gene locus_tag LOCUS_02580 11067 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329496.1 protein_id gnl|my_center|LOCUS_02580 12855 11137 gene locus_tag LOCUS_02590 12855 11137 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_02590 13956 12988 gene locus_tag LOCUS_02600 gene trxB 13956 12988 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722320.1 protein_id gnl|my_center|LOCUS_02600 14097 14591 gene locus_tag LOCUS_02610 14097 14591 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722321.1 protein_id gnl|my_center|LOCUS_02610 15359 14595 gene locus_tag LOCUS_02620 gene pgeF 15359 14595 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336849.1 protein_id gnl|my_center|LOCUS_02620 16425 15364 gene locus_tag LOCUS_02630 16425 15364 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140038.1 protein_id gnl|my_center|LOCUS_02630 17378 16422 gene locus_tag LOCUS_02640 gene lgt 17378 16422 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722324.1 protein_id gnl|my_center|LOCUS_02640 17411 18052 gene locus_tag LOCUS_02650 17411 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 >Feature sequence013 2054 3034 gene locus_tag LOCUS_02660 2054 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2974 3993 gene locus_tag LOCUS_02670 2974 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5877 4597 gene locus_tag LOCUS_02680 5877 4597 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972735.1 protein_id gnl|my_center|LOCUS_02680 9777 6142 gene locus_tag LOCUS_02690 9777 6142 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337531.1 protein_id gnl|my_center|LOCUS_02690 10700 10110 gene locus_tag LOCUS_02700 10700 10110 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337060.1 protein_id gnl|my_center|LOCUS_02700 12067 10685 gene locus_tag LOCUS_02710 gene mgtE 12067 10685 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722827.1 protein_id gnl|my_center|LOCUS_02710 12924 12139 gene locus_tag LOCUS_02720 12924 12139 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563818.1 protein_id gnl|my_center|LOCUS_02720 13381 13025 gene locus_tag LOCUS_02730 13381 13025 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722818.1 protein_id gnl|my_center|LOCUS_02730 13486 14544 gene locus_tag LOCUS_02740 13486 14544 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337055.1 protein_id gnl|my_center|LOCUS_02740 14626 15372 gene locus_tag LOCUS_02750 14626 15372 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537939.1 protein_id gnl|my_center|LOCUS_02750 15617 16936 gene locus_tag LOCUS_02760 15617 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 16955 17962 gene locus_tag LOCUS_02770 16955 17962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence014 342 2423 gene locus_tag LOCUS_02780 342 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 3006 2635 gene locus_tag LOCUS_02790 3006 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 3210 3569 gene locus_tag LOCUS_02800 3210 3569 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331338.1 protein_id gnl|my_center|LOCUS_02800 3924 4151 gene locus_tag LOCUS_02810 3924 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 4530 4240 gene locus_tag LOCUS_02820 4530 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 4453 4746 gene locus_tag LOCUS_02830 4453 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5851 4820 gene locus_tag LOCUS_02840 5851 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 7108 7281 gene locus_tag LOCUS_02850 7108 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7957 8268 gene locus_tag LOCUS_02860 7957 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 8740 8666 gene locus_tag LOCUS_t00010 8740 8666 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 9679 8810 gene locus_tag LOCUS_02870 9679 8810 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338062.1 protein_id gnl|my_center|LOCUS_02870 9716 11053 gene locus_tag LOCUS_02880 9716 11053 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338061.1 protein_id gnl|my_center|LOCUS_02880 11212 13629 gene locus_tag LOCUS_02890 gene lon 11212 13629 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337791.1 protein_id gnl|my_center|LOCUS_02890 13774 14136 gene locus_tag LOCUS_02900 13774 14136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 14192 14266 gene locus_tag LOCUS_t00020 14192 14266 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15140 15778 gene locus_tag LOCUS_02910 15140 15778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 15709 16173 gene locus_tag LOCUS_02920 15709 16173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 16570 16217 gene locus_tag LOCUS_02930 gene uraH 16570 16217 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013850504.1 protein_id gnl|my_center|LOCUS_02930 17066 16587 gene locus_tag LOCUS_02940 17066 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 <17781 17219 gene locus_tag LOCUS_02950 <17781 17219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028006006.1:recombinase family protein >Feature sequence015 1396 269 gene locus_tag LOCUS_02960 1396 269 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561701.1 protein_id gnl|my_center|LOCUS_02960 2714 1434 gene locus_tag LOCUS_02970 2714 1434 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976086.1 protein_id gnl|my_center|LOCUS_02970 3214 2711 gene locus_tag LOCUS_02980 3214 2711 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976087.1 protein_id gnl|my_center|LOCUS_02980 3588 3211 gene locus_tag LOCUS_02990 3588 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 4577 3585 gene locus_tag LOCUS_03000 4577 3585 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976088.1 protein_id gnl|my_center|LOCUS_03000 5048 6283 gene locus_tag LOCUS_03010 5048 6283 CDS product Hint domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382978.1 protein_id gnl|my_center|LOCUS_03010 6582 7511 gene locus_tag LOCUS_03020 gene pqqB 6582 7511 CDS product pyrroloquinoline quinone biosynthesis protein PqqB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399384.1 protein_id gnl|my_center|LOCUS_03020 7508 8251 gene locus_tag LOCUS_03030 gene pqqC 7508 8251 CDS product pyrroloquinoline-quinone synthase PqqC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969549.1 protein_id gnl|my_center|LOCUS_03030 8248 8520 gene locus_tag LOCUS_03040 gene pqqD 8248 8520 CDS product pyrroloquinoline quinone biosynthesis peptide chaperone PqqD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528708.1 protein_id gnl|my_center|LOCUS_03040 8517 9650 gene locus_tag LOCUS_03050 gene pqqE 8517 9650 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969547.1 protein_id gnl|my_center|LOCUS_03050 9900 10832 gene locus_tag LOCUS_03060 9900 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 12290 10905 gene locus_tag LOCUS_03070 12290 10905 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389054.1 protein_id gnl|my_center|LOCUS_03070 13906 12347 gene locus_tag LOCUS_03080 13906 12347 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974597.1 protein_id gnl|my_center|LOCUS_03080 14076 15005 gene locus_tag LOCUS_03090 14076 15005 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530419.1 protein_id gnl|my_center|LOCUS_03090 15088 16128 gene locus_tag LOCUS_03100 15088 16128 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530418.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence016 364 840 gene locus_tag LOCUS_03110 364 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03110 928 1221 gene locus_tag LOCUS_03120 928 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03120 1240 2022 gene locus_tag LOCUS_03130 1240 2022 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337545.1 protein_id gnl|my_center|LOCUS_03130 2731 2027 gene locus_tag LOCUS_03140 2731 2027 CDS product DUF599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563067.1 protein_id gnl|my_center|LOCUS_03140 2962 3423 gene locus_tag LOCUS_03150 2962 3423 CDS product Hsp20 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338660.1 protein_id gnl|my_center|LOCUS_03150 4003 3506 gene locus_tag LOCUS_03160 4003 3506 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531007.1 protein_id gnl|my_center|LOCUS_03160 4599 4000 gene locus_tag LOCUS_03170 gene recR 4599 4000 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720894.1 protein_id gnl|my_center|LOCUS_03170 4946 4602 gene locus_tag LOCUS_03180 4946 4602 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720893.1 protein_id gnl|my_center|LOCUS_03180 6720 4951 gene locus_tag LOCUS_03190 6720 4951 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338432.1 protein_id gnl|my_center|LOCUS_03190 6831 7754 gene locus_tag LOCUS_03200 gene nudC 6831 7754 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338430.1 protein_id gnl|my_center|LOCUS_03200 9908 7926 gene locus_tag LOCUS_03210 9908 7926 CDS product bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338431.1 protein_id gnl|my_center|LOCUS_03210 10227 10631 gene locus_tag LOCUS_03220 10227 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 11568 10648 gene locus_tag LOCUS_03230 11568 10648 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720888.1 protein_id gnl|my_center|LOCUS_03230 11766 12302 gene locus_tag LOCUS_03240 11766 12302 CDS product cytochrome c family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720887.1 protein_id gnl|my_center|LOCUS_03240 12478 12308 gene locus_tag LOCUS_03250 12478 12308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 12447 14345 gene locus_tag LOCUS_03260 12447 14345 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338427.1 protein_id gnl|my_center|LOCUS_03260 14377 15453 gene locus_tag LOCUS_03270 14377 15453 CDS product microcin C ABC transporter permease YejB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720885.1 protein_id gnl|my_center|LOCUS_03270 15450 16553 gene locus_tag LOCUS_03280 15450 16553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561816.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence017 74 1 gene locus_tag LOCUS_t00030 74 1 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 548 117 gene locus_tag LOCUS_03290 548 117 CDS product DUF1489 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339404.1 protein_id gnl|my_center|LOCUS_03290 636 1850 gene locus_tag LOCUS_03300 636 1850 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562193.1 protein_id gnl|my_center|LOCUS_03300 1988 2608 gene locus_tag LOCUS_03310 gene rpsD 1988 2608 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719445.1 protein_id gnl|my_center|LOCUS_03310 2729 3760 gene locus_tag LOCUS_03320 2729 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 3770 4594 gene locus_tag LOCUS_03330 3770 4594 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385004.1 protein_id gnl|my_center|LOCUS_03330 4591 5226 gene locus_tag LOCUS_03340 gene scpB 4591 5226 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565387.1 protein_id gnl|my_center|LOCUS_03340 5243 5461 gene locus_tag LOCUS_03350 5243 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 6543 5476 gene locus_tag LOCUS_03360 6543 5476 CDS product 2'-deoxycytidine 5'-triphosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337605.1 protein_id gnl|my_center|LOCUS_03360 6677 6600 gene locus_tag LOCUS_t00040 6677 6600 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7771 6776 gene locus_tag LOCUS_03370 7771 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 8090 7791 gene locus_tag LOCUS_03380 gene ihfA 8090 7791 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719760.1 protein_id gnl|my_center|LOCUS_03380 8282 8554 gene locus_tag LOCUS_03390 8282 8554 CDS product DksA/TraR family C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097470.1 protein_id gnl|my_center|LOCUS_03390 10040 8517 gene locus_tag LOCUS_03400 10040 8517 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331268.1 protein_id gnl|my_center|LOCUS_03400 10155 11162 gene locus_tag LOCUS_03410 10155 11162 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565859.1 protein_id gnl|my_center|LOCUS_03410 11256 11807 gene locus_tag LOCUS_03420 11256 11807 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724859.1 protein_id gnl|my_center|LOCUS_03420 11807 13147 gene locus_tag LOCUS_03430 11807 13147 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331270.1 protein_id gnl|my_center|LOCUS_03430 13165 13563 gene locus_tag LOCUS_03440 13165 13563 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331271.1 protein_id gnl|my_center|LOCUS_03440 13574 14962 gene locus_tag LOCUS_03450 13574 14962 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331272.1 protein_id gnl|my_center|LOCUS_03450 >Feature sequence018 85 390 gene locus_tag LOCUS_03460 gene nuoK 85 390 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910101.1 protein_id gnl|my_center|LOCUS_03460 398 2623 gene locus_tag LOCUS_03470 gene nuoL 398 2623 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337553.1 protein_id gnl|my_center|LOCUS_03470 2625 4172 gene locus_tag LOCUS_03480 2625 4172 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719680.1 protein_id gnl|my_center|LOCUS_03480 4182 5675 gene locus_tag LOCUS_03490 gene nuoN 4182 5675 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719681.1 protein_id gnl|my_center|LOCUS_03490 5668 6432 gene locus_tag LOCUS_03500 5668 6432 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140172.1 protein_id gnl|my_center|LOCUS_03500 6434 7213 gene locus_tag LOCUS_03510 6434 7213 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564427.1 protein_id gnl|my_center|LOCUS_03510 7206 8879 gene locus_tag LOCUS_03520 7206 8879 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719684.1 protein_id gnl|my_center|LOCUS_03520 8926 9621 gene locus_tag LOCUS_03530 8926 9621 CDS product tRNA (guanine(46)-N(7))-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339440.1 protein_id gnl|my_center|LOCUS_03530 9692 11023 gene locus_tag LOCUS_03540 gene aroA 9692 11023 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339439.1 protein_id gnl|my_center|LOCUS_03540 13042 11141 gene locus_tag LOCUS_03550 13042 11141 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140040.1 protein_id gnl|my_center|LOCUS_03550 15545 13266 gene locus_tag LOCUS_03560 15545 13266 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336861.1 protein_id gnl|my_center|LOCUS_03560 15714 16109 gene locus_tag LOCUS_03570 15714 16109 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564559.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence019 1030 536 gene locus_tag LOCUS_03580 gene ruvC 1030 536 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384899.1 protein_id gnl|my_center|LOCUS_03580 1153 3984 gene locus_tag LOCUS_03590 1153 3984 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338646.1 protein_id gnl|my_center|LOCUS_03590 3984 4346 gene locus_tag LOCUS_03600 3984 4346 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721306.1 protein_id gnl|my_center|LOCUS_03600 4343 5938 gene locus_tag LOCUS_03610 4343 5938 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338647.1 protein_id gnl|my_center|LOCUS_03610 5935 6426 gene locus_tag LOCUS_03620 5935 6426 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721310.1 protein_id gnl|my_center|LOCUS_03620 6423 6692 gene locus_tag LOCUS_03630 6423 6692 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721312.1 protein_id gnl|my_center|LOCUS_03630 6689 7093 gene locus_tag LOCUS_03640 6689 7093 CDS product Na+/H+ antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721315.1 protein_id gnl|my_center|LOCUS_03640 8030 7101 gene locus_tag LOCUS_03650 8030 7101 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384542.1 protein_id gnl|my_center|LOCUS_03650 8713 8027 gene locus_tag LOCUS_03660 8713 8027 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338318.1 protein_id gnl|my_center|LOCUS_03660 9366 8710 gene locus_tag LOCUS_03670 gene fsa 9366 8710 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720727.1 protein_id gnl|my_center|LOCUS_03670 10364 9486 gene locus_tag LOCUS_03680 gene folD 10364 9486 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338398.1 protein_id gnl|my_center|LOCUS_03680 10665 10354 gene locus_tag LOCUS_03690 10665 10354 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561857.1 protein_id gnl|my_center|LOCUS_03690 12897 11005 gene locus_tag LOCUS_03700 gene ftsH 12897 11005 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720845.1 protein_id gnl|my_center|LOCUS_03700 14218 12959 gene locus_tag LOCUS_03710 gene tilS 14218 12959 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338400.1 protein_id gnl|my_center|LOCUS_03710 15122 14208 gene locus_tag LOCUS_03720 gene ybgF 15122 14208 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338401.1 protein_id gnl|my_center|LOCUS_03720 15628 15122 gene locus_tag LOCUS_03730 gene pal 15628 15122 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537912.1 protein_id gnl|my_center|LOCUS_03730 <16258 15643 gene locus_tag LOCUS_03740 <16258 15643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002720849.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence020 <1 998 gene locus_tag LOCUS_03750 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537683.1:ABC transporter substrate-binding protein 1104 1886 gene locus_tag LOCUS_03760 1104 1886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_03760 1883 2707 gene locus_tag LOCUS_03770 1883 2707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_03770 2710 3192 gene locus_tag LOCUS_03780 2710 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3286 4287 gene locus_tag LOCUS_03790 3286 4287 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_03790 4298 5641 gene locus_tag LOCUS_03800 4298 5641 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 protein_id gnl|my_center|LOCUS_03800 5641 5934 gene locus_tag LOCUS_03810 5641 5934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 6535 5945 gene locus_tag LOCUS_03820 gene purN 6535 5945 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140088.1 protein_id gnl|my_center|LOCUS_03820 7575 6529 gene locus_tag LOCUS_03830 gene purM 7575 6529 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337122.1 protein_id gnl|my_center|LOCUS_03830 7689 7764 gene locus_tag LOCUS_t00050 7689 7764 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8147 7770 gene locus_tag LOCUS_03840 8147 7770 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384293.1 protein_id gnl|my_center|LOCUS_03840 9452 8277 gene locus_tag LOCUS_03850 9452 8277 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967274.1 protein_id gnl|my_center|LOCUS_03850 10897 9464 gene locus_tag LOCUS_03860 10897 9464 CDS product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 protein_id gnl|my_center|LOCUS_03860 12941 10926 gene locus_tag LOCUS_03870 12941 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 13682 13005 gene locus_tag LOCUS_03880 13682 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 14473 13646 gene locus_tag LOCUS_03890 14473 13646 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530938.1 protein_id gnl|my_center|LOCUS_03890 15971 14592 gene locus_tag LOCUS_03900 15971 14592 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337250.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence021 2080 443 gene locus_tag LOCUS_03910 2080 443 CDS product cisplatin damage response ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527948.1 protein_id gnl|my_center|LOCUS_03910 3072 2077 gene locus_tag LOCUS_03920 3072 2077 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992240.1 protein_id gnl|my_center|LOCUS_03920 3210 4109 gene locus_tag LOCUS_03930 3210 4109 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203271886.1 protein_id gnl|my_center|LOCUS_03930 4446 5501 gene locus_tag LOCUS_03940 4446 5501 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080867124.1 protein_id gnl|my_center|LOCUS_03940 5872 6471 gene locus_tag LOCUS_03950 5872 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6468 6746 gene locus_tag LOCUS_03960 6468 6746 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722276.1 protein_id gnl|my_center|LOCUS_03960 6743 7228 gene locus_tag LOCUS_03970 gene bfr 6743 7228 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561543.1 protein_id gnl|my_center|LOCUS_03970 10629 8095 gene locus_tag LOCUS_03980 10629 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 11856 12287 gene locus_tag LOCUS_03990 11856 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12339 12818 gene locus_tag LOCUS_04000 12339 12818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13576 13361 gene locus_tag LOCUS_04010 13576 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 13876 14676 gene locus_tag LOCUS_04020 13876 14676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 14676 15530 gene locus_tag LOCUS_04030 14676 15530 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095780.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence022 631 2070 gene locus_tag LOCUS_04040 631 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 2082 3122 gene locus_tag LOCUS_04050 2082 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3791 3153 gene locus_tag LOCUS_04060 3791 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 4487 3855 gene locus_tag LOCUS_04070 4487 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 4768 5463 gene locus_tag LOCUS_04080 4768 5463 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528120.1 protein_id gnl|my_center|LOCUS_04080 6820 5489 gene locus_tag LOCUS_04090 6820 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 7674 6874 gene locus_tag LOCUS_04100 7674 6874 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194966.1 protein_id gnl|my_center|LOCUS_04100 8719 7676 gene locus_tag LOCUS_04110 8719 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 9993 8716 gene locus_tag LOCUS_04120 9993 8716 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972945.1 protein_id gnl|my_center|LOCUS_04120 10984 9995 gene locus_tag LOCUS_04130 10984 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 11337 12272 gene locus_tag LOCUS_04140 11337 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 12265 13473 gene locus_tag LOCUS_04150 12265 13473 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097532308.1 protein_id gnl|my_center|LOCUS_04150 14783 13443 gene locus_tag LOCUS_04160 14783 13443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 15249 14902 gene locus_tag LOCUS_04170 15249 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence023 747 139 gene locus_tag LOCUS_04180 gene coaE 747 139 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338810.1 protein_id gnl|my_center|LOCUS_04180 1598 744 gene locus_tag LOCUS_04190 1598 744 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338809.1 protein_id gnl|my_center|LOCUS_04190 2076 2522 gene locus_tag LOCUS_04200 gene hemJ 2076 2522 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338807.1 protein_id gnl|my_center|LOCUS_04200 2649 3920 gene locus_tag LOCUS_04210 gene rho 2649 3920 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563271.1 protein_id gnl|my_center|LOCUS_04210 3928 5181 gene locus_tag LOCUS_04220 gene mnmE 3928 5181 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338806.1 protein_id gnl|my_center|LOCUS_04220 5192 7048 gene locus_tag LOCUS_04230 gene mnmG 5192 7048 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332781.1 protein_id gnl|my_center|LOCUS_04230 7045 7629 gene locus_tag LOCUS_04240 gene rsmG 7045 7629 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338804.1 protein_id gnl|my_center|LOCUS_04240 7622 8404 gene locus_tag LOCUS_04250 7622 8404 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385472.1 protein_id gnl|my_center|LOCUS_04250 8397 9287 gene locus_tag LOCUS_04260 8397 9287 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721719.1 protein_id gnl|my_center|LOCUS_04260 10484 9294 gene locus_tag LOCUS_04270 gene hemW 10484 9294 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338802.1 protein_id gnl|my_center|LOCUS_04270 11082 10477 gene locus_tag LOCUS_04280 gene rdgB 11082 10477 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338801.1 protein_id gnl|my_center|LOCUS_04280 11792 11070 gene locus_tag LOCUS_04290 gene rph 11792 11070 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921545.1 protein_id gnl|my_center|LOCUS_04290 11918 12967 gene locus_tag LOCUS_04300 gene hrcA 11918 12967 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721709.1 protein_id gnl|my_center|LOCUS_04300 12972 13529 gene locus_tag LOCUS_04310 12972 13529 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069332711.1 protein_id gnl|my_center|LOCUS_04310 13632 14216 gene locus_tag LOCUS_04320 gene gfa 13632 14216 CDS product S-(hydroxymethyl)glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337580.1 protein_id gnl|my_center|LOCUS_04320 14307 15440 gene locus_tag LOCUS_04330 14307 15440 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564386.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence024 1904 228 gene locus_tag LOCUS_04340 gene ctaD 1904 228 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337048.1 protein_id gnl|my_center|LOCUS_04340 2580 2065 gene locus_tag LOCUS_04350 2580 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3397 2687 gene locus_tag LOCUS_04360 gene lipB 3397 2687 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531111.1 protein_id gnl|my_center|LOCUS_04360 3531 7250 gene locus_tag LOCUS_04370 gene metH 3531 7250 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538096.1 protein_id gnl|my_center|LOCUS_04370 7301 7387 gene locus_tag LOCUS_t00060 7301 7387 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7588 8691 gene locus_tag LOCUS_04380 7588 8691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722797.1 protein_id gnl|my_center|LOCUS_04380 8714 9793 gene locus_tag LOCUS_04390 8714 9793 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 protein_id gnl|my_center|LOCUS_04390 9903 10985 gene locus_tag LOCUS_04400 9903 10985 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_04400 11036 12115 gene locus_tag LOCUS_04410 11036 12115 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669547.1 protein_id gnl|my_center|LOCUS_04410 12159 13241 gene locus_tag LOCUS_04420 12159 13241 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643541.1 protein_id gnl|my_center|LOCUS_04420 13297 14589 gene locus_tag LOCUS_04430 13297 14589 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337052.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence025 732 142 gene locus_tag LOCUS_04440 732 142 CDS product acyl-homoserine-lactone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385295.1 protein_id gnl|my_center|LOCUS_04440 1412 801 gene locus_tag LOCUS_04450 1412 801 CDS product autoinducer binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538005.1 protein_id gnl|my_center|LOCUS_04450 2045 1620 gene locus_tag LOCUS_04460 gene rplQ 2045 1620 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722538.1 protein_id gnl|my_center|LOCUS_04460 3213 2197 gene locus_tag LOCUS_04470 3213 2197 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722536.1 protein_id gnl|my_center|LOCUS_04470 3721 3332 gene locus_tag LOCUS_04480 gene rpsK 3721 3332 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722534.1 protein_id gnl|my_center|LOCUS_04480 4136 3735 gene locus_tag LOCUS_04490 gene rpsM 4136 3735 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722532.1 protein_id gnl|my_center|LOCUS_04490 4941 4252 gene locus_tag LOCUS_04500 4941 4252 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336954.1 protein_id gnl|my_center|LOCUS_04500 6321 4972 gene locus_tag LOCUS_04510 gene secY 6321 4972 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336953.1 protein_id gnl|my_center|LOCUS_04510 6976 6485 gene locus_tag LOCUS_04520 gene rplO 6976 6485 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563657.1 protein_id gnl|my_center|LOCUS_04520 7912 7172 gene locus_tag LOCUS_04530 7912 7172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337226.1 protein_id gnl|my_center|LOCUS_04530 8180 8689 gene locus_tag LOCUS_04540 8180 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04540 8740 9303 gene locus_tag LOCUS_04550 8740 9303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 9548 9363 gene locus_tag LOCUS_04560 gene rpmD 9548 9363 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006205449.1 protein_id gnl|my_center|LOCUS_04560 9839 9552 gene locus_tag LOCUS_04570 9839 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04570 10156 9839 gene locus_tag LOCUS_04580 10156 9839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04580 10621 10262 gene locus_tag LOCUS_04590 gene rplR 10621 10262 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722520.1 protein_id gnl|my_center|LOCUS_04590 11166 10633 gene locus_tag LOCUS_04600 gene rplF 11166 10633 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538008.1 protein_id gnl|my_center|LOCUS_04600 11577 11179 gene locus_tag LOCUS_04610 gene rpsH 11577 11179 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722516.1 protein_id gnl|my_center|LOCUS_04610 11892 11587 gene locus_tag LOCUS_04620 gene rpsN 11892 11587 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722514.1 protein_id gnl|my_center|LOCUS_04620 12471 11911 gene locus_tag LOCUS_04630 gene rplE 12471 11911 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336952.1 protein_id gnl|my_center|LOCUS_04630 12776 12471 gene locus_tag LOCUS_04640 gene rplX 12776 12471 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722510.1 protein_id gnl|my_center|LOCUS_04640 13144 12776 gene locus_tag LOCUS_04650 gene rplN 13144 12776 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 protein_id gnl|my_center|LOCUS_04650 13464 13213 gene locus_tag LOCUS_04660 gene rpsQ 13464 13213 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722502.1 protein_id gnl|my_center|LOCUS_04660 13683 13477 gene locus_tag LOCUS_04670 gene rpmC 13683 13477 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722500.1 protein_id gnl|my_center|LOCUS_04670 14320 13808 gene locus_tag LOCUS_04680 14320 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 14934 14521 gene locus_tag LOCUS_04690 gene rplP 14934 14521 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722499.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence026 1677 835 gene locus_tag LOCUS_04700 1677 835 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385122.1 protein_id gnl|my_center|LOCUS_04700 1698 3155 gene locus_tag LOCUS_04710 1698 3155 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336795.1 protein_id gnl|my_center|LOCUS_04710 4886 3222 gene locus_tag LOCUS_04720 4886 3222 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705057.1 protein_id gnl|my_center|LOCUS_04720 5665 4955 gene locus_tag LOCUS_04730 5665 4955 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337375.1 protein_id gnl|my_center|LOCUS_04730 7511 5655 gene locus_tag LOCUS_04740 7511 5655 CDS product PAS-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337374.1 protein_id gnl|my_center|LOCUS_04740 7668 9653 gene locus_tag LOCUS_04750 7668 9653 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337373.1 protein_id gnl|my_center|LOCUS_04750 9650 10471 gene locus_tag LOCUS_04760 9650 10471 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566968.1 protein_id gnl|my_center|LOCUS_04760 10538 11521 gene locus_tag LOCUS_04770 10538 11521 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719438.1 protein_id gnl|my_center|LOCUS_04770 11621 12697 gene locus_tag LOCUS_04780 11621 12697 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719437.1 protein_id gnl|my_center|LOCUS_04780 12760 14043 gene locus_tag LOCUS_04790 12760 14043 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337371.1 protein_id gnl|my_center|LOCUS_04790 14115 14960 gene locus_tag LOCUS_04800 14115 14960 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719435.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence027 791 351 gene locus_tag LOCUS_04810 791 351 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337389.1 protein_id gnl|my_center|LOCUS_04810 1762 791 gene locus_tag LOCUS_04820 1762 791 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337390.1 protein_id gnl|my_center|LOCUS_04820 2257 1790 gene locus_tag LOCUS_04830 2257 1790 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719468.1 protein_id gnl|my_center|LOCUS_04830 3200 2337 gene locus_tag LOCUS_04840 3200 2337 CDS product TIGR01459 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337391.1 protein_id gnl|my_center|LOCUS_04840 4296 3310 gene locus_tag LOCUS_04850 4296 3310 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564755.1 protein_id gnl|my_center|LOCUS_04850 4663 4316 gene locus_tag LOCUS_04860 4663 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976140.1 protein_id gnl|my_center|LOCUS_04860 5685 4660 gene locus_tag LOCUS_04870 5685 4660 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003568.1 protein_id gnl|my_center|LOCUS_04870 7020 5719 gene locus_tag LOCUS_04880 7020 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 7205 7492 gene locus_tag LOCUS_04890 7205 7492 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719473.1 protein_id gnl|my_center|LOCUS_04890 7538 9184 gene locus_tag LOCUS_04900 gene groL 7538 9184 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719474.1 protein_id gnl|my_center|LOCUS_04900 10649 9252 gene locus_tag LOCUS_04910 10649 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 12272 10752 gene locus_tag LOCUS_04920 12272 10752 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338484.1 protein_id gnl|my_center|LOCUS_04920 14492 12327 gene locus_tag LOCUS_04930 14492 12327 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338483.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence028 <1 740 gene locus_tag LOCUS_04940 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533144.1:glucose 1-dehydrogenase 761 1756 gene locus_tag LOCUS_04950 761 1756 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392939.1 protein_id gnl|my_center|LOCUS_04950 2638 1967 gene locus_tag LOCUS_04960 2638 1967 CDS product DUF1236 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339260.1 protein_id gnl|my_center|LOCUS_04960 2813 4291 gene locus_tag LOCUS_04970 2813 4291 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139973.1 protein_id gnl|my_center|LOCUS_04970 6556 4340 gene locus_tag LOCUS_04980 6556 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 7822 6662 gene locus_tag LOCUS_04990 7822 6662 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339111.1 protein_id gnl|my_center|LOCUS_04990 7920 8252 gene locus_tag LOCUS_05000 7920 8252 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 protein_id gnl|my_center|LOCUS_05000 8249 8776 gene locus_tag LOCUS_05010 8249 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 10669 8795 gene locus_tag LOCUS_05020 gene uvrC 10669 8795 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338696.1 protein_id gnl|my_center|LOCUS_05020 10625 10828 gene locus_tag LOCUS_05030 10625 10828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 11691 10960 gene locus_tag LOCUS_05040 11691 10960 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383369.1 protein_id gnl|my_center|LOCUS_05040 12666 11860 gene locus_tag LOCUS_05050 12666 11860 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338698.1 protein_id gnl|my_center|LOCUS_05050 13789 12917 gene locus_tag LOCUS_05060 13789 12917 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_05060 14567 13854 gene locus_tag LOCUS_05070 gene petC 14567 13854 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722004.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence029 958 251 gene locus_tag LOCUS_05080 958 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 1635 955 gene locus_tag LOCUS_05090 gene cas5e 1635 955 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387930.1 protein_id gnl|my_center|LOCUS_05090 2707 1628 gene locus_tag LOCUS_05100 gene cas7e 2707 1628 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044180303.1 protein_id gnl|my_center|LOCUS_05100 3225 2704 gene locus_tag LOCUS_05110 3225 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4673 3222 gene locus_tag LOCUS_05120 gene casA 4673 3222 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387933.1 protein_id gnl|my_center|LOCUS_05120 7499 5004 gene locus_tag LOCUS_05130 7499 5004 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091704098.1 protein_id gnl|my_center|LOCUS_05130 8058 7774 gene locus_tag LOCUS_05140 8058 7774 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034027947.1 protein_id gnl|my_center|LOCUS_05140 8360 8076 gene locus_tag LOCUS_05150 8360 8076 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086466044.1 protein_id gnl|my_center|LOCUS_05150 9035 8673 gene locus_tag LOCUS_05160 9035 8673 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337920.1 protein_id gnl|my_center|LOCUS_05160 9589 9867 gene locus_tag LOCUS_05170 9589 9867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 9978 10967 gene locus_tag LOCUS_05180 9978 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 10951 11400 gene locus_tag LOCUS_05190 10951 11400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 11553 11987 gene locus_tag LOCUS_05200 gene umuD 11553 11987 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219995814.1 protein_id gnl|my_center|LOCUS_05200 11992 13284 gene locus_tag LOCUS_05210 11992 13284 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038087.1 protein_id gnl|my_center|LOCUS_05210 14087 13401 gene locus_tag LOCUS_05220 14087 13401 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039062.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence030 198 1370 gene locus_tag LOCUS_05230 gene devC 198 1370 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_05230 1370 2068 gene locus_tag LOCUS_05240 1370 2068 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_05240 2544 3233 gene locus_tag LOCUS_05250 2544 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3233 3592 gene locus_tag LOCUS_05260 3233 3592 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720112.1 protein_id gnl|my_center|LOCUS_05260 5584 4250 gene locus_tag LOCUS_05270 5584 4250 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720539.1 protein_id gnl|my_center|LOCUS_05270 6418 5591 gene locus_tag LOCUS_05280 6418 5591 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720538.1 protein_id gnl|my_center|LOCUS_05280 7296 6415 gene locus_tag LOCUS_05290 7296 6415 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720537.1 protein_id gnl|my_center|LOCUS_05290 8129 7359 gene locus_tag LOCUS_05300 8129 7359 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720536.1 protein_id gnl|my_center|LOCUS_05300 8909 8160 gene locus_tag LOCUS_05310 8909 8160 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338188.1 protein_id gnl|my_center|LOCUS_05310 9574 9053 gene locus_tag LOCUS_05320 9574 9053 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720534.1 protein_id gnl|my_center|LOCUS_05320 9941 9633 gene locus_tag LOCUS_05330 9941 9633 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153440932.1 protein_id gnl|my_center|LOCUS_05330 12497 10179 gene locus_tag LOCUS_05340 gene clpA 12497 10179 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337384.1 protein_id gnl|my_center|LOCUS_05340 13421 12681 gene locus_tag LOCUS_05350 gene gloB 13421 12681 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383725.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence031 263 66 gene locus_tag LOCUS_05360 263 66 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_05360 799 365 gene locus_tag LOCUS_05370 799 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 1775 900 gene locus_tag LOCUS_05380 gene mmsB 1775 900 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338027.1 protein_id gnl|my_center|LOCUS_05380 2776 1775 gene locus_tag LOCUS_05390 2776 1775 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338028.1 protein_id gnl|my_center|LOCUS_05390 3921 2776 gene locus_tag LOCUS_05400 3921 2776 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338029.1 protein_id gnl|my_center|LOCUS_05400 4096 5568 gene locus_tag LOCUS_05410 4096 5568 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974605.1 protein_id gnl|my_center|LOCUS_05410 7171 5672 gene locus_tag LOCUS_05420 7171 5672 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565364.1 protein_id gnl|my_center|LOCUS_05420 7264 8163 gene locus_tag LOCUS_05430 7264 8163 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337879.1 protein_id gnl|my_center|LOCUS_05430 8251 8691 gene locus_tag LOCUS_05440 8251 8691 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720120.1 protein_id gnl|my_center|LOCUS_05440 8774 9274 gene locus_tag LOCUS_05450 gene coaD 8774 9274 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720119.1 protein_id gnl|my_center|LOCUS_05450 9332 10192 gene locus_tag LOCUS_05460 9332 10192 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337887.1 protein_id gnl|my_center|LOCUS_05460 10749 10204 gene locus_tag LOCUS_05470 10749 10204 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337019.1 protein_id gnl|my_center|LOCUS_05470 10922 11551 gene locus_tag LOCUS_05480 10922 11551 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563763.1 protein_id gnl|my_center|LOCUS_05480 11499 12314 gene locus_tag LOCUS_05490 11499 12314 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722722.1 protein_id gnl|my_center|LOCUS_05490 <13724 12440 gene locus_tag LOCUS_05500 <13724 12440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009563008.1:AAA family ATPase >Feature sequence032 <1 2403 gene locus_tag LOCUS_05510 <1 2403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967621.1:regulatory protein NosR 2352 3248 gene locus_tag LOCUS_05520 2352 3248 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 protein_id gnl|my_center|LOCUS_05520 3382 3834 gene locus_tag LOCUS_05530 3382 3834 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970968.1 protein_id gnl|my_center|LOCUS_05530 3850 5238 gene locus_tag LOCUS_05540 3850 5238 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338149.1 protein_id gnl|my_center|LOCUS_05540 5244 6047 gene locus_tag LOCUS_05550 5244 6047 CDS product CbbQ/NirQ/NorQ/GpvN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338148.1 protein_id gnl|my_center|LOCUS_05550 6052 7998 gene locus_tag LOCUS_05560 6052 7998 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338147.1 protein_id gnl|my_center|LOCUS_05560 7995 8558 gene locus_tag LOCUS_05570 7995 8558 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085996.1 protein_id gnl|my_center|LOCUS_05570 8555 8818 gene locus_tag LOCUS_05580 8555 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 9522 8824 gene locus_tag LOCUS_05590 9522 8824 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390386.1 protein_id gnl|my_center|LOCUS_05590 10314 9979 gene locus_tag LOCUS_05600 10314 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 10422 12725 gene locus_tag LOCUS_05610 gene glf 10422 12725 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162305162.