>Feature sequence001 1789 235 gene locus_tag LOCUS_r00010 1789 235 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4908 2128 gene locus_tag LOCUS_00010 4908 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 7701 5005 gene locus_tag LOCUS_00020 7701 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 10499 7896 gene locus_tag LOCUS_00030 10499 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 13136 10548 gene locus_tag LOCUS_00040 13136 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 14701 13337 gene locus_tag LOCUS_00050 14701 13337 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014017276.1 protein_id gnl|my_center|LOCUS_00050 15998 15027 gene locus_tag LOCUS_00060 15998 15027 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 protein_id gnl|my_center|LOCUS_00060 16366 16100 gene locus_tag LOCUS_00070 16366 16100 CDS product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879274.1 protein_id gnl|my_center|LOCUS_00070 17232 16444 gene locus_tag LOCUS_00080 gene ispE 17232 16444 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_00080 17993 17232 gene locus_tag LOCUS_00090 gene rsmA 17993 17232 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_00090 19117 17990 gene locus_tag LOCUS_00100 19117 17990 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_00100 21914 19203 gene locus_tag LOCUS_00110 21914 19203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 23318 21939 gene locus_tag LOCUS_00120 23318 21939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 24892 23414 gene locus_tag LOCUS_00130 24892 23414 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568258.1 protein_id gnl|my_center|LOCUS_00130 26066 24927 gene locus_tag LOCUS_00140 26066 24927 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_00140 26982 26077 gene locus_tag LOCUS_00150 26982 26077 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_00150 28201 26984 gene locus_tag LOCUS_00160 28201 26984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949069.1 protein_id gnl|my_center|LOCUS_00160 28977 28384 gene locus_tag LOCUS_00170 gene recR 28977 28384 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225425.1 protein_id gnl|my_center|LOCUS_00170 29288 28980 gene locus_tag LOCUS_00180 29288 28980 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230627.1 protein_id gnl|my_center|LOCUS_00180 32448 29290 gene locus_tag LOCUS_00190 32448 29290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 32607 33191 gene locus_tag LOCUS_00200 32607 33191 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948278.1 protein_id gnl|my_center|LOCUS_00200 33178 33750 gene locus_tag LOCUS_00210 33178 33750 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_00210 34082 35464 gene locus_tag LOCUS_00220 gene asnS 34082 35464 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948326.1 protein_id gnl|my_center|LOCUS_00220 36259 35522 gene locus_tag LOCUS_00230 36259 35522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 38964 36340 gene locus_tag LOCUS_00240 gene ppdK 38964 36340 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_00240 39895 39068 gene locus_tag LOCUS_00250 39895 39068 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_00250 40895 39936 gene locus_tag LOCUS_00260 40895 39936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 41011 41922 gene locus_tag LOCUS_00270 41011 41922 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861644.1 protein_id gnl|my_center|LOCUS_00270 42573 41974 gene locus_tag LOCUS_00280 42573 41974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 43947 42595 gene locus_tag LOCUS_00290 gene mnmE 43947 42595 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393777.1 protein_id gnl|my_center|LOCUS_00290 44071 44763 gene locus_tag LOCUS_00300 44071 44763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 45411 44800 gene locus_tag LOCUS_00310 45411 44800 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243764.1 protein_id gnl|my_center|LOCUS_00310 46365 45415 gene locus_tag LOCUS_00320 gene spoIIIJ 46365 45415 CDS product YidC family membrane integrase SpoIIIJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727748.1 protein_id gnl|my_center|LOCUS_00320 46705 46334 gene locus_tag LOCUS_00330 gene rnpA 46705 46334 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945544.1 protein_id gnl|my_center|LOCUS_00330 46911 46774 gene locus_tag LOCUS_00340 gene rpmH 46911 46774 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_00340 47905 46997 gene locus_tag LOCUS_00350 47905 46997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 48375 47902 gene locus_tag LOCUS_00360 48375 47902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 49591 48365 gene locus_tag LOCUS_00370 49591 48365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 49795 51189 gene locus_tag LOCUS_00380 gene dnaA 49795 51189 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420483.1 protein_id gnl|my_center|LOCUS_00380 51258 52385 gene locus_tag LOCUS_00390 gene dnaN 51258 52385 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831813.1 protein_id gnl|my_center|LOCUS_00390 53313 52429 gene locus_tag LOCUS_00400 53313 52429 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251222.1 protein_id gnl|my_center|LOCUS_00400 53673 53323 gene locus_tag LOCUS_00410 53673 53323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 55243 56316 gene locus_tag LOCUS_00420 gene recF 55243 56316 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470745.1 protein_id gnl|my_center|LOCUS_00420 56321 58237 gene locus_tag LOCUS_00430 gene gyrB 56321 58237 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_00430 58248 60794 gene locus_tag LOCUS_00440 gene gyrA 58248 60794 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_00440 60970 62244 gene locus_tag LOCUS_00450 gene serS 60970 62244 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295265.1 protein_id gnl|my_center|LOCUS_00450 62237 62626 gene locus_tag LOCUS_00460 62237 62626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 63045 62647 gene locus_tag LOCUS_00470 63045 62647 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775686.1 protein_id gnl|my_center|LOCUS_00470 63136 63717 gene locus_tag LOCUS_00480 gene eetB 63136 63717 CDS product flavin-based extracellular electron transfer system protein EetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723627.1 protein_id gnl|my_center|LOCUS_00480 63707 64654 gene locus_tag LOCUS_00490 63707 64654 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183386.1 protein_id gnl|my_center|LOCUS_00490 64651 65628 gene locus_tag LOCUS_00500 64651 65628 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545149.1 protein_id gnl|my_center|LOCUS_00500 65630 66361 gene locus_tag LOCUS_00510 gene surE 65630 66361 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948033.1 protein_id gnl|my_center|LOCUS_00510 66348 66887 gene locus_tag LOCUS_00520 66348 66887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 67007 68587 gene locus_tag LOCUS_00530 67007 68587 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462257.1 protein_id gnl|my_center|LOCUS_00530 68593 70014 gene locus_tag LOCUS_00540 68593 70014 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461659.1 protein_id gnl|my_center|LOCUS_00540 70100 70828 gene locus_tag LOCUS_00550 70100 70828 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_00550 70887 71732 gene locus_tag LOCUS_00560 gene folD 70887 71732 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_00560 71729 72295 gene locus_tag LOCUS_00570 gene pth 71729 72295 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722742.1 protein_id gnl|my_center|LOCUS_00570 72495 75689 gene locus_tag LOCUS_00580 gene mfd 72495 75689 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579713.1 protein_id gnl|my_center|LOCUS_00580 75748 76158 gene locus_tag LOCUS_00590 75748 76158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 76260 77138 gene locus_tag LOCUS_00600 gene fakB1 76260 77138 CDS product fatty acid kinase binding subunit FakB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686344.1 protein_id gnl|my_center|LOCUS_00600 77164 78030 gene locus_tag LOCUS_00610 gene fba 77164 78030 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724024.1 protein_id gnl|my_center|LOCUS_00610 78103 78630 gene locus_tag LOCUS_00620 78103 78630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 78679 80679 gene locus_tag LOCUS_00630 78679 80679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 80764 82632 gene locus_tag LOCUS_00640 gene mnmG 80764 82632 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000541039.1 protein_id gnl|my_center|LOCUS_00640 82625 83299 gene locus_tag LOCUS_00650 gene rsmG 82625 83299 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801941.1 protein_id gnl|my_center|LOCUS_00650 83312 84079 gene locus_tag LOCUS_00660 83312 84079 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_00660 84079 84918 gene locus_tag LOCUS_00670 84079 84918 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382909.1 protein_id gnl|my_center|LOCUS_00670 84918 85103 gene locus_tag LOCUS_00680 84918 85103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 85160 86887 gene locus_tag LOCUS_00690 85160 86887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 protein_id gnl|my_center|LOCUS_00690 88144 86903 gene locus_tag LOCUS_00700 88144 86903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 88903 88154 gene locus_tag LOCUS_00710 88903 88154 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_00710 88996 89700 gene locus_tag LOCUS_00720 88996 89700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 89770 90891 gene locus_tag LOCUS_00730 gene ugpC 89770 90891 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818931.1 protein_id gnl|my_center|LOCUS_00730 91026 92912 gene locus_tag LOCUS_00740 91026 92912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 92897 93652 gene locus_tag LOCUS_00750 gene tpiA 92897 93652 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_00750 93886 94506 gene locus_tag LOCUS_00760 gene rpsD 93886 94506 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703954.1 protein_id gnl|my_center|LOCUS_00760 94586 95692 gene locus_tag LOCUS_00770 94586 95692 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830860.1 protein_id gnl|my_center|LOCUS_00770 95685 96902 gene locus_tag LOCUS_00780 gene thiI 95685 96902 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000989282.1 protein_id gnl|my_center|LOCUS_00780 96892 97434 gene locus_tag LOCUS_00790 96892 97434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 97435 