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence033 707 474 gene locus_tag LOCUS_05620 707 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2197 704 gene locus_tag LOCUS_05630 2197 704 CDS product putative nucleotidyltransferase substrate binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388392.1 protein_id gnl|my_center|LOCUS_05630 3891 2194 gene locus_tag LOCUS_05640 3891 2194 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339077.1 protein_id gnl|my_center|LOCUS_05640 4208 3900 gene locus_tag LOCUS_05650 4208 3900 CDS product DUF485 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339076.1 protein_id gnl|my_center|LOCUS_05650 6268 4313 gene locus_tag LOCUS_05660 gene acs 6268 4313 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561943.1 protein_id gnl|my_center|LOCUS_05660 6481 6969 gene locus_tag LOCUS_05670 6481 6969 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338334.1 protein_id gnl|my_center|LOCUS_05670 9322 7028 gene locus_tag LOCUS_05680 9322 7028 CDS product glycosyl hydrolase family 28-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383673.1 protein_id gnl|my_center|LOCUS_05680 11072 9465 gene locus_tag LOCUS_05690 11072 9465 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338336.1 protein_id gnl|my_center|LOCUS_05690 11146 11568 gene locus_tag LOCUS_05700 11146 11568 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720750.1 protein_id gnl|my_center|LOCUS_05700 13027 11576 gene locus_tag LOCUS_05710 gene dacB 13027 11576 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338335.1 protein_id gnl|my_center|LOCUS_05710 <13551 13027 gene locus_tag LOCUS_05720 <13551 13027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139976.1:membrane protein >Feature sequence034 464 1060 gene locus_tag LOCUS_05730 464 1060 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531897.1 protein_id gnl|my_center|LOCUS_05730 1653 1138 gene locus_tag LOCUS_05740 1653 1138 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810396.1 protein_id gnl|my_center|LOCUS_05740 1864 1658 gene locus_tag LOCUS_05750 1864 1658 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722161.1 protein_id gnl|my_center|LOCUS_05750 2493 1861 gene locus_tag LOCUS_05760 2493 1861 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562559.1 protein_id gnl|my_center|LOCUS_05760 3409 2495 gene locus_tag LOCUS_05770 gene trxA 3409 2495 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336780.1 protein_id gnl|my_center|LOCUS_05770 4334 3543 gene locus_tag LOCUS_05780 4334 3543 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721037.1 protein_id gnl|my_center|LOCUS_05780 4309 5349 gene locus_tag LOCUS_05790 4309 5349 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336857.1 protein_id gnl|my_center|LOCUS_05790 6166 5480 gene locus_tag LOCUS_05800 6166 5480 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721035.1 protein_id gnl|my_center|LOCUS_05800 6303 7364 gene locus_tag LOCUS_05810 gene ribA 6303 7364 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338539.1 protein_id gnl|my_center|LOCUS_05810 7376 7912 gene locus_tag LOCUS_05820 7376 7912 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561673.1 protein_id gnl|my_center|LOCUS_05820 8258 8866 gene locus_tag LOCUS_05830 8258 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 11121 8932 gene locus_tag LOCUS_05840 11121 8932 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368459.1 protein_id gnl|my_center|LOCUS_05840 13019 11535 gene locus_tag LOCUS_05850 13019 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05850 >Feature sequence035 1259 3 gene locus_tag LOCUS_05860 1259 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 1311 1937 gene locus_tag LOCUS_05870 1311 1937 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243834.1 protein_id gnl|my_center|LOCUS_05870 1976 2872 gene locus_tag LOCUS_05880 1976 2872 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338391.1 protein_id gnl|my_center|LOCUS_05880 2905 4419 gene locus_tag LOCUS_05890 gene gatB 2905 4419 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337137.1 protein_id gnl|my_center|LOCUS_05890 4520 5092 gene locus_tag LOCUS_05900 4520 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5294 5097 gene locus_tag LOCUS_05910 5294 5097 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384904.1 protein_id gnl|my_center|LOCUS_05910 5345 6829 gene locus_tag LOCUS_05920 gene hisS 5345 6829 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339406.1 protein_id gnl|my_center|LOCUS_05920 6826 7887 gene locus_tag LOCUS_05930 6826 7887 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339405.1 protein_id gnl|my_center|LOCUS_05930 7881 8573 gene locus_tag LOCUS_05940 gene hisG 7881 8573 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724462.1 protein_id gnl|my_center|LOCUS_05940 9755 8634 gene locus_tag LOCUS_05950 gene ftsY 9755 8634 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140067.1 protein_id gnl|my_center|LOCUS_05950 10763 10077 gene locus_tag LOCUS_05960 10763 10077 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337078.1 protein_id gnl|my_center|LOCUS_05960 11786 10857 gene locus_tag LOCUS_05970 11786 10857 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337523.1 protein_id gnl|my_center|LOCUS_05970 11927 12169 gene locus_tag LOCUS_05980 11927 12169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 <13300 12314 gene locus_tag LOCUS_05990 <13300 12314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337524.1:phosphoglycerate kinase >Feature sequence036 555 256 gene locus_tag LOCUS_06000 555 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 828 595 gene locus_tag LOCUS_06010 828 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1275 874 gene locus_tag LOCUS_06020 1275 874 CDS product group III truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088962.1 protein_id gnl|my_center|LOCUS_06020 1498 4449 gene locus_tag LOCUS_06030 gene ileS 1498 4449 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338324.1 protein_id gnl|my_center|LOCUS_06030 5576 4614 gene locus_tag LOCUS_06040 gene folE2 5576 4614 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722743.1 protein_id gnl|my_center|LOCUS_06040 6810 5644 gene locus_tag LOCUS_06050 gene metZ 6810 5644 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722742.1 protein_id gnl|my_center|LOCUS_06050 6961 7935 gene locus_tag LOCUS_06060 6961 7935 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923336.1 protein_id gnl|my_center|LOCUS_06060 7992 10406 gene locus_tag LOCUS_06070 7992 10406 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337230.1 protein_id gnl|my_center|LOCUS_06070 11871 10525 gene locus_tag LOCUS_06080 gene glmM 11871 10525 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337039.1 protein_id gnl|my_center|LOCUS_06080 12695 11868 gene locus_tag LOCUS_06090 gene folP 12695 11868 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337038.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06090 >Feature sequence037 646 245 gene locus_tag LOCUS_06100 646 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1036 740 gene locus_tag LOCUS_06110 gene ihfB 1036 740 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339437.1 protein_id gnl|my_center|LOCUS_06110 2869 1190 gene locus_tag LOCUS_06120 gene rpsA 2869 1190 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564251.1 protein_id gnl|my_center|LOCUS_06120 3655 3068 gene locus_tag LOCUS_06130 3655 3068 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339438.1 protein_id gnl|my_center|LOCUS_06130 5003 3831 gene locus_tag LOCUS_06140 5003 3831 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337746.1 protein_id gnl|my_center|LOCUS_06140 5167 5541 gene locus_tag LOCUS_06150 5167 5541 CDS product NADH:ubiquinone oxidoreductase subunit NDUFA12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720340.1 protein_id gnl|my_center|LOCUS_06150 5543 6007 gene locus_tag LOCUS_06160 gene mlaD 5543 6007 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921521.1 protein_id gnl|my_center|LOCUS_06160 6004 6576 gene locus_tag LOCUS_06170 6004 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7439 7660 gene locus_tag LOCUS_06180 7439 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8958 7612 gene locus_tag LOCUS_06190 gene accC 8958 7612 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537788.1 protein_id gnl|my_center|LOCUS_06190 9457 8966 gene locus_tag LOCUS_06200 gene accB 9457 8966 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720335.1 protein_id gnl|my_center|LOCUS_06200 10456 9560 gene locus_tag LOCUS_06210 10456 9560 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337323.1 protein_id gnl|my_center|LOCUS_06210 11379 10453 gene locus_tag LOCUS_06220 11379 10453 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174794.1 protein_id gnl|my_center|LOCUS_06220 <13083 11450 gene locus_tag LOCUS_06230 <13083 11450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337876.1:transketolase >Feature sequence038 <1 576 gene locus_tag LOCUS_06240 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043607342.1:glycosyltransferase 962 1642 gene locus_tag LOCUS_06250 962 1642 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061725.1 protein_id gnl|my_center|LOCUS_06250 1886 1596 gene locus_tag LOCUS_06260 1886 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 2021 3202 gene locus_tag LOCUS_06270 2021 3202 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_06270 3782 3189 gene locus_tag LOCUS_06280 3782 3189 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530660.1 protein_id gnl|my_center|LOCUS_06280 8442 3793 gene locus_tag LOCUS_06290 8442 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9395 8439 gene locus_tag LOCUS_06300 9395 8439 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143639.1 protein_id gnl|my_center|LOCUS_06300 12727 9392 gene locus_tag LOCUS_06310 12727 9392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence039 3159 1789 gene locus_tag LOCUS_06320 3159 1789 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_06320 5125 4043 gene locus_tag LOCUS_06330 gene pheS 5125 4043 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722590.1 protein_id gnl|my_center|LOCUS_06330 5866 5183 gene locus_tag LOCUS_06340 gene aqpS 5866 5183 CDS product aquaglyceroporin AqpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969025.1 protein_id gnl|my_center|LOCUS_06340 6316 7779 gene locus_tag LOCUS_06350 6316 7779 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969573.1 protein_id gnl|my_center|LOCUS_06350 8240 7881 gene locus_tag LOCUS_06360 gene rplT 8240 7881 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722591.1 protein_id gnl|my_center|LOCUS_06360 8454 8254 gene locus_tag LOCUS_06370 gene rpmI 8454 8254 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722593.1 protein_id gnl|my_center|LOCUS_06370 8795 8562 gene locus_tag LOCUS_06380 8795 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 10265 8817 gene locus_tag LOCUS_06390 gene pyk 10265 8817 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722594.1 protein_id gnl|my_center|LOCUS_06390 10390 11130 gene locus_tag LOCUS_06400 10390 11130 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383190.1 protein_id gnl|my_center|LOCUS_06400 <12832 11210 gene locus_tag LOCUS_06410 <12832 11210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338317.1:primosomal protein N' >Feature sequence040 <1 684 gene locus_tag LOCUS_06420 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196472.1:glycosyltransferase family 1 protein 684 1709 gene locus_tag LOCUS_06430 684 1709 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969657.1 protein_id gnl|my_center|LOCUS_06430 1739 3427 gene locus_tag LOCUS_06440 1739 3427 CDS product beta-1,6-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538035.1 protein_id gnl|my_center|LOCUS_06440 3424 4806 gene locus_tag LOCUS_06450 3424 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538034.1 protein_id gnl|my_center|LOCUS_06450 5826 4813 gene locus_tag LOCUS_06460 gene queG 5826 4813 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338745.1 protein_id gnl|my_center|LOCUS_06460 6568 5888 gene locus_tag LOCUS_06470 6568 5888 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384812.1 protein_id gnl|my_center|LOCUS_06470 7351 6641 gene locus_tag LOCUS_06480 gene mtgA 7351 6641 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338747.1 protein_id gnl|my_center|LOCUS_06480 8033 7407 gene locus_tag LOCUS_06490 8033 7407 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312755.1 protein_id gnl|my_center|LOCUS_06490 8234 8150 gene locus_tag LOCUS_t00070 8234 8150 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8461 9450 gene locus_tag LOCUS_06500 8461 9450 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338750.1 protein_id gnl|my_center|LOCUS_06500 9450 10247 gene locus_tag LOCUS_06510 9450 10247 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721584.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence041 1600 2406 gene locus_tag LOCUS_06520 1600 2406 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000303.1 protein_id gnl|my_center|LOCUS_06520 3225 2488 gene locus_tag LOCUS_06530 3225 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3406 3648 gene locus_tag LOCUS_06540 3406 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3958 5007 gene locus_tag LOCUS_06550 3958 5007 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339539.1 protein_id gnl|my_center|LOCUS_06550 5018 6016 gene locus_tag LOCUS_06560 5018 6016 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339540.1 protein_id gnl|my_center|LOCUS_06560 6013 6858 gene locus_tag LOCUS_06570 gene cysT 6013 6858 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384410.1 protein_id gnl|my_center|LOCUS_06570 6855 7652 gene locus_tag LOCUS_06580 gene cysW 6855 7652 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384411.1 protein_id gnl|my_center|LOCUS_06580 7998 8168 gene locus_tag LOCUS_06590 7998 8168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 8202 8414 gene locus_tag LOCUS_06600 8202 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8348 9151 gene locus_tag LOCUS_06610 8348 9151 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339140.1 protein_id gnl|my_center|LOCUS_06610 9148 10269 gene locus_tag LOCUS_06620 9148 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 10259 10594 gene locus_tag LOCUS_06630 10259 10594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 10767 10513 gene locus_tag LOCUS_06640 10767 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 10884 11330 gene locus_tag LOCUS_06650 10884 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 11317 11748 gene locus_tag LOCUS_06660 gene exbD 11317 11748 CDS product TonB system transport protein ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970692.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence042 1544 1789 gene locus_tag LOCUS_06670 1544 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 1782 2096 gene locus_tag LOCUS_06680 1782 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 2265 3170 gene locus_tag LOCUS_06690 2265 3170 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724684.1 protein_id gnl|my_center|LOCUS_06690 3312 3683 gene locus_tag LOCUS_06700 gene flaF 3312 3683 CDS product flagellar biosynthesis regulator FlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626463.1 protein_id gnl|my_center|LOCUS_06700 3680 4087 gene locus_tag LOCUS_06710 gene flbT 3680 4087 CDS product flagellar biosynthesis repressor FlbT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724687.1 protein_id gnl|my_center|LOCUS_06710 4084 4863 gene locus_tag LOCUS_06720 4084 4863 CDS product DUF1217 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836204.1 protein_id gnl|my_center|LOCUS_06720 6606 5074 gene locus_tag LOCUS_06730 gene ubiB 6606 5074 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140011.1 protein_id gnl|my_center|LOCUS_06730 7360 6608 gene locus_tag LOCUS_06740 gene ubiE 7360 6608 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721909.1 protein_id gnl|my_center|LOCUS_06740 7420 8265 gene locus_tag LOCUS_06750 gene mutM 7420 8265 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385127.1 protein_id gnl|my_center|LOCUS_06750 8323 9099 gene locus_tag LOCUS_06760 8323 9099 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721912.1 protein_id gnl|my_center|LOCUS_06760 9257 9526 gene locus_tag LOCUS_06770 gene rpsT 9257 9526 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721915.1 protein_id gnl|my_center|LOCUS_06770 10006 11391 gene locus_tag LOCUS_06780 gene dnaA 10006 11391 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721917.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence043 2058 883 gene locus_tag LOCUS_06790 2058 883 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210864.1 protein_id gnl|my_center|LOCUS_06790 3933 2062 gene locus_tag LOCUS_06800 gene cobT 3933 2062 CDS product cobaltochelatase subunit CobT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566423.1 protein_id gnl|my_center|LOCUS_06800 4023 4490 gene locus_tag LOCUS_06810 4023 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 4849 4475 gene locus_tag LOCUS_06820 4849 4475 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384516.1 protein_id gnl|my_center|LOCUS_06820 4923 5519 gene locus_tag LOCUS_06830 4923 5519 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384515.1 protein_id gnl|my_center|LOCUS_06830 6100 5570 gene locus_tag LOCUS_06840 6100 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7077 6100 gene locus_tag LOCUS_06850 gene cobS 7077 6100 CDS product cobaltochelatase subunit CobS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003542.1 protein_id gnl|my_center|LOCUS_06850 7262 8233 gene locus_tag LOCUS_06860 7262 8233 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337878.1 protein_id gnl|my_center|LOCUS_06860 8545 9504 gene locus_tag LOCUS_06870 8545 9504 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337604.1 protein_id gnl|my_center|LOCUS_06870 9652 10698 gene locus_tag LOCUS_06880 9652 10698 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970730.1 protein_id gnl|my_center|LOCUS_06880 10969 10769 gene locus_tag LOCUS_06890 10969 10769 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384941.1 protein_id gnl|my_center|LOCUS_06890 <11794 11038 gene locus_tag LOCUS_06900 <11794 11038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339246.1:D-glycerate dehydrogenase >Feature sequence044 <1 928 gene locus_tag LOCUS_06910 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061774.1:PLP-dependent aminotransferase family protein 1094 1543 gene locus_tag LOCUS_06920 1094 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1540 2799 gene locus_tag LOCUS_06930 1540 2799 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626098.1 protein_id gnl|my_center|LOCUS_06930 2810 5944 gene locus_tag LOCUS_06940 2810 5944 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972841.1 protein_id gnl|my_center|LOCUS_06940 6669 6046 gene locus_tag LOCUS_06950 gene bluB 6669 6046 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086038.1 protein_id gnl|my_center|LOCUS_06950 7616 6924 gene locus_tag LOCUS_06960 7616 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 8944 7838 gene locus_tag LOCUS_06970 8944 7838 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337929.1 protein_id gnl|my_center|LOCUS_06970 9747 8941 gene locus_tag LOCUS_06980 9747 8941 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720158.1 protein_id gnl|my_center|LOCUS_06980 10613 9744 gene locus_tag LOCUS_06990 10613 9744 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565322.1 protein_id gnl|my_center|LOCUS_06990 <11770 10752 gene locus_tag LOCUS_07000 <11770 10752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337930.1:PLP-dependent aminotransferase family protein >Feature sequence045 <1 1420 gene locus_tag LOCUS_07010 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532298.1:glucoamylase family protein 2724 1621 gene locus_tag LOCUS_07020 2724 1621 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338864.1 protein_id gnl|my_center|LOCUS_07020 3740 2721 gene locus_tag LOCUS_07030 3740 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 5179 3737 gene locus_tag LOCUS_07040 gene flgK 5179 3737 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338862.1 protein_id gnl|my_center|LOCUS_07040 6522 5206 gene locus_tag LOCUS_07050 6522 5206 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721867.1 protein_id gnl|my_center|LOCUS_07050 7368 6604 gene locus_tag LOCUS_07060 7368 6604 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669859.1 protein_id gnl|my_center|LOCUS_07060 9022 7430 gene locus_tag LOCUS_07070 9022 7430 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973582.1 protein_id gnl|my_center|LOCUS_07070 9134 9823 gene locus_tag LOCUS_07080 9134 9823 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428234.1 protein_id gnl|my_center|LOCUS_07080 9820 10494 gene locus_tag LOCUS_07090 9820 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence046 258 740 gene locus_tag LOCUS_07100 258 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 798 1124 gene locus_tag LOCUS_07110 798 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2650 1484 gene locus_tag LOCUS_07120 2650 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4381 3089 gene locus_tag LOCUS_07130 gene ccrA 4381 3089 CDS product crotonyl-CoA carboxylase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721248.1 protein_id gnl|my_center|LOCUS_07130 4619 6577 gene locus_tag LOCUS_07140 4619 6577 CDS product protein meaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338628.1 protein_id gnl|my_center|LOCUS_07140 6725 7588 gene locus_tag LOCUS_07150 gene hpaI 6725 7588 CDS product 4-hydroxy-2-oxoheptanedioate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392271.1 protein_id gnl|my_center|LOCUS_07150 8200 7595 gene locus_tag LOCUS_07160 8200 7595 CDS product peroxidase-related enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339294.1 protein_id gnl|my_center|LOCUS_07160 8330 9826 gene locus_tag LOCUS_07170 gene ffh 8330 9826 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338684.1 protein_id gnl|my_center|LOCUS_07170 9942 10238 gene locus_tag LOCUS_07180 9942 10238 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721398.1 protein_id gnl|my_center|LOCUS_07180 10261 10665 gene locus_tag LOCUS_07190 10261 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 10923 11420 gene locus_tag LOCUS_07200 gene rimM 10923 11420 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721394.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence047 537 184 gene locus_tag LOCUS_07210 537 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 1333 1067 gene locus_tag LOCUS_07220 1333 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2031 1405 gene locus_tag LOCUS_07230 2031 1405 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532730.1 protein_id gnl|my_center|LOCUS_07230 2464 2036 gene locus_tag LOCUS_07240 2464 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07240 3755 3495 gene locus_tag LOCUS_07250 3755 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252489.1 protein_id gnl|my_center|LOCUS_07250 4040 3843 gene locus_tag LOCUS_07260 4040 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721150.1 protein_id gnl|my_center|LOCUS_07260 4453 4142 gene locus_tag LOCUS_07270 4453 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5728 4625 gene locus_tag LOCUS_07280 5728 4625 CDS product glycosyltransferase 61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383885.1 protein_id gnl|my_center|LOCUS_07280 6805 5933 gene locus_tag LOCUS_07290 6805 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7951 6857 gene locus_tag LOCUS_07300 7951 6857 CDS product glycosyltransferase 61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383885.1 protein_id gnl|my_center|LOCUS_07300 9948 8071 gene locus_tag LOCUS_07310 9948 8071 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337352.1 protein_id gnl|my_center|LOCUS_07310 10186 10407 gene locus_tag LOCUS_07320 10186 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10441 10716 gene locus_tag LOCUS_07330 10441 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 10874 10799 gene locus_tag LOCUS_t00080 10874 10799 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11217 10918 gene locus_tag LOCUS_07340 11217 10918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence048 516 1859 gene locus_tag LOCUS_07350 gene phaZ 516 1859 CDS product polyhydroxyalkanoate depolymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565567.1 protein_id gnl|my_center|LOCUS_07350 1936 2412 gene locus_tag LOCUS_07360 1936 2412 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719538.1 protein_id gnl|my_center|LOCUS_07360 3188 2454 gene locus_tag LOCUS_07370 3188 2454 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140274.1 protein_id gnl|my_center|LOCUS_07370 3355 5301 gene locus_tag LOCUS_07380 gene thrS 3355 5301 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383594.1 protein_id gnl|my_center|LOCUS_07380 5548 5754 gene locus_tag LOCUS_07390 5548 5754 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 protein_id gnl|my_center|LOCUS_07390 5853 8486 gene locus_tag LOCUS_07400 5853 8486 CDS product sarcosine oxidase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140189.1 protein_id gnl|my_center|LOCUS_07400 8479 9003 gene locus_tag LOCUS_07410 8479 9003 CDS product sarcosine oxidase subunit gamma family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337661.1 protein_id gnl|my_center|LOCUS_07410 9907 9017 gene locus_tag LOCUS_07420 gene rarD 9907 9017 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537686.1 protein_id gnl|my_center|LOCUS_07420 10748 10149 gene locus_tag LOCUS_07430 10748 10149 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719843.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence049 2264 1281 gene locus_tag LOCUS_07440 2264 1281 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088811.1 protein_id gnl|my_center|LOCUS_07440 3133 3711 gene locus_tag LOCUS_07450 3133 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 5078 3738 gene locus_tag LOCUS_07460 5078 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5182 6144 gene locus_tag LOCUS_07470 5182 6144 CDS product tripartite tricarboxylate transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252832.1 protein_id gnl|my_center|LOCUS_07470 6199 6672 gene locus_tag LOCUS_07480 6199 6672 CDS product tripartite tricarboxylate transporter TctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402123.1 protein_id gnl|my_center|LOCUS_07480 6680 8179 gene locus_tag LOCUS_07490 6680 8179 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974568.1 protein_id gnl|my_center|LOCUS_07490 8254 9090 gene locus_tag LOCUS_07500 8254 9090 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311158.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence050 1852 434 gene locus_tag LOCUS_07510 gene pccR 1852 434 CDS product propionyl-CoA assimilation transcriptional regulator PccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719339.1 protein_id gnl|my_center|LOCUS_07510 3116 1968 gene locus_tag LOCUS_07520 3116 1968 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337296.1 protein_id gnl|my_center|LOCUS_07520 3486 3130 gene locus_tag LOCUS_07530 3486 3130 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384980.1 protein_id gnl|my_center|LOCUS_07530 4970 3477 gene locus_tag LOCUS_07540 4970 3477 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337085.1 protein_id gnl|my_center|LOCUS_07540 5717 5046 gene locus_tag LOCUS_07550 5717 5046 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337086.1 protein_id gnl|my_center|LOCUS_07550 6757 5714 gene locus_tag LOCUS_07560 gene pyrC 6757 5714 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337087.1 protein_id gnl|my_center|LOCUS_07560 6894 7196 gene locus_tag LOCUS_07570 6894 7196 CDS product Antifreeze protein, type I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720473.1 protein_id gnl|my_center|LOCUS_07570 8289 7270 gene locus_tag LOCUS_07580 gene gap 8289 7270 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384869.1 protein_id gnl|my_center|LOCUS_07580 8595 8425 gene locus_tag LOCUS_07590 8595 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 9094 9417 gene locus_tag LOCUS_07600 9094 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07600 9439 9663 gene locus_tag LOCUS_07610 9439 9663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07610 9709 10092 gene locus_tag LOCUS_07620 9709 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07620 >Feature sequence051 355 5 gene locus_tag LOCUS_07630 355 5 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389769.1 protein_id gnl|my_center|LOCUS_07630 1299 355 gene locus_tag LOCUS_07640 1299 355 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967060.1 protein_id gnl|my_center|LOCUS_07640 1529 1453 gene locus_tag LOCUS_t00090 1529 1453 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2082 1579 gene locus_tag LOCUS_07650 2082 1579 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669283.1 protein_id gnl|my_center|LOCUS_07650 2723 2082 gene locus_tag LOCUS_07660 2723 2082 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719511.1 protein_id gnl|my_center|LOCUS_07660 3446 2835 gene locus_tag LOCUS_07670 gene pdxH 3446 2835 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337412.1 protein_id gnl|my_center|LOCUS_07670 3509 4351 gene locus_tag LOCUS_07680 gene fabI 3509 4351 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719509.1 protein_id gnl|my_center|LOCUS_07680 4359 4970 gene locus_tag LOCUS_07690 4359 4970 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205912.1 protein_id gnl|my_center|LOCUS_07690 4982 5494 gene locus_tag LOCUS_07700 gene gpt 4982 5494 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337411.1 protein_id gnl|my_center|LOCUS_07700 5494 5958 gene locus_tag LOCUS_07710 5494 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 6156 5986 gene locus_tag LOCUS_07720 6156 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 6493 6239 gene locus_tag LOCUS_07730 6493 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 8160 6658 gene locus_tag LOCUS_07740 gene trpE 8160 6658 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643621.1 protein_id gnl|my_center|LOCUS_07740 10112 8160 gene locus_tag LOCUS_07750 10112 8160 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337149.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence052 980 69 gene locus_tag LOCUS_07760 980 69 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064618.1 protein_id gnl|my_center|LOCUS_07760 2608 977 gene locus_tag LOCUS_07770 2608 977 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064619.1 protein_id gnl|my_center|LOCUS_07770 2714 3658 gene locus_tag LOCUS_07780 2714 3658 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084035.1 protein_id gnl|my_center|LOCUS_07780 3760 5352 gene locus_tag LOCUS_07790 3760 5352 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084030.1 protein_id gnl|my_center|LOCUS_07790 5375 6346 gene locus_tag LOCUS_07800 5375 6346 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064134.1 protein_id gnl|my_center|LOCUS_07800 6479 7312 gene locus_tag LOCUS_07810 6479 7312 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315087.1 protein_id gnl|my_center|LOCUS_07810 7316 8305 gene locus_tag LOCUS_07820 7316 8305 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083810.1 protein_id gnl|my_center|LOCUS_07820 8302 9252 gene locus_tag LOCUS_07830 8302 9252 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_07830 9750 9157 gene locus_tag LOCUS_07840 9750 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 9929 10186 gene locus_tag LOCUS_07850 9929 10186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 10222 10410 gene locus_tag LOCUS_07860 10222 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence053 806 294 gene locus_tag LOCUS_07870 gene rpsI 806 294 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384467.1 protein_id gnl|my_center|LOCUS_07870 1273 809 gene locus_tag LOCUS_07880 gene rplM 1273 809 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720164.1 protein_id gnl|my_center|LOCUS_07880 1830 1423 gene locus_tag LOCUS_07890 1830 1423 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723418.1 protein_id gnl|my_center|LOCUS_07890 1900 2691 gene locus_tag LOCUS_07900 1900 2691 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338959.1 protein_id gnl|my_center|LOCUS_07900 3448 2711 gene locus_tag LOCUS_07910 3448 2711 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719288.1 protein_id gnl|my_center|LOCUS_07910 6456 3523 gene locus_tag LOCUS_07920 6456 3523 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669211.1 protein_id gnl|my_center|LOCUS_07920 6513 6881 gene locus_tag LOCUS_07930 6513 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 7769 6915 gene locus_tag LOCUS_07940 7769 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 9230 7905 gene locus_tag LOCUS_07950 9230 7905 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383893.1 protein_id gnl|my_center|LOCUS_07950 <10317 9247 gene locus_tag LOCUS_07960 <10317 9247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337255.1:ATP-binding protein >Feature sequence054 319 1077 gene locus_tag LOCUS_07970 319 1077 CDS product DUF1638 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531173.1 protein_id gnl|my_center|LOCUS_07970 1199 1501 gene locus_tag LOCUS_07980 1199 1501 CDS product virulence factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531170.1 protein_id gnl|my_center|LOCUS_07980 1494 2153 gene locus_tag LOCUS_07990 1494 2153 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531169.1 protein_id gnl|my_center|LOCUS_07990 2150 3241 gene locus_tag LOCUS_08000 2150 3241 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531168.1 protein_id gnl|my_center|LOCUS_08000 3280 4233 gene locus_tag LOCUS_08010 3280 4233 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531167.1 protein_id gnl|my_center|LOCUS_08010 4281 5420 gene locus_tag LOCUS_08020 4281 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08020 5420 6328 gene locus_tag LOCUS_08030 5420 6328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08030 6451 6888 gene locus_tag LOCUS_08040 6451 6888 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972923.1 protein_id gnl|my_center|LOCUS_08040 8694 7777 gene locus_tag LOCUS_08050 8694 7777 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083152.1 protein_id gnl|my_center|LOCUS_08050 9269 8694 gene locus_tag LOCUS_08060 9269 8694 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967626.1 protein_id gnl|my_center|LOCUS_08060 10087 9266 gene locus_tag LOCUS_08070 10087 9266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967625.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence055 587 1138 gene locus_tag LOCUS_08080 587 1138 CDS product DUF1285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338669.1 protein_id gnl|my_center|LOCUS_08080 1139 1906 gene locus_tag LOCUS_08090 1139 1906 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384539.1 protein_id gnl|my_center|LOCUS_08090 1938 2093 gene locus_tag LOCUS_08100 1938 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2096 3202 gene locus_tag LOCUS_08110 2096 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974153.1 protein_id gnl|my_center|LOCUS_08110 3321 5141 gene locus_tag LOCUS_08120 gene typA 3321 5141 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720611.1 protein_id gnl|my_center|LOCUS_08120 5215 5859 gene locus_tag LOCUS_08130 5215 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 6719 5835 gene locus_tag LOCUS_08140 gene purU 6719 5835 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721207.1 protein_id gnl|my_center|LOCUS_08140 7133 6810 gene locus_tag LOCUS_08150 7133 6810 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720517.1 protein_id gnl|my_center|LOCUS_08150 8654 7446 gene locus_tag LOCUS_08160 8654 7446 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337737.1 protein_id gnl|my_center|LOCUS_08160 8992 8729 gene locus_tag LOCUS_08170 8992 8729 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719929.1 protein_id gnl|my_center|LOCUS_08170 <10071 9006 gene locus_tag LOCUS_08180 <10071 9006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009562231.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence056 541 2499 gene locus_tag LOCUS_08190 541 2499 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114537.1 protein_id gnl|my_center|LOCUS_08190 3564 2509 gene locus_tag LOCUS_08200 3564 2509 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397743.1 protein_id gnl|my_center|LOCUS_08200 4371 3592 gene locus_tag LOCUS_08210 4371 3592 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209786.1 protein_id gnl|my_center|LOCUS_08210 5546 4374 gene locus_tag LOCUS_08220 5546 4374 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019995456.1 protein_id gnl|my_center|LOCUS_08220 6638 5604 gene locus_tag LOCUS_08230 6638 5604 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967931.1 protein_id gnl|my_center|LOCUS_08230 7313 7999 gene locus_tag LOCUS_08240 7313 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 8133 8942 gene locus_tag LOCUS_08250 8133 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 9488 8976 gene locus_tag LOCUS_08260 9488 8976 CDS product DUF2243 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311089.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence057 2330 879 gene locus_tag LOCUS_08270 2330 879 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401689.1 protein_id gnl|my_center|LOCUS_08270 2441 3253 gene locus_tag LOCUS_08280 2441 3253 CDS product FCD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389168.1 protein_id gnl|my_center|LOCUS_08280 4674 4120 gene locus_tag LOCUS_08290 4674 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 7261 4685 gene locus_tag LOCUS_08300 7261 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 7813 8820 gene locus_tag LOCUS_08310 7813 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 8833 9054 gene locus_tag LOCUS_08320 8833 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 9243 9518 gene locus_tag LOCUS_08330 9243 9518 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence058 3 1325 gene locus_tag LOCUS_08340 gene ilvD 3 1325 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383299.1 protein_id gnl|my_center|LOCUS_08340 1335 2120 gene locus_tag LOCUS_08350 1335 2120 CDS product DUF6478 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383300.1 protein_id gnl|my_center|LOCUS_08350 2134 2517 gene locus_tag LOCUS_08360 2134 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 3241 2522 gene locus_tag LOCUS_08370 3241 2522 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338597.1 protein_id gnl|my_center|LOCUS_08370 3978 3238 gene locus_tag LOCUS_08380 3978 3238 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338596.1 protein_id gnl|my_center|LOCUS_08380 4075 4875 gene locus_tag LOCUS_08390 gene map 4075 4875 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338595.1 protein_id gnl|my_center|LOCUS_08390 5134 4973 gene locus_tag LOCUS_08400 5134 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5598 5131 gene locus_tag LOCUS_08410 gene ruvX 5598 5131 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719835.1 protein_id gnl|my_center|LOCUS_08410 6992 5595 gene locus_tag LOCUS_08420 gene ccmI 6992 5595 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920446.1 protein_id gnl|my_center|LOCUS_08420 7225 8514 gene locus_tag LOCUS_08430 7225 8514 CDS product sarcosine oxidase subunit beta family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719837.1 protein_id gnl|my_center|LOCUS_08430 8642 8977 gene locus_tag LOCUS_08440 8642 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 9092 9493 gene locus_tag LOCUS_08450 9092 9493 CDS product sarcosine oxidase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719839.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence059 400 843 gene locus_tag LOCUS_08460 400 843 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339434.1 protein_id gnl|my_center|LOCUS_08460 876 2102 gene locus_tag LOCUS_08470 gene trpB 876 2102 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724529.1 protein_id gnl|my_center|LOCUS_08470 2747 2142 gene locus_tag LOCUS_08480 2747 2142 CDS product DUF4893 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531172.1 protein_id gnl|my_center|LOCUS_08480 3117 2740 gene locus_tag LOCUS_08490 3117 2740 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724527.1 protein_id gnl|my_center|LOCUS_08490 3820 3125 gene locus_tag LOCUS_08500 gene pth 3820 3125 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338521.1 protein_id gnl|my_center|LOCUS_08500 3959 4588 gene locus_tag LOCUS_08510 3959 4588 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720342.1 protein_id gnl|my_center|LOCUS_08510 4754 6016 gene locus_tag LOCUS_08520 gene clpX 4754 6016 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338056.1 protein_id gnl|my_center|LOCUS_08520 7110 6229 gene locus_tag LOCUS_08530 gene tsf 7110 6229 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719943.1 protein_id gnl|my_center|LOCUS_08530 7965 7171 gene locus_tag LOCUS_08540 gene rpsB 7965 7171 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719944.1 protein_id gnl|my_center|LOCUS_08540 8294 8370 gene locus_tag LOCUS_t00100 8294 8370 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8750 8905 gene locus_tag LOCUS_08550 8750 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 9074 9412 gene locus_tag LOCUS_08560 9074 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 <9879 9306 gene locus_tag LOCUS_08570 <9879 9306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389722.1:PHB depolymerase family esterase >Feature sequence060 226 783 gene locus_tag LOCUS_08580 226 783 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467620.1 protein_id gnl|my_center|LOCUS_08580 784 1941 gene locus_tag LOCUS_08590 gene mnmH 784 1941 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339449.1 protein_id gnl|my_center|LOCUS_08590 2851 2132 gene locus_tag LOCUS_08600 2851 2132 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339143.1 protein_id gnl|my_center|LOCUS_08600 3141 2839 gene locus_tag LOCUS_08610 3141 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337161.1 protein_id gnl|my_center|LOCUS_08610 3341 4042 gene locus_tag LOCUS_08620 3341 4042 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530243.1 protein_id gnl|my_center|LOCUS_08620 4206 4018 gene locus_tag LOCUS_08630 4206 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4261 6060 gene locus_tag LOCUS_08640 gene lepA 4261 6060 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670005.1 protein_id gnl|my_center|LOCUS_08640 7140 6181 gene locus_tag LOCUS_08650 7140 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 7854 7333 gene locus_tag LOCUS_08660 7854 7333 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_08660 8982 7897 gene locus_tag LOCUS_08670 gene trpS 8982 7897 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003525.1 protein_id gnl|my_center|LOCUS_08670 8995 9705 gene locus_tag LOCUS_08680 8995 9705 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722664.1 protein_id gnl|my_center|LOCUS_08680 9876 9709 gene locus_tag LOCUS_08690 9876 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence061 877 68 gene locus_tag LOCUS_08700 gene proC 877 68 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140370.1 protein_id gnl|my_center|LOCUS_08700 1441 938 gene locus_tag LOCUS_08710 1441 938 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562659.1 protein_id gnl|my_center|LOCUS_08710 2620 1721 gene locus_tag LOCUS_08720 2620 1721 CDS product virulence-associated methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407297.1 protein_id gnl|my_center|LOCUS_08720 2698 3408 gene locus_tag LOCUS_08730 2698 3408 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530738.1 protein_id gnl|my_center|LOCUS_08730 4211 3462 gene locus_tag LOCUS_08740 4211 3462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389674.1 protein_id gnl|my_center|LOCUS_08740 5091 4222 gene locus_tag LOCUS_08750 5091 4222 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008282.1 protein_id gnl|my_center|LOCUS_08750 5996 5088 gene locus_tag LOCUS_08760 5996 5088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066547.1 protein_id gnl|my_center|LOCUS_08760 7084 5993 gene locus_tag LOCUS_08770 7084 5993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383852.1 protein_id gnl|my_center|LOCUS_08770 8690 7089 gene locus_tag LOCUS_08780 8690 7089 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139954.1 protein_id gnl|my_center|LOCUS_08780 9308 8802 gene locus_tag LOCUS_08790 9308 8802 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719317.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence062 1275 1051 gene locus_tag LOCUS_08800 1275 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2024 1272 gene locus_tag LOCUS_08810 2024 1272 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338460.1 protein_id gnl|my_center|LOCUS_08810 2238 2032 gene locus_tag LOCUS_08820 2238 2032 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720934.1 protein_id gnl|my_center|LOCUS_08820 2314 3315 gene locus_tag LOCUS_08830 2314 3315 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338461.1 protein_id gnl|my_center|LOCUS_08830 4869 3445 gene locus_tag LOCUS_08840 4869 3445 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330072.1 protein_id gnl|my_center|LOCUS_08840 5139 7505 gene locus_tag LOCUS_08850 5139 7505 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003713.1 protein_id gnl|my_center|LOCUS_08850 7483 7623 gene locus_tag LOCUS_08860 7483 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 8300 7695 gene locus_tag LOCUS_08870 8300 7695 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561627.1 protein_id gnl|my_center|LOCUS_08870 9009 8290 gene locus_tag LOCUS_08880 9009 8290 CDS product VacJ family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338569.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence063 804 472 gene locus_tag LOCUS_08890 804 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 697 972 gene locus_tag LOCUS_08900 697 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1377 1850 gene locus_tag LOCUS_08910 1377 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1972 2634 gene locus_tag LOCUS_08920 1972 2634 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_08920 2631 3968 gene locus_tag LOCUS_08930 2631 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4105 4245 gene locus_tag LOCUS_08940 4105 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4545 5285 gene locus_tag LOCUS_08950 4545 5285 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_08950 6056 5319 gene locus_tag LOCUS_08960 6056 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08960 6328 6053 gene locus_tag LOCUS_08970 6328 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08970 8868 7489 gene locus_tag LOCUS_08980 8868 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence064 464 57 gene locus_tag LOCUS_08990 464 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1852 557 gene locus_tag LOCUS_09000 gene nuoF 1852 557 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337550.1 protein_id gnl|my_center|LOCUS_09000 2086 1865 gene locus_tag LOCUS_09010 2086 1865 CDS product DUF5337 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337549.1 protein_id gnl|my_center|LOCUS_09010 2742 2092 gene locus_tag LOCUS_09020 2742 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3722 2781 gene locus_tag LOCUS_09030 gene nuoE 3722 2781 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337548.1 protein_id gnl|my_center|LOCUS_09030 5035 3797 gene locus_tag LOCUS_09040 5035 3797 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564438.1 protein_id gnl|my_center|LOCUS_09040 5484 5041 gene locus_tag LOCUS_09050 5484 5041 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013664.1 protein_id gnl|my_center|LOCUS_09050 6128 5481 gene locus_tag LOCUS_09060 6128 5481 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337546.1 protein_id gnl|my_center|LOCUS_09060 6761 6132 gene locus_tag LOCUS_09070 6761 6132 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719665.1 protein_id gnl|my_center|LOCUS_09070 7117 6752 gene locus_tag LOCUS_09080 7117 6752 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385030.1 protein_id gnl|my_center|LOCUS_09080 8024 7254 gene locus_tag LOCUS_09090 8024 7254 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971780.1 protein_id gnl|my_center|LOCUS_09090 8852 8097 gene locus_tag LOCUS_09100 8852 8097 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009936067.1 protein_id gnl|my_center|LOCUS_09100 <9578 8938 gene locus_tag LOCUS_09110 <9578 8938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009565362.1:excinuclease ABC subunit UvrA >Feature sequence065 1651 464 gene locus_tag LOCUS_09120 1651 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2743 1904 gene locus_tag LOCUS_09130 2743 1904 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383279.1 protein_id gnl|my_center|LOCUS_09130 3661 2909 gene locus_tag LOCUS_09140 3661 2909 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333546.1 protein_id gnl|my_center|LOCUS_09140 4152 3658 gene locus_tag LOCUS_09150 4152 3658 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890701.1 protein_id gnl|my_center|LOCUS_09150 6719 4149 gene locus_tag LOCUS_09160 gene mgtA 6719 4149 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_09160 7364 7080 gene locus_tag LOCUS_09170 7364 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09170 7831 7331 gene locus_tag LOCUS_09180 7831 7331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09180 8820 8578 gene locus_tag LOCUS_09190 8820 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09190 8844 9113 gene locus_tag LOCUS_09200 8844 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence066 771 640 gene locus_tag LOCUS_09210 771 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1260 1472 gene locus_tag LOCUS_09220 1260 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1670 3055 gene locus_tag LOCUS_09230 1670 3055 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819390.1 protein_id gnl|my_center|LOCUS_09230 3059 3349 gene locus_tag LOCUS_09240 3059 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09240 3387 3668 gene locus_tag LOCUS_09250 3387 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09250 3691 4317 gene locus_tag LOCUS_09260 3691 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09260 5625 4333 gene locus_tag LOCUS_09270 5625 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6702 6022 gene locus_tag LOCUS_09280 6702 6022 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531177.1 protein_id gnl|my_center|LOCUS_09280 8668 7085 gene locus_tag LOCUS_09290 8668 7085 CDS product trimethylamine methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence067 1360 2 gene locus_tag LOCUS_09300 1360 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2570 2298 gene locus_tag LOCUS_09310 2570 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3255 4529 gene locus_tag LOCUS_09320 gene sstT 3255 4529 CDS product serine/threonine transporter SstT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216063.1 protein_id gnl|my_center|LOCUS_09320 5657 4632 gene locus_tag LOCUS_09330 gene tdh 5657 4632 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074264.1 protein_id gnl|my_center|LOCUS_09330 6856 5660 gene locus_tag LOCUS_09340 gene kbl 6856 5660 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175931.1 protein_id gnl|my_center|LOCUS_09340 7216 7386 gene locus_tag LOCUS_09350 7216 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 7404 7673 gene locus_tag LOCUS_09360 7404 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09360 7667 7963 gene locus_tag LOCUS_09370 7667 7963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09370 8790 8383 gene locus_tag LOCUS_09380 8790 8383 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970565.1 protein_id gnl|my_center|LOCUS_09380 9047 8787 gene locus_tag LOCUS_09390 9047 8787 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182307811.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence068 222 2015 gene locus_tag LOCUS_09400 222 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2186 2683 gene locus_tag LOCUS_09410 2186 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2693 3319 gene locus_tag LOCUS_09420 2693 3319 CDS product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 protein_id gnl|my_center|LOCUS_09420 3316 4200 gene locus_tag LOCUS_09430 3316 4200 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_09430 4197 4643 gene locus_tag LOCUS_09440 4197 4643 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149776562.1 protein_id gnl|my_center|LOCUS_09440 4653 8651 gene locus_tag LOCUS_09450 4653 8651 CDS product glycoside hydrolase/phage tail family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383960.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence069 328 1080 gene locus_tag LOCUS_09460 328 1080 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338779.1 protein_id gnl|my_center|LOCUS_09460 1195 1626 gene locus_tag LOCUS_09470 gene arfB 1195 1626 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538074.1 protein_id gnl|my_center|LOCUS_09470 1623 2066 gene locus_tag LOCUS_09480 1623 2066 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909719.1 protein_id gnl|my_center|LOCUS_09480 2115 3539 gene locus_tag LOCUS_09490 2115 3539 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337282.1 protein_id gnl|my_center|LOCUS_09490 3790 3554 gene locus_tag LOCUS_09500 3790 3554 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721241.1 protein_id gnl|my_center|LOCUS_09500 5250 3856 gene locus_tag LOCUS_09510 5250 3856 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338470.1 protein_id gnl|my_center|LOCUS_09510 6161 5268 gene locus_tag LOCUS_09520 gene fmt 6161 5268 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383426.1 protein_id gnl|my_center|LOCUS_09520 6797 6297 gene locus_tag LOCUS_09530 gene def 6797 6297 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338558.1 protein_id gnl|my_center|LOCUS_09530 7265 6804 gene locus_tag LOCUS_09540 gene def 7265 6804 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383428.1 protein_id gnl|my_center|LOCUS_09540 7399 8583 gene locus_tag LOCUS_09550 7399 8583 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338556.1 protein_id gnl|my_center|LOCUS_09550 8595 9206 gene locus_tag LOCUS_09560 8595 9206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence070 1318 797 gene locus_tag LOCUS_09570 gene mraZ 1318 797 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_09570 3065 1965 gene locus_tag LOCUS_09580 3065 1965 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337233.1 protein_id gnl|my_center|LOCUS_09580 3671 4453 gene locus_tag LOCUS_09590 gene rlmJ 3671 4453 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338187.1 protein_id gnl|my_center|LOCUS_09590 4878 4432 gene locus_tag LOCUS_09600 4878 4432 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001518898.1 protein_id gnl|my_center|LOCUS_09600 5582 4890 gene locus_tag LOCUS_09610 5582 4890 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337365.1 protein_id gnl|my_center|LOCUS_09610 5677 5964 gene locus_tag LOCUS_09620 gene gatC 5677 5964 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719430.1 protein_id gnl|my_center|LOCUS_09620 5961 7442 gene locus_tag LOCUS_09630 gene gatA 5961 7442 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337367.1 protein_id gnl|my_center|LOCUS_09630 7471 8049 gene locus_tag LOCUS_09640 7471 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 8100 9041 gene locus_tag LOCUS_09650 8100 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence071 3457 1379 gene locus_tag LOCUS_09660 3457 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09660 4132 3506 gene locus_tag LOCUS_09670 4132 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09670 5391 4195 gene locus_tag LOCUS_09680 5391 4195 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722667.1 protein_id gnl|my_center|LOCUS_09680 5508 6434 gene locus_tag LOCUS_09690 gene rsmI 5508 6434 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337001.1 protein_id gnl|my_center|LOCUS_09690 6424 6831 gene locus_tag LOCUS_09700 6424 6831 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383076.1 protein_id gnl|my_center|LOCUS_09700 6896 7855 gene locus_tag LOCUS_09710 gene gshB 6896 7855 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383077.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence072 <1 1818 gene locus_tag LOCUS_09720 <1 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162992369.1:malate synthase G 3364 1823 gene locus_tag LOCUS_09730 3364 1823 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931292.1 protein_id gnl|my_center|LOCUS_09730 3824 3441 gene locus_tag LOCUS_09740 3824 3441 CDS product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 protein_id gnl|my_center|LOCUS_09740 5083 3881 gene locus_tag LOCUS_09750 5083 3881 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720951.1 protein_id gnl|my_center|LOCUS_09750 5157 5447 gene locus_tag LOCUS_09760 5157 5447 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338469.1 protein_id gnl|my_center|LOCUS_09760 5508 6032 gene locus_tag LOCUS_09770 5508 6032 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139949.1 protein_id gnl|my_center|LOCUS_09770 6476 6048 gene locus_tag LOCUS_09780 6476 6048 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720555.1 protein_id gnl|my_center|LOCUS_09780 6581 7486 gene locus_tag LOCUS_09790 gene thyX 6581 7486 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383016.1 protein_id gnl|my_center|LOCUS_09790 7618 8211 gene locus_tag LOCUS_09800 7618 8211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09800 8208 8984 gene locus_tag LOCUS_09810 8208 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence073 2 220 gene locus_tag LOCUS_09820 2 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 594 1091 gene locus_tag LOCUS_09830 594 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1677 1450 gene locus_tag LOCUS_09840 1677 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1919 3067 gene locus_tag LOCUS_09850 1919 3067 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775996.1 protein_id gnl|my_center|LOCUS_09850 3733 4908 gene locus_tag LOCUS_09860 3733 4908 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_09860 5620 5886 gene locus_tag LOCUS_09870 5620 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 5929 6282 gene locus_tag LOCUS_09880 5929 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6373 7107 gene locus_tag LOCUS_09890 6373 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 7255 8754 gene locus_tag LOCUS_09900 7255 8754 CDS product YfjI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035339735.1 protein_id gnl|my_center|LOCUS_09900 8905 9132 gene locus_tag LOCUS_09910 8905 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence074 2124 160 gene locus_tag LOCUS_09920 gene parE 2124 160 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003707.1 protein_id gnl|my_center|LOCUS_09920 2854 2195 gene locus_tag LOCUS_09930 2854 2195 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312247.1 protein_id gnl|my_center|LOCUS_09930 3075 4136 gene locus_tag LOCUS_09940 gene rnd 3075 4136 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337124.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09940 4066 4287 gene locus_tag LOCUS_09950 4066 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09950 4810 4301 gene locus_tag LOCUS_09960 4810 4301 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385751.1 protein_id gnl|my_center|LOCUS_09960 5218 4904 gene locus_tag LOCUS_09970 5218 4904 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337341.1 protein_id gnl|my_center|LOCUS_09970 5973 5215 gene locus_tag LOCUS_09980 gene hisF 5973 5215 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562844.1 protein_id gnl|my_center|LOCUS_09980 7049 6075 gene locus_tag LOCUS_09990 7049 6075 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337607.1 protein_id gnl|my_center|LOCUS_09990 8107 7046 gene locus_tag LOCUS_10000 gene plsX 8107 7046 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337608.1 protein_id gnl|my_center|LOCUS_10000 8392 8186 gene locus_tag LOCUS_10010 gene rpmF 8392 8186 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537694.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence075 384 1469 gene locus_tag LOCUS_10020 384 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2850 1516 gene locus_tag LOCUS_10030 gene tig 2850 1516 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720285.1 protein_id gnl|my_center|LOCUS_10030 2957 2873 gene locus_tag LOCUS_t00110 2957 2873 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4665 3043 gene locus_tag LOCUS_10040 4665 3043 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531453.1 protein_id gnl|my_center|LOCUS_10040 4818 5156 gene locus_tag LOCUS_10050 4818 5156 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_10050 5196 6602 gene locus_tag LOCUS_10060 gene glnA 5196 6602 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720290.1 protein_id gnl|my_center|LOCUS_10060 6779 7405 gene locus_tag LOCUS_10070 6779 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 7497 8804 gene locus_tag LOCUS_10080 gene purB 7497 8804 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384999.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence076 380 1831 gene locus_tag LOCUS_10090 gene zwf 380 1831 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562257.1 protein_id gnl|my_center|LOCUS_10090 1839 2507 gene locus_tag LOCUS_10100 gene pgl 1839 2507 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337699.1 protein_id gnl|my_center|LOCUS_10100 2517 3059 gene locus_tag LOCUS_10110 2517 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10110 2981 4093 gene locus_tag LOCUS_10120 2981 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10120 5384 4419 gene locus_tag LOCUS_10130 5384 4419 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337476.1 protein_id gnl|my_center|LOCUS_10130 5678 5394 gene locus_tag LOCUS_10140 5678 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 5711 6307 gene locus_tag LOCUS_10150 5711 6307 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337477.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence077 848 258 gene locus_tag LOCUS_10160 848 258 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338205.1 protein_id gnl|my_center|LOCUS_10160 940 1320 gene locus_tag LOCUS_10170 940 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1361 2524 gene locus_tag LOCUS_10180 1361 2524 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338523.1 protein_id gnl|my_center|LOCUS_10180 2633 3253 gene locus_tag LOCUS_10190 2633 3253 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721014.1 protein_id gnl|my_center|LOCUS_10190 3331 4671 gene locus_tag LOCUS_10200 gene trmFO 3331 4671 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337618.1 protein_id gnl|my_center|LOCUS_10200 4653 5504 gene locus_tag LOCUS_10210 gene gluQRS 4653 5504 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337617.1 protein_id gnl|my_center|LOCUS_10210 5842 5486 gene locus_tag LOCUS_10220 gene hisI 5842 5486 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337616.1 protein_id gnl|my_center|LOCUS_10220 5902 6336 gene locus_tag LOCUS_10230 5902 6336 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719774.1 protein_id gnl|my_center|LOCUS_10230 8715 6622 gene locus_tag LOCUS_10240 gene recG 8715 6622 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337615.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence078 1687 359 gene locus_tag LOCUS_10250 1687 359 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337521.1 protein_id gnl|my_center|LOCUS_10250 3103 1700 gene locus_tag LOCUS_10260 3103 1700 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337522.1 protein_id gnl|my_center|LOCUS_10260 4166 3117 gene locus_tag LOCUS_10270 gene pdhA 4166 3117 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719639.1 protein_id gnl|my_center|LOCUS_10270 4554 4261 gene locus_tag LOCUS_10280 4554 4261 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383966.1 protein_id gnl|my_center|LOCUS_10280 5882 4614 gene locus_tag LOCUS_10290 5882 4614 CDS product acetylornithine deacetylase/succinyl-diaminopimelate desuccinylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104490930.1 protein_id gnl|my_center|LOCUS_10290 6152 6754 gene locus_tag LOCUS_10300 6152 6754 CDS product DUF1523 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095640297.1 protein_id gnl|my_center|LOCUS_10300 7280 6804 gene locus_tag LOCUS_10310 gene dps 7280 6804 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312098.1 protein_id gnl|my_center|LOCUS_10310 7656 7420 gene locus_tag LOCUS_10320 7656 7420 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719616.1 protein_id gnl|my_center|LOCUS_10320 8554 7817 gene locus_tag LOCUS_10330 gene fabG 8554 7817 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719615.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence079 994 248 gene locus_tag LOCUS_10340 gene tssE 994 248 CDS product type VI secretion system baseplate subunit TssE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339345.1 protein_id gnl|my_center|LOCUS_10340 1508 1017 gene locus_tag LOCUS_10350 1508 1017 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724313.1 protein_id gnl|my_center|LOCUS_10350 3141 1627 gene locus_tag LOCUS_10360 gene tssC 3141 1627 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161601251.1 protein_id gnl|my_center|LOCUS_10360 3684 3145 gene locus_tag LOCUS_10370 gene tssB 3684 3145 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724310.1 protein_id gnl|my_center|LOCUS_10370 4851 3742 gene locus_tag LOCUS_10380 4851 3742 CDS product type VI secretion system ImpA family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339343.1 protein_id gnl|my_center|LOCUS_10380 7077 4963 gene locus_tag LOCUS_10390 7077 4963 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339342.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence080 941 126 gene locus_tag LOCUS_10400 941 126 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339543.1 protein_id gnl|my_center|LOCUS_10400 2055 1003 gene locus_tag LOCUS_10410 2055 1003 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723135.1 protein_id gnl|my_center|LOCUS_10410 2290 3297 gene locus_tag LOCUS_10420 2290 3297 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339542.1 protein_id gnl|my_center|LOCUS_10420 3752 3402 gene locus_tag LOCUS_10430 3752 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6053 3816 gene locus_tag LOCUS_10440 gene ptsP 6053 3816 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563776.1 protein_id gnl|my_center|LOCUS_10440 7362 6106 gene locus_tag LOCUS_10450 7362 6106 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337028.1 protein_id gnl|my_center|LOCUS_10450 8267 7851 gene locus_tag LOCUS_10460 8267 7851 CDS product DUF1178 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337454.1 protein_id gnl|my_center|LOCUS_10460 8727 8326 gene locus_tag LOCUS_10470 8727 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence081 457 1530 gene locus_tag LOCUS_10480 gene gmd 457 1530 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868774.1 protein_id gnl|my_center|LOCUS_10480 1527 2954 gene locus_tag LOCUS_10490 1527 2954 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331335.1 protein_id gnl|my_center|LOCUS_10490 2951 3904 gene locus_tag LOCUS_10500 2951 3904 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331384.1 protein_id gnl|my_center|LOCUS_10500 3918 5270 gene locus_tag LOCUS_10510 3918 5270 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385416.1 protein_id gnl|my_center|LOCUS_10510 5359 6351 gene locus_tag LOCUS_10520 5359 6351 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721134.1 protein_id gnl|my_center|LOCUS_10520 6440 7135 gene locus_tag LOCUS_10530 6440 7135 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721136.1 protein_id gnl|my_center|LOCUS_10530 7132 8454 gene locus_tag LOCUS_10540 7132 8454 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338587.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence082 <1 1158 gene locus_tag LOCUS_10550 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113241.1:heme d1 biosynthesis protein NirF 1155 2141 gene locus_tag LOCUS_10560 1155 2141 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_10560 2138 2620 gene locus_tag LOCUS_10570 2138 2620 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_10570 2635 3105 gene locus_tag LOCUS_10580 2635 3105 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_10580 3118 4341 gene locus_tag LOCUS_10590 gene nirJ 3118 4341 CDS product heme d1 biosynthesis radical SAM protein NirJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124643914.1 protein_id gnl|my_center|LOCUS_10590 4316 5911 gene locus_tag LOCUS_10600 4316 5911 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068497115.1 protein_id gnl|my_center|LOCUS_10600 5955 6152 gene locus_tag LOCUS_10610 5955 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7206 6274 gene locus_tag LOCUS_10620 7206 6274 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338926.1 protein_id gnl|my_center|LOCUS_10620 7838 7233 gene locus_tag LOCUS_10630 gene mobA 7838 7233 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970348.1 protein_id gnl|my_center|LOCUS_10630 7933 8451 gene locus_tag LOCUS_10640 7933 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence083 1391 534 gene locus_tag LOCUS_10650 1391 534 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338699.1 protein_id gnl|my_center|LOCUS_10650 1683 1444 gene locus_tag LOCUS_10660 gene purS 1683 1444 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337254.1 protein_id gnl|my_center|LOCUS_10660 2463 1705 gene locus_tag LOCUS_10670 2463 1705 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383888.1 protein_id gnl|my_center|LOCUS_10670 2594 2908 gene locus_tag LOCUS_10680 2594 2908 CDS product DUF1476 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719280.1 protein_id gnl|my_center|LOCUS_10680 4254 2944 gene locus_tag LOCUS_10690 4254 2944 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337311.1 protein_id gnl|my_center|LOCUS_10690 4767 4267 gene locus_tag LOCUS_10700 4767 4267 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337310.1 protein_id gnl|my_center|LOCUS_10700 5242 4769 gene locus_tag LOCUS_10710 5242 4769 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337309.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10710 5355 5753 gene locus_tag LOCUS_10720 5355 5753 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719359.1 protein_id gnl|my_center|LOCUS_10720 5906 6313 gene locus_tag LOCUS_10730 5906 6313 CDS product MerR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719358.1 protein_id gnl|my_center|LOCUS_10730 6330 8105 gene locus_tag LOCUS_10740 6330 8105 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337307.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence084 <1 762 gene locus_tag LOCUS_10750 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339415.1:FAD-dependent oxidoreductase 795 1130 gene locus_tag LOCUS_10760 795 1130 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724672.1 protein_id gnl|my_center|LOCUS_10760 1186 2286 gene locus_tag LOCUS_10770 gene aroC 1186 2286 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721996.1 protein_id gnl|my_center|LOCUS_10770 2385 3749 gene locus_tag LOCUS_10780 2385 3749 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338651.1 protein_id gnl|my_center|LOCUS_10780 4157 3780 gene locus_tag LOCUS_10790 4157 3780 CDS product DUF2852 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719789.1 protein_id gnl|my_center|LOCUS_10790 4854 4243 gene locus_tag LOCUS_10800 4854 4243 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337928.1 protein_id gnl|my_center|LOCUS_10800 5143 4865 gene locus_tag LOCUS_10810 5143 4865 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336940.1 protein_id gnl|my_center|LOCUS_10810 5553 5140 gene locus_tag LOCUS_10820 5553 5140 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722435.1 protein_id gnl|my_center|LOCUS_10820 6556 5582 gene locus_tag LOCUS_10830 gene rapZ 6556 5582 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561581.1 protein_id gnl|my_center|LOCUS_10830 6987 6553 gene locus_tag LOCUS_10840 6987 6553 CDS product HPr kinase/phosphatase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336939.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence085 1350 85 gene locus_tag LOCUS_10850 1350 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1721 2152 gene locus_tag LOCUS_10860 1721 2152 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384527.1 protein_id gnl|my_center|LOCUS_10860 2157 2834 gene locus_tag LOCUS_10870 2157 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3257 2895 gene locus_tag LOCUS_10880 gene grxD 3257 2895 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720111.1 protein_id gnl|my_center|LOCUS_10880 3542 3306 gene locus_tag LOCUS_10890 3542 3306 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384862.1 protein_id gnl|my_center|LOCUS_10890 4569 3907 gene locus_tag LOCUS_10900 4569 3907 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724361.1 protein_id gnl|my_center|LOCUS_10900 4674 4976 gene locus_tag LOCUS_10910 4674 4976 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097704.1 protein_id gnl|my_center|LOCUS_10910 4976 5638 gene locus_tag LOCUS_10920 4976 5638 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339372.1 protein_id gnl|my_center|LOCUS_10920 5631 6971 gene locus_tag LOCUS_10930 5631 6971 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339373.1 protein_id gnl|my_center|LOCUS_10930 7416 7186 gene locus_tag LOCUS_10940 7416 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 7528 8241 gene locus_tag LOCUS_10950 7528 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10950 >Feature sequence086 22 672 gene locus_tag LOCUS_10960 22 672 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396119.1 protein_id gnl|my_center|LOCUS_10960 889 1722 gene locus_tag LOCUS_10970 gene fghA 889 1722 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721045.1 protein_id gnl|my_center|LOCUS_10970 1898 3913 gene locus_tag LOCUS_10980 1898 3913 CDS product methanol/ethanol family PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719727.1 protein_id gnl|my_center|LOCUS_10980 4025 4696 gene locus_tag LOCUS_10990 4025 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4711 5505 gene locus_tag LOCUS_11000 4711 5505 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920376.1 protein_id gnl|my_center|LOCUS_11000 5524 5988 gene locus_tag LOCUS_11010 5524 5988 CDS product PQQ-dependent catabolism-associated CXXCW motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337582.1 protein_id gnl|my_center|LOCUS_11010 6922 5993 gene locus_tag LOCUS_11020 6922 5993 CDS product cytochrome D1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087474.1 protein_id gnl|my_center|LOCUS_11020 7473 6919 gene locus_tag LOCUS_11030 7473 6919 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087475.1 protein_id gnl|my_center|LOCUS_11030 7985 7470 gene locus_tag LOCUS_11040 7985 7470 CDS product DUF3280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337579.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence087 1205 48 gene locus_tag LOCUS_11050 1205 48 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719144.1 protein_id gnl|my_center|LOCUS_11050 1349 1780 gene locus_tag LOCUS_11060 1349 1780 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719143.1 protein_id gnl|my_center|LOCUS_11060 1828 2301 gene locus_tag LOCUS_11070 gene smpB 1828 2301 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721091.1 protein_id gnl|my_center|LOCUS_11070 2905 2495 gene locus_tag LOCUS_11080 2905 2495 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729173.1 protein_id gnl|my_center|LOCUS_11080 3011 3862 gene locus_tag LOCUS_11090 gene sseA 3011 3862 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 protein_id gnl|my_center|LOCUS_11090 3862 5046 gene locus_tag LOCUS_11100 3862 5046 CDS product aspartate/tyrosine/aromatic aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338567.1 protein_id gnl|my_center|LOCUS_11100 5344 5150 gene locus_tag LOCUS_11110 5344 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 6389 5670 gene locus_tag LOCUS_11120 6389 5670 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338653.1 protein_id gnl|my_center|LOCUS_11120 6423 7349 gene locus_tag LOCUS_11130 gene ubiA 6423 7349 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338654.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence088 2 169 gene locus_tag LOCUS_11140 2 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 474 1775 gene locus_tag LOCUS_11150 474 1775 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527246.1 protein_id gnl|my_center|LOCUS_11150 2618 1791 gene locus_tag LOCUS_11160 2618 1791 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255197.1 protein_id gnl|my_center|LOCUS_11160 2790 3986 gene locus_tag LOCUS_11170 2790 3986 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401694.1 protein_id gnl|my_center|LOCUS_11170 3986 4963 gene locus_tag LOCUS_11180 3986 4963 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_11180 4960 6150 gene locus_tag LOCUS_11190 4960 6150 CDS product DSD1 family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401700.1 protein_id gnl|my_center|LOCUS_11190 6150 7112 gene locus_tag LOCUS_11200 6150 7112 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064255183.1 protein_id gnl|my_center|LOCUS_11200 8048 7551 gene locus_tag LOCUS_11210 8048 7551 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336828.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence089 <1 738 gene locus_tag LOCUS_11220 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338457.1:L-threonylcarbamoyladenylate synthase 779 1591 gene locus_tag LOCUS_11230 779 1591 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338649.1 protein_id gnl|my_center|LOCUS_11230 2355 1570 gene locus_tag LOCUS_11240 2355 1570 CDS product protein-disulfide reductase DsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563045.1 protein_id gnl|my_center|LOCUS_11240 2471 4096 gene locus_tag LOCUS_11250 2471 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4093 4722 gene locus_tag LOCUS_11260 4093 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 4719 5993 gene locus_tag LOCUS_11270 gene pyrC 4719 5993 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338650.1 protein_id gnl|my_center|LOCUS_11270 5986 6588 gene locus_tag LOCUS_11280 gene plsY 5986 6588 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563048.1 protein_id gnl|my_center|LOCUS_11280 6731 6585 gene locus_tag LOCUS_11290 6731 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6881 6744 gene locus_tag LOCUS_11300 6881 6744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7784 6909 gene locus_tag LOCUS_11310 7784 6909 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722439.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence090 3993 3172 gene locus_tag LOCUS_11320 gene kynA 3993 3172 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086931.1 protein_id gnl|my_center|LOCUS_11320 4997 3990 gene locus_tag LOCUS_11330 4997 3990 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037399686.1 protein_id gnl|my_center|LOCUS_11330 5072 6115 gene locus_tag LOCUS_11340 gene selD 5072 6115 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967014.1 protein_id gnl|my_center|LOCUS_11340 6564 6121 gene locus_tag LOCUS_11350 6564 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7441 6875 gene locus_tag LOCUS_11360 gene efp 7441 6875 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720643.