98175 gene locus_tag LOCUS_00800 97435 98175 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166692.1 protein_id gnl|my_center|LOCUS_00800 98299 98760 gene locus_tag LOCUS_00810 98299 98760 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_00810 98772 99839 gene locus_tag LOCUS_00820 gene nusA 98772 99839 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986792.1 protein_id gnl|my_center|LOCUS_00820 99848 100126 gene locus_tag LOCUS_00830 99848 100126 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071128.1 protein_id gnl|my_center|LOCUS_00830 100113 100418 gene locus_tag LOCUS_00840 100113 100418 CDS product YlxQ-related RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357860.1 protein_id gnl|my_center|LOCUS_00840 100418 102727 gene locus_tag LOCUS_00850 gene infB 100418 102727 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036343.1 protein_id gnl|my_center|LOCUS_00850 102717 103055 gene locus_tag LOCUS_00860 gene rbfA 102717 103055 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776442.1 protein_id gnl|my_center|LOCUS_00860 103063 104811 gene locus_tag LOCUS_00870 gene uvrC 103063 104811 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544305.1 protein_id gnl|my_center|LOCUS_00870 104802 105656 gene locus_tag LOCUS_00880 104802 105656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 107350 105671 gene locus_tag LOCUS_00890 gene rnjA 107350 105671 CDS product ribonuclease J1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000670368.1 protein_id gnl|my_center|LOCUS_00890 109401 107914 gene locus_tag LOCUS_00900 109401 107914 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584014.1 protein_id gnl|my_center|LOCUS_00900 110010 109477 gene locus_tag LOCUS_00910 110010 109477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 >Feature sequence002 2759 675 gene locus_tag LOCUS_00920 2759 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 4126 2846 gene locus_tag LOCUS_00930 gene lpdA 4126 2846 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949165.1 protein_id gnl|my_center|LOCUS_00930 5556 4123 gene locus_tag LOCUS_00940 gene gcvPB 5556 4123 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948420.1 protein_id gnl|my_center|LOCUS_00940 6866 5556 gene locus_tag LOCUS_00950 gene gcvPA 6866 5556 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948419.1 protein_id gnl|my_center|LOCUS_00950 7239 6859 gene locus_tag LOCUS_00960 gene gcvH 7239 6859 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_00960 8331 7249 gene locus_tag LOCUS_00970 gene gcvT 8331 7249 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831107.1 protein_id gnl|my_center|LOCUS_00970 10706 8424 gene locus_tag LOCUS_00980 10706 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 13009 10727 gene locus_tag LOCUS_00990 13009 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 14413 13013 gene locus_tag LOCUS_01000 gene sufB 14413 13013 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118827.1 protein_id gnl|my_center|LOCUS_01000 14831 14394 gene locus_tag LOCUS_01010 14831 14394 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287684.1 protein_id gnl|my_center|LOCUS_01010 16044 14833 gene locus_tag LOCUS_01020 16044 14833 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989988.1 protein_id gnl|my_center|LOCUS_01020 16839 16045 gene locus_tag LOCUS_01030 16839 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 17660 16836 gene locus_tag LOCUS_01040 gene sufC 17660 16836 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151872.1 protein_id gnl|my_center|LOCUS_01040 18871 17657 gene locus_tag LOCUS_01050 18871 17657 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_01050 19442 18972 gene locus_tag LOCUS_01060 19442 18972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 21216 19435 gene locus_tag LOCUS_01070 21216 19435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827098.1 protein_id gnl|my_center|LOCUS_01070 22988 21216 gene locus_tag LOCUS_01080 22988 21216 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583044.1 protein_id gnl|my_center|LOCUS_01080 23604 23122 gene locus_tag LOCUS_01090 23604 23122 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963411.1 protein_id gnl|my_center|LOCUS_01090 27206 23652 gene locus_tag LOCUS_01100 gene nifJ 27206 23652 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626879.1 protein_id gnl|my_center|LOCUS_01100 29115 27319 gene locus_tag LOCUS_01110 29115 27319 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_01110 30938 29112 gene locus_tag LOCUS_01120 30938 29112 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680888.1 protein_id gnl|my_center|LOCUS_01120 32044 31220 gene locus_tag LOCUS_01130 gene rsmI 32044 31220 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947928.1 protein_id gnl|my_center|LOCUS_01130 32791 32045 gene locus_tag LOCUS_01140 32791 32045 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903463.1 protein_id gnl|my_center|LOCUS_01140 33626 32775 gene locus_tag LOCUS_01150 33626 32775 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_01150 34608 33619 gene locus_tag LOCUS_01160 gene holB 34608 33619 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 protein_id gnl|my_center|LOCUS_01160 35241 34609 gene locus_tag LOCUS_01170 gene tmk 35241 34609 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243137.1 protein_id gnl|my_center|LOCUS_01170 36061 35333 gene locus_tag LOCUS_01180 gene truA 36061 35333 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001995175.1 protein_id gnl|my_center|LOCUS_01180 37055 36051 gene locus_tag LOCUS_01190 37055 36051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 37917 37048 gene locus_tag LOCUS_01200 37917 37048 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982066.1 protein_id gnl|my_center|LOCUS_01200 38702 37893 gene locus_tag LOCUS_01210 38702 37893 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476335.1 protein_id gnl|my_center|LOCUS_01210 39140 38712 gene locus_tag LOCUS_01220 39140 38712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 39878 39228 gene locus_tag LOCUS_01230 39878 39228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 40567 39962 gene locus_tag LOCUS_01240 40567 39962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 41206 40577 gene locus_tag LOCUS_01250 41206 40577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 41408 41208 gene locus_tag LOCUS_01260 41408 41208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 42092 41493 gene locus_tag LOCUS_01270 42092 41493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 42784 42236 gene locus_tag LOCUS_01280 42784 42236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 43474 42926 gene locus_tag LOCUS_01290 43474 42926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 43957 43502 gene locus_tag LOCUS_01300 43957 43502 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016851.1 protein_id gnl|my_center|LOCUS_01300 45059 44061 gene locus_tag LOCUS_01310 45059 44061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 46035 45079 gene locus_tag LOCUS_01320 46035 45079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 46557 46189 gene locus_tag LOCUS_01330 gene rplQ 46557 46189 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225836.1 protein_id gnl|my_center|LOCUS_01330 47607 46567 gene locus_tag LOCUS_01340 gene rpoA 47607 46567 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569643.1 protein_id gnl|my_center|LOCUS_01340 48038 47646 gene locus_tag LOCUS_01350 gene rpsK 48038 47646 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356226.1 protein_id gnl|my_center|LOCUS_01350 48418 48053 gene locus_tag LOCUS_01360 gene rpsM 48418 48053 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936622.1 protein_id gnl|my_center|LOCUS_01360 48614 48435 gene locus_tag LOCUS_01370 48614 48435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 48792 48574 gene locus_tag LOCUS_01380 gene infA 48792 48574 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_01380 49549 48785 gene locus_tag LOCUS_01390 gene map 49549 48785 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_01390 50195 49536 gene locus_tag LOCUS_01400 50195 49536 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357697.1 protein_id gnl|my_center|LOCUS_01400 51544 50195 gene locus_tag LOCUS_01410 gene secY 51544 50195 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490114.1 protein_id gnl|my_center|LOCUS_01410 51984 51544 gene locus_tag LOCUS_01420 gene rplO 51984 51544 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_01420 52181 51996 gene locus_tag LOCUS_01430 gene rpmD 52181 51996 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888745.1 protein_id gnl|my_center|LOCUS_01430 52792 52184 gene locus_tag LOCUS_01440 gene rpsE 52792 52184 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129922.1 protein_id gnl|my_center|LOCUS_01440 53155 52802 gene locus_tag LOCUS_01450 gene rplR 53155 52802 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_01450 53697 53164 gene locus_tag LOCUS_01460 gene rplF 53697 53164 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086558.1 protein_id gnl|my_center|LOCUS_01460 54109 53708 gene locus_tag LOCUS_01470 gene rpsH 54109 53708 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178881.1 protein_id gnl|my_center|LOCUS_01470 54308 54123 gene locus_tag LOCUS_01480 gene rpsN 54308 54123 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085700.1 protein_id gnl|my_center|LOCUS_01480 54858 54319 gene locus_tag LOCUS_01490 gene rplE 54858 54319 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080831.1 protein_id gnl|my_center|LOCUS_01490 55187 54867 gene locus_tag LOCUS_01500 gene rplX 55187 54867 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356212.1 protein_id gnl|my_center|LOCUS_01500 55566 55198 gene locus_tag LOCUS_01510 gene rplN 55566 55198 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615912.1 protein_id gnl|my_center|LOCUS_01510 55840 55580 gene locus_tag LOCUS_01520 gene rpsQ 55840 55580 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_01520 56108 55848 gene locus_tag LOCUS_01530 56108 55848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 56527 56108 gene locus_tag LOCUS_01540 gene rplP 56527 56108 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166906.1 protein_id gnl|my_center|LOCUS_01540 57213 56530 gene locus_tag LOCUS_01550 gene rpsC 57213 56530 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720944.1 protein_id gnl|my_center|LOCUS_01550 57567 57220 gene locus_tag LOCUS_01560 gene rplV 57567 57220 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_01560 