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence091 3 1568 gene locus_tag LOCUS_11370 3 1568 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383008.1 protein_id gnl|my_center|LOCUS_11370 1616 2422 gene locus_tag LOCUS_11380 1616 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2975 2553 gene locus_tag LOCUS_11390 2975 2553 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118563.1 protein_id gnl|my_center|LOCUS_11390 3026 3961 gene locus_tag LOCUS_11400 3026 3961 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_11400 5223 4063 gene locus_tag LOCUS_11410 5223 4063 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337638.1 protein_id gnl|my_center|LOCUS_11410 5294 5617 gene locus_tag LOCUS_11420 gene erpA 5294 5617 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566170.1 protein_id gnl|my_center|LOCUS_11420 5621 6889 gene locus_tag LOCUS_11430 5621 6889 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973285.1 protein_id gnl|my_center|LOCUS_11430 6932 7720 gene locus_tag LOCUS_11440 gene xth 6932 7720 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337637.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence092 760 978 gene locus_tag LOCUS_11450 760 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11450 1063 1815 gene locus_tag LOCUS_11460 1063 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2798 1812 gene locus_tag LOCUS_11470 2798 1812 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969408.1 protein_id gnl|my_center|LOCUS_11470 3147 4067 gene locus_tag LOCUS_11480 3147 4067 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385252.1 protein_id gnl|my_center|LOCUS_11480 4067 4654 gene locus_tag LOCUS_11490 4067 4654 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930617.1 protein_id gnl|my_center|LOCUS_11490 4679 5983 gene locus_tag LOCUS_11500 4679 5983 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385254.1 protein_id gnl|my_center|LOCUS_11500 5987 6421 gene locus_tag LOCUS_11510 gene gloA 5987 6421 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_11510 6607 7824 gene locus_tag LOCUS_11520 6607 7824 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533462.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence093 1053 889 gene locus_tag LOCUS_11530 1053 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1759 1142 gene locus_tag LOCUS_11540 1759 1142 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720903.1 protein_id gnl|my_center|LOCUS_11540 2515 1760 gene locus_tag LOCUS_11550 2515 1760 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086578.1 protein_id gnl|my_center|LOCUS_11550 3209 2517 gene locus_tag LOCUS_11560 3209 2517 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338435.1 protein_id gnl|my_center|LOCUS_11560 3289 3714 gene locus_tag LOCUS_11570 3289 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4046 3639 gene locus_tag LOCUS_11580 4046 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11580 5680 4043 gene locus_tag LOCUS_11590 5680 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6769 5702 gene locus_tag LOCUS_11600 6769 5702 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976142.1 protein_id gnl|my_center|LOCUS_11600 6950 7618 gene locus_tag LOCUS_11610 6950 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence094 1877 930 gene locus_tag LOCUS_11620 1877 930 CDS product DUF2927 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337360.1 protein_id gnl|my_center|LOCUS_11620 3144 1945 gene locus_tag LOCUS_11630 3144 1945 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384880.1 protein_id gnl|my_center|LOCUS_11630 3362 4624 gene locus_tag LOCUS_11640 gene fabF 3362 4624 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337505.1 protein_id gnl|my_center|LOCUS_11640 4624 5802 gene locus_tag LOCUS_11650 gene mltG 4624 5802 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140158.1 protein_id gnl|my_center|LOCUS_11650 6702 7073 gene locus_tag LOCUS_11660 6702 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence095 <1 2104 gene locus_tag LOCUS_11670 <1 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337229.1:pyruvate carboxylase 2677 2108 gene locus_tag LOCUS_11680 2677 2108 CDS product SgcJ/EcaC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403315.1 protein_id gnl|my_center|LOCUS_11680 3017 2592 gene locus_tag LOCUS_11690 3017 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3630 3007 gene locus_tag LOCUS_11700 3630 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3776 3850 gene locus_tag LOCUS_t00120 3776 3850 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6807 4318 gene locus_tag LOCUS_11710 6807 4318 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339417.1 protein_id gnl|my_center|LOCUS_11710 6742 6918 gene locus_tag LOCUS_11720 6742 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 7973 6972 gene locus_tag LOCUS_11730 7973 6972 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337394.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence096 1137 724 gene locus_tag LOCUS_11740 gene flgA 1137 724 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721892.1 protein_id gnl|my_center|LOCUS_11740 1922 1137 gene locus_tag LOCUS_11750 gene flgG 1922 1137 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338880.1 protein_id gnl|my_center|LOCUS_11750 2645 1935 gene locus_tag LOCUS_11760 2645 1935 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338881.1 protein_id gnl|my_center|LOCUS_11760 2911 2645 gene locus_tag LOCUS_11770 2911 2645 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338882.1 protein_id gnl|my_center|LOCUS_11770 3211 2915 gene locus_tag LOCUS_11780 3211 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3610 3224 gene locus_tag LOCUS_11790 gene flgC 3610 3224 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003754.1 protein_id gnl|my_center|LOCUS_11790 4002 3613 gene locus_tag LOCUS_11800 4002 3613 CDS product FlgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338884.1 protein_id gnl|my_center|LOCUS_11800 4189 5418 gene locus_tag LOCUS_11810 4189 5418 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338885.1 protein_id gnl|my_center|LOCUS_11810 5557 6048 gene locus_tag LOCUS_11820 5557 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6060 7031 gene locus_tag LOCUS_11830 6060 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 <8058 7395 gene locus_tag LOCUS_11840 <8058 7395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012066520.1:extensin family protein >Feature sequence097 150 1076 gene locus_tag LOCUS_11850 150 1076 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337748.1 protein_id gnl|my_center|LOCUS_11850 1107 1445 gene locus_tag LOCUS_11860 1107 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2803 1757 gene locus_tag LOCUS_11870 2803 1757 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153441684.1 protein_id gnl|my_center|LOCUS_11870 3965 2838 gene locus_tag LOCUS_11880 gene prfB 3965 2838 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720136.1 protein_id gnl|my_center|LOCUS_11880 6561 4063 gene locus_tag LOCUS_11890 6561 4063 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337888.1 protein_id gnl|my_center|LOCUS_11890 <7951 6634 gene locus_tag LOCUS_11900 <7951 6634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337889.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence098 605 114 gene locus_tag LOCUS_11910 605 114 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720600.1 protein_id gnl|my_center|LOCUS_11910 1953 610 gene locus_tag LOCUS_11920 1953 610 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139917.1 protein_id gnl|my_center|LOCUS_11920 2707 1946 gene locus_tag LOCUS_11930 gene sufC 2707 1946 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720602.1 protein_id gnl|my_center|LOCUS_11930 3510 2719 gene locus_tag LOCUS_11940 3510 2719 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383884.1 protein_id gnl|my_center|LOCUS_11940 5033 3507 gene locus_tag LOCUS_11950 gene sufB 5033 3507 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139918.1 protein_id gnl|my_center|LOCUS_11950 6085 5039 gene locus_tag LOCUS_11960 6085 5039 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338229.1 protein_id gnl|my_center|LOCUS_11960 7350 6082 gene locus_tag LOCUS_11970 gene coaBC 7350 6082 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338345.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence099 892 191 gene locus_tag LOCUS_11980 892 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1012 936 gene locus_tag LOCUS_t00130 1012 936 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1113 1337 gene locus_tag LOCUS_11990 1113 1337 CDS product DUF6324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561771.1 protein_id gnl|my_center|LOCUS_11990 1833 1639 gene locus_tag LOCUS_12000 1833 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2690 1944 gene locus_tag LOCUS_12010 gene ftrB 2690 1944 CDS product transcriptional activator FtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919286.1 protein_id gnl|my_center|LOCUS_12010 2931 5651 gene locus_tag LOCUS_12020 2931 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence100 2 2557 gene locus_tag LOCUS_12030 2 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 3241 3582 gene locus_tag LOCUS_12040 3241 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12040 5862 4597 gene locus_tag LOCUS_12050 5862 4597 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222093.1 protein_id gnl|my_center|LOCUS_12050 7452 5872 gene locus_tag LOCUS_12060 7452 5872 CDS product di-heme-cytochrome C peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113489.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence101 199 756 gene locus_tag LOCUS_12070 199 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2309 753 gene locus_tag LOCUS_12080 2309 753 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003668.1 protein_id gnl|my_center|LOCUS_12080 2497 4095 gene locus_tag LOCUS_12090 2497 4095 CDS product M10 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338088.1 protein_id gnl|my_center|LOCUS_12090 5291 4776 gene locus_tag LOCUS_12100 5291 4776 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142185.1 protein_id gnl|my_center|LOCUS_12100 6343 5660 gene locus_tag LOCUS_12110 gene gph 6343 5660 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338841.1 protein_id gnl|my_center|LOCUS_12110 7050 6340 gene locus_tag LOCUS_12120 7050 6340 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721822.1 protein_id gnl|my_center|LOCUS_12120 <7738 7043 gene locus_tag LOCUS_12130 <7738 7043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337745.1:ribulose-phosphate 3-epimerase >Feature sequence102 1963 917 gene locus_tag LOCUS_12140 1963 917 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_12140 2666 3034 gene locus_tag LOCUS_12150 2666 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12150 3037 3384 gene locus_tag LOCUS_12160 3037 3384 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337701.1 protein_id gnl|my_center|LOCUS_12160 4522 3368 gene locus_tag LOCUS_12170 gene lpxB 4522 3368 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337682.1 protein_id gnl|my_center|LOCUS_12170 4919 4569 gene locus_tag LOCUS_12180 4919 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12180 6147 5359 gene locus_tag LOCUS_12190 gene lpxA 6147 5359 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384338.1 protein_id gnl|my_center|LOCUS_12190 6631 6140 gene locus_tag LOCUS_12200 gene fabZ 6631 6140 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719864.1 protein_id gnl|my_center|LOCUS_12200 7269 6709 gene locus_tag LOCUS_12210 7269 6709 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561934.1 protein_id gnl|my_center|LOCUS_12210 7705 7343 gene locus_tag LOCUS_12220 7705 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence103 <1 1185 gene locus_tag LOCUS_12230 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337042.1:UbiH/UbiF family hydroxylase 1768 1349 gene locus_tag LOCUS_12240 1768 1349 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337040.1 protein_id gnl|my_center|LOCUS_12240 2262 1807 gene locus_tag LOCUS_12250 2262 1807 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722770.1 protein_id gnl|my_center|LOCUS_12250 2385 3407 gene locus_tag LOCUS_12260 gene ilvC 2385 3407 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563794.1 protein_id gnl|my_center|LOCUS_12260 3741 3457 gene locus_tag LOCUS_12270 3741 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 7268 3792 gene locus_tag LOCUS_12280 gene dnaE 7268 3792 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339407.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence104 315 1205 gene locus_tag LOCUS_12290 315 1205 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337244.1 protein_id gnl|my_center|LOCUS_12290 1193 2230 gene locus_tag LOCUS_12300 1193 2230 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337245.1 protein_id gnl|my_center|LOCUS_12300 2255 3601 gene locus_tag LOCUS_12310 gene ftsA 2255 3601 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719268.1 protein_id gnl|my_center|LOCUS_12310 3795 5021 gene locus_tag LOCUS_12320 3795 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12320 4910 5398 gene locus_tag LOCUS_12330 4910 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5581 6525 gene locus_tag LOCUS_12340 gene lpxC 5581 6525 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719270.1 protein_id gnl|my_center|LOCUS_12340 6673 7521 gene locus_tag LOCUS_12350 6673 7521 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337247.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence105 1640 780 gene locus_tag LOCUS_12360 1640 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2916 1624 gene locus_tag LOCUS_12370 gene soxC 2916 1624 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_12370 4639 2963 gene locus_tag LOCUS_12380 gene soxB 4639 2963 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086299.1 protein_id gnl|my_center|LOCUS_12380 5608 4745 gene locus_tag LOCUS_12390 gene soxA 5608 4745 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086298.1 protein_id gnl|my_center|LOCUS_12390 6019 5690 gene locus_tag LOCUS_12400 gene soxZ 6019 5690 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086297.1 protein_id gnl|my_center|LOCUS_12400 6519 6061 gene locus_tag LOCUS_12410 gene soxY 6519 6061 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086296.1 protein_id gnl|my_center|LOCUS_12410 7054 6566 gene locus_tag LOCUS_12420 gene soxX 7054 6566 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171929.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence106 107 853 gene locus_tag LOCUS_12430 107 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721579.1 protein_id gnl|my_center|LOCUS_12430 850 5385 gene locus_tag LOCUS_12440 gene gltB 850 5385 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721575.1 protein_id gnl|my_center|LOCUS_12440 5503 6561 gene locus_tag LOCUS_12450 5503 6561 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 protein_id gnl|my_center|LOCUS_12450 6631 7557 gene locus_tag LOCUS_12460 6631 7557 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705352.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence107 609 791 gene locus_tag LOCUS_12470 609 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2520 1999 gene locus_tag LOCUS_12480 2520 1999 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815617.1 protein_id gnl|my_center|LOCUS_12480 2706 3473 gene locus_tag LOCUS_12490 2706 3473 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815607.1 protein_id gnl|my_center|LOCUS_12490 3487 4278 gene locus_tag LOCUS_12500 gene menB 3487 4278 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229054.1 protein_id gnl|my_center|LOCUS_12500 4336 5496 gene locus_tag LOCUS_12510 4336 5496 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_12510 5536 7188 gene locus_tag LOCUS_12520 gene fadK 5536 7188 CDS product medium-chain fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001302824.1 protein_id gnl|my_center|LOCUS_12520 7185 7364 gene locus_tag LOCUS_12530 7185 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence108 1 291 gene locus_tag LOCUS_12540 1 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 346 1491 gene locus_tag LOCUS_12550 346 1491 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384470.1 protein_id gnl|my_center|LOCUS_12550 1497 2972 gene locus_tag LOCUS_12560 1497 2972 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338958.1 protein_id gnl|my_center|LOCUS_12560 3769 3032 gene locus_tag LOCUS_12570 3769 3032 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337503.1 protein_id gnl|my_center|LOCUS_12570 5078 3786 gene locus_tag LOCUS_12580 gene gltA 5078 3786 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337142.1 protein_id gnl|my_center|LOCUS_12580 6534 5134 gene locus_tag LOCUS_12590 gene gltX 6534 5134 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337143.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence109 395 42 gene locus_tag LOCUS_12600 395 42 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722651.1 protein_id gnl|my_center|LOCUS_12600 1390 395 gene locus_tag LOCUS_12610 gene secF 1390 395 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722650.1 protein_id gnl|my_center|LOCUS_12610 3066 1402 gene locus_tag LOCUS_12620 gene secD 3066 1402 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722648.1 protein_id gnl|my_center|LOCUS_12620 3411 3076 gene locus_tag LOCUS_12630 gene yajC 3411 3076 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722646.1 protein_id gnl|my_center|LOCUS_12630 3622 4434 gene locus_tag LOCUS_12640 gene mazG 3622 4434 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337840.1 protein_id gnl|my_center|LOCUS_12640 5353 4418 gene locus_tag LOCUS_12650 gene dusA 5353 4418 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337083.1 protein_id gnl|my_center|LOCUS_12650 5506 6561 gene locus_tag LOCUS_12660 5506 6561 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975769.1 protein_id gnl|my_center|LOCUS_12660 <7514 6824 gene locus_tag LOCUS_12670 <7514 6824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339149.1:ATP-binding protein >Feature sequence110 <1 921 gene locus_tag LOCUS_12680 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086197.1:fumarylacetoacetate hydrolase family protein 918 1865 gene locus_tag LOCUS_12690 918 1865 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086181.1 protein_id gnl|my_center|LOCUS_12690 1870 2514 gene locus_tag LOCUS_12700 1870 2514 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086182.1 protein_id gnl|my_center|LOCUS_12700 2862 4457 gene locus_tag LOCUS_12710 2862 4457 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723837.1 protein_id gnl|my_center|LOCUS_12710 4517 5524 gene locus_tag LOCUS_12720 4517 5524 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973574.1 protein_id gnl|my_center|LOCUS_12720 5543 6442 gene locus_tag LOCUS_12730 5543 6442 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723841.1 protein_id gnl|my_center|LOCUS_12730 6447 7283 gene locus_tag LOCUS_12740 6447 7283 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313845.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence111 1754 336 gene locus_tag LOCUS_12750 gene tldD 1754 336 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337011.1 protein_id gnl|my_center|LOCUS_12750 1923 2828 gene locus_tag LOCUS_12760 gene coxB 1923 2828 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337012.1 protein_id gnl|my_center|LOCUS_12760 2837 3772 gene locus_tag LOCUS_12770 gene cyoE 2837 3772 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722694.1 protein_id gnl|my_center|LOCUS_12770 3772 4041 gene locus_tag LOCUS_12780 3772 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4038 4610 gene locus_tag LOCUS_12790 4038 4610 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337013.1 protein_id gnl|my_center|LOCUS_12790 4636 5472 gene locus_tag LOCUS_12800 4636 5472 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722701.1 protein_id gnl|my_center|LOCUS_12800 5602 6273 gene locus_tag LOCUS_12810 5602 6273 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337014.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence112 1839 967 gene locus_tag LOCUS_12820 1839 967 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385501.1 protein_id gnl|my_center|LOCUS_12820 2021 2524 gene locus_tag LOCUS_12830 2021 2524 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338743.1 protein_id gnl|my_center|LOCUS_12830 2521 3231 gene locus_tag LOCUS_12840 2521 3231 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563182.1 protein_id gnl|my_center|LOCUS_12840 4129 3257 gene locus_tag LOCUS_12850 gene rfbA 4129 3257 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382898.1 protein_id gnl|my_center|LOCUS_12850 4974 4126 gene locus_tag LOCUS_12860 gene rfbD 4974 4126 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836182.1 protein_id gnl|my_center|LOCUS_12860 5705 4971 gene locus_tag LOCUS_12870 5705 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 6688 5651 gene locus_tag LOCUS_12880 gene rfbB 6688 5651 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385394.1 protein_id gnl|my_center|LOCUS_12880 7257 6685 gene locus_tag LOCUS_12890 gene rfbC 7257 6685 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385393.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence113 <1 1482 gene locus_tag LOCUS_12900 <1 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337091.1:OmpA family protein 2019 1522 gene locus_tag LOCUS_12910 2019 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338652.1 protein_id gnl|my_center|LOCUS_12910 2417 2016 gene locus_tag LOCUS_12920 2417 2016 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721534.1 protein_id gnl|my_center|LOCUS_12920 3550 2414 gene locus_tag LOCUS_12930 gene dapE 3550 2414 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338737.1 protein_id gnl|my_center|LOCUS_12930 4313 3555 gene locus_tag LOCUS_12940 4313 3555 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537472.1 protein_id gnl|my_center|LOCUS_12940 4471 6129 gene locus_tag LOCUS_12950 4471 6129 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140055.1 protein_id gnl|my_center|LOCUS_12950 6268 6690 gene locus_tag LOCUS_12960 6268 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 <7247 6698 gene locus_tag LOCUS_12970 <7247 6698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722424.1:DNA repair protein RecO >Feature sequence114 255 1760 gene locus_tag LOCUS_12980 255 1760 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967081.1 protein_id gnl|my_center|LOCUS_12980 5458 2330 gene locus_tag LOCUS_12990 5458 2330 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383167.1 protein_id gnl|my_center|LOCUS_12990 6839 5463 gene locus_tag LOCUS_13000 6839 5463 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538123.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence115 359 1120 gene locus_tag LOCUS_13010 359 1120 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_13010 1634 1128 gene locus_tag LOCUS_13020 1634 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1730 3112 gene locus_tag LOCUS_13030 gene rimO 1730 3112 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008101.1 protein_id gnl|my_center|LOCUS_13030 3112 4005 gene locus_tag LOCUS_13040 3112 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4002 4346 gene locus_tag LOCUS_13050 4002 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4386 6041 gene locus_tag LOCUS_13060 gene ettA 4386 6041 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720754.1 protein_id gnl|my_center|LOCUS_13060 6477 6031 gene locus_tag LOCUS_13070 6477 6031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence116 2352 271 gene locus_tag LOCUS_13080 2352 271 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530644.1 protein_id gnl|my_center|LOCUS_13080 3420 2416 gene locus_tag LOCUS_13090 3420 2416 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530643.1 protein_id gnl|my_center|LOCUS_13090 3616 4860 gene locus_tag LOCUS_13100 3616 4860 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012643405.1 protein_id gnl|my_center|LOCUS_13100 4857 5936 gene locus_tag LOCUS_13110 4857 5936 CDS product hybrid-cluster NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331302.1 protein_id gnl|my_center|LOCUS_13110 6483 6028 gene locus_tag LOCUS_13120 6483 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382853.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence117 1771 2709 gene locus_tag LOCUS_13130 1771 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2810 3709 gene locus_tag LOCUS_13140 2810 3709 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337022.1 protein_id gnl|my_center|LOCUS_13140 3727 4341 gene locus_tag LOCUS_13150 3727 4341 CDS product inner membrane-spanning protein YciB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722725.1 protein_id gnl|my_center|LOCUS_13150 4756 4589 gene locus_tag LOCUS_13160 gene rpmG 4756 4589 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011750518.1 protein_id gnl|my_center|LOCUS_13160 5314 4871 gene locus_tag LOCUS_13170 5314 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 <6954 5983 gene locus_tag LOCUS_13180 <6954 5983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337635.1:FAD-dependent monooxygenase >Feature sequence118 <1 636 gene locus_tag LOCUS_13190 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169775301.1:MBL fold metallo-hydrolase 1702 614 gene locus_tag LOCUS_13200 1702 614 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086305.1 protein_id gnl|my_center|LOCUS_13200 1998 1693 gene locus_tag LOCUS_13210 1998 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2016 2528 gene locus_tag LOCUS_13220 2016 2528 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719580.1 protein_id gnl|my_center|LOCUS_13220 4800 3418 gene locus_tag LOCUS_13230 4800 3418 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140228.1 protein_id gnl|my_center|LOCUS_13230 4967 6196 gene locus_tag LOCUS_13240 gene hemA 4967 6196 CDS product 5-aminolevulinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337894.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence119 1686 436 gene locus_tag LOCUS_13250 1686 436 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722555.1 protein_id gnl|my_center|LOCUS_13250 2825 1797 gene locus_tag LOCUS_13260 2825 1797 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722552.1 protein_id gnl|my_center|LOCUS_13260 3695 2982 gene locus_tag LOCUS_13270 3695 2982 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336958.1 protein_id gnl|my_center|LOCUS_13270 4348 3692 gene locus_tag LOCUS_13280 4348 3692 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385291.1 protein_id gnl|my_center|LOCUS_13280 5391 4345 gene locus_tag LOCUS_13290 5391 4345 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136857752.1 protein_id gnl|my_center|LOCUS_13290 5762 5388 gene locus_tag LOCUS_13300 gene crcB 5762 5388 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563665.1 protein_id gnl|my_center|LOCUS_13300 <6860 5795 gene locus_tag LOCUS_13310 <6860 5795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336957.1:replication-associated recombination protein A >Feature sequence120 2 187 gene locus_tag LOCUS_13320 2 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 230 1132 gene locus_tag LOCUS_13330 230 1132 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721655.1 protein_id gnl|my_center|LOCUS_13330 2932 1142 gene locus_tag LOCUS_13340 2932 1142 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338836.1 protein_id gnl|my_center|LOCUS_13340 3524 2940 gene locus_tag LOCUS_13350 3524 2940 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721805.1 protein_id gnl|my_center|LOCUS_13350 3669 3529 gene locus_tag LOCUS_13360 3669 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3768 4571 gene locus_tag LOCUS_13370 gene phyR 3768 4571 CDS product response regulator PhyR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338837.1 protein_id gnl|my_center|LOCUS_13370 5503 4748 gene locus_tag LOCUS_13380 5503 4748 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651233.1 protein_id gnl|my_center|LOCUS_13380 5643 6563 gene locus_tag LOCUS_13390 gene nagK 5643 6563 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000291270.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence121 2208 1549 gene locus_tag LOCUS_13400 gene rimP 2208 1549 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338756.1 protein_id gnl|my_center|LOCUS_13400 3777 2347 gene locus_tag LOCUS_13410 3777 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 5198 3966 gene locus_tag LOCUS_13420 5198 3966 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486271.1 protein_id gnl|my_center|LOCUS_13420 6331 5231 gene locus_tag LOCUS_13430 gene nspC 6331 5231 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336768.1 protein_id gnl|my_center|LOCUS_13430 6520 6780 gene locus_tag LOCUS_13440 gene grxC 6520 6780 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385447.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence122 <1 712 gene locus_tag LOCUS_13450 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336800.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase 712 987 gene locus_tag LOCUS_13460 712 987 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385406.1 protein_id gnl|my_center|LOCUS_13460 984 1406 gene locus_tag LOCUS_13470 984 1406 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336801.1 protein_id gnl|my_center|LOCUS_13470 1411 1803 gene locus_tag LOCUS_13480 1411 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 1976 3760 gene locus_tag LOCUS_13490 1976 3760 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337351.1 protein_id gnl|my_center|LOCUS_13490 5158 3764 gene locus_tag LOCUS_13500 5158 3764 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198974.1 protein_id gnl|my_center|LOCUS_13500 5365 6471 gene locus_tag LOCUS_13510 gene zapE 5365 6471 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338896.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence123 217 1572 gene locus_tag LOCUS_13520 217 1572 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338190.1 protein_id gnl|my_center|LOCUS_13520 1745 3055 gene locus_tag LOCUS_13530 1745 3055 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 protein_id gnl|my_center|LOCUS_13530 3720 3052 gene locus_tag LOCUS_13540 3720 3052 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336935.1 protein_id gnl|my_center|LOCUS_13540 5882 3762 gene locus_tag LOCUS_13550 5882 3762 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561565.1 protein_id gnl|my_center|LOCUS_13550 6264 5908 gene locus_tag LOCUS_13560 gene rpoZ 6264 5908 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722412.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence124 1514 585 gene locus_tag LOCUS_13570 gene oppC 1514 585 CDS product oligopeptide ABC transporter permease OppC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706428.1 protein_id gnl|my_center|LOCUS_13570 2436 1519 gene locus_tag LOCUS_13580 gene oppB 2436 1519 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911112.1 protein_id gnl|my_center|LOCUS_13580 4121 2520 gene locus_tag LOCUS_13590 4121 2520 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706430.1 protein_id gnl|my_center|LOCUS_13590 4081 4299 gene locus_tag LOCUS_13600 4081 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4366 5034 gene locus_tag LOCUS_13610 4366 5034 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563933.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence125 533 619 gene locus_tag LOCUS_t00140 533 619 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 696 1616 gene locus_tag LOCUS_13620 gene rocF 696 1616 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337620.1 protein_id gnl|my_center|LOCUS_13620 1845 2771 gene locus_tag LOCUS_13630 gene argF 1845 2771 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337153.1 protein_id gnl|my_center|LOCUS_13630 3262 4125 gene locus_tag LOCUS_13640 3262 4125 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765762.1 protein_id gnl|my_center|LOCUS_13640 4648 5871 gene locus_tag LOCUS_13650 4648 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13650 5900 6280 gene locus_tag LOCUS_13660 5900 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13660 >Feature sequence126 237 983 gene locus_tag LOCUS_13670 237 983 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 protein_id gnl|my_center|LOCUS_13670 1451 987 gene locus_tag LOCUS_13680 1451 987 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721599.1 protein_id gnl|my_center|LOCUS_13680 2120 1539 gene locus_tag LOCUS_13690 gene raiA 2120 1539 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721597.1 protein_id gnl|my_center|LOCUS_13690 3020 2271 gene locus_tag LOCUS_13700 gene lptB 3020 2271 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721595.1 protein_id gnl|my_center|LOCUS_13700 3493 3017 gene locus_tag LOCUS_13710 3493 3017 CDS product LptA/OstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563197.1 protein_id gnl|my_center|LOCUS_13710 4078 3515 gene locus_tag LOCUS_13720 gene lptC 4078 3515 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338753.1 protein_id gnl|my_center|LOCUS_13720 5022 4078 gene locus_tag LOCUS_13730 5022 4078 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139988.1 protein_id gnl|my_center|LOCUS_13730 5646 5032 gene locus_tag LOCUS_13740 5646 5032 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338751.1 protein_id gnl|my_center|LOCUS_13740 5948 5805 gene locus_tag LOCUS_13750 5948 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 <6747 5903 gene locus_tag LOCUS_13760 <6747 5903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391964.1:cytochrome d ubiquinol oxidase subunit II >Feature sequence127 1263 352 gene locus_tag LOCUS_13770 1263 352 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339356.1 protein_id gnl|my_center|LOCUS_13770 2083 1265 gene locus_tag LOCUS_13780 2083 1265 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339357.1 protein_id gnl|my_center|LOCUS_13780 2121 2744 gene locus_tag LOCUS_13790 2121 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 2845 4587 gene locus_tag LOCUS_13800 2845 4587 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550550.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence128 2226 1075 gene locus_tag LOCUS_13810 2226 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3284 2223 gene locus_tag LOCUS_13820 3284 2223 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338705.1 protein_id gnl|my_center|LOCUS_13820 4145 3318 gene locus_tag LOCUS_13830 4145 3318 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140018.1 protein_id gnl|my_center|LOCUS_13830 5533 4145 gene locus_tag LOCUS_13840 5533 4145 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383287.1 protein_id gnl|my_center|LOCUS_13840 5700 6722 gene locus_tag LOCUS_13850 5700 6722 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721972.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence129 386 1483 gene locus_tag LOCUS_13860 386 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 1527 2057 gene locus_tag LOCUS_13870 1527 2057 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217433129.1 protein_id gnl|my_center|LOCUS_13870 2054 2266 gene locus_tag LOCUS_13880 2054 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2263 2769 gene locus_tag LOCUS_13890 2263 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2822 3211 gene locus_tag LOCUS_13900 2822 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3423 3172 gene locus_tag LOCUS_13910 3423 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3699 4034 gene locus_tag LOCUS_13920 3699 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4021 4512 gene locus_tag LOCUS_13930 4021 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 4754 5209 gene locus_tag LOCUS_13940 4754 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 5475 5257 gene locus_tag LOCUS_13950 5475 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339486.1 protein_id gnl|my_center|LOCUS_13950 5728 5603 gene locus_tag LOCUS_13960 5728 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13960 5830 6609 gene locus_tag LOCUS_13970 5830 6609 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339594.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence130 317 132 gene locus_tag LOCUS_13980 317 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4011 409 gene locus_tag LOCUS_13990 gene mfd 4011 409 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337755.1 protein_id gnl|my_center|LOCUS_13990 4622 4050 gene locus_tag LOCUS_14000 4622 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 4773 5777 gene locus_tag LOCUS_14010 gene hemB 4773 5777 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719957.1 protein_id gnl|my_center|LOCUS_14010 6533 5877 gene locus_tag LOCUS_14020 6533 5877 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336991.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence131 523 1908 gene locus_tag LOCUS_14030 gene puuE 523 1908 CDS product allantoinase PuuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336830.1 protein_id gnl|my_center|LOCUS_14030 2061 2969 gene locus_tag LOCUS_14040 2061 2969 CDS product bifunctional allantoicase/(S)-ureidoglycine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804446.1 protein_id gnl|my_center|LOCUS_14040 3030 3701 gene locus_tag LOCUS_14050 3030 3701 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722129.1 protein_id gnl|my_center|LOCUS_14050 3792 4925 gene locus_tag LOCUS_14060 3792 4925 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722128.1 protein_id gnl|my_center|LOCUS_14060 5066 6115 gene locus_tag LOCUS_14070 5066 6115 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209066719.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence132 939 184 gene locus_tag LOCUS_14080 939 184 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338691.1 protein_id gnl|my_center|LOCUS_14080 2798 936 gene locus_tag LOCUS_14090 gene yidC 2798 936 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038142527.1 protein_id gnl|my_center|LOCUS_14090 3869 2898 gene locus_tag LOCUS_14100 3869 2898 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337406.1 protein_id gnl|my_center|LOCUS_14100 4273 3866 gene locus_tag LOCUS_14110 4273 3866 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338497.1 protein_id gnl|my_center|LOCUS_14110 4361 5701 gene locus_tag LOCUS_14120 gene gltX 4361 5701 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338496.1 protein_id gnl|my_center|LOCUS_14120 <6516 5917 gene locus_tag LOCUS_14130 <6516 5917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338563.1:FAD-dependent oxidoreductase >Feature sequence133 <1 690 gene locus_tag LOCUS_14140 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338236.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase 1939 767 gene locus_tag LOCUS_14150 1939 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2010 2873 gene locus_tag LOCUS_14160 2010 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14160 3068 3766 gene locus_tag LOCUS_14170 3068 3766 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391444.1 protein_id gnl|my_center|LOCUS_14170 5774 4563 gene locus_tag LOCUS_14180 5774 4563 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566727.1 protein_id gnl|my_center|LOCUS_14180 6259 5771 gene locus_tag LOCUS_14190 6259 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence134 <1 1194 gene locus_tag LOCUS_14200 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013382965.1:succinate dehydrogenase flavoprotein subunit 1194 1574 gene locus_tag LOCUS_14210 1194 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1574 1894 gene locus_tag LOCUS_14220 1574 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721275.1 protein_id gnl|my_center|LOCUS_14220 2000 2779 gene locus_tag LOCUS_14230 2000 2779 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721286.1 protein_id gnl|my_center|LOCUS_14230 2943 3107 gene locus_tag LOCUS_14240 2943 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3262 4104 gene locus_tag LOCUS_14250 3262 4104 CDS product DUF1989 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965444.1 protein_id gnl|my_center|LOCUS_14250 4442 4089 gene locus_tag LOCUS_14260 4442 4089 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841832.1 protein_id gnl|my_center|LOCUS_14260 4618 5055 gene locus_tag LOCUS_14270 4618 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 5045 5800 gene locus_tag LOCUS_14280 5045 5800 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382937.1 protein_id gnl|my_center|LOCUS_14280 5849 6091 gene locus_tag LOCUS_14290 5849 6091 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165443178.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence135 265 182 gene locus_tag LOCUS_t00150 265 182 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 374 1192 gene locus_tag LOCUS_14300 gene rlmB 374 1192 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337339.1 protein_id gnl|my_center|LOCUS_14300 1299 1739 gene locus_tag LOCUS_14310 1299 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1920 2348 gene locus_tag LOCUS_14320 1920 2348 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337340.1 protein_id gnl|my_center|LOCUS_14320 2604 4184 gene locus_tag LOCUS_14330 2604 4184 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337403.1 protein_id gnl|my_center|LOCUS_14330 4455 5447 gene locus_tag LOCUS_14340 4455 5447 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719492.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence136 205 1131 gene locus_tag LOCUS_14350 gene metA 205 1131 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337925.1 protein_id gnl|my_center|LOCUS_14350 1207 1950 gene locus_tag LOCUS_14360 1207 1950 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971606.1 protein_id gnl|my_center|LOCUS_14360 1990 2904 gene locus_tag LOCUS_14370 1990 2904 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063174092.1 protein_id gnl|my_center|LOCUS_14370 3562 2909 gene locus_tag LOCUS_14380 3562 2909 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970791.1 protein_id gnl|my_center|LOCUS_14380 3767 3606 gene locus_tag LOCUS_14390 3767 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3703 4755 gene locus_tag LOCUS_14400 3703 4755 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719295.1 protein_id gnl|my_center|LOCUS_14400 5218 6303 gene locus_tag LOCUS_14410 5218 6303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090540.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence137 186 647 gene locus_tag LOCUS_14420 186 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1078 686 gene locus_tag LOCUS_14430 gene msrB 1078 686 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537695.1 protein_id gnl|my_center|LOCUS_14430 1182 1937 gene locus_tag LOCUS_14440 1182 1937 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337612.1 protein_id gnl|my_center|LOCUS_14440 2004 3131 gene locus_tag LOCUS_14450 gene tgt 2004 3131 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337793.1 protein_id gnl|my_center|LOCUS_14450 3775 3128 gene locus_tag LOCUS_14460 3775 3128 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529571.1 protein_id gnl|my_center|LOCUS_14460 4278 3772 gene locus_tag LOCUS_14470 gene rnhA 4278 3772 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003711.1 protein_id gnl|my_center|LOCUS_14470 5381 4422 gene locus_tag LOCUS_14480 gene ispH 5381 4422 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722409.1 protein_id gnl|my_center|LOCUS_14480 6006 5440 gene locus_tag LOCUS_14490 6006 5440 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722410.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence138 966 118 gene locus_tag LOCUS_14500 966 118 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719693.1 protein_id gnl|my_center|LOCUS_14500 1819 959 gene locus_tag LOCUS_14510 gene tatC 1819 959 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719692.1 protein_id gnl|my_center|LOCUS_14510 2308 1823 gene locus_tag LOCUS_14520 gene tatB 2308 1823 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719691.1 protein_id gnl|my_center|LOCUS_14520 2675 2337 gene locus_tag LOCUS_14530 2675 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2824 3399 gene locus_tag LOCUS_14540 2824 3399 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337828.1 protein_id gnl|my_center|LOCUS_14540 4106 3432 gene locus_tag LOCUS_14550 4106 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 <6318 4085 gene locus_tag LOCUS_14560 <6318 4085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338775.1:YjbH domain-containing protein >Feature sequence139 2747 1110 gene locus_tag LOCUS_14570 2747 1110 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337820.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence140 1445 657 gene locus_tag LOCUS_14580 1445 657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339104.1 protein_id gnl|my_center|LOCUS_14580 2683 1454 gene locus_tag LOCUS_14590 gene fabB 2683 1454 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339105.1 protein_id gnl|my_center|LOCUS_14590 3210 2701 gene locus_tag LOCUS_14600 gene fabA 3210 2701 CDS product bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538101.1 protein_id gnl|my_center|LOCUS_14600 4338 3352 gene locus_tag LOCUS_14610 4338 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383548.1 protein_id gnl|my_center|LOCUS_14610 5003 4335 gene locus_tag LOCUS_14620 5003 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 5317 5721 gene locus_tag LOCUS_14630 gene infC 5317 5721 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003529.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence141 131 376 gene locus_tag LOCUS_14640 131 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1640 468 gene locus_tag LOCUS_14650 1640 468 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097850.1 protein_id gnl|my_center|LOCUS_14650 1784 2446 gene locus_tag LOCUS_14660 1784 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 2341 2826 gene locus_tag LOCUS_14670 2341 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14670 2823 3731 gene locus_tag LOCUS_14680 2823 3731 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533693.1 protein_id gnl|my_center|LOCUS_14680 4849 3659 gene locus_tag LOCUS_14690 4849 3659 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061601.1 protein_id gnl|my_center|LOCUS_14690 6066 4864 gene locus_tag LOCUS_14700 gene pcaF 6066 4864 CDS product 3-oxoadipyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402686.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence142 1080 235 gene locus_tag LOCUS_14710 1080 235 CDS product (3S)-malyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338634.1 protein_id gnl|my_center|LOCUS_14710 1293 1835 gene locus_tag LOCUS_14720 1293 1835 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313899.1 protein_id gnl|my_center|LOCUS_14720 2042 3004 gene locus_tag LOCUS_14730 gene mdh 2042 3004 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721256.1 protein_id gnl|my_center|LOCUS_14730 3266 4459 gene locus_tag LOCUS_14740 gene sucC 3266 4459 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_14740 4459 5007 gene locus_tag LOCUS_14750 4459 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 5047 5931 gene locus_tag LOCUS_14760 gene sucD 5047 5931 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721254.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence143 1436 2656 gene locus_tag LOCUS_14770 1436 2656 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973356.1 protein_id gnl|my_center|LOCUS_14770 3217 3549 gene locus_tag LOCUS_14780 3217 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3610 3825 gene locus_tag LOCUS_14790 3610 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3933 4229 gene locus_tag LOCUS_14800 3933 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence144 2 340 gene locus_tag LOCUS_14810 2 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 439 942 gene locus_tag LOCUS_14820 439 942 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721677.1 protein_id gnl|my_center|LOCUS_14820 1078 1359 gene locus_tag LOCUS_14830 1078 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 1823 1311 gene locus_tag LOCUS_14840 1823 1311 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721675.1 protein_id gnl|my_center|LOCUS_14840 2410 1955 gene locus_tag LOCUS_14850 2410 1955 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720606.1 protein_id gnl|my_center|LOCUS_14850 2604 3263 gene locus_tag LOCUS_14860 2604 3263 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720607.1 protein_id gnl|my_center|LOCUS_14860 3260 3892 gene locus_tag LOCUS_14870 3260 3892 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338230.1 protein_id gnl|my_center|LOCUS_14870 3931 4284 gene locus_tag LOCUS_14880 3931 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 4539 5753 gene locus_tag LOCUS_14890 4539 5753 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336833.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence145 1327 728 gene locus_tag LOCUS_14900 gene tmk 1327 728 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385182.1 protein_id gnl|my_center|LOCUS_14900 2485 1343 gene locus_tag LOCUS_14910 2485 1343 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561978.1 protein_id gnl|my_center|LOCUS_14910 2674 3039 gene locus_tag LOCUS_14920 2674 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 3607 3020 gene locus_tag LOCUS_14930 3607 3020 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396078.1 protein_id gnl|my_center|LOCUS_14930 5405 3840 gene locus_tag LOCUS_14940 5405 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 5967 5518 gene locus_tag LOCUS_14950 gene dtd 5967 5518 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337353.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence146 <1 530 gene locus_tag LOCUS_14960 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338227.1:adenosylcobinamide-phosphate synthase CbiB 652 1599 gene locus_tag LOCUS_14970 gene cobD 652 1599 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338490.1 protein_id gnl|my_center|LOCUS_14970 3043 1601 gene locus_tag LOCUS_14980 3043 1601 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338494.1 protein_id gnl|my_center|LOCUS_14980 3932 3318 gene locus_tag LOCUS_14990 gene cobO 3932 3318 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337767.1 protein_id gnl|my_center|LOCUS_14990 4267 4626 gene locus_tag LOCUS_15000 4267 4626 CDS product DUF1636 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562166.1 protein_id gnl|my_center|LOCUS_15000 4627 5682 gene locus_tag LOCUS_15010 gene cobW 4627 5682 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086046.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence147 <1 911 gene locus_tag LOCUS_15020 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338184.1:adenylosuccinate synthase 911 1126 gene locus_tag LOCUS_15030 911 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 1123 1812 gene locus_tag LOCUS_15040 1123 1812 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338181.1 protein_id gnl|my_center|LOCUS_15040 1832 2998 gene locus_tag LOCUS_15050 1832 2998 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088437.1 protein_id gnl|my_center|LOCUS_15050 3001 3387 gene locus_tag LOCUS_15060 3001 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4853 3462 gene locus_tag LOCUS_15070 gene lpdA 4853 3462 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670037.1 protein_id gnl|my_center|LOCUS_15070 5835 4966 gene locus_tag LOCUS_15080 gene napH 5835 4966 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925622.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence148 <1 1015 gene locus_tag LOCUS_15090 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336782.1:FAD-dependent monooxygenase 1105 1701 gene locus_tag LOCUS_15100 1105 1701 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336786.1 protein_id gnl|my_center|LOCUS_15100 2300 1716 gene locus_tag LOCUS_15110 2300 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722170.1 protein_id gnl|my_center|LOCUS_15110 2480 3661 gene locus_tag LOCUS_15120 2480 3661 CDS product acetyl-CoA C-acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338901.1 protein_id gnl|my_center|LOCUS_15120 5251 3806 gene locus_tag LOCUS_15130 5251 3806 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992328.1 protein_id gnl|my_center|LOCUS_15130 5534 5226 gene locus_tag LOCUS_15140 5534 5226 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_15140 <6051 5531 gene locus_tag LOCUS_15150 <6051 5531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972150.1:glycosyltransferase family 2 protein >Feature sequence149 2423 819 gene locus_tag LOCUS_15160 2423 819 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003589.1 protein_id gnl|my_center|LOCUS_15160 3828 2668 gene locus_tag LOCUS_15170 3828 2668 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337540.1 protein_id gnl|my_center|LOCUS_15170 4098 4173 gene locus_tag LOCUS_t00160 4098 4173 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4857 5909 gene locus_tag LOCUS_15180 gene nadA 4857 5909 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969039.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence150 <1 532 gene locus_tag LOCUS_15190 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719608.1:amidophosphoribosyltransferase 910 545 gene locus_tag LOCUS_15200 gene arsC 910 545 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085868.1 protein_id gnl|my_center|LOCUS_15200 1076 1792 gene locus_tag LOCUS_15210 1076 1792 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039869.1 protein_id gnl|my_center|LOCUS_15210 1789 2355 gene locus_tag LOCUS_15220 1789 2355 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992389.1 protein_id gnl|my_center|LOCUS_15220 2802 2365 gene locus_tag LOCUS_15230 2802 2365 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530317.1 protein_id gnl|my_center|LOCUS_15230 2928 3830 gene locus_tag LOCUS_15240 2928 3830 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338581.1 protein_id gnl|my_center|LOCUS_15240 3864 4733 gene locus_tag LOCUS_15250 3864 4733 CDS product manganese/iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338582.1 protein_id gnl|my_center|LOCUS_15250 4730 5596 gene locus_tag LOCUS_15260 4730 5596 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385380.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence151 404 2425 gene locus_tag LOCUS_15270 gene nuoG 404 2425 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140171.1 protein_id gnl|my_center|LOCUS_15270 2430 3227 gene locus_tag LOCUS_15280 2430 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3220 4284 gene locus_tag LOCUS_15290 gene nuoH 3220 4284 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564432.1 protein_id gnl|my_center|LOCUS_15290 4289 4465 gene locus_tag LOCUS_15300 4289 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4467 4958 gene locus_tag LOCUS_15310 gene nuoI 4467 4958 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719675.1 protein_id gnl|my_center|LOCUS_15310 4955 5362 gene locus_tag LOCUS_15320 4955 5362 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719676.1 protein_id gnl|my_center|LOCUS_15320 5359 5961 gene locus_tag LOCUS_15330 5359 5961 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385018.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence152 1216 428 gene locus_tag LOCUS_15340 1216 428 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337734.1 protein_id gnl|my_center|LOCUS_15340 2340 1216 gene locus_tag LOCUS_15350 2340 1216 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337733.1 protein_id gnl|my_center|LOCUS_15350 2714 2397 gene locus_tag LOCUS_15360 2714 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15360 3652 2711 gene locus_tag LOCUS_15370 3652 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15370 3916 4137 gene locus_tag LOCUS_15380 3916 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 4137 5318 gene locus_tag LOCUS_15390 4137 5318 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337632.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence153 <1 994 gene locus_tag LOCUS_15400 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337237.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 1024 2106 gene locus_tag LOCUS_15410 gene mraY 1024 2106 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719256.1 protein_id gnl|my_center|LOCUS_15410 2116 2349 gene locus_tag LOCUS_15420 2116 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2413 3816 gene locus_tag LOCUS_15430 gene murD 2413 3816 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337238.1 protein_id gnl|my_center|LOCUS_15430 3938 4423 gene locus_tag LOCUS_15440 3938 4423 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337239.1 protein_id gnl|my_center|LOCUS_15440 4532 5698 gene locus_tag LOCUS_15450 gene ftsW 4532 5698 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719261.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence154 746 72 gene locus_tag LOCUS_15460 746 72 CDS product manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338754.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 1672 872 gene locus_tag LOCUS_15470 gene cysQ 1672 872 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338755.1 protein_id gnl|my_center|LOCUS_15470 1823 2644 gene locus_tag LOCUS_15480 1823 2644 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385425.1 protein_id gnl|my_center|LOCUS_15480 3275 2622 gene locus_tag LOCUS_15490 3275 2622 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639854.1 protein_id gnl|my_center|LOCUS_15490 3447 5369 gene locus_tag LOCUS_15500 gene dnaK 3447 5369 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721635.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence155 1762 359 gene locus_tag LOCUS_15510 1762 359 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720964.1 protein_id gnl|my_center|LOCUS_15510 1923 3287 gene locus_tag LOCUS_15520 1923 3287 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338481.1 protein_id gnl|my_center|LOCUS_15520 4073 3324 gene locus_tag LOCUS_15530 4073 3324 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096568.1 protein_id gnl|my_center|LOCUS_15530 4446 4117 gene locus_tag LOCUS_15540 gene emrE 4446 4117 CDS product SMR family multidrug efflux protein EmrE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070449.1 protein_id gnl|my_center|LOCUS_15540 5789 4443 gene locus_tag LOCUS_15550 gene miaB 5789 4443 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339445.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence156 48 260 gene locus_tag LOCUS_15560 48 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1184 288 gene locus_tag LOCUS_15570 1184 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 2836 1181 gene locus_tag LOCUS_15580 2836 1181 CDS product alpha/beta-hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976330.1 protein_id gnl|my_center|LOCUS_15580 3595 3233 gene locus_tag LOCUS_15590 3595 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15590 3755 3940 gene locus_tag LOCUS_15600 3755 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4899 5156 gene locus_tag LOCUS_15610 4899 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15610 5153 5374 gene locus_tag LOCUS_15620 5153 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 >Feature sequence157 2606 621 gene locus_tag LOCUS_15630 2606 621 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339001.1 protein_id gnl|my_center|LOCUS_15630 2832 3164 gene locus_tag LOCUS_15640 2832 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 3122 3325 gene locus_tag LOCUS_15650 3122 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 3348 4601 gene locus_tag LOCUS_15660 3348 4601 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528741.1 protein_id gnl|my_center|LOCUS_15660 4603 5442 gene locus_tag LOCUS_15670 4603 5442 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089072.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15670 5470 5619 gene locus_tag LOCUS_15680 5470 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15680 >Feature sequence158 246 52 gene locus_tag LOCUS_15690 246 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 608 1126 gene locus_tag LOCUS_15700 608 1126 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013524992.1 protein_id gnl|my_center|LOCUS_15700 1203 1415 gene locus_tag LOCUS_15710 1203 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2196 1423 gene locus_tag LOCUS_15720 2196 1423 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721008.1 protein_id gnl|my_center|LOCUS_15720 2274 2660 gene locus_tag LOCUS_15730 2274 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3981 2698 gene locus_tag LOCUS_15740 3981 2698 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975013.1 protein_id gnl|my_center|LOCUS_15740 4114 4866 gene locus_tag LOCUS_15750 4114 4866 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338520.1 protein_id gnl|my_center|LOCUS_15750 5447 4896 gene locus_tag LOCUS_15760 5447 4896 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_15760 5656 5447 gene locus_tag LOCUS_15770 5656 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence159 <1 585 gene locus_tag LOCUS_15780 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389053.1:amino acid ABC transporter ATP-binding protein 2333 624 gene locus_tag LOCUS_15790 2333 624 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530360.1 protein_id gnl|my_center|LOCUS_15790 3086 2460 gene locus_tag LOCUS_15800 3086 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615968.1 protein_id gnl|my_center|LOCUS_15800 3237 4097 gene locus_tag LOCUS_15810 3237 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 4133 4609 gene locus_tag LOCUS_15820 gene aroQ 4133 4609 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007537427.1 protein_id gnl|my_center|LOCUS_15820 5399 4611 gene locus_tag LOCUS_15830 5399 4611 CDS product IclR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966068.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence160 <1 741 gene locus_tag LOCUS_15840 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338210.1:GGDEF domain-containing protein 1675 719 gene locus_tag LOCUS_15850 1675 719 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383812.1 protein_id gnl|my_center|LOCUS_15850 3302 1980 gene locus_tag LOCUS_15860 3302 1980 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153438978.1 protein_id gnl|my_center|LOCUS_15860 3712 3368 gene locus_tag LOCUS_15870 3712 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3620 5458 gene locus_tag LOCUS_15880 3620 5458 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327523.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence161 330 1196 gene locus_tag LOCUS_15890 gene motA 330 1196 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721884.1 protein_id gnl|my_center|LOCUS_15890 1196 1465 gene locus_tag LOCUS_15900 1196 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1462 3540 gene locus_tag LOCUS_15910 gene flhA 1462 3540 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338875.1 protein_id gnl|my_center|LOCUS_15910 3540 4280 gene locus_tag LOCUS_15920 3540 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 4277 5368 gene locus_tag LOCUS_15930 4277 5368 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338877.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence162 2468 4066 gene locus_tag LOCUS_15940 2468 4066 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338624.1 protein_id gnl|my_center|LOCUS_15940 4113 4463 gene locus_tag LOCUS_15950 4113 4463 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383236.1 protein_id gnl|my_center|LOCUS_15950 5471 4470 gene locus_tag LOCUS_15960 gene moaA 5471 4470 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669564.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence163 <1 950 gene locus_tag LOCUS_15970 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336959.1:amino acid ABC transporter permease 962 1753 gene locus_tag LOCUS_15980 962 1753 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722560.1 protein_id gnl|my_center|LOCUS_15980 1788 2723 gene locus_tag LOCUS_15990 1788 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3645 2785 gene locus_tag LOCUS_16000 3645 2785 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336969.1 protein_id gnl|my_center|LOCUS_16000 3818 4774 gene locus_tag LOCUS_16010 3818 4774 CDS product L-malyl-CoA/beta-methylmalyl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336971.1 protein_id gnl|my_center|LOCUS_16010 5274 4879 gene locus_tag LOCUS_16020 5274 4879 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382994.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence164 251 703 gene locus_tag LOCUS_16030 251 703 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385513.1 protein_id gnl|my_center|LOCUS_16030 684 1085 gene locus_tag LOCUS_16040 684 1085 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240481.1 protein_id gnl|my_center|LOCUS_16040 1096 1722 gene locus_tag LOCUS_16050 1096 1722 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390920.1 protein_id gnl|my_center|LOCUS_16050 1719 2366 gene locus_tag LOCUS_16060 1719 2366 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385558.1 protein_id gnl|my_center|LOCUS_16060 2428 2961 gene locus_tag LOCUS_16070 2428 2961 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390134.1 protein_id gnl|my_center|LOCUS_16070 3281 3084 gene locus_tag LOCUS_16080 3281 3084 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315122.1 protein_id gnl|my_center|LOCUS_16080 4657 3359 gene locus_tag LOCUS_16090 gene hslU 4657 3359 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336810.1 protein_id gnl|my_center|LOCUS_16090 5277 4720 gene locus_tag LOCUS_16100 gene hslV 5277 4720 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722250.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence165 <1 1381 gene locus_tag LOCUS_16110 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928912.1:GMC family oxidoreductase 1382 2722 gene locus_tag LOCUS_16120 1382 2722 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142001.1 protein_id gnl|my_center|LOCUS_16120 2726 3778 gene locus_tag LOCUS_16130 2726 3778 CDS product L-dopachrome tautomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072052.1 protein_id gnl|my_center|LOCUS_16130 3893 4288 gene locus_tag LOCUS_16140 3893 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16140 4316 5410 gene locus_tag LOCUS_16150 4316 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16150 >Feature sequence166 808 488 gene locus_tag LOCUS_16160 gene hspQ 808 488 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722172.1 protein_id gnl|my_center|LOCUS_16160 1375 920 gene locus_tag LOCUS_16170 1375 920 CDS product CreA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840846.1 protein_id gnl|my_center|LOCUS_16170 2195 1449 gene locus_tag LOCUS_16180 2195 1449 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338900.1 protein_id gnl|my_center|LOCUS_16180 3860 2268 gene locus_tag LOCUS_16190 gene serA 3860 2268 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721933.1 protein_id gnl|my_center|LOCUS_16190 5107 3959 gene locus_tag LOCUS_16200 5107 3959 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338898.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence167 1785 913 gene locus_tag LOCUS_16210 1785 913 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721831.1 protein_id gnl|my_center|LOCUS_16210 2786 1791 gene locus_tag LOCUS_16220 2786 1791 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339166.1 protein_id gnl|my_center|LOCUS_16220 2913 3806 gene locus_tag LOCUS_16230 gene cbbR 2913 3806 CDS product LysR family transcriptional regulator CbbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338845.1 protein_id gnl|my_center|LOCUS_16230 4231 4719 gene locus_tag LOCUS_16240 4231 4719 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971128.1 protein_id gnl|my_center|LOCUS_16240 5463 4960 gene locus_tag LOCUS_16250 5463 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence168 193 432 gene locus_tag LOCUS_16260 193 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1679 429 gene locus_tag LOCUS_16270 1679 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1883 1809 gene locus_tag LOCUS_t00170 1883 1809 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1979 3163 gene locus_tag LOCUS_16280 1979 3163 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337766.1 protein_id gnl|my_center|LOCUS_16280 4008 3160 gene locus_tag LOCUS_16290 gene kdsA 4008 3160 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382951.1 protein_id gnl|my_center|LOCUS_16290 <5536 4005 gene locus_tag LOCUS_16300 <5536 4005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538103.1:capsule polysaccharide transporter >Feature sequence169 1094 492 gene locus_tag LOCUS_16310 1094 492 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338911.1 protein_id gnl|my_center|LOCUS_16310 2085 1192 gene locus_tag LOCUS_16320 2085 1192 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140016.1 protein_id gnl|my_center|LOCUS_16320 2918 2061 gene locus_tag LOCUS_16330 gene mepA 2918 2061 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385579.1 protein_id gnl|my_center|LOCUS_16330 4279 2915 gene locus_tag LOCUS_16340 4279 2915 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338909.1 protein_id gnl|my_center|LOCUS_16340 4900 4319 gene locus_tag LOCUS_16350 4900 4319 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140015.1 protein_id gnl|my_center|LOCUS_16350 5026 5319 gene locus_tag LOCUS_16360 5026 5319 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140014.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence170 1724 1026 gene locus_tag LOCUS_16370 1724 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 3243 1906 gene locus_tag LOCUS_16380 3243 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4237 3467 gene locus_tag LOCUS_16390 4237 3467 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975340.1 protein_id gnl|my_center|LOCUS_16390 <5452 4247 gene locus_tag LOCUS_16400 <5452 4247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808661.1:M81 family metallopeptidase >Feature sequence171 2759 825 gene locus_tag LOCUS_16410 2759 825 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338772.1 protein_id gnl|my_center|LOCUS_16410 3017 3442 gene locus_tag LOCUS_16420 3017 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3529 4950 gene locus_tag LOCUS_16430 gene ahcY 3529 4950 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528332.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence172 1220 387 gene locus_tag LOCUS_16440 1220 387 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383374.1 protein_id gnl|my_center|LOCUS_16440 1872 1327 gene locus_tag LOCUS_16450 1872 1327 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338439.1 protein_id gnl|my_center|LOCUS_16450 1894 3321 gene locus_tag LOCUS_16460 gene argH 1894 3321 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338440.1 protein_id gnl|my_center|LOCUS_16460 3318 3464 gene locus_tag LOCUS_16470 3318 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 3580 3774 gene locus_tag LOCUS_16480 3580 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3698 4021 gene locus_tag LOCUS_16490 3698 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4021 5286 gene locus_tag LOCUS_16500 gene lysA 4021 5286 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720913.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence173 1932 670 gene locus_tag LOCUS_16510 gene hflK 1932 670 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338174.1 protein_id gnl|my_center|LOCUS_16510 3348 2023 gene locus_tag LOCUS_16520 gene gor 3348 2023 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338175.1 protein_id gnl|my_center|LOCUS_16520 4121 3393 gene locus_tag LOCUS_16530 gene rpiA 4121 3393 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338176.1 protein_id gnl|my_center|LOCUS_16530 4230 5390 gene locus_tag LOCUS_16540 4230 5390 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384089.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence174 3 692 gene locus_tag LOCUS_16550 3 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 686 1948 gene locus_tag LOCUS_16560 686 1948 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720129.1 protein_id gnl|my_center|LOCUS_16560 1945 2529 gene locus_tag LOCUS_16570 1945 2529 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720128.1 protein_id gnl|my_center|LOCUS_16570 2933 3763 gene locus_tag LOCUS_16580 2933 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 3841 5235 gene locus_tag LOCUS_16590 3841 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence175 1 1017 gene locus_tag LOCUS_16600 1 1017 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331274.1 protein_id gnl|my_center|LOCUS_16600 1023 1976 gene locus_tag LOCUS_16610 gene pta 1023 1976 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331275.1 protein_id gnl|my_center|LOCUS_16610 2523 3224 gene locus_tag LOCUS_16620 2523 3224 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338511.1 protein_id gnl|my_center|LOCUS_16620 3952 3218 gene locus_tag LOCUS_16630 3952 3218 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338510.1 protein_id gnl|my_center|LOCUS_16630 4087 4491 gene locus_tag LOCUS_16640 gene mce 4087 4491 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720998.1 protein_id gnl|my_center|LOCUS_16640 4491 4757 gene locus_tag LOCUS_16650 4491 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 <5348 4741 gene locus_tag LOCUS_16660 <5348 4741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338508.1:EI24 domain-containing protein >Feature sequence176 <1 824 gene locus_tag LOCUS_16670 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein 890 1804 gene locus_tag LOCUS_16680 gene argB 890 1804 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721433.1 protein_id gnl|my_center|LOCUS_16680 1877 2395 gene locus_tag LOCUS_16690 1877 2395 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338695.1 protein_id gnl|my_center|LOCUS_16690 2565 3224 gene locus_tag LOCUS_16700 2565 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 4606 3434 gene locus_tag LOCUS_16710 4606 3434 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_16710 4613 4780 gene locus_tag LOCUS_16720 4613 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 4841 5188 gene locus_tag LOCUS_16730 4841 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence177 2096 1068 gene locus_tag LOCUS_16740 2096 1068 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086540.1 protein_id gnl|my_center|LOCUS_16740 2613 2191 gene locus_tag LOCUS_16750 2613 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 3769 2753 gene locus_tag LOCUS_16760 3769 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 <5309 4343 gene locus_tag LOCUS_16770 <5309 4343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838605.1:phosphoenolpyruvate synthase >Feature sequence178 647 192 gene locus_tag LOCUS_16780 647 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 1552 1082 gene locus_tag LOCUS_16790 gene greA 1552 1082 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722610.1 protein_id gnl|my_center|LOCUS_16790 1582 1791 gene locus_tag LOCUS_16800 1582 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1776 3428 gene locus_tag LOCUS_16810 1776 3428 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336975.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence179 866 9 gene locus_tag LOCUS_16820 gene metF 866 9 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719324.1 protein_id gnl|my_center|LOCUS_16820 957 1853 gene locus_tag LOCUS_16830 957 1853 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719323.1 protein_id gnl|my_center|LOCUS_16830 1914 2702 gene locus_tag LOCUS_16840 1914 2702 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719321.1 protein_id gnl|my_center|LOCUS_16840 2838 3833 gene locus_tag LOCUS_16850 2838 3833 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721079.1 protein_id gnl|my_center|LOCUS_16850 <5262 3775 gene locus_tag LOCUS_16860 <5262 3775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338564.1:transglycosylase SLT domain-containing protein >Feature sequence180 <1 882 gene locus_tag LOCUS_16870 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140178.1:ABC transporter substrate-binding protein 890 1846 gene locus_tag LOCUS_16880 890 1846 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975090.1 protein_id gnl|my_center|LOCUS_16880 1868 2440 gene locus_tag LOCUS_16890 1868 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 2437 3171 gene locus_tag LOCUS_16900 2437 3171 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337586.1 protein_id gnl|my_center|LOCUS_16900 3168 3965 gene locus_tag LOCUS_16910 3168 3965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337587.1 protein_id gnl|my_center|LOCUS_16910 3969 4565 gene locus_tag LOCUS_16920 3969 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719737.1 protein_id gnl|my_center|LOCUS_16920 4651 5217 gene locus_tag LOCUS_16930 4651 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence181 1191 2111 gene locus_tag LOCUS_16940 1191 2111 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338543.1 protein_id gnl|my_center|LOCUS_16940 3468 2212 gene locus_tag LOCUS_16950 3468 2212 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563407.1 protein_id gnl|my_center|LOCUS_16950 4926 3676 gene locus_tag LOCUS_16960 4926 3676 CDS product TIGR03862 family flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385531.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence182 445 843 gene locus_tag LOCUS_16970 445 843 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721618.1 protein_id gnl|my_center|LOCUS_16970 967 1095 gene locus_tag LOCUS_16980 967 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1627 1493 gene locus_tag LOCUS_16990 1627 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 4476 1936 gene locus_tag LOCUS_17000 gene infB 4476 1936 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338758.1 protein_id gnl|my_center|LOCUS_17000 5101 4466 gene locus_tag LOCUS_17010 5101 4466 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721612.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence183 284 679 gene locus_tag LOCUS_17020 284 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17020 4755 913 gene locus_tag LOCUS_17030 4755 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence184 1176 172 gene locus_tag LOCUS_17040 gene choV 1176 172 CDS product choline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337289.1 protein_id gnl|my_center|LOCUS_17040 2051 1173 gene locus_tag LOCUS_17050 gene choW 2051 1173 CDS product choline ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337290.1 protein_id gnl|my_center|LOCUS_17050 2992 2051 gene locus_tag LOCUS_17060 2992 2051 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066528.1 protein_id gnl|my_center|LOCUS_17060 3080 3649 gene locus_tag LOCUS_17070 gene betI 3080 3649 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337292.1 protein_id gnl|my_center|LOCUS_17070 3649 5085 gene locus_tag LOCUS_17080 gene betB 3649 5085 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337293.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence185 899 177 gene locus_tag LOCUS_17090 899 177 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338103.1 protein_id gnl|my_center|LOCUS_17090 2641 899 gene locus_tag LOCUS_17100 2641 899 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338102.1 protein_id gnl|my_center|LOCUS_17100 3005 4174 gene locus_tag LOCUS_17110 3005 4174 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338101.1 protein_id gnl|my_center|LOCUS_17110 <5127 4261 gene locus_tag LOCUS_17120 <5127 4261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719363.1:TIGR02186 family protein >Feature sequence186 774 2027 gene locus_tag LOCUS_17130 774 2027 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061635.1 protein_id gnl|my_center|LOCUS_17130 2116 3300 gene locus_tag LOCUS_17140 2116 3300 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384129.1 protein_id gnl|my_center|LOCUS_17140 3440 4168 gene locus_tag LOCUS_17150 3440 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 4986 4348 gene locus_tag LOCUS_17160 4986 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 4891 5082 gene locus_tag LOCUS_17170 4891 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence187 2213 558 gene locus_tag LOCUS_17180 2213 558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974601.1 protein_id gnl|my_center|LOCUS_17180 3075 2218 gene locus_tag LOCUS_17190 3075 2218 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182307726.1 protein_id gnl|my_center|LOCUS_17190 4036 3080 gene locus_tag LOCUS_17200 4036 3080 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974599.1 protein_id gnl|my_center|LOCUS_17200 4186 4881 gene locus_tag LOCUS_17210 4186 4881 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337856.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence188 <1 2003 gene locus_tag LOCUS_17220 <1 2003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337044.1:glycosyltransferase 4965 2110 gene locus_tag LOCUS_17230 4965 2110 CDS product [glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140182.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence189 29 1354 gene locus_tag LOCUS_17240 29 1354 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003627.1 protein_id gnl|my_center|LOCUS_17240 1378 2349 gene locus_tag LOCUS_17250 gene pdxA 1378 2349 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337833.1 protein_id gnl|my_center|LOCUS_17250 2525 3370 gene locus_tag LOCUS_17260 gene rsmA 2525 3370 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384457.1 protein_id gnl|my_center|LOCUS_17260 4372 3374 gene locus_tag LOCUS_17270 4372 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 <5074 4456 gene locus_tag LOCUS_17280 <5074 4456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337836.1:peptide chain release factor N(5)-glutamine methyltransferase >Feature sequence190 1676 1906 gene locus_tag LOCUS_17290 1676 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1903 2028 gene locus_tag LOCUS_17300 1903 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3595 3059 gene locus_tag LOCUS_17310 3595 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3936 3736 gene locus_tag LOCUS_17320 3936 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 4451 3933 gene locus_tag LOCUS_17330 4451 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence191 2052 673 gene locus_tag LOCUS_17340 2052 673 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921358.1 protein_id gnl|my_center|LOCUS_17340 2402 3613 gene locus_tag LOCUS_17350 2402 3613 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196429.1 protein_id gnl|my_center|LOCUS_17350 3635 4534 gene locus_tag LOCUS_17360 3635 4534 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931547.