57845 57570 gene locus_tag LOCUS_01570 gene rpsS 57845 57570 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356205.1 protein_id gnl|my_center|LOCUS_01570 58690 57857 gene locus_tag LOCUS_01580 gene rplB 58690 57857 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936663.1 protein_id gnl|my_center|LOCUS_01580 58981 58700 gene locus_tag LOCUS_01590 gene rplW 58981 58700 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_01590 59628 58981 gene locus_tag LOCUS_01600 gene rplD 59628 58981 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_01600 60302 59631 gene locus_tag LOCUS_01610 gene rplC 60302 59631 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399671.1 protein_id gnl|my_center|LOCUS_01610 60626 60312 gene locus_tag LOCUS_01620 gene rpsJ 60626 60312 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567567.1 protein_id gnl|my_center|LOCUS_01620 65715 60868 gene locus_tag LOCUS_01630 65715 60868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence003 567 1292 gene locus_tag LOCUS_01640 567 1292 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016603.1 protein_id gnl|my_center|LOCUS_01640 1372 1644 gene locus_tag LOCUS_01650 gene rpsP 1372 1644 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268750.1 protein_id gnl|my_center|LOCUS_01650 1647 1898 gene locus_tag LOCUS_01660 1647 1898 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391865.1 protein_id gnl|my_center|LOCUS_01660 1901 2392 gene locus_tag LOCUS_01670 gene rimM 1901 2392 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_01670 2389 3114 gene locus_tag LOCUS_01680 gene trmD 2389 3114 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_01680 3163 3516 gene locus_tag LOCUS_01690 gene rplS 3163 3516 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_01690 3637 4653 gene locus_tag LOCUS_01700 gene ccpA 3637 4653 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727369.1 protein_id gnl|my_center|LOCUS_01700 4728 5990 gene locus_tag LOCUS_01710 gene tyrS 4728 5990 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_01710 7010 6012 gene locus_tag LOCUS_01720 gene trpS 7010 6012 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_01720 7272 9635 gene locus_tag LOCUS_01730 7272 9635 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748873.1 protein_id gnl|my_center|LOCUS_01730 9739 10965 gene locus_tag LOCUS_01740 9739 10965 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644204.1 protein_id gnl|my_center|LOCUS_01740 10976 11980 gene locus_tag LOCUS_01750 10976 11980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_01750 11988 13658 gene locus_tag LOCUS_01760 11988 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 13651 15195 gene locus_tag LOCUS_01770 13651 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 15292 15627 gene locus_tag LOCUS_01780 15292 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 15629 17668 gene locus_tag LOCUS_01790 15629 17668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 17727 18164 gene locus_tag LOCUS_01800 gene spxA 17727 18164 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254213.1 protein_id gnl|my_center|LOCUS_01800 18754 18191 gene locus_tag LOCUS_01810 18754 18191 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232924.1 protein_id gnl|my_center|LOCUS_01810 18856 19530 gene locus_tag LOCUS_01820 18856 19530 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360523.1 protein_id gnl|my_center|LOCUS_01820 19533 20282 gene locus_tag LOCUS_01830 19533 20282 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106785139.1 protein_id gnl|my_center|LOCUS_01830 20556 21587 gene locus_tag LOCUS_01840 gene pheS 20556 21587 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398818.1 protein_id gnl|my_center|LOCUS_01840 21597 23990 gene locus_tag LOCUS_01850 gene pheT 21597 23990 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398979.1 protein_id gnl|my_center|LOCUS_01850 25086 24070 gene locus_tag LOCUS_01860 25086 24070 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426117.1 protein_id gnl|my_center|LOCUS_01860 25350 26015 gene locus_tag LOCUS_01870 25350 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 26931 26041 gene locus_tag LOCUS_01880 26931 26041 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990127.1 protein_id gnl|my_center|LOCUS_01880 27011 27862 gene locus_tag LOCUS_01890 27011 27862 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 protein_id gnl|my_center|LOCUS_01890 27909 28466 gene locus_tag LOCUS_01900 gene efp 27909 28466 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699839.1 protein_id gnl|my_center|LOCUS_01900 28470 29240 gene locus_tag LOCUS_01910 28470 29240 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578368.1 protein_id gnl|my_center|LOCUS_01910 29327 29734 gene locus_tag LOCUS_01920 29327 29734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 29736 31712 gene locus_tag LOCUS_01930 gene tkt 29736 31712 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989730.1 protein_id gnl|my_center|LOCUS_01930 31781 33136 gene locus_tag LOCUS_01940 gene pepV 31781 33136 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001274265.1 protein_id gnl|my_center|LOCUS_01940 33138 34829 gene locus_tag LOCUS_01950 33138 34829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 34826 35341 gene locus_tag LOCUS_01960 34826 35341 CDS product DUF84 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869966.1 protein_id gnl|my_center|LOCUS_01960 35338 35889 gene locus_tag LOCUS_01970 35338 35889 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_01970 36126 38513 gene locus_tag LOCUS_01980 36126 38513 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_01980 38678 38959 gene locus_tag LOCUS_01990 gene rpsF 38678 38959 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233779.1 protein_id gnl|my_center|LOCUS_01990 38962 39423 gene locus_tag LOCUS_02000 gene ssb 38962 39423 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981966.1 protein_id gnl|my_center|LOCUS_02000 39437 39658 gene locus_tag LOCUS_02010 gene rpsR 39437 39658 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 protein_id gnl|my_center|LOCUS_02010 39936 42188 gene locus_tag LOCUS_02020 39936 42188 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113900.1 protein_id gnl|my_center|LOCUS_02020 42191 43519 gene locus_tag LOCUS_02030 gene dnaB 42191 43519 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_02030 43519 44586 gene locus_tag LOCUS_02040 gene prfA 43519 44586 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475834.1 protein_id gnl|my_center|LOCUS_02040 44586 45416 gene locus_tag LOCUS_02050 gene prmC 44586 45416 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104948.1 protein_id gnl|my_center|LOCUS_02050 45400 46350 gene locus_tag LOCUS_02060 45400 46350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 46338 46919 gene locus_tag LOCUS_02070 46338 46919 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_02070 46985 47614 gene locus_tag LOCUS_02080 gene upp 46985 47614 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_02080 47586 48119 gene locus_tag LOCUS_02090 47586 48119 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_02090 48112 48345 gene locus_tag LOCUS_02100 48112 48345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 48963 48373 gene locus_tag LOCUS_02110 48963 48373 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357285.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence004 1066 3603 gene locus_tag LOCUS_02120 1066 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 3613 4047 gene locus_tag LOCUS_02130 3613 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 4063 4365 gene locus_tag LOCUS_02140 4063 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 4407 5630 gene locus_tag LOCUS_02150 gene hflX 4407 5630 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391877.1 protein_id gnl|my_center|LOCUS_02150 6338 5655 gene locus_tag LOCUS_02160 6338 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 7474 6335 gene locus_tag LOCUS_02170 gene nagA 7474 6335 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_02170 8700 7471 gene locus_tag LOCUS_02180 8700 7471 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975110.1 protein_id gnl|my_center|LOCUS_02180 10477 8711 gene locus_tag LOCUS_02190 10477 8711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 11703 10564 gene locus_tag LOCUS_02200 gene dxr 11703 10564 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790373.1 protein_id gnl|my_center|LOCUS_02200 12612 11716 gene locus_tag LOCUS_02210 12612 11716 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183183.1 protein_id gnl|my_center|LOCUS_02210 13277 12609 gene locus_tag LOCUS_02220 13277 12609 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_02220 13401 14123 gene locus_tag LOCUS_02230 gene pyrH 13401 14123 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965095.1 protein_id gnl|my_center|LOCUS_02230 14123 14686 gene locus_tag LOCUS_02240 gene frr 14123 14686 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339966.1 protein_id gnl|my_center|LOCUS_02240 14771 15337 gene locus_tag LOCUS_02250 14771 15337 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_02250 16256 15420 gene locus_tag LOCUS_02260 gene tsf 16256 15420 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699817.1 protein_id gnl|my_center|LOCUS_02260 17635 16256 gene locus_tag LOCUS_02270 17635 16256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 18246 17794 gene locus_tag LOCUS_02280 18246 17794 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733108.1 protein_id gnl|my_center|LOCUS_02280 19159 18239 gene locus_tag LOCUS_02290 gene xerC 19159 18239 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101227.1 protein_id gnl|my_center|LOCUS_02290 20447 19152 gene locus_tag LOCUS_02300 gene trmFO 20447 19152 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989721.1 protein_id gnl|my_center|LOCUS_02300 21431 20514 gene locus_tag LOCUS_02310 21431 20514 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966719.1 protein_id gnl|my_center|LOCUS_02310 22162 21431 gene locus_tag LOCUS_02320 22162 21431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 24146 22242 gene locus_tag LOCUS_02330 gene thrS 24146 22242 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213295.1 protein_id gnl|my_center|LOCUS_02330 25254 24433 gene locus_tag LOCUS_02340 gene dnaI 25254 24433 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475785.1 protein_id gnl|my_center|LOCUS_02340 26567 25260 gene locus_tag LOCUS_02350 26567 25260 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415039.1 