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence192 2549 213 gene locus_tag LOCUS_17370 gene xdhB 2549 213 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975647.1 protein_id gnl|my_center|LOCUS_17370 4002 2551 gene locus_tag LOCUS_17380 gene xdhA 4002 2551 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975646.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence193 1390 4461 gene locus_tag LOCUS_17390 1390 4461 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384955.1 protein_id gnl|my_center|LOCUS_17390 4872 4948 gene locus_tag LOCUS_t00180 4872 4948 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence194 1176 583 gene locus_tag LOCUS_17400 1176 583 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809123.1 protein_id gnl|my_center|LOCUS_17400 1267 2286 gene locus_tag LOCUS_17410 1267 2286 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719464.1 protein_id gnl|my_center|LOCUS_17410 2691 2290 gene locus_tag LOCUS_17420 2691 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3965 2703 gene locus_tag LOCUS_17430 gene purD 3965 2703 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337026.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence195 <1 1102 gene locus_tag LOCUS_17440 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004534776.1:acyl-CoA synthetase 1099 1746 gene locus_tag LOCUS_17450 1099 1746 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337754.1 protein_id gnl|my_center|LOCUS_17450 1810 2475 gene locus_tag LOCUS_17460 1810 2475 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384509.1 protein_id gnl|my_center|LOCUS_17460 4396 2483 gene locus_tag LOCUS_17470 4396 2483 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719583.1 protein_id gnl|my_center|LOCUS_17470 4919 4434 gene locus_tag LOCUS_17480 4919 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence196 <1 1598 gene locus_tag LOCUS_17490 <1 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337294.1:choline dehydrogenase 1655 2332 gene locus_tag LOCUS_17500 1655 2332 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140124.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence197 1850 504 gene locus_tag LOCUS_17510 1850 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17510 3130 1850 gene locus_tag LOCUS_17520 3130 1850 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969142.1 protein_id gnl|my_center|LOCUS_17520 3485 3159 gene locus_tag LOCUS_17530 3485 3159 CDS product DUF1491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722422.1 protein_id gnl|my_center|LOCUS_17530 4414 3485 gene locus_tag LOCUS_17540 gene era 4414 3485 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383414.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence198 <1 1234 gene locus_tag LOCUS_17550 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338603.1:peptidoglycan DD-metalloendopeptidase family protein 1231 2712 gene locus_tag LOCUS_17560 1231 2712 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565257.1 protein_id gnl|my_center|LOCUS_17560 2709 3227 gene locus_tag LOCUS_17570 2709 3227 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338602.1 protein_id gnl|my_center|LOCUS_17570 3810 4541 gene locus_tag LOCUS_17580 3810 4541 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338738.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence199 2053 1388 gene locus_tag LOCUS_17590 2053 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17590 3668 2541 gene locus_tag LOCUS_17600 3668 2541 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337041.1 protein_id gnl|my_center|LOCUS_17600 3806 4504 gene locus_tag LOCUS_17610 3806 4504 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338189.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence200 <1 1030 gene locus_tag LOCUS_17620 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384150.1:PQQ-like beta-propeller repeat protein 1030 2517 gene locus_tag LOCUS_17630 gene der 1030 2517 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719849.1 protein_id gnl|my_center|LOCUS_17630 3253 2522 gene locus_tag LOCUS_17640 3253 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 4629 3337 gene locus_tag LOCUS_17650 gene serS 4629 3337 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563716.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence201 950 126 gene locus_tag LOCUS_17660 950 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17660 1911 955 gene locus_tag LOCUS_17670 gene accD 1911 955 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721171.1 protein_id gnl|my_center|LOCUS_17670 1984 3429 gene locus_tag LOCUS_17680 gene cls 1984 3429 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537429.1 protein_id gnl|my_center|LOCUS_17680 3505 3849 gene locus_tag LOCUS_17690 3505 3849 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_17690 3980 4480 gene locus_tag LOCUS_17700 3980 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence202 206 1528 gene locus_tag LOCUS_17710 206 1528 CDS product NCS1 family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272625.1 protein_id gnl|my_center|LOCUS_17710 2499 1645 gene locus_tag LOCUS_17720 gene pdxY 2499 1645 CDS product pyridoxal kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388900.1 protein_id gnl|my_center|LOCUS_17720 4200 3196 gene locus_tag LOCUS_17730 4200 3196 CDS product transcriptional regulator GcvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166353.1 protein_id gnl|my_center|LOCUS_17730 <4786 4205 gene locus_tag LOCUS_17740 <4786 4205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931611.1:amidase >Feature sequence203 2213 1065 gene locus_tag LOCUS_17750 gene lptF 2213 1065 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337830.1 protein_id gnl|my_center|LOCUS_17750 2372 3985 gene locus_tag LOCUS_17760 2372 3985 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720054.1 protein_id gnl|my_center|LOCUS_17760 4005 4457 gene locus_tag LOCUS_17770 4005 4457 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191993882.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence204 779 552 gene locus_tag LOCUS_17780 779 552 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015535.1 protein_id gnl|my_center|LOCUS_17780 893 1810 gene locus_tag LOCUS_17790 893 1810 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_17790 2311 1844 gene locus_tag LOCUS_17800 2311 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 3809 2454 gene locus_tag LOCUS_17810 3809 2454 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_17810 >Feature sequence205 1788 547 gene locus_tag LOCUS_17820 1788 547 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651618.1 protein_id gnl|my_center|LOCUS_17820 2687 1782 gene locus_tag LOCUS_17830 2687 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3101 2703 gene locus_tag LOCUS_17840 3101 2703 CDS product cupredoxin family copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070939175.1 protein_id gnl|my_center|LOCUS_17840 3735 3169 gene locus_tag LOCUS_17850 3735 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 4384 3785 gene locus_tag LOCUS_17860 4384 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence206 963 49 gene locus_tag LOCUS_17870 gene cbbX 963 49 CDS product CbbX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140002.1 protein_id gnl|my_center|LOCUS_17870 1465 1076 gene locus_tag LOCUS_17880 1465 1076 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721826.1 protein_id gnl|my_center|LOCUS_17880 2944 1481 gene locus_tag LOCUS_17890 2944 1481 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721829.1 protein_id gnl|my_center|LOCUS_17890 4038 2959 gene locus_tag LOCUS_17900 gene fba 4038 2959 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338843.1 protein_id gnl|my_center|LOCUS_17900 <4755 4042 gene locus_tag LOCUS_17910 <4755 4042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339167.1:transketolase >Feature sequence207 535 1506 gene locus_tag LOCUS_17920 535 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 2185 1544 gene locus_tag LOCUS_17930 2185 1544 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721974.1 protein_id gnl|my_center|LOCUS_17930 2330 2716 gene locus_tag LOCUS_17940 2330 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 3323 2709 gene locus_tag LOCUS_17950 3323 2709 CDS product glycosyltransferase family 29 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338918.1 protein_id gnl|my_center|LOCUS_17950 4333 3320 gene locus_tag LOCUS_17960 4333 3320 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338917.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence208 203 388 gene locus_tag LOCUS_17970 203 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 388 1671 gene locus_tag LOCUS_17980 gene murA 388 1671 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720800.1 protein_id gnl|my_center|LOCUS_17980 1664 2107 gene locus_tag LOCUS_17990 1664 2107 CDS product DUF2948 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338374.1 protein_id gnl|my_center|LOCUS_17990 2184 3482 gene locus_tag LOCUS_18000 gene hisD 2184 3482 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338373.1 protein_id gnl|my_center|LOCUS_18000 3532 4011 gene locus_tag LOCUS_18010 3532 4011 CDS product UPF0262 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338372.1 protein_id gnl|my_center|LOCUS_18010 4014 4493 gene locus_tag LOCUS_18020 4014 4493 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338371.1 protein_id gnl|my_center|LOCUS_18020 >Feature sequence209 <1 1328 gene locus_tag LOCUS_18030 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336803.1:PAS-domain containing protein 2845 2198 gene locus_tag LOCUS_18040 2845 2198 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338538.1 protein_id gnl|my_center|LOCUS_18040 4005 2947 gene locus_tag LOCUS_18050 4005 2947 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338535.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence210 104 430 gene locus_tag LOCUS_18060 104 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385352.1 protein_id gnl|my_center|LOCUS_18060 535 1800 gene locus_tag LOCUS_18070 535 1800 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338735.1 protein_id gnl|my_center|LOCUS_18070 1950 2291 gene locus_tag LOCUS_18080 1950 2291 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003140884.1 protein_id gnl|my_center|LOCUS_18080 2639 2391 gene locus_tag LOCUS_18090 2639 2391 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531486.1 protein_id gnl|my_center|LOCUS_18090 3617 2793 gene locus_tag LOCUS_18100 gene dapD 3617 2793 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721542.1 protein_id gnl|my_center|LOCUS_18100 3718 4545 gene locus_tag LOCUS_18110 3718 4545 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139985.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence211 <4684 1480 gene locus_tag LOCUS_18120 <4684 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336949.1:DNA-directed RNA polymerase subunit beta' >Feature sequence212 458 616 gene locus_tag LOCUS_18130 458 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18130 609 4013 gene locus_tag LOCUS_18140 gene addA 609 4013 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336808.1 protein_id gnl|my_center|LOCUS_18140 4066 4386 gene locus_tag LOCUS_18150 gene trxA 4066 4386 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722246.1 protein_id gnl|my_center|LOCUS_18150 4666 4409 gene locus_tag LOCUS_18160 4666 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence213 <1 1334 gene locus_tag LOCUS_18170 <1 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337537.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU 1336 3153 gene locus_tag LOCUS_18180 gene glmS 1336 3153 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337536.1 protein_id gnl|my_center|LOCUS_18180 3795 4409 gene locus_tag LOCUS_18190 3795 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence214 140 1066 gene locus_tag LOCUS_18200 140 1066 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721044.1 protein_id gnl|my_center|LOCUS_18200 1072 1869 gene locus_tag LOCUS_18210 1072 1869 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225130.1 protein_id gnl|my_center|LOCUS_18210 1889 2683 gene locus_tag LOCUS_18220 1889 2683 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531742.1 protein_id gnl|my_center|LOCUS_18220 3518 2739 gene locus_tag LOCUS_18230 gene fliP 3518 2739 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140004.1 protein_id gnl|my_center|LOCUS_18230 3859 3596 gene locus_tag LOCUS_18240 3859 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 4416 3856 gene locus_tag LOCUS_18250 4416 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 >Feature sequence215 468 1544 gene locus_tag LOCUS_18260 468 1544 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538137.1 protein_id gnl|my_center|LOCUS_18260 1541 2428 gene locus_tag LOCUS_18270 1541 2428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564218.1 protein_id gnl|my_center|LOCUS_18270 2453 3529 gene locus_tag LOCUS_18280 2453 3529 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008106.1 protein_id gnl|my_center|LOCUS_18280 4227 3691 gene locus_tag LOCUS_18290 4227 3691 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942408.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence216 1406 69 gene locus_tag LOCUS_18300 1406 69 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140446.1 protein_id gnl|my_center|LOCUS_18300 2069 1410 gene locus_tag LOCUS_18310 2069 1410 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 protein_id gnl|my_center|LOCUS_18310 2208 2549 gene locus_tag LOCUS_18320 2208 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2703 3083 gene locus_tag LOCUS_18330 2703 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3107 3577 gene locus_tag LOCUS_18340 3107 3577 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 protein_id gnl|my_center|LOCUS_18340 >Feature sequence217 1842 181 gene locus_tag LOCUS_18350 1842 181 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275275.1 protein_id gnl|my_center|LOCUS_18350 2461 2075 gene locus_tag LOCUS_18360 2461 2075 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252024.1 protein_id gnl|my_center|LOCUS_18360 2709 2458 gene locus_tag LOCUS_18370 2709 2458 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061623.1 protein_id gnl|my_center|LOCUS_18370 3696 4589 gene locus_tag LOCUS_18380 3696 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18380 >Feature sequence218 875 45 gene locus_tag LOCUS_18390 875 45 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337675.1 protein_id gnl|my_center|LOCUS_18390 1612 872 gene locus_tag LOCUS_18400 gene uppS 1612 872 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719857.1 protein_id gnl|my_center|LOCUS_18400 2262 1618 gene locus_tag LOCUS_18410 gene frr 2262 1618 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384346.1 protein_id gnl|my_center|LOCUS_18410 3043 2255 gene locus_tag LOCUS_18420 gene pyrH 3043 2255 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383887.1 protein_id gnl|my_center|LOCUS_18420 3065 3952 gene locus_tag LOCUS_18430 gene miaA 3065 3952 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337672.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence219 <1 1973 gene locus_tag LOCUS_18440 <1 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965644.1:glycosyltransferase family 2 protein 1977 2852 gene locus_tag LOCUS_18450 1977 2852 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877815.1 protein_id gnl|my_center|LOCUS_18450 2849 3952 gene locus_tag LOCUS_18460 gene wecB 2849 3952 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence220 91 531 gene locus_tag LOCUS_18470 91 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18470 1745 1125 gene locus_tag LOCUS_18480 1745 1125 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525110.1 protein_id gnl|my_center|LOCUS_18480 3158 1761 gene locus_tag LOCUS_18490 3158 1761 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525109.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence221 1062 304 gene locus_tag LOCUS_18500 1062 304 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338722.1 protein_id gnl|my_center|LOCUS_18500 1465 1049 gene locus_tag LOCUS_18510 gene rbfA 1465 1049 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385562.1 protein_id gnl|my_center|LOCUS_18510 1538 2344 gene locus_tag LOCUS_18520 gene dapB 1538 2344 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338720.1 protein_id gnl|my_center|LOCUS_18520 2513 3817 gene locus_tag LOCUS_18530 2513 3817 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339050.1 protein_id gnl|my_center|LOCUS_18530 4042 3851 gene locus_tag LOCUS_18540 4042 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence222 280 903 gene locus_tag LOCUS_18550 280 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 2178 1258 gene locus_tag LOCUS_18560 2178 1258 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339199.1 protein_id gnl|my_center|LOCUS_18560 3450 2371 gene locus_tag LOCUS_18570 gene ychF 3450 2371 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721019.1 protein_id gnl|my_center|LOCUS_18570 3584 4381 gene locus_tag LOCUS_18580 gene trpA 3584 4381 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338525.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence223 1849 1412 gene locus_tag LOCUS_18590 1849 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967553.1 protein_id gnl|my_center|LOCUS_18590 3165 1942 gene locus_tag LOCUS_18600 gene rlmN 3165 1942 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721983.1 protein_id gnl|my_center|LOCUS_18600 3808 3287 gene locus_tag LOCUS_18610 3808 3287 CDS product invasion associated locus B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721985.1 protein_id gnl|my_center|LOCUS_18610 >Feature sequence224 598 1089 gene locus_tag LOCUS_18620 gene rplJ 598 1089 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385333.1 protein_id gnl|my_center|LOCUS_18620 1156 1533 gene locus_tag LOCUS_18630 gene rplL 1156 1533 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722477.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence225 303 214 gene locus_tag LOCUS_t00190 303 214 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 501 2000 gene locus_tag LOCUS_18640 gene cysS 501 2000 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337688.1 protein_id gnl|my_center|LOCUS_18640 1997 3610 gene locus_tag LOCUS_18650 gene cimA 1997 3610 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003601.1 protein_id gnl|my_center|LOCUS_18650 3610 4362 gene locus_tag LOCUS_18660 3610 4362 CDS product squalene/phytoene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337691.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence226 3410 531 gene locus_tag LOCUS_18670 gene fdhF 3410 531 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338701.1 protein_id gnl|my_center|LOCUS_18670 <4460 3407 gene locus_tag LOCUS_18680 <4460 3407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338700.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence227 3676 338 gene locus_tag LOCUS_18690 gene carB 3676 338 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003709.1 protein_id gnl|my_center|LOCUS_18690 <4452 3765 gene locus_tag LOCUS_18700 <4452 3765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338889.1:flagellar hook capping FlgD N-terminal domain-containing protein >Feature sequence228 1361 951 gene locus_tag LOCUS_18710 1361 951 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214914.1 protein_id gnl|my_center|LOCUS_18710 2259 1411 gene locus_tag LOCUS_18720 2259 1411 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383682.1 protein_id gnl|my_center|LOCUS_18720 3285 2374 gene locus_tag LOCUS_18730 3285 2374 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383681.1 protein_id gnl|my_center|LOCUS_18730 <4446 3342 gene locus_tag LOCUS_18740 <4446 3342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957983.1:SLC13 family permease >Feature sequence229 606 1172 gene locus_tag LOCUS_18750 606 1172 CDS product DciA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336761.1 protein_id gnl|my_center|LOCUS_18750 1169 1852 gene locus_tag LOCUS_18760 1169 1852 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015921714.1 protein_id gnl|my_center|LOCUS_18760 1867 2988 gene locus_tag LOCUS_18770 1867 2988 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336759.1 protein_id gnl|my_center|LOCUS_18770 4162 3170 gene locus_tag LOCUS_18780 gene lpxK 4162 3170 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336758.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence230 1322 1543 gene locus_tag LOCUS_18790 1322 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2144 2608 gene locus_tag LOCUS_18800 2144 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 <4433 2722 gene locus_tag LOCUS_18810 <4433 2722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009565602.1:DegQ family serine endoprotease >Feature sequence231 1338 487 gene locus_tag LOCUS_18820 1338 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1455 2129 gene locus_tag LOCUS_18830 1455 2129 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338446.1 protein_id gnl|my_center|LOCUS_18830 2126 3118 gene locus_tag LOCUS_18840 2126 3118 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338447.1 protein_id gnl|my_center|LOCUS_18840 3118 3888 gene locus_tag LOCUS_18850 3118 3888 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338448.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence232 31 738 gene locus_tag LOCUS_18860 31 738 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337590.1 protein_id gnl|my_center|LOCUS_18860 751 1893 gene locus_tag LOCUS_18870 751 1893 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337591.1 protein_id gnl|my_center|LOCUS_18870 1883 3268 gene locus_tag LOCUS_18880 1883 3268 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337592.1 protein_id gnl|my_center|LOCUS_18880 3265 3999 gene locus_tag LOCUS_18890 3265 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337593.1 protein_id gnl|my_center|LOCUS_18890 3996 4340 gene locus_tag LOCUS_18900 3996 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969582.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence233 1325 609 gene locus_tag LOCUS_18910 gene hisA 1325 609 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337342.1 protein_id gnl|my_center|LOCUS_18910 1470 1853 gene locus_tag LOCUS_18920 1470 1853 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337343.1 protein_id gnl|my_center|LOCUS_18920 3853 2051 gene locus_tag LOCUS_18930 gene edd 3853 2051 CDS product phosphogluconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538199.1 protein_id gnl|my_center|LOCUS_18930 >Feature sequence234 199 552 gene locus_tag LOCUS_18940 199 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 1490 564 gene locus_tag LOCUS_18950 1490 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2569 1508 gene locus_tag LOCUS_18960 2569 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3630 2566 gene locus_tag LOCUS_18970 3630 2566 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115088.1 protein_id gnl|my_center|LOCUS_18970 <4393 3584 gene locus_tag LOCUS_18980 <4393 3584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003123798.1:DUF2169 domain-containing protein >Feature sequence235 62 535 gene locus_tag LOCUS_18990 gene moaC 62 535 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719152.1 protein_id gnl|my_center|LOCUS_18990 532 1713 gene locus_tag LOCUS_19000 532 1713 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337145.1 protein_id gnl|my_center|LOCUS_19000 1811 2560 gene locus_tag LOCUS_19010 gene lexA 1811 2560 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719150.1 protein_id gnl|my_center|LOCUS_19010 3037 2684 gene locus_tag LOCUS_19020 3037 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4036 3059 gene locus_tag LOCUS_19030 gene hemC 4036 3059 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139943.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence236 522 1142 gene locus_tag LOCUS_19040 522 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2009 1149 gene locus_tag LOCUS_19050 2009 1149 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338925.1 protein_id gnl|my_center|LOCUS_19050 3004 2006 gene locus_tag LOCUS_19060 3004 2006 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140036.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence237 1553 282 gene locus_tag LOCUS_19070 1553 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1900 1550 gene locus_tag LOCUS_19080 1900 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065638.1 protein_id gnl|my_center|LOCUS_19080 2243 1845 gene locus_tag LOCUS_19090 2243 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19090 3118 2240 gene locus_tag LOCUS_19100 3118 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19100 3093 3278 gene locus_tag LOCUS_19110 3093 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence238 1362 280 gene locus_tag LOCUS_19120 1362 280 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338724.1 protein_id gnl|my_center|LOCUS_19120 2306 2224 gene locus_tag LOCUS_t00200 2306 2224 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3467 2520 gene locus_tag LOCUS_19130 gene lipA 3467 2520 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719936.1 protein_id gnl|my_center|LOCUS_19130 3599 4144 gene locus_tag LOCUS_19140 3599 4144 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972294.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence239 1033 2247 gene locus_tag LOCUS_19150 1033 2247 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338855.1 protein_id gnl|my_center|LOCUS_19150 2400 2618 gene locus_tag LOCUS_19160 gene infA 2400 2618 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384801.1 protein_id gnl|my_center|LOCUS_19160 2641 3195 gene locus_tag LOCUS_19170 2641 3195 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384802.1 protein_id gnl|my_center|LOCUS_19170 3192 3818 gene locus_tag LOCUS_19180 3192 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence240 497 1321 gene locus_tag LOCUS_19190 497 1321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388398.1 protein_id gnl|my_center|LOCUS_19190 1481 2656 gene locus_tag LOCUS_19200 1481 2656 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337152.1 protein_id gnl|my_center|LOCUS_19200 4007 2700 gene locus_tag LOCUS_19210 4007 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence241 465 2078 gene locus_tag LOCUS_19220 465 2078 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339545.1 protein_id gnl|my_center|LOCUS_19220 2382 2306 gene locus_tag LOCUS_t00210 2382 2306 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3851 2448 gene locus_tag LOCUS_19230 3851 2448 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563098.1 protein_id gnl|my_center|LOCUS_19230 4051 4218 gene locus_tag LOCUS_19240 gene rpmH 4051 4218 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721419.1 protein_id gnl|my_center|LOCUS_19240 >Feature sequence242 817 359 gene locus_tag LOCUS_19250 gene nrdR 817 359 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720557.1 protein_id gnl|my_center|LOCUS_19250 1343 912 gene locus_tag LOCUS_19260 1343 912 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972106.1 protein_id gnl|my_center|LOCUS_19260 1675 1340 gene locus_tag LOCUS_19270 1675 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 3088 1679 gene locus_tag LOCUS_19280 3088 1679 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383523.1 protein_id gnl|my_center|LOCUS_19280 3188 3739 gene locus_tag LOCUS_19290 3188 3739 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036623.1 protein_id gnl|my_center|LOCUS_19290 4196 3783 gene locus_tag LOCUS_19300 4196 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence243 884 192 gene locus_tag LOCUS_19310 gene phoB 884 192 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382996.1 protein_id gnl|my_center|LOCUS_19310 1600 887 gene locus_tag LOCUS_19320 gene phoU 1600 887 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719749.1 protein_id gnl|my_center|LOCUS_19320 2429 1626 gene locus_tag LOCUS_19330 gene pstB 2429 1626 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337598.1 protein_id gnl|my_center|LOCUS_19330 3736 2447 gene locus_tag LOCUS_19340 gene pstA 3736 2447 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_19340 <4272 3746 gene locus_tag LOCUS_19350 <4272 3746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388357.1:phosphate ABC transporter permease subunit PstC >Feature sequence244 1306 2 gene locus_tag LOCUS_19360 1306 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 1815 3560 gene locus_tag LOCUS_19370 gene argS 1815 3560 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140224.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence245 38 877 gene locus_tag LOCUS_19380 38 877 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337625.1 protein_id gnl|my_center|LOCUS_19380 1055 2794 gene locus_tag LOCUS_19390 1055 2794 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669364.1 protein_id gnl|my_center|LOCUS_19390 3037 3597 gene locus_tag LOCUS_19400 gene ilvN 3037 3597 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719784.1 protein_id gnl|my_center|LOCUS_19400 <4258 3614 gene locus_tag LOCUS_19410 <4258 3614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719501.1:M48 family metallopeptidase >Feature sequence246 1 1200 gene locus_tag LOCUS_19420 1 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19420 1211 2311 gene locus_tag LOCUS_19430 1211 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19430 >Feature sequence247 <1 2814 gene locus_tag LOCUS_19440 <1 2814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041669772.1:2-oxoglutarate dehydrogenase E1 component >Feature sequence248 15 731 gene locus_tag LOCUS_19450 15 731 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561875.1 protein_id gnl|my_center|LOCUS_19450 2396 954 gene locus_tag LOCUS_19460 2396 954 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448980.1 protein_id gnl|my_center|LOCUS_19460 3140 2466 gene locus_tag LOCUS_19470 3140 2466 CDS product CbiX/SirB N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336840.1 protein_id gnl|my_center|LOCUS_19470 3744 3169 gene locus_tag LOCUS_19480 3744 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 >Feature sequence249 2761 425 gene locus_tag LOCUS_19490 gene bamA 2761 425 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337678.1 protein_id gnl|my_center|LOCUS_19490 <4209 2864 gene locus_tag LOCUS_19500 <4209 2864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_123640612.1:RIP metalloprotease RseP >Feature sequence250 <1 751 gene locus_tag LOCUS_19510 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384544.1:TIGR01620 family protein 923 1546 gene locus_tag LOCUS_19520 gene pgsA 923 1546 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721439.1 protein_id gnl|my_center|LOCUS_19520 1525 1794 gene locus_tag LOCUS_19530 gene moaD 1525 1794 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721437.1 protein_id gnl|my_center|LOCUS_19530 1794 2231 gene locus_tag LOCUS_19540 1794 2231 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721436.1 protein_id gnl|my_center|LOCUS_19540 2298 3257 gene locus_tag LOCUS_19550 2298 3257 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722606.1 protein_id gnl|my_center|LOCUS_19550 3254 3568 gene locus_tag LOCUS_19560 gene sugE 3254 3568 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118477.1 protein_id gnl|my_center|LOCUS_19560 3737 3576 gene locus_tag LOCUS_19570 3737 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 4075 3981 gene locus_tag LOCUS_t00220 4075 3981 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence251 1 189 gene locus_tag LOCUS_19580 1 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 179 613 gene locus_tag LOCUS_19590 179 613 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107683.1 protein_id gnl|my_center|LOCUS_19590 769 617 gene locus_tag LOCUS_19600 769 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1581 931 gene locus_tag LOCUS_19610 gene pyrF 1581 931 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382860.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence252 380 676 gene locus_tag LOCUS_19620 380 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 765 2027 gene locus_tag LOCUS_19630 765 2027 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337346.1 protein_id gnl|my_center|LOCUS_19630 2224 2033 gene locus_tag LOCUS_19640 2224 2033 CDS product DUF3008 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368443.1 protein_id gnl|my_center|LOCUS_19640 2691 2230 gene locus_tag LOCUS_19650 2691 2230 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563806.1 protein_id gnl|my_center|LOCUS_19650 2830 3981 gene locus_tag LOCUS_19660 gene carA 2830 3981 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722785.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence253 138 1664 gene locus_tag LOCUS_19670 138 1664 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087552.1 protein_id gnl|my_center|LOCUS_19670 1808 2842 gene locus_tag LOCUS_19680 gene adhP 1808 2842 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_19680 2884 4062 gene locus_tag LOCUS_19690 2884 4062 CDS product DNA topoisomerase IB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529828.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence254 <1 1744 gene locus_tag LOCUS_19700 <1 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385557.1:adenine deaminase 2195 1764 gene locus_tag LOCUS_19710 2195 1764 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338894.1 protein_id gnl|my_center|LOCUS_19710 3276 2197 gene locus_tag LOCUS_19720 gene recF 3276 2197 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140012.1 protein_id gnl|my_center|LOCUS_19720 <4149 3273 gene locus_tag LOCUS_19730 <4149 3273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338892.1:DNA polymerase III subunit beta >Feature sequence255 174 1283 gene locus_tag LOCUS_19740 174 1283 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197192.1 protein_id gnl|my_center|LOCUS_19740 1365 3182 gene locus_tag LOCUS_19750 1365 3182 CDS product thiamine pyrophosphate-requiring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530887.1 protein_id gnl|my_center|LOCUS_19750 <4140 3273 gene locus_tag LOCUS_19760 <4140 3273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538170.1:metallophosphoesterase >Feature sequence256 <1 922 gene locus_tag LOCUS_19770 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002723944.1:ABC transporter substrate-binding protein 927 1700 gene locus_tag LOCUS_19780 927 1700 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723942.1 protein_id gnl|my_center|LOCUS_19780 1697 2398 gene locus_tag LOCUS_19790 1697 2398 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339190.1 protein_id gnl|my_center|LOCUS_19790 2400 3287 gene locus_tag LOCUS_19800 2400 3287 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339189.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence257 <1 833 gene locus_tag LOCUS_19810 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941985.1:efflux RND transporter periplasmic adaptor subunit 830 3886 gene locus_tag LOCUS_19820 830 3886 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083188.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence258 850 194 gene locus_tag LOCUS_19830 850 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1928 852 gene locus_tag LOCUS_19840 1928 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2260 1934 gene locus_tag LOCUS_19850 2260 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3690 2257 gene locus_tag LOCUS_19860 gene scfB 3690 2257 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393900.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence259 31 1446 gene locus_tag LOCUS_19870 31 1446 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338105.1 protein_id gnl|my_center|LOCUS_19870 1474 2232 gene locus_tag LOCUS_19880 1474 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 3609 2578 gene locus_tag LOCUS_19890 3609 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence260 >Feature sequence261 745 332 gene locus_tag LOCUS_19900 745 332 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313628.1 protein_id gnl|my_center|LOCUS_19900 906 1139 gene locus_tag LOCUS_19910 gene hfq 906 1139 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719962.1 protein_id gnl|my_center|LOCUS_19910 1140 2543 gene locus_tag LOCUS_19920 gene hflX 1140 2543 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140208.1 protein_id gnl|my_center|LOCUS_19920 3732 2935 gene locus_tag LOCUS_19930 3732 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence262 625 879 gene locus_tag LOCUS_19940 625 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 906 1265 gene locus_tag LOCUS_19950 906 1265 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_19950 1262 1480 gene locus_tag LOCUS_19960 1262 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 1480 1794 gene locus_tag LOCUS_19970 1480 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 1887 2891 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcgggtgcggggaacag 3238 2948 gene locus_tag LOCUS_19980 gene cas2e 3238 2948 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942042.1 protein_id gnl|my_center|LOCUS_19980 <3905 3235 gene locus_tag LOCUS_19990 <3905 3235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942041.1:type I-E CRISPR-associated endonuclease Cas1e >Feature sequence263 997 305 gene locus_tag LOCUS_20000 997 305 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397451.1 protein_id gnl|my_center|LOCUS_20000 1189 1695 gene locus_tag LOCUS_20010 1189 1695 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383969.1 protein_id gnl|my_center|LOCUS_20010 1688 2281 gene locus_tag LOCUS_20020 1688 2281 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337525.1 protein_id gnl|my_center|LOCUS_20020 2742 2479 gene locus_tag LOCUS_20030 2742 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 3170 3430 gene locus_tag LOCUS_20040 3170 3430 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337130.1 protein_id gnl|my_center|LOCUS_20040 >Feature sequence264 975 28 gene locus_tag LOCUS_20050 975 28 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721622.1 protein_id gnl|my_center|LOCUS_20050 1173 3878 gene locus_tag LOCUS_20060 gene secA 1173 3878 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338761.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence265 2074 341 gene locus_tag LOCUS_20070 gene phaC 2074 341 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389569.1 protein_id gnl|my_center|LOCUS_20070 2824 3312 gene locus_tag LOCUS_20080 2824 3312 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971886.1 protein_id gnl|my_center|LOCUS_20080 <3830 3302 gene locus_tag LOCUS_20090 <3830 3302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525764.1:NADH:flavin oxidoreductase/NADH oxidase >Feature sequence266 <1 936 gene locus_tag LOCUS_20100 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391192.1:L-aspartate oxidase 933 1784 gene locus_tag LOCUS_20110 gene nadC 933 1784 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389186.1 protein_id gnl|my_center|LOCUS_20110 3067 2621 gene locus_tag LOCUS_20120 3067 2621 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338542.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence267 492 1706 gene locus_tag LOCUS_20130 492 1706 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336864.1 protein_id gnl|my_center|LOCUS_20130 1703 2701 gene locus_tag LOCUS_20140 1703 2701 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336865.1 protein_id gnl|my_center|LOCUS_20140 2698 3345 gene locus_tag LOCUS_20150 gene upp 2698 3345 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336866.1 protein_id gnl|my_center|LOCUS_20150 >Feature sequence268 1514 348 gene locus_tag LOCUS_20160 1514 348 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706681.1 protein_id gnl|my_center|LOCUS_20160 2070 1528 gene locus_tag LOCUS_20170 2070 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20170 2308 2565 gene locus_tag LOCUS_20180 2308 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 3114 2614 gene locus_tag LOCUS_20190 3114 2614 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337983.1 protein_id gnl|my_center|LOCUS_20190 >Feature sequence269 1510 755 gene locus_tag LOCUS_20200 1510 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 2163 1507 gene locus_tag LOCUS_20210 2163 1507 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976313.1 protein_id gnl|my_center|LOCUS_20210 2924 2160 gene locus_tag LOCUS_20220 2924 2160 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529413.1 protein_id gnl|my_center|LOCUS_20220 3123 2926 gene locus_tag LOCUS_20230 gene thiS 3123 2926 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969799.1 protein_id gnl|my_center|LOCUS_20230 <3809 3101 gene locus_tag LOCUS_20240 <3809 3101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969800.1:glycine oxidase ThiO >Feature sequence270 1988 1071 gene locus_tag LOCUS_20250 gene fdhE 1988 1071 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967003.1 protein_id gnl|my_center|LOCUS_20250 2726 2025 gene locus_tag LOCUS_20260 2726 2025 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967002.1 protein_id gnl|my_center|LOCUS_20260 3740 2727 gene locus_tag LOCUS_20270 gene fdxH 3740 2727 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967001.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence271 931 365 gene locus_tag LOCUS_20280 931 365 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337318.1 protein_id gnl|my_center|LOCUS_20280 1525 1031 gene locus_tag LOCUS_20290 1525 1031 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383650.1 protein_id gnl|my_center|LOCUS_20290 1669 2415 gene locus_tag LOCUS_20300 1669 2415 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338777.1 protein_id gnl|my_center|LOCUS_20300 3184 2372 gene locus_tag LOCUS_20310 gene truA 3184 2372 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338327.1 protein_id gnl|my_center|LOCUS_20310 <3791 3189 gene locus_tag LOCUS_20320 <3791 3189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145399393.1:5-bromo-4-chloroindolyl phosphate hydrolysis family protein >Feature sequence272 608 1060 gene locus_tag LOCUS_20330 608 1060 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566035.1 protein_id gnl|my_center|LOCUS_20330 1057 1665 gene locus_tag LOCUS_20340 1057 1665 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338252.1 protein_id gnl|my_center|LOCUS_20340 <3778 1669 gene locus_tag LOCUS_20350 <3778 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336946.1:DNA topoisomerase IV subunit A >Feature sequence273 <1 502 gene locus_tag LOCUS_20360 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385449.1:SAM-dependent methyltransferase 499 1557 gene locus_tag LOCUS_20370 gene hemH 499 1557 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161601244.1 protein_id gnl|my_center|LOCUS_20370 1651 2679 gene locus_tag LOCUS_20380 1651 2679 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721690.1 protein_id gnl|my_center|LOCUS_20380 2676 3266 gene locus_tag LOCUS_20390 2676 3266 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338789.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence274 2167 314 gene locus_tag LOCUS_20400 2167 314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338226.1 protein_id gnl|my_center|LOCUS_20400 3192 2167 gene locus_tag LOCUS_20410 gene oppF 3192 2167 CDS product murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005164170.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence275 1073 153 gene locus_tag LOCUS_20420 1073 153 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339315.1 protein_id gnl|my_center|LOCUS_20420 2214 1075 gene locus_tag LOCUS_20430 gene rodA 2214 1075 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383599.1 protein_id gnl|my_center|LOCUS_20430 3764 2220 gene locus_tag LOCUS_20440 3764 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence276 <1 1128 gene locus_tag LOCUS_20450 <1 1128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337305.1:acetyl-CoA C-acetyltransferase 1445 3631 gene locus_tag LOCUS_20460 1445 3631 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337304.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence277 <1 867 gene locus_tag LOCUS_20470 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528744.1:dihydrolipoyl dehydrogenase 1513 1779 gene locus_tag LOCUS_20480 1513 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2205 3068 gene locus_tag LOCUS_20490 2205 3068 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401773.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence278 303 1331 gene locus_tag LOCUS_20500 303 1331 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337863.1 protein_id gnl|my_center|LOCUS_20500 1609 2712 gene locus_tag LOCUS_20510 gene hisC 1609 2712 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337377.1 protein_id gnl|my_center|LOCUS_20510 2709 3620 gene locus_tag LOCUS_20520 2709 3620 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719447.1 protein_id gnl|my_center|LOCUS_20520 >Feature sequence279 164 424 gene locus_tag LOCUS_20530 164 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 421 810 gene locus_tag LOCUS_20540 421 810 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382955.1 protein_id gnl|my_center|LOCUS_20540 887 2275 gene locus_tag LOCUS_20550 gene lpdA 887 2275 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338629.1 protein_id gnl|my_center|LOCUS_20550 2404 2886 gene locus_tag LOCUS_20560 2404 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 <3673 2988 gene locus_tag LOCUS_20570 <3673 2988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869162.1:CaiB/BaiF CoA-transferase family protein >Feature sequence280 167 841 gene locus_tag LOCUS_20580 167 841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724800.1 protein_id gnl|my_center|LOCUS_20580 2211 838 gene locus_tag LOCUS_20590 2211 838 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338528.1 protein_id gnl|my_center|LOCUS_20590 2343 2753 gene locus_tag LOCUS_20600 2343 2753 CDS product ketosteroid isomerase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338370.1 protein_id gnl|my_center|LOCUS_20600 2750 3331 gene locus_tag LOCUS_20610 2750 3331 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338369.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence281 489 1400 gene locus_tag LOCUS_20620 489 1400 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385565.1 protein_id gnl|my_center|LOCUS_20620 1537 1806 gene locus_tag LOCUS_20630 gene rpsO 1537 1806 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721510.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence282 1861 536 gene locus_tag LOCUS_20640 1861 536 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114935040.1 protein_id gnl|my_center|LOCUS_20640 <3643 1866 gene locus_tag LOCUS_20650 <3643 1866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083147.1:TAT-dependent nitrous-oxide reductase >Feature sequence283 61 675 gene locus_tag LOCUS_20660 61 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331348.1 protein_id gnl|my_center|LOCUS_20660 1737 679 gene locus_tag LOCUS_20670 1737 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136887798.1 protein_id gnl|my_center|LOCUS_20670 1736 2461 gene locus_tag LOCUS_20680 1736 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2486 3421 gene locus_tag LOCUS_20690 2486 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331351.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence284 <1 590 gene locus_tag LOCUS_20700 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383981.1:DedA family protein 622 1122 gene locus_tag LOCUS_20710 622 1122 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337855.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence285 >Feature sequence286 1371 16 gene locus_tag LOCUS_20720 1371 16 CDS product allantoin permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188297.1 protein_id gnl|my_center|LOCUS_20720 2324 1443 gene locus_tag LOCUS_20730 2324 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20730 3564 2236 gene locus_tag LOCUS_20740 3564 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20740 >Feature sequence287 477 139 gene locus_tag LOCUS_20750 477 139 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986517.1 protein_id gnl|my_center|LOCUS_20750 855 499 gene locus_tag LOCUS_20760 855 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1721 1948 gene locus_tag LOCUS_20770 1721 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 1945 2220 gene locus_tag LOCUS_20780 1945 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2602 2964 gene locus_tag LOCUS_20790 2602 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence288 2438 1782 gene locus_tag LOCUS_20800 2438 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2586 2897 gene locus_tag LOCUS_20810 2586 2897 CDS product ETC complex I subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719237.1 protein_id gnl|my_center|LOCUS_20810 2902 3399 gene locus_tag LOCUS_20820 2902 3399 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337225.1 protein_id gnl|my_center|LOCUS_20820 3419 3495 gene locus_tag LOCUS_t00230 3419 3495 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence289 710 2107 gene locus_tag LOCUS_20830 gene fumC 710 2107 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337260.1 protein_id gnl|my_center|LOCUS_20830 2107 2304 gene locus_tag LOCUS_20840 2107 2304 CDS product DUF4169 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337259.1 protein_id gnl|my_center|LOCUS_20840 2416 2667 gene locus_tag LOCUS_20850 2416 2667 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537765.1 protein_id gnl|my_center|LOCUS_20850 2776 3522 gene locus_tag LOCUS_20860 2776 3522 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338392.1 protein_id gnl|my_center|LOCUS_20860 >Feature sequence290 338 685 gene locus_tag LOCUS_20870 338 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 1186 695 gene locus_tag LOCUS_20880 1186 695 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338085.1 protein_id gnl|my_center|LOCUS_20880 2268 1186 gene locus_tag LOCUS_20890 2268 1186 CDS product type III polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338084.1 protein_id gnl|my_center|LOCUS_20890 3043 2480 gene locus_tag LOCUS_20900 3043 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3236 3460 gene locus_tag LOCUS_20910 3236 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 >Feature sequence291 585 953 gene locus_tag LOCUS_20920 585 953 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339218.1 protein_id gnl|my_center|LOCUS_20920 950 1669 gene locus_tag LOCUS_20930 950 1669 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339217.1 protein_id gnl|my_center|LOCUS_20930 2062 1742 gene locus_tag LOCUS_20940 2062 1742 CDS product DUF6280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720413.1 protein_id gnl|my_center|LOCUS_20940 3456 2335 gene locus_tag LOCUS_20950 gene dinB 3456 2335 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970234.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence292 173 1459 gene locus_tag LOCUS_20960 173 1459 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720567.1 protein_id gnl|my_center|LOCUS_20960 2128 1469 gene locus_tag LOCUS_20970 gene agkR 2128 1469 CDS product GntR family transcriptional regulator AgkR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721288.1 protein_id gnl|my_center|LOCUS_20970 2854 2168 gene locus_tag LOCUS_20980 2854 2168 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338637.1 protein_id gnl|my_center|LOCUS_20980 2943 3260 gene locus_tag LOCUS_20990 2943 3260 CDS product TIGR02300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385056.1 protein_id gnl|my_center|LOCUS_20990 3433 3508 gene locus_tag LOCUS_t00240 3433 3508 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence293 1629 307 gene locus_tag LOCUS_21000 gene petB 1629 307 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722007.1 protein_id gnl|my_center|LOCUS_21000 2221 1643 gene locus_tag LOCUS_21010 gene petA 2221 1643 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722009.1 protein_id gnl|my_center|LOCUS_21010 3338 2454 gene locus_tag LOCUS_21020 3338 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence294 1077 1766 gene locus_tag LOCUS_21030 1077 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 1810 2712 gene locus_tag LOCUS_21040 1810 2712 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339638.1 protein_id gnl|my_center|LOCUS_21040 2716 3021 gene locus_tag LOCUS_21050 2716 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339639.1 protein_id gnl|my_center|LOCUS_21050 3162 3262 gene locus_tag LOCUS_t00250 3162 3262 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence295 1836 2042 gene locus_tag LOCUS_21060 1836 2042 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384317.1 protein_id gnl|my_center|LOCUS_21060 2172 2594 gene locus_tag LOCUS_21070 gene ndk 2172 2594 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720049.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence296 <1 725 gene locus_tag LOCUS_21080 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385455.1:CCA tRNA nucleotidyltransferase 725 2560 gene locus_tag LOCUS_21090 725 2560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338786.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence297 <1 2052 gene locus_tag LOCUS_21100 <1 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722755.1:PEP-utilizing enzyme 2260 2856 gene locus_tag LOCUS_21110 2260 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence298 1956 454 gene locus_tag LOCUS_21120 1956 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 <3462 1996 gene locus_tag LOCUS_21130 <3462 1996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073856744.1:GMC family oxidoreductase >Feature sequence299 <1 1593 gene locus_tag LOCUS_21140 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337035.1:glycine--tRNA ligase subunit beta 1878 3065 gene locus_tag LOCUS_21150 gene kynU 1878 3065 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338098.1 protein_id gnl|my_center|LOCUS_21150 >Feature sequence300 27 626 gene locus_tag LOCUS_21160 27 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 776 2002 gene locus_tag LOCUS_21170 776 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 2199 3203 gene locus_tag LOCUS_21180 2199 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 >Feature sequence301 <3435 1092 gene locus_tag LOCUS_21190 <3435 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140209.1:PAS domain-containing sensor histidine kinase >Feature sequence302 1105 185 gene locus_tag LOCUS_21200 gene murB 1105 185 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337243.1 protein_id gnl|my_center|LOCUS_21200 1244 2179 gene locus_tag LOCUS_21210 gene choX 1244 2179 CDS product choline ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974042.1 protein_id gnl|my_center|LOCUS_21210 >Feature sequence303 1472 450 gene locus_tag LOCUS_21220 gene fni 1472 450 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533385.1 protein_id gnl|my_center|LOCUS_21220 2806 3270 gene locus_tag LOCUS_21230 2806 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence304 834 2204 gene locus_tag LOCUS_21240 834 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2253 3383 gene locus_tag LOCUS_21250 2253 3383 CDS product HBL/NHE enterotoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706402.1 protein_id gnl|my_center|LOCUS_21250 >Feature sequence305 1184 168 gene locus_tag LOCUS_21260 1184 168 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338674.1 protein_id gnl|my_center|LOCUS_21260 1932 1234 gene locus_tag LOCUS_21270 gene nth 1932 1234 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382944.1 protein_id gnl|my_center|LOCUS_21270 2143 2802 gene locus_tag LOCUS_21280 2143 2802 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721366.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence306 1 1410 gene locus_tag LOCUS_21290 1 1410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338426.1 protein_id gnl|my_center|LOCUS_21290 1407 2633 gene locus_tag LOCUS_21300 1407 2633 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338425.1 protein_id gnl|my_center|LOCUS_21300 >Feature sequence307 1428 385 gene locus_tag LOCUS_21310 1428 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2027 3226 gene locus_tag LOCUS_21320 gene repA 2027 3226 CDS product plasmid partitioning protein RepA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969718.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence308 620 27 gene locus_tag LOCUS_21330 gene rplI 620 27 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338021.1 protein_id gnl|my_center|LOCUS_21330 859 632 gene locus_tag LOCUS_21340 gene rpsR 859 632 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720283.1 protein_id gnl|my_center|LOCUS_21340 1358 879 gene locus_tag LOCUS_21350 1358 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 1625 2266 gene locus_tag LOCUS_21360 1625 2266 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_21360 <3360 2345 gene locus_tag LOCUS_21370 <3360 2345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389542.1:cytochrome-c peroxidase >Feature sequence309 1402 458 gene locus_tag LOCUS_21380 1402 458 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338408.1 protein_id gnl|my_center|LOCUS_21380 2196 1399 gene locus_tag LOCUS_21390 2196 1399 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338407.1 protein_id gnl|my_center|LOCUS_21390 2987 2193 gene locus_tag LOCUS_21400 2987 2193 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338406.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence310 1384 128 gene locus_tag LOCUS_21410 1384 128 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084676.1 protein_id gnl|my_center|LOCUS_21410 2100 1396 gene locus_tag LOCUS_21420 2100 1396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_21420 2864 2097 gene locus_tag LOCUS_21430 2864 2097 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391052.1 protein_id gnl|my_center|LOCUS_21430 3135 2866 gene locus_tag LOCUS_21440 3135 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence311 68 901 gene locus_tag LOCUS_21450 gene trmD 68 901 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382927.1 protein_id gnl|my_center|LOCUS_21450 898 1290 gene locus_tag LOCUS_21460 gene rplS 898 1290 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721387.1 protein_id gnl|my_center|LOCUS_21460 1302 1523 gene locus_tag LOCUS_21470 gene rpmE 1302 1523 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721385.1 protein_id gnl|my_center|LOCUS_21470 2480 1596 gene locus_tag LOCUS_21480 2480 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence312 <1 736 gene locus_tag LOCUS_21490 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538018.1:SDR family oxidoreductase 826 1911 gene locus_tag LOCUS_21500 826 1911 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020477356.1 protein_id gnl|my_center|LOCUS_21500 1940 2317 gene locus_tag LOCUS_21510 1940 2317 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974941.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence313 1989 1579 gene locus_tag LOCUS_21520 1989 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 2638 2153 gene locus_tag LOCUS_21530 2638 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 <3303 2739 gene locus_tag LOCUS_21540 <3303 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063921601.1:heavy metal translocating P-type ATPase >Feature sequence314 347 1072 gene locus_tag LOCUS_21550 347 1072 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669985.1 protein_id gnl|my_center|LOCUS_21550 1166 1750 gene locus_tag LOCUS_21560 1166 1750 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384161.1 protein_id gnl|my_center|LOCUS_21560 2534 1797 gene locus_tag LOCUS_21570 2534 1797 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338726.1 protein_id gnl|my_center|LOCUS_21570 <3299 2744 gene locus_tag LOCUS_21580 <3299 2744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384162.1:aconitate hydratase AcnA >Feature sequence315 258 1049 gene locus_tag LOCUS_21590 258 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1690 1779 gene locus_tag LOCUS_t00260 1690 1779 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <3295 2034 gene locus_tag LOCUS_21600 <3295 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918711.1:class I SAM-dependent DNA methyltransferase >Feature sequence316 1292 1011 gene locus_tag LOCUS_21610 1292 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 1550 1475 gene locus_tag LOCUS_t00270 1550 1475 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2365 1928 gene locus_tag LOCUS_21620 gene trxC 2365 1928 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_21620 <3281 2625 gene locus_tag LOCUS_21630 <3281 2625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337303.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence317 1803 55 gene locus_tag LOCUS_21640 1803 55 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729441.1 protein_id gnl|my_center|LOCUS_21640 1989 2342 gene locus_tag LOCUS_21650 1989 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2251 2943 gene locus_tag LOCUS_21660 2251 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21660 >Feature sequence318 2781 979 gene locus_tag LOCUS_21670 2781 979 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719253.1 protein_id gnl|my_center|LOCUS_21670 3188 2787 gene locus_tag LOCUS_21680 3188 2787 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719252.1 protein_id gnl|my_center|LOCUS_21680 >Feature sequence319 <1 966 gene locus_tag LOCUS_21690 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970881.1:nitronate monooxygenase family protein 3196 1949 gene locus_tag LOCUS_21700 3196 1949 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339433.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence320 >Feature sequence321 624 10 gene locus_tag LOCUS_21710 624 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 900 3128 gene locus_tag LOCUS_21720 900 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 >Feature sequence322 856 1173 gene locus_tag LOCUS_21730 856 1173 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719241.1 protein_id gnl|my_center|LOCUS_21730 1234 1884 gene locus_tag LOCUS_21740 gene parA 1234 1884 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389279.1 protein_id gnl|my_center|LOCUS_21740 1987 2931 gene locus_tag LOCUS_21750 1987 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence323 1255 200 gene locus_tag LOCUS_21760 gene prfA 1255 200 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337837.1 protein_id gnl|my_center|LOCUS_21760 1407 2756 gene locus_tag LOCUS_21770 gene gdhA 1407 2756 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967123.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence324 1079 477 gene locus_tag LOCUS_21780 1079 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 >Feature sequence325 829 275 gene locus_tag LOCUS_21790 gene vpsC 829 275 CDS product exopolysaccharide biosynthesis acetyltransferase VpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098186.1 protein_id gnl|my_center|LOCUS_21790 2006 966 gene locus_tag LOCUS_21800 2006 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 2266 3123 gene locus_tag LOCUS_21810 2266 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 >Feature sequence326 1642 1286 gene locus_tag LOCUS_21820 1642 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 2449 1739 gene locus_tag LOCUS_21830 gene cobF 2449 1739 CDS product precorrin-6A synthase (deacetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337779.1 protein_id gnl|my_center|LOCUS_21830 <3125 2518 gene locus_tag LOCUS_21840 <3125 2518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002723748.1:energy-coupling factor ABC transporter permease >Feature sequence327 283 642 gene locus_tag LOCUS_21850 gene gcvH 283 642 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719352.1 protein_id gnl|my_center|LOCUS_21850 >Feature sequence328 2862 769 gene locus_tag LOCUS_21860 gene tkt 2862 769 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092005623.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence329 732 115 gene locus_tag LOCUS_21870 732 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 948 736 gene locus_tag LOCUS_21880 948 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 866 1705 gene locus_tag LOCUS_21890 866 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2679 2452 gene locus_tag LOCUS_21900 2679 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence330 400 1218 gene locus_tag LOCUS_21910 400 1218 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537935.1 protein_id gnl|my_center|LOCUS_21910 >Feature sequence331 1280 2482 gene locus_tag LOCUS_21920 1280 2482 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721701.1 protein_id gnl|my_center|LOCUS_21920 2962 3035 gene locus_tag LOCUS_t00280 2962 3035 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence332 <1 1018 gene locus_tag LOCUS_21930 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537851.1:DUF5930 domain-containing protein 1008 1514 gene locus_tag LOCUS_21940 1008 1514 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337886.1 protein_id gnl|my_center|LOCUS_21940 2066 1899 gene locus_tag LOCUS_21950 2066 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21950 <3057 2021 gene locus_tag LOCUS_21960 <3057 2021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140066.1:FAD-binding oxidoreductase note possible pseudo, frameshifted >Feature sequence333 2051 909 gene locus_tag LOCUS_21970 2051 909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532240.1 protein_id gnl|my_center|LOCUS_21970 2955 2053 gene locus_tag LOCUS_21980 2955 2053 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368464.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence334 2 1600 gene locus_tag LOCUS_21990 2 1600 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338036.1 protein_id gnl|my_center|LOCUS_21990 1651 1726 gene locus_tag LOCUS_t00290 1651 1726 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2500 2655 gene locus_tag LOCUS_22000 2500 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence335 886 1338 gene locus_tag LOCUS_22010 886 1338 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082909757.1 protein_id gnl|my_center|LOCUS_22010 2439 2173 gene locus_tag LOCUS_22020 2439 2173 CDS product DUF2171 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532118.1 protein_id gnl|my_center|LOCUS_22020 2920 2576 gene locus_tag LOCUS_22030 2920 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 >Feature sequence336 2473 470 gene locus_tag LOCUS_22040 gene nirS 2473 470 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence337 579 421 gene locus_tag LOCUS_22050 579 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 992 576 gene locus_tag LOCUS_22060 992 576 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530371.1 protein_id gnl|my_center|LOCUS_22060 2013 985 gene locus_tag LOCUS_22070 gene ruvB 2013 985 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338313.1 protein_id gnl|my_center|LOCUS_22070 2906 2025 gene locus_tag LOCUS_22080 gene htpX 2906 2025 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876568.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence338 2671 344 gene locus_tag LOCUS_22090 gene tssI 2671 344 CDS product type VI secretion system tip protein TssI/VgrG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339354.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence339 2864 1542 gene locus_tag LOCUS_22100 gene glcF 2864 1542 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401690.1 protein_id gnl|my_center|LOCUS_22100 >Feature sequence340 2118 2771 gene locus_tag LOCUS_22110 2118 2771 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723102.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence341 <1 688 gene locus_tag LOCUS_22120 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014527266.1:sulfotransferase >Feature sequence342 1158 928 gene locus_tag LOCUS_22130 1158 928 CDS product hexameric tyrosine-coordinated heme protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963152.1 protein_id gnl|my_center|LOCUS_22130 2407 1802 gene locus_tag LOCUS_22140 2407 1802 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528246.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence343 <1 764 gene locus_tag LOCUS_22150 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705534.1:nitrate reductase subunit alpha 761 2284 gene locus_tag LOCUS_22160 gene narH 761 2284 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_22160 >Feature sequence344 901 1344 gene locus_tag LOCUS_22170 901 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1348 2073 gene locus_tag LOCUS_22180 1348 2073 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_22180 2354 2070 gene locus_tag LOCUS_22190 2354 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22190 2804 2382 gene locus_tag LOCUS_22200 2804 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22200 >Feature sequence345 171 521 gene locus_tag LOCUS_22210 171 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 844 1953 gene locus_tag LOCUS_22220 844 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence346 305 739 gene locus_tag LOCUS_22230 305 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 743 1561 gene locus_tag LOCUS_22240 743 1561 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336944.1 protein_id gnl|my_center|LOCUS_22240 1590 1790 gene locus_tag LOCUS_22250 1590 1790 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722450.1 protein_id gnl|my_center|LOCUS_22250 1790 2362 gene locus_tag LOCUS_22260 1790 2362 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385343.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence347 529 308 gene locus_tag LOCUS_22270 529 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 919 566 gene locus_tag LOCUS_22280 919 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 2415 1012 gene locus_tag LOCUS_22290 2415 1012 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207317.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence348 <1 892 gene locus_tag LOCUS_22300 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807436.1:molybdopterin-synthase adenylyltransferase MoeB 892 1833 gene locus_tag LOCUS_22310 892 1833 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389332.1 protein_id gnl|my_center|LOCUS_22310 1830 2507 gene locus_tag LOCUS_22320 gene tenA 1830 2507 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090123.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence349 <1 1797 gene locus_tag LOCUS_22330 <1 1797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338906.1:DNA helicase RecQ 2561 2073 gene locus_tag LOCUS_22340 2561 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 >Feature sequence350 <1 1331 gene locus_tag LOCUS_22350 <1 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004548106.1:acyl-CoA ligase (AMP-forming), exosortase A system-associated 1341 1577 gene locus_tag LOCUS_22360 1341 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1588 2799 gene locus_tag LOCUS_22370 1588 2799 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992304.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence351 935 1237 gene locus_tag LOCUS_22380 935 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22380 1210 1803 gene locus_tag LOCUS_22390 1210 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22390 <2884 1834 gene locus_tag LOCUS_22400 <2884 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140093.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence352 1975 1187 gene locus_tag LOCUS_22410 gene radC 1975 1187 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338763.1 protein_id gnl|my_center|LOCUS_22410 <2884 2028 gene locus_tag LOCUS_22420 <2884 2028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338764.1:molecular chaperone DnaJ >Feature sequence353 1053 1316 gene locus_tag LOCUS_22430 1053 1316 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014761069.1 protein_id gnl|my_center|LOCUS_22430 2599 1382 gene locus_tag LOCUS_22440 2599 1382 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336960.1 protein_id gnl|my_center|LOCUS_22440 >Feature sequence354 <2876 2029 gene locus_tag LOCUS_22450 <2876 2029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338201.1:DNA primase >Feature sequence355 1050 31 gene locus_tag LOCUS_22460 gene cceR 1050 31 CDS product LacI family DNA-binding transcriptional regulator CceR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336932.1 protein_id gnl|my_center|LOCUS_22460 1146 1222 gene locus_tag LOCUS_t00300 1146 1222 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2271 1294 gene locus_tag LOCUS_22470 gene pip 2271 1294 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338765.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence356 747 274 gene locus_tag LOCUS_22480 gene rplV 747 274 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538011.1 protein_id gnl|my_center|LOCUS_22480 1031 753 gene locus_tag LOCUS_22490 gene rpsS 1031 753 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538012.1 protein_id gnl|my_center|LOCUS_22490 1874 1035 gene locus_tag LOCUS_22500 gene rplB 1874 1035 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538013.1 protein_id gnl|my_center|LOCUS_22500 2280 1978 gene locus_tag LOCUS_22510 2280 1978 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722494.1 protein_id gnl|my_center|LOCUS_22510 <2822 2277 gene locus_tag LOCUS_22520 <2822 2277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722493.1:50S ribosomal protein L4 >Feature sequence357 2347 95 gene locus_tag LOCUS_22530 2347 95 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339403.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence358 336 593 gene locus_tag LOCUS_22540 336 593 CDS product formate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563132.1 protein_id gnl|my_center|LOCUS_22540 >Feature sequence359 1820 723 gene locus_tag LOCUS_22550 gene aroB 1820 723 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337780.1 protein_id gnl|my_center|LOCUS_22550 2401 1820 gene locus_tag LOCUS_22560 2401 1820 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140213.1 protein_id gnl|my_center|LOCUS_22560 2500 2748 gene locus_tag LOCUS_22570 2500 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 >Feature sequence360 234 791 gene locus_tag LOCUS_22580 234 791 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339016.1 protein_id gnl|my_center|LOCUS_22580 2343 808 gene locus_tag LOCUS_22590 2343 808 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537550.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence361 1672 671 gene locus_tag LOCUS_22600 gene galE 1672 671 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338390.1 protein_id gnl|my_center|LOCUS_22600 2566 1676 gene locus_tag LOCUS_22610 gene galU 2566 1676 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563200.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence362 1415 267 gene locus_tag LOCUS_22620 1415 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1697 1772 gene locus_tag LOCUS_t00310 1697 1772 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1792 2667 gene locus_tag LOCUS_22630 1792 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence363 384 683 gene locus_tag LOCUS_22640 384 683 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_22640 747 2063 gene locus_tag LOCUS_22650 747 2063 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972180.1 protein_id gnl|my_center|LOCUS_22650 <2756 2220 gene locus_tag LOCUS_22660 <2756 2220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338723.1:tRNA pseudouridine(55) synthase TruB >Feature sequence364 422 793 gene locus_tag LOCUS_22670 422 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 1139 1699 gene locus_tag LOCUS_22680 1139 1699 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383727.1 protein_id gnl|my_center|LOCUS_22680 >Feature sequence365 22 795 gene locus_tag LOCUS_22690 gene narI 22 795 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191967.1 protein_id gnl|my_center|LOCUS_22690 801 1592 gene locus_tag LOCUS_22700 801 1592 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528382.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence366 494 2164 gene locus_tag LOCUS_22710 494 2164 CDS product DUF2125 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721144.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence367 <1 983 gene locus_tag LOCUS_22720 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337032.1:trypsin-like peptidase domain-containing protein 2436 988 gene locus_tag LOCUS_22730 2436 988 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337031.1 protein_id gnl|my_center|LOCUS_22730 >Feature sequence368 <1 667 gene locus_tag LOCUS_22740 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385197.1:single-stranded-DNA-specific exonuclease RecJ 923 997 gene locus_tag LOCUS_t00320 923 997 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence369 836 267 gene locus_tag LOCUS_22750 836 267 CDS product heme NO-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338211.1 protein_id gnl|my_center|LOCUS_22750 1173 901 gene locus_tag LOCUS_22760 1173 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence370 <1 2108 gene locus_tag LOCUS_22770 <1 2108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338395.1:ligase-associated DNA damage response DEXH box helicase >Feature sequence371 669 863 gene locus_tag LOCUS_22780 669 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1427 2251 gene locus_tag LOCUS_22790 1427 2251 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005856056.1 protein_id gnl|my_center|LOCUS_22790 >Feature sequence372 <1 681 gene locus_tag LOCUS_22800 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338741.1:polyprenyl synthetase family protein >Feature sequence373 >Feature sequence374 2547 967 gene locus_tag LOCUS_22810 2547 967 CDS product glucan biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621906.1 protein_id gnl|my_center|LOCUS_22810 >Feature sequence375 977 315 gene locus_tag LOCUS_22820 977 315 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389052.1 protein_id gnl|my_center|LOCUS_22820 1630 977 gene locus_tag LOCUS_22830 1630 977 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389051.1 protein_id gnl|my_center|LOCUS_22830 2510 1689 gene locus_tag LOCUS_22840 2510 1689 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470652.1 protein_id gnl|my_center|LOCUS_22840 >Feature sequence376 1660 38 gene locus_tag LOCUS_22850 1660 38 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028287100.1 protein_id gnl|my_center|LOCUS_22850 2261 1770 gene locus_tag LOCUS_22860 2261 1770 CDS product DUF3035 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338716.1 protein_id gnl|my_center|LOCUS_22860 >Feature sequence377 466 918 gene locus_tag LOCUS_22870 466 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 938 1423 gene locus_tag LOCUS_22880 938 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1835 1497 gene locus_tag LOCUS_22890 1835 1497 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383622.1 protein_id gnl|my_center|LOCUS_22890 2251 1922 gene locus_tag LOCUS_22900 2251 1922 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337479.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence378 <1 1683 gene locus_tag LOCUS_22910 <1 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972171.1:Na/Pi cotransporter family protein 2145 2450 gene locus_tag LOCUS_22920 2145 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence379 1046 1585 gene locus_tag LOCUS_22930 1046 1585 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973183.1 protein_id gnl|my_center|LOCUS_22930 2535 1582 gene locus_tag LOCUS_22940 2535 1582 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722210.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence380 1077 595 gene locus_tag LOCUS_22950 1077 595 CDS product DUF6446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384809.1 protein_id gnl|my_center|LOCUS_22950 2036 1074 gene locus_tag LOCUS_22960 2036 1074 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337033.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence381 2387 180 gene locus_tag LOCUS_22970 2387 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22970 >Feature sequence382 922 398 gene locus_tag LOCUS_22980 gene secB 922 398 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721743.1 protein_id gnl|my_center|LOCUS_22980 1471 974 gene locus_tag LOCUS_22990 1471 974 CDS product FxsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563277.1 protein_id gnl|my_center|LOCUS_22990 1594 2232 gene locus_tag LOCUS_23000 1594 2232 CDS product Tim44/TimA family putative adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385483.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence383 261 1361 gene locus_tag LOCUS_23010 gene trgB 261 1361 CDS product tellurite resistance ADP-ribose pyrophosphatase TrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161601245.1 protein_id gnl|my_center|LOCUS_23010 1427 2458 gene locus_tag LOCUS_23020 1427 2458 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719301.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence384 1323 1009 gene locus_tag LOCUS_23030 1323 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 <2562 1320 gene locus_tag LOCUS_23040 <2562 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338715.1:pitrilysin family protein >Feature sequence385 1564 722 gene locus_tag LOCUS_23050 gene dapF 1564 722 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538114.1 protein_id gnl|my_center|LOCUS_23050 1652 1727 gene locus_tag LOCUS_t00330 1652 1727 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2539 1958 gene locus_tag LOCUS_23060 2539 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 >Feature sequence386 9 1565 gene locus_tag LOCUS_23070 9 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence387 1579 2016 gene locus_tag LOCUS_23080 1579 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 >Feature sequence388 206 1375 gene locus_tag LOCUS_23090 206 1375 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_23090 <2509 1403 gene locus_tag LOCUS_23100 <2509 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337843.1:ATP-binding protein >Feature sequence389 <1 1298 gene locus_tag LOCUS_23110 <1 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338533.1:leucine--tRNA ligase 1285 1761 gene locus_tag LOCUS_23120 gene lptE 1285 1761 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338532.