protein_id gnl|my_center|LOCUS_02350 26939 26577 gene locus_tag LOCUS_02360 26939 26577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 27510 26941 gene locus_tag LOCUS_02370 gene coaE 27510 26941 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438041.1 protein_id gnl|my_center|LOCUS_02370 28334 27513 gene locus_tag LOCUS_02380 gene mutM 28334 27513 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114478.1 protein_id gnl|my_center|LOCUS_02380 28836 28336 gene locus_tag LOCUS_02390 28836 28336 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879756.1 protein_id gnl|my_center|LOCUS_02390 31469 28848 gene locus_tag LOCUS_02400 gene polA 31469 28848 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398870.1 protein_id gnl|my_center|LOCUS_02400 31583 32968 gene locus_tag LOCUS_02410 31583 32968 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681109.1 protein_id gnl|my_center|LOCUS_02410 33093 34424 gene locus_tag LOCUS_02420 33093 34424 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062283476.1 protein_id gnl|my_center|LOCUS_02420 34436 35098 gene locus_tag LOCUS_02430 34436 35098 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547171.1 protein_id gnl|my_center|LOCUS_02430 35100 35546 gene locus_tag LOCUS_02440 35100 35546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 36330 35563 gene locus_tag LOCUS_02450 36330 35563 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_02450 37775 36540 gene locus_tag LOCUS_02460 37775 36540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 38548 37772 gene locus_tag LOCUS_02470 38548 37772 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_02470 39978 38545 gene locus_tag LOCUS_02480 gene miaB 39978 38545 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244831.1 protein_id gnl|my_center|LOCUS_02480 40481 40122 gene locus_tag LOCUS_02490 40481 40122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 41854 40493 gene locus_tag LOCUS_02500 41854 40493 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_02500 42159 43199 gene locus_tag LOCUS_02510 42159 43199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 43770 43192 gene locus_tag LOCUS_02520 43770 43192 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124550.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence005 130 441 gene locus_tag LOCUS_02530 130 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 1184 474 gene locus_tag LOCUS_02540 1184 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2601 1288 gene locus_tag LOCUS_02550 gene eno 2601 1288 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103955.1 protein_id gnl|my_center|LOCUS_02550 4127 2601 gene locus_tag LOCUS_02560 gene gpmI 4127 2601 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228330.1 protein_id gnl|my_center|LOCUS_02560 4831 4214 gene locus_tag LOCUS_02570 4831 4214 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 protein_id gnl|my_center|LOCUS_02570 6130 4985 gene locus_tag LOCUS_02580 gene ftsZ 6130 4985 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 protein_id gnl|my_center|LOCUS_02580 7096 6197 gene locus_tag LOCUS_02590 7096 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 8237 7107 gene locus_tag LOCUS_02600 gene tgt 8237 7107 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229725.1 protein_id gnl|my_center|LOCUS_02600 9272 8247 gene locus_tag LOCUS_02610 gene queA 9272 8247 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_02610 10257 9256 gene locus_tag LOCUS_02620 gene ruvB 10257 9256 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546115.1 protein_id gnl|my_center|LOCUS_02620 10311 10868 gene locus_tag LOCUS_02630 gene ruvA 10311 10868 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309787.1 protein_id gnl|my_center|LOCUS_02630 12304 10898 gene locus_tag LOCUS_02640 gene ffh 12304 10898 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547873.1 protein_id gnl|my_center|LOCUS_02640 12626 12315 gene locus_tag LOCUS_02650 12626 12315 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891062.1 protein_id gnl|my_center|LOCUS_02650 13603 12626 gene locus_tag LOCUS_02660 gene ftsY 13603 12626 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_02660 15658 13676 gene locus_tag LOCUS_02670 gene topA 15658 13676 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001557331.1 protein_id gnl|my_center|LOCUS_02670 16351 15746 gene locus_tag LOCUS_02680 gene rnhB 16351 15746 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021956.1 protein_id gnl|my_center|LOCUS_02680 17178 16348 gene locus_tag LOCUS_02690 gene ylqF 17178 16348 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700107.1 protein_id gnl|my_center|LOCUS_02690 17975 17181 gene locus_tag LOCUS_02700 17975 17181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 20077 17975 gene locus_tag LOCUS_02710 20077 17975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 20219 21046 gene locus_tag LOCUS_02720 gene yitU 20219 21046 CDS product 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YitU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233007.1 protein_id gnl|my_center|LOCUS_02720 23660 21075 gene locus_tag LOCUS_02730 23660 21075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 24433 23657 gene locus_tag LOCUS_02740 gene recX 24433 23657 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704972.1 protein_id gnl|my_center|LOCUS_02740 25343 24417 gene locus_tag LOCUS_02750 25343 24417 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722640.1 protein_id gnl|my_center|LOCUS_02750 26450 25347 gene locus_tag LOCUS_02760 gene prfB 26450 25347 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_02760 28964 26454 gene locus_tag LOCUS_02770 gene secA 28964 26454 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228033.1 protein_id gnl|my_center|LOCUS_02770 32361 29077 gene locus_tag LOCUS_02780 32361 29077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 33012 32455 gene locus_tag LOCUS_02790 gene raiA 33012 32455 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_02790 33395 33075 gene locus_tag LOCUS_02800 33395 33075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 33852 33481 gene locus_tag LOCUS_02810 gene rplL 33852 33481 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_02810 34358 33864 gene locus_tag LOCUS_02820 gene rplJ 34358 33864 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 protein_id gnl|my_center|LOCUS_02820 35234 34527 gene locus_tag LOCUS_02830 gene rplA 35234 34527 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235040.1 protein_id gnl|my_center|LOCUS_02830 35740 35312 gene locus_tag LOCUS_02840 gene rplK 35740 35312 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141598.1 protein_id gnl|my_center|LOCUS_02840 36590 35925 gene locus_tag LOCUS_02850 36590 35925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 38347 36593 gene locus_tag LOCUS_02860 38347 36593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 38465 38920 gene locus_tag LOCUS_02870 38465 38920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 39551 38997 gene locus_tag LOCUS_02880 gene nusG 39551 38997 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415794.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence006 1514 2053 gene locus_tag LOCUS_02890 1514 2053 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_02890 2336 2121 gene locus_tag LOCUS_02900 gene rpmE 2336 2121 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933240.1 protein_id gnl|my_center|LOCUS_02900 2565 3152 gene locus_tag LOCUS_02910 2565 3152 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243018.1 protein_id gnl|my_center|LOCUS_02910 3142 3591 gene locus_tag LOCUS_02920 gene tadA 3142 3591 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_02920 3769 4737 gene locus_tag LOCUS_02930 gene dusB 3769 4737 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290055.1 protein_id gnl|my_center|LOCUS_02930 4724 5998 gene locus_tag LOCUS_02940 gene lysA 4724 5998 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902969.1 protein_id gnl|my_center|LOCUS_02940 5998 6885 gene locus_tag LOCUS_02950 5998 6885 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_02950 6885 7982 gene locus_tag LOCUS_02960 6885 7982 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963505.1 protein_id gnl|my_center|LOCUS_02960 7972 8949 gene locus_tag LOCUS_02970 7972 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 8946 10229 gene locus_tag LOCUS_02980 8946 10229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 10336 12198 gene locus_tag LOCUS_02990 10336 12198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 12191 15451 gene locus_tag LOCUS_03000 12191 15451 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_03000 15454 16449 gene locus_tag LOCUS_03010 15454 16449 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_03010 16449 17444 gene locus_tag LOCUS_03020 16449 17444 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583940.1 protein_id gnl|my_center|LOCUS_03020 17448 19229 gene locus_tag LOCUS_03030 17448 19229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 19229 19954 gene locus_tag LOCUS_03040 19229 19954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 19970 23923 gene locus_tag LOCUS_03050 19970 23923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 23926 25161 gene locus_tag LOCUS_03060 23926 25161 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_03060 25151 26185 gene locus_tag LOCUS_03070 25151 26185 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_03070 26240 28501 gene locus_tag LOCUS_03080 26240 28501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 28498 29454 gene locus_tag LOCUS_03090 28498 29454 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963508.1 protein_id gnl|my_center|LOCUS_03090 29560 32745 gene locus_tag LOCUS_03100 29560 32745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 >Feature sequence007 1674 157 gene locus_tag LOCUS_03110 gene nupO 1674 157 CDS product guanosine ABC transporter ATP-binding protein NupO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228830.1 protein_id gnl|my_center|LOCUS_03110 2980 1745 gene locus_tag LOCUS_03120 2980 1745 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_03120 3564 2995 gene locus_tag LOCUS_03130 3564 2995 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866483.1 protein_id gnl|my_center|LOCUS_03130 3958 3866 gene locus_tag LOCUS_t00010 3958 3866 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4554 4039 gene locus_tag LOCUS_03140 4554 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 5492 4533 gene locus_tag