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence390 <1 671 gene locus_tag LOCUS_23130 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719610.1:DNA repair protein RadA 716 1321 gene locus_tag LOCUS_23140 716 1321 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719609.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence391 <1 934 gene locus_tag LOCUS_23150 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337469.1:RluA family pseudouridine synthase 945 1853 gene locus_tag LOCUS_23160 gene rpoH 945 1853 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719564.1 protein_id gnl|my_center|LOCUS_23160 >Feature sequence392 1762 956 gene locus_tag LOCUS_23170 1762 956 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531216.1 protein_id gnl|my_center|LOCUS_23170 <2471 1759 gene locus_tag LOCUS_23180 <2471 1759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531217.1:ABC transporter permease >Feature sequence393 992 198 gene locus_tag LOCUS_23190 gene lepB 992 198 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722417.1 protein_id gnl|my_center|LOCUS_23190 1488 1051 gene locus_tag LOCUS_23200 gene acpS 1488 1051 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009561568.1 protein_id gnl|my_center|LOCUS_23200 1910 1485 gene locus_tag LOCUS_23210 1910 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 <2471 1907 gene locus_tag LOCUS_23220 <2471 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722415.1:pyridoxine 5'-phosphate synthase >Feature sequence394 <2447 308 gene locus_tag LOCUS_23230 <2447 308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337267.1:DUF3772 domain-containing protein >Feature sequence395 542 1597 gene locus_tag LOCUS_23240 542 1597 CDS product quinoprotein relay system zinc metallohydrolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003593.1 protein_id gnl|my_center|LOCUS_23240 1956 1573 gene locus_tag LOCUS_23250 1956 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 >Feature sequence396 >Feature sequence397 1528 359 gene locus_tag LOCUS_23260 1528 359 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337511.1 protein_id gnl|my_center|LOCUS_23260 2167 1619 gene locus_tag LOCUS_23270 2167 1619 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337510.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence398 770 189 gene locus_tag LOCUS_23280 770 189 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722709.1 protein_id gnl|my_center|LOCUS_23280 2035 770 gene locus_tag LOCUS_23290 2035 770 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337016.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence399 876 424 gene locus_tag LOCUS_23300 gene rplK 876 424 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385335.1 protein_id gnl|my_center|LOCUS_23300 1488 949 gene locus_tag LOCUS_23310 gene nusG 1488 949 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722468.1 protein_id gnl|my_center|LOCUS_23310 1837 1646 gene locus_tag LOCUS_23320 gene secE 1837 1646 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722466.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence400 931 1413 gene locus_tag LOCUS_23330 931 1413 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012641245.1 protein_id gnl|my_center|LOCUS_23330 1410 2192 gene locus_tag LOCUS_23340 1410 2192 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339418.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence401 588 1769 gene locus_tag LOCUS_23350 588 1769 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385507.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence402 8 370 gene locus_tag LOCUS_23360 8 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence403 819 292 gene locus_tag LOCUS_23370 819 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence404 <1 1593 gene locus_tag LOCUS_23380 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532916.1:acyl-CoA synthetase >Feature sequence405 1 366 gene locus_tag LOCUS_23390 1 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 676 395 gene locus_tag LOCUS_23400 676 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 942 673 gene locus_tag LOCUS_23410 942 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 <2352 948 gene locus_tag LOCUS_23420 <2352 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719263.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence406 648 1514 gene locus_tag LOCUS_23430 648 1514 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140207.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence407 2240 117 gene locus_tag LOCUS_23440 gene fusA 2240 117 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336951.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence408 <1 674 gene locus_tag LOCUS_23450 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165993556.1:IS5 family transposase 1168 725 gene locus_tag LOCUS_23460 1168 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1268 1591 gene locus_tag LOCUS_23470 1268 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23470 >Feature sequence409 2 889 gene locus_tag LOCUS_23480 2 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 1427 1684 gene locus_tag LOCUS_23490 1427 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2291 1791 gene locus_tag LOCUS_23500 2291 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence410 <2326 1230 gene locus_tag LOCUS_23510 <2326 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338571.1:HlyD family type I secretion periplasmic adaptor subunit >Feature sequence411 368 1510 gene locus_tag LOCUS_23520 368 1510 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015920660.1 protein_id gnl|my_center|LOCUS_23520 >Feature sequence412 >Feature sequence413 <2316 1807 gene locus_tag LOCUS_23530 <2316 1807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336881.1:TAXI family TRAP transporter solute-binding subunit >Feature sequence414 >Feature sequence415 450 244 gene locus_tag LOCUS_23540 450 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 >Feature sequence416 <2304 1658 gene locus_tag LOCUS_23550 <2304 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975669.1:ABC transporter permease >Feature sequence417 98 721 gene locus_tag LOCUS_23560 98 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 904 1860 gene locus_tag LOCUS_23570 904 1860 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724804.1 protein_id gnl|my_center|LOCUS_23570 >Feature sequence418 1397 42 gene locus_tag LOCUS_23580 1397 42 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975177.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence419 <1 541 gene locus_tag LOCUS_23590 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337589.1:quinoprotein dehydrogenase-associated SoxYZ-like carrier 586 1323 gene locus_tag LOCUS_23600 586 1323 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228695.1 protein_id gnl|my_center|LOCUS_23600 >Feature sequence420 <2288 297 gene locus_tag LOCUS_23610 <2288 297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339575.1:aldehyde dehydrogenase family protein >Feature sequence421 613 1338 gene locus_tag LOCUS_23620 613 1338 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530892.1 protein_id gnl|my_center|LOCUS_23620 1443 1667 gene locus_tag LOCUS_23630 1443 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 <2278 1657 gene locus_tag LOCUS_23640 <2278 1657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338479.1:ABC transporter ATP-binding protein >Feature sequence422 2077 386 gene locus_tag LOCUS_23650 2077 386 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338456.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence423 491 66 gene locus_tag LOCUS_23660 491 66 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818374.1 protein_id gnl|my_center|LOCUS_23660 773 546 gene locus_tag LOCUS_23670 773 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720310.1 protein_id gnl|my_center|LOCUS_23670 876 1124 gene locus_tag LOCUS_23680 876 1124 CDS product DUF2312 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720309.1 protein_id gnl|my_center|LOCUS_23680 2059 1187 gene locus_tag LOCUS_23690 2059 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 >Feature sequence424 488 694 gene locus_tag LOCUS_23700 488 694 CDS product DUF1737 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721263.1 protein_id gnl|my_center|LOCUS_23700 691 1725 gene locus_tag LOCUS_23710 691 1725 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338635.1 protein_id gnl|my_center|LOCUS_23710 >Feature sequence425 989 273 gene locus_tag LOCUS_23720 989 273 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336806.1 protein_id gnl|my_center|LOCUS_23720 <2252 962 gene locus_tag LOCUS_23730 <2252 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336805.1:phosphotransferase >Feature sequence426 <1 533 gene locus_tag LOCUS_23740 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972317.1:PDR/VanB family oxidoreductase 545 1438 gene locus_tag LOCUS_23750 545 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1435 1860 gene locus_tag LOCUS_23760 1435 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23760 2189 1857 gene locus_tag LOCUS_23770 2189 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence427 <1 1089 gene locus_tag LOCUS_23780 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338342.1:M3 family metallopeptidase 1086 1520 gene locus_tag LOCUS_23790 1086 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 <2207 1579 gene locus_tag LOCUS_23800 <2207 1579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041669258.1:SH3 domain-containing protein >Feature sequence428 421 44 gene locus_tag LOCUS_23810 gene uraH 421 44 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528242.1 protein_id gnl|my_center|LOCUS_23810 1904 411 gene locus_tag LOCUS_23820 1904 411 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970358.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence429 801 1157 gene locus_tag LOCUS_23830 801 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971659.1 protein_id gnl|my_center|LOCUS_23830 1832 1173 gene locus_tag LOCUS_23840 1832 1173 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337694.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence430 1221 433 gene locus_tag LOCUS_23850 1221 433 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338955.1 protein_id gnl|my_center|LOCUS_23850 1528 1340 gene locus_tag LOCUS_23860 1528 1340 CDS product DUF3553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723397.1 protein_id gnl|my_center|LOCUS_23860 >Feature sequence431 63 401 gene locus_tag LOCUS_23870 63 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 462 722 gene locus_tag LOCUS_23880 462 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23880 >Feature sequence432 1003 416 gene locus_tag LOCUS_23890 gene hisB 1003 416 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence433 1516 959 gene locus_tag LOCUS_23900 1516 959 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562233.1 protein_id gnl|my_center|LOCUS_23900 >Feature sequence434 >Feature sequence435 191 1357 gene locus_tag LOCUS_23910 gene metK 191 1357 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724558.1 protein_id gnl|my_center|LOCUS_23910 <2130 1401 gene locus_tag LOCUS_23920 <2130 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337759.1:penicillin acylase family protein >Feature sequence436 512 901 gene locus_tag LOCUS_23930 gene sdhC 512 901 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563028.1 protein_id gnl|my_center|LOCUS_23930 913 1305 gene locus_tag LOCUS_23940 913 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence437 <1 1991 gene locus_tag LOCUS_23950 <1 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339352.1:type VI secretion system membrane subunit TssM >Feature sequence438 562 230 gene locus_tag LOCUS_23960 562 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23960 981 529 gene locus_tag LOCUS_23970 981 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23970 <2095 873 gene locus_tag LOCUS_23980 <2095 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969513.1:polysaccharide pyruvyl transferase family protein >Feature sequence439 283 1017 gene locus_tag LOCUS_23990 283 1017 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337774.1 protein_id gnl|my_center|LOCUS_23990 1727 993 gene locus_tag LOCUS_24000 gene cobJ 1727 993 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337773.1 protein_id gnl|my_center|LOCUS_24000 2086 1724 gene locus_tag LOCUS_24010 2086 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence440 803 234 gene locus_tag LOCUS_24020 803 234 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_24020 >Feature sequence441 93 1139 gene locus_tag LOCUS_24030 93 1139 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392444.1 protein_id gnl|my_center|LOCUS_24030 <2066 1158 gene locus_tag LOCUS_24040 <2066 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064252830.1:aconitate hydratase AcnA >Feature sequence442 511 167 gene locus_tag LOCUS_24050 511 167 CDS product H-type lectin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137194167.1 protein_id gnl|my_center|LOCUS_24050 1272 598 gene locus_tag LOCUS_24060 1272 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1805 1356 gene locus_tag LOCUS_24070 1805 1356 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383731.1 protein_id gnl|my_center|LOCUS_24070 >Feature sequence443 529 1218 gene locus_tag LOCUS_24080 529 1218 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973715.1 protein_id gnl|my_center|LOCUS_24080 1814 1254 gene locus_tag LOCUS_24090 1814 1254 CDS product DUF2076 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723572.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence444 <1 538 gene locus_tag LOCUS_24100 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002724497.1:iron chelate uptake ABC transporter family permease subunit 734 973 gene locus_tag LOCUS_24110 734 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 >Feature sequence445 <1 1264 gene locus_tag LOCUS_24120 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338224.1:methionine--tRNA ligase 1572 1817 gene locus_tag LOCUS_24130 1572 1817 CDS product DUF4170 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722116.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence446 >Feature sequence447 1344 196 gene locus_tag LOCUS_24140 1344 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1958 1509 gene locus_tag LOCUS_24150 1958 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 >Feature sequence448 <1 595 gene locus_tag LOCUS_24160 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531202.1:aspartate aminotransferase family protein >Feature sequence449 <2004 1148 gene locus_tag LOCUS_24170 <2004 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337157.1:methylmalonyl Co-A mutase-associated GTPase MeaB >Feature sequence450 763 284 gene locus_tag LOCUS_24180 763 284 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719940.1 protein_id gnl|my_center|LOCUS_24180 818 1006 gene locus_tag LOCUS_24190 818 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 1876 1031 gene locus_tag LOCUS_24200 1876 1031 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008163.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence451 <1 1456 gene locus_tag LOCUS_24210 <1 1456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533595.1:gamma-glutamyltransferase >Feature sequence452 <1 1220 gene locus_tag LOCUS_24220 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881051.1:glucans biosynthesis glucosyltransferase MdoH >Feature sequence453 >Feature sequence454 729 1109 gene locus_tag LOCUS_24230 729 1109 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972404.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence455 853 77 gene locus_tag LOCUS_24240 853 77 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720280.1 protein_id gnl|my_center|LOCUS_24240 1543 875 gene locus_tag LOCUS_24250 1543 875 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720279.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence456 <1 759 gene locus_tag LOCUS_24260 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943837.1:CARDB domain-containing protein >Feature sequence457 63 1736 gene locus_tag LOCUS_24270 63 1736 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338186.1 protein_id gnl|my_center|LOCUS_24270 >Feature sequence458 >Feature sequence459 713 144 gene locus_tag LOCUS_24280 713 144 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011841687.1 protein_id gnl|my_center|LOCUS_24280 1067 1327 gene locus_tag LOCUS_24290 1067 1327 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338499.1 protein_id gnl|my_center|LOCUS_24290 1573 1331 gene locus_tag LOCUS_24300 1573 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337408.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence460 893 339 gene locus_tag LOCUS_24310 gene prrA 893 339 CDS product global response regulator transcription factor PrrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722225.1 protein_id gnl|my_center|LOCUS_24310 1607 987 gene locus_tag LOCUS_24320 1607 987 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722229.1 protein_id gnl|my_center|LOCUS_24320 >Feature sequence461 1772 1338 gene locus_tag LOCUS_24330 1772 1338 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009564474.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence462 817 170 gene locus_tag LOCUS_24340 817 170 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722779.1 protein_id gnl|my_center|LOCUS_24340 883 1620 gene locus_tag LOCUS_24350 883 1620 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337043.1 protein_id gnl|my_center|LOCUS_24350 1651 1893 gene locus_tag LOCUS_24360 1651 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 >Feature sequence463 879 1565 gene locus_tag LOCUS_24370 879 1565 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385403.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence464 240 43 gene locus_tag LOCUS_24380 240 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 551 237 gene locus_tag LOCUS_24390 551 237 CDS product gene transfer agent family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719629.1 protein_id gnl|my_center|LOCUS_24390 964 551 gene locus_tag LOCUS_24400 964 551 CDS product phage major tail protein, TP901-1 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719628.1 protein_id gnl|my_center|LOCUS_24400 1408 977 gene locus_tag LOCUS_24410 1408 977 CDS product DUF3168 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337514.1 protein_id gnl|my_center|LOCUS_24410 1743 1405 gene locus_tag LOCUS_24420 1743 1405 CDS product head-tail adaptor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383951.1 protein_id gnl|my_center|LOCUS_24420 >Feature sequence465 297 1064 gene locus_tag LOCUS_24430 297 1064 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036275.1 protein_id gnl|my_center|LOCUS_24430 1061 1933 gene locus_tag LOCUS_24440 1061 1933 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036276.1 protein_id gnl|my_center|LOCUS_24440 >Feature sequence466 1719 475 gene locus_tag LOCUS_24450 gene tyrS 1719 475 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337526.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence467 1481 618 gene locus_tag LOCUS_24460 gene cheR 1481 618 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970951.1 protein_id gnl|my_center|LOCUS_24460 >Feature sequence468 >Feature sequence469 <1 1277 gene locus_tag LOCUS_24470 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338903.1:alpha-2-macroglobulin family protein >Feature sequence470 1766 531 gene locus_tag LOCUS_24480 1766 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24480 >Feature sequence471 1339 515 gene locus_tag LOCUS_24490 gene panB 1339 515 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563678.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence472 <1 1179 gene locus_tag LOCUS_24500 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140385.1:type VI secretion system-associated FHA domain protein TagH 1176 1649 gene locus_tag LOCUS_24510 gene tssJ 1176 1649 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339349.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence473 1682 636 gene locus_tag LOCUS_24520 1682 636 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336817.1 protein_id gnl|my_center|LOCUS_24520 >Feature sequence474 289 1158 gene locus_tag LOCUS_24530 gene msrP 289 1158 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338939.1 protein_id gnl|my_center|LOCUS_24530 1158 1772 gene locus_tag LOCUS_24540 gene msrQ 1158 1772 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338940.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence475 1109 315 gene locus_tag LOCUS_24550 gene surE 1109 315 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383988.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence476 117 1601 gene locus_tag LOCUS_24560 gene glpK 117 1601 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337641.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence477 <1 898 gene locus_tag LOCUS_24570 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337147.1:anthranilate phosphoribosyltransferase 895 1548 gene locus_tag LOCUS_24580 895 1548 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383899.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence478 2 685 gene locus_tag LOCUS_24590 2 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 751 921 gene locus_tag LOCUS_24600 751 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 982 1623 gene locus_tag LOCUS_24610 982 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338453.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence479 641 1765 gene locus_tag LOCUS_24620 641 1765 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180937856.1 protein_id gnl|my_center|LOCUS_24620 >Feature sequence480 <1 632 gene locus_tag LOCUS_24630 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338626.1:quinone-dependent dihydroorotate dehydrogenase 1470 640 gene locus_tag LOCUS_24640 gene cysE 1470 640 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719636.1 protein_id gnl|my_center|LOCUS_24640 >Feature sequence481 113 1330 gene locus_tag LOCUS_24650 113 1330 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339301.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence482 975 571 gene locus_tag LOCUS_24660 975 571 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_24660 1211 972 gene locus_tag LOCUS_24670 1211 972 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403013.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence483 378 22 gene locus_tag LOCUS_24680 378 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 427 1047 gene locus_tag LOCUS_24690 427 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence484 65 841 gene locus_tag LOCUS_24700 65 841 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188391.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence485 1071 22 gene locus_tag LOCUS_24710 gene tssG 1071 22 CDS product type VI secretion system baseplate subunit TssG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525304.1 protein_id gnl|my_center|LOCUS_24710 1391 1035 gene locus_tag LOCUS_24720 1391 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 >Feature sequence486 <1 1444 gene locus_tag LOCUS_24730 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337543.1:acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha >Feature sequence487 <1774 428 gene locus_tag LOCUS_24740 <1774 428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975176.1:amidohydrolase >Feature sequence488 <1 651 gene locus_tag LOCUS_24750 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339102.1:NCS1 family transporter 1035 808 gene locus_tag LOCUS_24760 1035 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 1560 1766 gene locus_tag LOCUS_24770 1560 1766 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720550.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence489 155 1522 gene locus_tag LOCUS_24780 155 1522 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720543.1 protein_id gnl|my_center|LOCUS_24780 >Feature sequence490 1757 1515 gene locus_tag LOCUS_24790 1757 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence491 >Feature sequence492 4 588 gene locus_tag LOCUS_24800 4 588 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140162.1 protein_id gnl|my_center|LOCUS_24800 588 1220 gene locus_tag LOCUS_24810 588 1220 CDS product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence493 1129 344 gene locus_tag LOCUS_24820 1129 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence494 1038 148 gene locus_tag LOCUS_24830 gene ttcA 1038 148 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338688.1 protein_id gnl|my_center|LOCUS_24830 1309 1031 gene locus_tag LOCUS_24840 gene yidD 1309 1031 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721423.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence495 1100 291 gene locus_tag LOCUS_24850 gene rfbF 1100 291 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859505.1 protein_id gnl|my_center|LOCUS_24850 <1730 1097 gene locus_tag LOCUS_24860 <1730 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046117184.1:glycosyltransferase family 4 protein >Feature sequence496 <1712 218 gene locus_tag LOCUS_24870 <1712 218 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338614.1:MFS transporter >Feature sequence497 98 886 gene locus_tag LOCUS_24880 98 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 <1709 1180 gene locus_tag LOCUS_24890 <1709 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338368.1:carbon-nitrogen hydrolase family protein >Feature sequence498 <1 1649 gene locus_tag LOCUS_24900 <1 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012643744.1:bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA >Feature sequence499 1608 1411 gene locus_tag LOCUS_24910 1608 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence500 84 689 gene locus_tag LOCUS_24920 84 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24920 <1693 686 gene locus_tag LOCUS_24930 <1693 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969143.1:AAA family ATPase >Feature sequence501 1 1014 gene locus_tag LOCUS_24940 1 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 <1691 1129 gene locus_tag LOCUS_24950 <1691 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146588923.1:PAS domain-containing protein >Feature sequence502 943 290 gene locus_tag LOCUS_24960 943 290 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538104.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence503 >Feature sequence504 >Feature sequence505 1563 40 gene locus_tag LOCUS_24970 gene zwf 1563 40 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089499.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence506 <1 1637 gene locus_tag LOCUS_24980 <1 1637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338040.1:ATP-binding protein >Feature sequence507 891 196 gene locus_tag LOCUS_24990 891 196 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088320.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence508 <1 903 gene locus_tag LOCUS_25000 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331263.1:plasmid partitioning protein RepA >Feature sequence509 249 22 gene locus_tag LOCUS_25010 249 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1012 635 gene locus_tag LOCUS_25020 1012 635 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_25020 1086 1283 gene locus_tag LOCUS_25030 1086 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 >Feature sequence510 <1607 933 gene locus_tag LOCUS_25040 <1607 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974840.1:plasmid replication protein RepC >Feature sequence511 157 546 gene locus_tag LOCUS_25050 157 546 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384559.1 protein_id gnl|my_center|LOCUS_25050 543 1079 gene locus_tag LOCUS_25060 543 1079 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918326.1 protein_id gnl|my_center|LOCUS_25060 1109 1435 gene locus_tag LOCUS_25070 1109 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence512 145 1524 gene locus_tag LOCUS_25080 145 1524 CDS product DUF2254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_25080 >Feature sequence513 53 436 gene locus_tag LOCUS_25090 53 436 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199254442.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence514 359 276 gene locus_tag LOCUS_t00340 359 276 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence515 >Feature sequence516 >Feature sequence517 1085 291 gene locus_tag LOCUS_25100 gene thiD 1085 291 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242048.1 protein_id gnl|my_center|LOCUS_25100 >Feature sequence518 <1559 495 gene locus_tag LOCUS_25110 <1559 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140134.1:AMP-binding protein >Feature sequence519 240 1193 gene locus_tag LOCUS_25120 240 1193 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338742.1 protein_id gnl|my_center|LOCUS_25120 1190 1447 gene locus_tag LOCUS_25130 1190 1447 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003503059.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence520 <1 1145 gene locus_tag LOCUS_25140 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139982.1:DNA mismatch repair endonuclease MutL 1195 1542 gene locus_tag LOCUS_25150 1195 1542 CDS product DUF3775 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173751.1 protein_id gnl|my_center|LOCUS_25150 >Feature sequence521 <1543 319 gene locus_tag LOCUS_25160 <1543 319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339341.1:type VI secretion system ATPase TssH >Feature sequence522 348 1106 gene locus_tag LOCUS_25170 348 1106 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724798.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence523 55 330 gene locus_tag LOCUS_25180 gene rpmB 55 330 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337158.1 protein_id gnl|my_center|LOCUS_25180 465 818 gene locus_tag LOCUS_25190 465 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 842 1351 gene locus_tag LOCUS_25200 842 1351 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337160.1 protein_id gnl|my_center|LOCUS_25200 >Feature sequence524 822 463 gene locus_tag LOCUS_25210 822 463 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719755.1 protein_id gnl|my_center|LOCUS_25210 1262 819 gene locus_tag LOCUS_25220 1262 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence525 >Feature sequence526 <1 1110 gene locus_tag LOCUS_25230 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722232.1:ActS/PrrB/RegB family redox-sensitive histidine kinase >Feature sequence527 733 377 gene locus_tag LOCUS_25240 733 377 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331294.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence528 1292 27 gene locus_tag LOCUS_25250 1292 27 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338953.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence529 <1 705 gene locus_tag LOCUS_25260 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462477.1:ATP-grasp domain-containing protein 698 1357 gene locus_tag LOCUS_25270 698 1357 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392275.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence530 >Feature sequence531 748 185 gene locus_tag LOCUS_25280 748 185 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338246.1 protein_id gnl|my_center|LOCUS_25280 <1461 745 gene locus_tag LOCUS_25290 <1461 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338245.1:UbiD family decarboxylase >Feature sequence532 >Feature sequence533 66 266 gene locus_tag LOCUS_25300 66 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 266 1015 gene locus_tag LOCUS_25310 266 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence534 1093 464 gene locus_tag LOCUS_25320 gene gmk 1093 464 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008153.1 protein_id gnl|my_center|LOCUS_25320 >Feature sequence535 <1 963 gene locus_tag LOCUS_25330 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086056.1:cobyrinate a,c-diamide synthase >Feature sequence536 1272 289 gene locus_tag LOCUS_25340 1272 289 CDS product GlxA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720078.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence537 >Feature sequence538 260 805 gene locus_tag LOCUS_25350 gene cobU 260 805 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966032.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence539 >Feature sequence540 590 144 gene locus_tag LOCUS_25360 590 144 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721667.1 protein_id gnl|my_center|LOCUS_25360 1411 587 gene locus_tag LOCUS_25370 1411 587 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193365317.1 protein_id gnl|my_center|LOCUS_25370 >Feature sequence541 288 830 gene locus_tag LOCUS_25380 288 830 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720630.1 protein_id gnl|my_center|LOCUS_25380 830 1255 gene locus_tag LOCUS_25390 830 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25390 >Feature sequence542 >Feature sequence543 889 329 gene locus_tag LOCUS_25400 gene rsmD 889 329 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338578.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence544 590 958 gene locus_tag LOCUS_25410 590 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 >Feature sequence545 >Feature sequence546 <1 1122 gene locus_tag LOCUS_25420 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114856.1:(7S,10S)-hydroperoxide diol synthase >Feature sequence547 952 554 gene locus_tag LOCUS_25430 952 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence548 593 1198 gene locus_tag LOCUS_25440 593 1198 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723403.1 protein_id gnl|my_center|LOCUS_25440 >Feature sequence549 >Feature sequence550 140 661 gene locus_tag LOCUS_25450 140 661 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337765.1 protein_id gnl|my_center|LOCUS_25450 <1336 669 gene locus_tag LOCUS_25460 <1336 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337388.1:beta-eliminating lyase-related protein >Feature sequence551 158 6 gene locus_tag LOCUS_25470 158 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 496 155 gene locus_tag LOCUS_25480 496 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence552 87 935 gene locus_tag LOCUS_25490 87 935 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385329.1 protein_id gnl|my_center|LOCUS_25490 >Feature sequence553 158 553 gene locus_tag LOCUS_25500 158 553 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337316.1 protein_id gnl|my_center|LOCUS_25500 >Feature sequence554 >Feature sequence555 1014 241 gene locus_tag LOCUS_25510 gene cobM 1014 241 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337777.1 protein_id gnl|my_center|LOCUS_25510 >Feature sequence556 >Feature sequence557 >Feature sequence558 488 1111 gene locus_tag LOCUS_25520 488 1111 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566395.1 protein_id gnl|my_center|LOCUS_25520 >Feature sequence559 >Feature sequence560 >Feature sequence561 >Feature sequence562 >Feature sequence563 1009 245 gene locus_tag LOCUS_25530 1009 245 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338452.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence564 327 599 gene locus_tag LOCUS_25540 327 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence565 171 383 gene locus_tag LOCUS_25550 171 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 414 887 gene locus_tag LOCUS_25560 414 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence566 >Feature sequence567 >Feature sequence568 >Feature sequence569 30 314 gene locus_tag LOCUS_25570 30 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 311 676 gene locus_tag LOCUS_25580 311 676 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918320.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence570 >Feature sequence571 >Feature sequence572 <1 797 gene locus_tag LOCUS_25590 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014537860.1:DUF4159 domain-containing protein note possible pseudo, frameshifted >Feature sequence573 >Feature sequence574 >Feature sequence575 <1 1139 gene locus_tag LOCUS_25600 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338570.1:type I secretion system permease/ATPase >Feature sequence576 <1221 691 gene locus_tag LOCUS_25610 <1221 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017139941.1:cell envelope integrity/translocation protein TolA >Feature sequence577 <1 761 gene locus_tag LOCUS_25620 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970299.1:dihydrolipoamide acetyltransferase family protein >Feature sequence578 >Feature sequence579 348 1007 gene locus_tag LOCUS_25630 348 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 >Feature sequence580 >Feature sequence581 <1194 312 gene locus_tag LOCUS_25640 <1194 312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528761.1:PepSY domain-containing protein >Feature sequence582 >Feature sequence583 80 286 gene locus_tag LOCUS_25650 80 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1091 381 gene locus_tag LOCUS_25660 1091 381 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965913.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence584 <1 572 gene locus_tag LOCUS_25670 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002722208.1:adenosylhomocysteinase 575 937 gene locus_tag LOCUS_25680 575 937 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015456625.1 protein_id gnl|my_center|LOCUS_25680 >Feature sequence585 127 1050 gene locus_tag LOCUS_25690 127 1050 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061502.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence586 1175 285 gene locus_tag LOCUS_25700 1175 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 >Feature sequence587 >Feature sequence588 2 985 gene locus_tag LOCUS_25710 2 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence589 940 158 gene locus_tag LOCUS_25720 940 158 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017265866.1 protein_id gnl|my_center|LOCUS_25720 >Feature sequence590 >Feature sequence591 >Feature sequence592 <1127 293 gene locus_tag LOCUS_25730 <1127 293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268240.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence593 <1126 576 gene locus_tag LOCUS_25740 <1126 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140035.1:ABC transporter ATP-binding protein >Feature sequence594 1025 384 gene locus_tag LOCUS_25750 gene eda 1025 384 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719793.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence595 >Feature sequence596 >Feature sequence597 <1105 87 gene locus_tag LOCUS_25760 <1105 87 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967621.1:regulatory protein NosR >Feature sequence598 <1 783 gene locus_tag LOCUS_25770 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013094810.1:signal transduction histidine-protein kinase/phosphatase UhpB >Feature sequence599 >Feature sequence600 <1 603 gene locus_tag LOCUS_25780 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337692.1:MFS transporter >Feature sequence601 947 279 gene locus_tag LOCUS_25790 gene msrA 947 279 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095789.1 protein_id gnl|my_center|LOCUS_25790 >Feature sequence602 >Feature sequence603 <1091 119 gene locus_tag LOCUS_25800 <1091 119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533482.1:acyltransferase family protein >Feature sequence604 >Feature sequence605 <1 698 gene locus_tag LOCUS_25810 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003227859.1:als operon DNA-binding transcriptional repressor AlsR >Feature sequence606 >Feature sequence607 >Feature sequence608 1059 442 gene locus_tag LOCUS_25820 1059 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 >Feature sequence609 >Feature sequence610 >Feature sequence611 >Feature sequence612 <1 533 gene locus_tag LOCUS_25830 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941873.1:thiol reductant ABC exporter subunit CydC <1044 440 gene locus_tag LOCUS_25840 <1044 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970697.1:AraC family transcriptional regulator >Feature sequence613 <1044 434 gene locus_tag LOCUS_25850 <1044 434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002719238.1:excinuclease ABC subunit UvrB >Feature sequence614 <1006 498 gene locus_tag LOCUS_25860 <1006 498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969224.1:SMP-30/gluconolactonase/LRE family protein >Feature sequence615