LOCUS_03150 gene whiA 5492 4533 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546596.1 protein_id gnl|my_center|LOCUS_03150 6388 5489 gene locus_tag LOCUS_03160 gene trxB 6388 5489 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000272302.1 protein_id gnl|my_center|LOCUS_03160 7339 6389 gene locus_tag LOCUS_03170 gene lgt 7339 6389 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922849.1 protein_id gnl|my_center|LOCUS_03170 10215 7402 gene locus_tag LOCUS_03180 gene uvrA 10215 7402 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485563.1 protein_id gnl|my_center|LOCUS_03180 12194 10224 gene locus_tag LOCUS_03190 gene ligA 12194 10224 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031450.1 protein_id gnl|my_center|LOCUS_03190 13429 12287 gene locus_tag LOCUS_03200 13429 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 13959 13426 gene locus_tag LOCUS_03210 13959 13426 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869257.1 protein_id gnl|my_center|LOCUS_03210 14996 14037 gene locus_tag LOCUS_03220 14996 14037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 17224 15119 gene locus_tag LOCUS_03230 17224 15119 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898558.1 protein_id gnl|my_center|LOCUS_03230 18858 17233 gene locus_tag LOCUS_03240 18858 17233 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_03240 19525 18863 gene locus_tag LOCUS_03250 19525 18863 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_03250 21822 19528 gene locus_tag LOCUS_03260 21822 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 23260 21839 gene locus_tag LOCUS_03270 23260 21839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 24497 23253 gene locus_tag LOCUS_03280 24497 23253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 26007 24952 gene locus_tag LOCUS_03290 26007 24952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 27027 26068 gene locus_tag LOCUS_03300 gene tsaD 27027 26068 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414585.1 protein_id gnl|my_center|LOCUS_03300 27479 27024 gene locus_tag LOCUS_03310 gene rimI 27479 27024 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583327.1 protein_id gnl|my_center|LOCUS_03310 28055 27480 gene locus_tag LOCUS_03320 28055 27480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 28501 28052 gene locus_tag LOCUS_03330 gene tsaE 28501 28052 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049642.1 protein_id gnl|my_center|LOCUS_03330 29027 28575 gene locus_tag LOCUS_03340 29027 28575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 29268 29038 gene locus_tag LOCUS_03350 29268 29038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 30431 29307 gene locus_tag LOCUS_03360 gene ispD 30431 29307 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_03360 30940 30434 gene locus_tag LOCUS_03370 30940 30434 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881124.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence008 220 29 gene locus_tag LOCUS_03380 gene rpmB 220 29 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124776.1 protein_id gnl|my_center|LOCUS_03380 595 2271 gene locus_tag LOCUS_03390 595 2271 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245033.1 protein_id gnl|my_center|LOCUS_03390 2318 4345 gene locus_tag LOCUS_03400 gene recG 2318 4345 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151509.1 protein_id gnl|my_center|LOCUS_03400 4354 5355 gene locus_tag LOCUS_03410 gene plsX 4354 5355 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000239753.1 protein_id gnl|my_center|LOCUS_03410 5348 6031 gene locus_tag LOCUS_03420 gene rnc 5348 6031 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830158.1 protein_id gnl|my_center|LOCUS_03420 6042 6656 gene locus_tag LOCUS_03430 6042 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 6643 7272 gene locus_tag LOCUS_03440 gene nth 6643 7272 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130627.1 protein_id gnl|my_center|LOCUS_03440 8847 7273 gene locus_tag LOCUS_03450 gene pavA 8847 7273 CDS product Rqc2 family fibronectin-binding protein PavA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006695.1 protein_id gnl|my_center|LOCUS_03450 8983 9603 gene locus_tag LOCUS_03460 gene gmk 8983 9603 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287358.1 protein_id gnl|my_center|LOCUS_03460 9603 9854 gene locus_tag LOCUS_03470 9603 9854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 9968 10834 gene locus_tag LOCUS_03480 9968 10834 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964831.1 protein_id gnl|my_center|LOCUS_03480 10831 13131 gene locus_tag LOCUS_03490 gene priA 10831 13131 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547921.1 protein_id gnl|my_center|LOCUS_03490 13142 14071 gene locus_tag LOCUS_03500 gene fmt 13142 14071 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439455.1 protein_id gnl|my_center|LOCUS_03500 14068 14634 gene locus_tag LOCUS_03510 14068 14634 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230797.1 protein_id gnl|my_center|LOCUS_03510 15315 14650 gene locus_tag LOCUS_03520 15315 14650 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965071.1 protein_id gnl|my_center|LOCUS_03520 15439 16629 gene locus_tag LOCUS_03530 15439 16629 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422058.1 protein_id gnl|my_center|LOCUS_03530 16653 17888 gene locus_tag LOCUS_03540 16653 17888 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_03540 18395 17907 gene locus_tag LOCUS_03550 gene coaD 18395 17907 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545514.1 protein_id gnl|my_center|LOCUS_03550 18521 19972 gene locus_tag LOCUS_03560 gene gltX 18521 19972 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_03560 19986 21377 gene locus_tag LOCUS_03570 19986 21377 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_03570 21379 22692 gene locus_tag LOCUS_03580 21379 22692 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_03580 22695 23876 gene locus_tag LOCUS_03590 gene metK 22695 23876 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_03590 24041 28108 gene locus_tag LOCUS_03600 24041 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence009 <1 1195 gene locus_tag LOCUS_03610 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393449.1:ABC transporter permease 1182 2186 gene locus_tag LOCUS_03620 1182 2186 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_03620 2359 3912 gene locus_tag LOCUS_03630 2359 3912 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874412.1 protein_id gnl|my_center|LOCUS_03630 3899 4717 gene locus_tag LOCUS_03640 3899 4717 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_03640 4714 5556 gene locus_tag LOCUS_03650 4714 5556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964156.1 protein_id gnl|my_center|LOCUS_03650 5553 6638 gene locus_tag LOCUS_03660 5553 6638 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_03660 6635 6955 gene locus_tag LOCUS_03670 6635 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 7077 6995 gene locus_tag LOCUS_t00020 7077 6995 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7162 7087 gene locus_tag LOCUS_t00030 7162 7087 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7240 7167 gene locus_tag LOCUS_t00040 7240 7167 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 7365 7580 gene locus_tag LOCUS_03680 7365 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 7637 9265 gene locus_tag LOCUS_03690 7637 9265 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001985392.1 protein_id gnl|my_center|LOCUS_03690 9385 9461 gene locus_tag LOCUS_t00050 9385 9461 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9520 9596 gene locus_tag LOCUS_t00060 9520 9596 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9598 9671 gene locus_tag LOCUS_t00070 9598 9671 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9805 10122 gene locus_tag LOCUS_03700 9805 10122 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_03700 10119 10712 gene locus_tag LOCUS_03710 10119 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 10718 11680 gene locus_tag LOCUS_03720 10718 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 11942 12015 gene locus_tag LOCUS_t00080 11942 12015 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12045 12917 gene locus_tag LOCUS_03730 12045 12917 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_03730 12946 15357 gene locus_tag LOCUS_03740 12946 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 15478 16155 gene locus_tag LOCUS_03750 15478 16155 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_03750 16161 16529 gene locus_tag LOCUS_03760 gene perR 16161 16529 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830391.1 protein_id gnl|my_center|LOCUS_03760 16693 17103 gene locus_tag LOCUS_03770 16693 17103 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966974.1 protein_id gnl|my_center|LOCUS_03770 17189 18052 gene locus_tag LOCUS_03780 17189 18052 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966614.1 protein_id gnl|my_center|LOCUS_03780 18152 18412 gene locus_tag LOCUS_03790 18152 18412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 18405 20657 gene locus_tag LOCUS_03800 gene feoB 18405 20657 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_03800 20654 20842 gene locus_tag LOCUS_03810 20654 20842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 20835 21212 gene locus_tag LOCUS_03820 20835 21212 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_03820 21266 21820 gene locus_tag LOCUS_03830 gene mscL 21266 21820 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383048.1 protein_id gnl|my_center|LOCUS_03830 21907 23334 gene locus_tag LOCUS_03840 21907 23334 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964320.1 protein_id gnl|my_center|LOCUS_03840 23345 23878 gene locus_tag LOCUS_03850 gene gmk 23345 23878 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599646.1 protein_id gnl|my_center|LOCUS_03850 23875 26454 gene locus_tag LOCUS_03860 23875 26454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 26465 27040 gene locus_tag LOCUS_03870 26465 27040 CDS product phosphate propanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865105.1 protein_id gnl|my_center|LOCUS_03870 27101 27177 gene locus_tag LOCUS_t00090 27101 27177 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 1273 74 gene locus_tag LOCUS_03880 1273 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 1400 1588 gene locus_tag LOCUS_03890 1400 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1588 3858 gene locus_tag LOCUS_03900 1588 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3860 4252 gene locus_tag LOCUS_03910 3860 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4518 4901 gene locus_tag LOCUS_03920 4518 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 4831 5049 gene locus_tag LOCUS_03930 4831 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 5106 5309 gene locus_tag LOCUS_03940 5106 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 5293 6624 gene locus_tag LOCUS_03950 5293 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6602 8170 gene locus_tag LOCUS_03960 6602 8170 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_03960 8814 8462 gene locus_tag LOCUS_tm00010 8814 8462 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9186 8815 gene locus_tag LOCUS_03970 9186 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 9637 9188 gene locus_tag LOCUS_03980 gene smpB 9637 9188 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723350.1 protein_id gnl|my_center|LOCUS_03980 11667 9646 gene locus_tag LOCUS_03990 gene rnr 11667 9646 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387150.1 protein_id gnl|my_center|LOCUS_03990 11958 11722 gene locus_tag LOCUS_04000 11958 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 14358 12040 gene locus_tag LOCUS_04010 gene lon 14358 12040 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229618.1 protein_id gnl|my_center|LOCUS_04010 15701 14409 gene locus_tag LOCUS_04020 gene tig 15701 14409 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729253.1 protein_id gnl|my_center|LOCUS_04020 16184 15771 gene locus_tag LOCUS_04030 16184 15771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 17822 16269 gene locus_tag LOCUS_04040 17822 16269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 18779 17835 gene locus_tag LOCUS_04050 18779 17835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 18941 19540 gene locus_tag LOCUS_04060 18941 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 19688 19612 gene locus_tag LOCUS_t00100 19688 19612 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20336 19782 gene locus_tag LOCUS_04070 gene rsmD 20336 19782 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546846.1 protein_id gnl|my_center|LOCUS_04070 20681 20337 gene locus_tag LOCUS_04080 20681 20337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 21619 20726 gene locus_tag LOCUS_04090 21619 20726 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435130.1 protein_id gnl|my_center|LOCUS_04090 23616 21688 gene locus_tag LOCUS_04100 23616 21688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_04100 25418 23613 gene locus_tag LOCUS_04110 25418 23613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_04110 >Feature sequence011 694 1308 gene locus_tag LOCUS_04120 694 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 1280 1954 gene locus_tag LOCUS_04130 1280 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2146 2679 gene locus_tag LOCUS_04140 gene infC 2146 2679 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_031267356.1 protein_id gnl|my_center|LOCUS_04140 2699 2908 gene locus_tag LOCUS_04150 2699 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2910 3269 gene locus_tag LOCUS_04160 gene rplT 2910 3269 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289310.1 protein_id gnl|my_center|LOCUS_04160 3373 5043 gene locus_tag LOCUS_04170 3373 5043 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_04170 4985 5476 gene locus_tag LOCUS_04180 4985 5476 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797099.1 protein_id gnl|my_center|LOCUS_04180 5473 6951 gene locus_tag LOCUS_04190 gene glpK 5473 6951 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896469.1 protein_id gnl|my_center|LOCUS_04190 6973 8649 gene locus_tag LOCUS_04200 6973 8649 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052590.1 protein_id gnl|my_center|LOCUS_04200 8649 11345 gene locus_tag LOCUS_04210 gene alaS 8649 11345 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246158.1 protein_id gnl|my_center|LOCUS_04210 11342 11752 gene locus_tag LOCUS_04220 gene ruvX 11342 11752 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939059.1 protein_id gnl|my_center|LOCUS_04220 11775 12281 gene locus_tag LOCUS_04230 11775 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 13334 12336 gene locus_tag LOCUS_04240 13334 12336 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256628.1 protein_id gnl|my_center|LOCUS_04240 14458 13334 gene locus_tag LOCUS_04250 14458 13334 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_04250 14550 15980 gene locus_tag LOCUS_04260 14550 15980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 15964 18891 gene locus_tag LOCUS_04270 15964 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 19020 19448 gene locus_tag LOCUS_04280 gene glmS 19020 19448 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816944.1 protein_id gnl|my_center|LOCUS_04280 19445 20821 gene locus_tag LOCUS_04290 gene glmL 19445 20821 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682340.1 protein_id gnl|my_center|LOCUS_04290 20818 22281 gene locus_tag LOCUS_04300 20818 22281 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680091.1 protein_id gnl|my_center|LOCUS_04300 22281 23525 gene locus_tag LOCUS_04310 22281 23525 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_04310 23522 23767 gene locus_tag LOCUS_04320 23522 23767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence012 71 1423 gene locus_tag LOCUS_04330 gene xseA 71 1423 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990104.1 protein_id gnl|my_center|LOCUS_04330 1413 1595 gene locus_tag LOCUS_04340 1413 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 1597 3375 gene locus_tag LOCUS_04350 gene dxs 1597 3375 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366447.1 protein_id gnl|my_center|LOCUS_04350 3385 5028 gene locus_tag LOCUS_04360 gene recN 3385 5028 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_04360 5248 5057 gene locus_tag LOCUS_04370 5248 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5313 6524 gene locus_tag LOCUS_04380 5313 6524 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208841.1 protein_id gnl|my_center|LOCUS_04380 6508 7359 gene locus_tag LOCUS_04390 6508 7359 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281259.1 protein_id gnl|my_center|LOCUS_04390 7545 8801 gene locus_tag LOCUS_04400 gene hisS 7545 8801 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830876.1 protein_id gnl|my_center|LOCUS_04400 8798 10558 gene locus_tag LOCUS_04410 gene aspS 8798 10558 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_04410 10567 10824 gene locus_tag LOCUS_04420 10567 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 10811 11281 gene locus_tag LOCUS_04430 10811 11281 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_04430 11377 12387 gene locus_tag LOCUS_04440 11377 12387 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020751561.1 protein_id gnl|my_center|LOCUS_04440 12387 12836 gene locus_tag LOCUS_04450 12387 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 12838 13311 gene locus_tag LOCUS_04460 gene lspA 12838 13311 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565533.1 protein_id gnl|my_center|LOCUS_04460 13308 14201 gene locus_tag LOCUS_04470 13308 14201 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 protein_id gnl|my_center|LOCUS_04470 15068 14220 gene locus_tag LOCUS_04480 gene rnhC 15068 14220 CDS product ribonuclease HIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071591.1 protein_id gnl|my_center|LOCUS_04480 15127 17451 gene locus_tag LOCUS_04490 15127 17451 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833037.1 protein_id gnl|my_center|LOCUS_04490 17510 18880 gene locus_tag LOCUS_04500 17510 18880 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931023.1 protein_id gnl|my_center|LOCUS_04500 18910 19560 gene locus_tag LOCUS_04510 gene ung 18910 19560 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_04510 19736 20320 gene locus_tag LOCUS_04520 gene thiT 19736 20320 CDS product energy-coupled thiamine transporter ThiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922072.1 protein_id gnl|my_center|LOCUS_04520 20916 20347 gene locus_tag LOCUS_04530 gene recU 20916 20347 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155594.1 protein_id gnl|my_center|LOCUS_04530 21037 22860 gene locus_tag LOCUS_04540 gene lepA 21037 22860 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078755645.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence013 <1 622 gene locus_tag LOCUS_04550 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438997.1:DegV family protein 754 1602 gene locus_tag LOCUS_04560 754 1602 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438997.1 protein_id gnl|my_center|LOCUS_04560 1712 3766 gene locus_tag LOCUS_04570 gene fusA 1712 3766 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627021.1 protein_id gnl|my_center|LOCUS_04570 3813 4628 gene locus_tag LOCUS_04580 3813 4628 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209981.1 protein_id gnl|my_center|LOCUS_04580 4701 6122 gene locus_tag LOCUS_04590 4701 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 6191 7048 gene locus_tag LOCUS_04600 6191 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7125 7403 gene locus_tag LOCUS_04610 7125 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 7409 7531 gene locus_tag LOCUS_04620 7409 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7643 7930 gene locus_tag LOCUS_04630 7643 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 7911 10331 gene locus_tag LOCUS_04640 gene leuS 7911 10331 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009461.1 protein_id gnl|my_center|LOCUS_04640 10333 13581 gene locus_tag LOCUS_04650 10333 13581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 13583 14167 gene locus_tag LOCUS_04660 13583 14167 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763267.1 protein_id gnl|my_center|LOCUS_04660 14326 17991 gene locus_tag LOCUS_04670 gene rpoB 14326 17991 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389470.1 protein_id gnl|my_center|LOCUS_04670 17995 21732 gene locus_tag LOCUS_04680 gene rpoC 17995 21732 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732839.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence014 340 167 gene locus_tag LOCUS_04690 340 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 648 415 gene locus_tag LOCUS_04700 648 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 1039 794 gene locus_tag LOCUS_04710 1039 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 1806 1627 gene locus_tag LOCUS_04720 1806 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2050 1907 gene locus_tag LOCUS_04730 2050 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4165 3953 gene locus_tag LOCUS_04740 4165 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 5520 5705 gene locus_tag LOCUS_04750 5520 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 5791 6114 gene locus_tag LOCUS_04760 5791 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 6169 6300 gene locus_tag LOCUS_04770 6169 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6690 6878 gene locus_tag LOCUS_04780 6690 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 7203 7415 gene locus_tag LOCUS_04790 7203 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 7541 7735 gene locus_tag LOCUS_04800 7541 7735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 8501 8863 gene locus_tag LOCUS_04810 8501 8863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 8978 9271 gene locus_tag LOCUS_04820 8978 9271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 9896 10279 gene locus_tag LOCUS_04830 9896 10279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 10394 11578 gene locus_tag LOCUS_04840 10394 11578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 11674 12237 gene locus_tag LOCUS_04850 11674 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 12570 12692 gene locus_tag LOCUS_04860 12570 12692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 13071 12919 gene locus_tag LOCUS_04870 13071 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 14210 14422 gene locus_tag LOCUS_04880 14210 14422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 15595 15783 gene locus_tag LOCUS_04890 15595 15783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 15928 16185 gene locus_tag LOCUS_04900 15928 16185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 18847 18095 gene locus_tag LOCUS_04910 18847 18095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 19074 19211 gene locus_tag LOCUS_04920 19074 19211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 19734 19880 gene locus_tag LOCUS_04930 19734 19880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 20663 20292 gene locus_tag LOCUS_04940 20663 20292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 21290 20853 gene locus_tag LOCUS_04950 21290 20853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 21352 21540 gene locus_tag LOCUS_04960 21352 21540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence015 2185 599 gene locus_tag LOCUS_04970 gene rny 2185 599 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000099773.1 protein_id gnl|my_center|LOCUS_04970 3321 2338 gene locus_tag LOCUS_04980 gene recA 3321 2338 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732286.1 protein_id gnl|my_center|LOCUS_04980 3934 3332 gene locus_tag LOCUS_04990 gene pgsA 3934 3332 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_04990 5067 3979 gene locus_tag LOCUS_05000 5067 3979 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_05000 5146 5415 gene locus_tag LOCUS_05010 gene rpsT 5146 5415 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895949.1 protein_id gnl|my_center|LOCUS_05010 6395 5436 gene locus_tag LOCUS_05020 gene holA 6395 5436 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990136.1 protein_id gnl|my_center|LOCUS_05020 8566 6440 gene locus_tag LOCUS_05030 8566 6440 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_05030 9038 8508 gene locus_tag LOCUS_05040 gene comEA 9038 8508 CDS product competence protein ComEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398514.1 protein_id gnl|my_center|LOCUS_05040 9187 11391 gene locus_tag LOCUS_05050 9187 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 13677 11470 gene locus_tag LOCUS_05060 13677 11470 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732598.1 protein_id gnl|my_center|LOCUS_05060 14786 13677 gene locus_tag LOCUS_05070 gene mnmA 14786 13677 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202943733.1 protein_id gnl|my_center|LOCUS_05070 16774 14795 gene locus_tag LOCUS_05080 gene uvrB 16774 14795 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243787.1 protein_id gnl|my_center|LOCUS_05080 17544 16774 gene locus_tag LOCUS_05090 17544 16774 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873338.1 protein_id gnl|my_center|LOCUS_05090 20337 17635 gene locus_tag LOCUS_05100 20337 17635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 21355 20414 gene locus_tag LOCUS_05110 gene yhaM 21355 20414 CDS product 3'-5' exoribonuclease YhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244175.1 protein_id gnl|my_center|LOCUS_05110 22587 21367 gene locus_tag LOCUS_05120 22587 21367 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831104.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence016 313 164 gene locus_tag LOCUS_05130 gene rpmG 313 164 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_05130 916 377 gene locus_tag LOCUS_05140 916 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 1648 944 gene locus_tag LOCUS_05150 gene rlmB 1648 944 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399684.1 protein_id gnl|my_center|LOCUS_05150 2024 1641 gene locus_tag LOCUS_05160 2024 1641 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356056.1 protein_id gnl|my_center|LOCUS_05160 3370 2024 gene locus_tag LOCUS_05170 gene cysS 3370 2024 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631969.1 protein_id gnl|my_center|LOCUS_05170 4834 3398 gene locus_tag LOCUS_05180 4834 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 5492 4821 gene locus_tag LOCUS_05190 5492 4821 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009909965.1 protein_id gnl|my_center|LOCUS_05190 5970 5578 gene locus_tag LOCUS_05200 gene rpsI 5970 5578 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399691.1 protein_id gnl|my_center|LOCUS_05200 6418 5963 gene locus_tag LOCUS_05210 gene rplM 6418 5963 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001250038.1 protein_id gnl|my_center|LOCUS_05210 7160 6573 gene locus_tag LOCUS_05220 7160 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8767 7178 gene locus_tag LOCUS_05230 gene metG 8767 7178 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289325.1 protein_id gnl|my_center|LOCUS_05230 9714 8761 gene locus_tag LOCUS_05240 gene pfkA 9714 8761 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723299.1 protein_id gnl|my_center|LOCUS_05240 12740 9711 gene locus_tag LOCUS_05250 gene dnaE 12740 9711 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673740.1 protein_id gnl|my_center|LOCUS_05250 14121 12814 gene locus_tag LOCUS_05260 14121 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 15033 14140 gene locus_tag LOCUS_05270 15033 14140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 16927 15026 gene locus_tag LOCUS_05280 16927 15026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 18184 16991 gene locus_tag LOCUS_05290 18184 16991 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223511.1 protein_id gnl|my_center|LOCUS_05290 18320 18604 gene locus_tag LOCUS_05300 18320 18604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 20110 18545 gene locus_tag LOCUS_05310 20110 18545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 20982 20194 gene locus_tag LOCUS_05320 20982 20194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence017 131 937 gene locus_tag LOCUS_05330 131 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 927 2069 gene locus_tag LOCUS_05340 927 2069 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679900.1 protein_id gnl|my_center|LOCUS_05340 2081 4702 gene locus_tag LOCUS_05350 2081 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 4702 5619 gene locus_tag LOCUS_05360 4702 5619 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048289.1 protein_id gnl|my_center|LOCUS_05360 5616 6746 gene locus_tag LOCUS_05370 gene anmK 5616 6746 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439909.1 protein_id gnl|my_center|LOCUS_05370 6739 7650 gene locus_tag LOCUS_05380 gene murQ 6739 7650 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892350.1 protein_id gnl|my_center|LOCUS_05380 7634 8368 gene locus_tag LOCUS_05390 7634 8368 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966927.1 protein_id gnl|my_center|LOCUS_05390 8365 9153 gene locus_tag LOCUS_05400 8365 9153 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965836.1 protein_id gnl|my_center|LOCUS_05400 9155 10357 gene locus_tag LOCUS_05410 9155 10357 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965835.1 protein_id gnl|my_center|LOCUS_05410 10350 11741 gene locus_tag LOCUS_05420 10350 11741 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965834.1 protein_id gnl|my_center|LOCUS_05420 11898 19136 gene locus_tag LOCUS_05430 11898 19136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 19293 20252 gene locus_tag LOCUS_05440 gene adhP 19293 20252 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921783.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence018 668 24 gene locus_tag LOCUS_05450 668 24 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183168.1 protein_id gnl|my_center|LOCUS_05450 1956 715 gene locus_tag LOCUS_05460 gene rpoD 1956 715 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226225.1 protein_id gnl|my_center|LOCUS_05460 3704 1971 gene locus_tag LOCUS_05470 3704 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5089 3722 gene locus_tag LOCUS_05480 5089 3722 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_05480 6135 5089 gene locus_tag LOCUS_05490 6135 5089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 7805 6252 gene locus_tag LOCUS_05500 7805 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 8238 7921 gene locus_tag LOCUS_05510 8238 7921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 8809 8240 gene locus_tag LOCUS_05520 gene rsxA 8809 8240 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_05520 9495 8812 gene locus_tag LOCUS_05530 9495 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 11144 9495 gene locus_tag LOCUS_05540 11144 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 12358 11141 gene locus_tag LOCUS_05550 12358 11141 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015691.1 protein_id gnl|my_center|LOCUS_05550 13649 12360 gene locus_tag LOCUS_05560 gene rsxC 13649 12360 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428488.1 protein_id gnl|my_center|LOCUS_05560 14386 13667 gene locus_tag LOCUS_05570 14386 13667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 15278 14379 gene locus_tag LOCUS_05580 gene era 15278 14379 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 protein_id gnl|my_center|LOCUS_05580 15669 15262 gene locus_tag LOCUS_05590 gene cdd 15669 15262 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016798.1 protein_id gnl|my_center|LOCUS_05590 16082 15684 gene locus_tag LOCUS_05600 gene ybeY 16082 15684 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016624.1 protein_id gnl|my_center|LOCUS_05600 17034 16072 gene locus_tag LOCUS_05610 17034 16072 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117767.1 protein_id gnl|my_center|LOCUS_05610 20133 17146 gene locus_tag LOCUS_05620 20133 17146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 >Feature sequence019 1103 960 gene locus_tag LOCUS_05630 1103 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1568 1494 gene locus_tag LOCUS_t00110 1568 1494 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2119 1616 gene locus_tag LOCUS_05640 2119 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2585 2244 gene locus_tag LOCUS_05650 2585 2244 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981888.1 protein_id gnl|my_center|LOCUS_05650 3551 2907 gene locus_tag LOCUS_05660 gene deoD 3551 2907 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_05660 4222 3551 gene locus_tag LOCUS_05670 gene deoC 4222 3551 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356166.1 protein_id gnl|my_center|LOCUS_05670 4853 4203 gene locus_tag LOCUS_05680 4853 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 5706 4837 gene locus_tag LOCUS_05690 5706 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8452 5708 gene locus_tag LOCUS_05700 gene ileS 8452 5708 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245512.1 protein_id gnl|my_center|LOCUS_05700 8720 8463 gene locus_tag LOCUS_05710 8720 8463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 9073 8720 gene locus_tag LOCUS_05720 9073 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 9734 9084 gene locus_tag LOCUS_05730 9734 9084 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218005.1 protein_id gnl|my_center|LOCUS_05730 10792 9842 gene locus_tag LOCUS_05740 10792 9842 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382909.1 protein_id gnl|my_center|LOCUS_05740 14940 10807 gene locus_tag LOCUS_05750 14940 10807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 16817 15063 gene locus_tag LOCUS_05760 16817 15063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 17147 18628 gene locus_tag LOCUS_05770 17147 18628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 19423 18647 gene locus_tag LOCUS_05780 19423 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 19793 19398 gene locus_tag LOCUS_05790 19793 19398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence020 714 190 gene locus_tag LOCUS_05800 714 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2707 740 gene locus_tag LOCUS_05810 2707 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4760 2781 gene locus_tag LOCUS_05820 4760 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 6833 4857 gene locus_tag LOCUS_05830 6833 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 7272 6883 gene locus_tag LOCUS_05840 7272 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 8854 7265 gene locus_tag LOCUS_05850 8854 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 10404 8866 gene locus_tag LOCUS_05860 gene cls 10404 8866 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638280.1 protein_id gnl|my_center|LOCUS_05860 11727 10489 gene locus_tag LOCUS_05870 11727 10489 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_05870 13150 11813 gene locus_tag LOCUS_05880 gene rlmD 13150 11813 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048300.1 protein_id gnl|my_center|LOCUS_05880 14236 13223 gene locus_tag LOCUS_05890 gene gap 14236 13223 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016560.1 protein_id gnl|my_center|LOCUS_05890 14770 14345 gene locus_tag LOCUS_05900 gene aroQ 14770 14345 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_05900 15540 14773 gene locus_tag LOCUS_05910 15540 14773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 <19321 15593 gene locus_tag LOCUS_05920 <19321 15593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245843.1:PolC-type DNA polymerase III >Feature sequence021 582 259 gene locus_tag LOCUS_05930 582 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 1201 584 gene locus_tag LOCUS_05940 1201 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1354 1205 gene locus_tag LOCUS_05950 1354 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 1515 1354 gene locus_tag LOCUS_05960 1515 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3428 1599 gene locus_tag LOCUS_05970 3428 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3829 3425 gene locus_tag LOCUS_05980 3829 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 3993 3826 gene locus_tag LOCUS_05990 3993 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 4554 4189 gene locus_tag LOCUS_06000 4554 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5255 5797 gene locus_tag LOCUS_06010 5255 5797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 5857 6084 gene locus_tag LOCUS_06020 5857 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 8822 6312 gene locus_tag LOCUS_06030 8822 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 10124 8976 gene locus_tag LOCUS_06040 10124 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 10593 10099 gene locus_tag LOCUS_06050 10593 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 10943 10599 gene locus_tag LOCUS_06060 10943 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 11245 10940 gene locus_tag LOCUS_06070 11245 10940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 11478 11242 gene locus_tag LOCUS_06080 11478 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 11954 11481 gene locus_tag LOCUS_06090 11954 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 12262 11978 gene locus_tag LOCUS_06100 12262 11978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 12936 12286 gene locus_tag LOCUS_06110 12936 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 13289 12957 gene locus_tag LOCUS_06120 13289 12957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 13639 13364 gene locus_tag LOCUS_06130 13639 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 14780 13671 gene locus_tag LOCUS_06140 14780 13671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 15043 14819 gene locus_tag LOCUS_06150 15043 14819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 15293 15108 gene locus_tag LOCUS_06160 15293 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 15576 15271 gene locus_tag LOCUS_06170 15576 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 16080 15583 gene locus_tag LOCUS_06180 16080 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 18820 16082 gene locus_tag LOCUS_06190 18820 16082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence022 169 244 gene locus_tag LOCUS_t00120 169 244 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 254 329 gene locus_tag LOCUS_t00130 254 329 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 335 410 gene locus_tag LOCUS_t00140 335 410 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 438 526 gene locus_tag LOCUS_t00150 438 526 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 550 625 gene locus_tag LOCUS_t00160 550 625 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 655 731 gene locus_tag LOCUS_t00170 655 731 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 738 814 gene locus_tag LOCUS_t00180 738 814 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 848 938 gene locus_tag LOCUS_t00190 848 938 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 982 1057 gene locus_tag LOCUS_t00200 982 1057 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1074 1149 gene locus_tag LOCUS_t00210 1074 1149 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1159 1234 gene locus_tag LOCUS_t00220 1159 1234 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1479 3911 gene locus_tag LOCUS_06200 1479 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4009 4887 gene locus_tag LOCUS_06210 4009 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4884 7418 gene locus_tag LOCUS_06220 4884 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 7537 8037 gene locus_tag LOCUS_06230 gene nuoE 7537 8037 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986413.1 protein_id gnl|my_center|LOCUS_06230 8027 9880 gene locus_tag LOCUS_06240 8027 9880 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986412.1 protein_id gnl|my_center|LOCUS_06240 9893 11665 gene locus_tag LOCUS_06250 9893 11665 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_06250 11665 12591 gene locus_tag LOCUS_06260 11665 12591 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861062.1 protein_id gnl|my_center|LOCUS_06260 12584 13327 gene locus_tag LOCUS_06270 12584 13327 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888755.1 protein_id gnl|my_center|LOCUS_06270 13388 15121 gene locus_tag LOCUS_06280 13388 15121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 15215 15901 gene locus_tag LOCUS_06290 15215 15901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 15994 16953 gene locus_tag LOCUS_06300 15994 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 16956 18929 gene locus_tag LOCUS_06310 16956 18929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence023 533 2707 gene locus_tag LOCUS_06320 533 2707 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_06320 2811 3365 gene locus_tag LOCUS_06330 2811 3365 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_06330 3429 4925 gene locus_tag LOCUS_06340 3429 4925 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_06340 4935 5285 gene locus_tag LOCUS_06350 4935 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5272 5586 gene locus_tag LOCUS_06360 5272 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06360 5651 6040 gene locus_tag LOCUS_06370 5651 6040 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_06370 6040 6351 gene locus_tag LOCUS_06380 gene trxA 6040 6351 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_06380 6494 8332 gene locus_tag LOCUS_06390 6494 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 8420 9376 gene locus_tag LOCUS_06400 gene pstC 8420 9376 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454007.1 protein_id gnl|my_center|LOCUS_06400 9373 10575 gene locus_tag LOCUS_06410 9373 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 10587 11405 gene locus_tag LOCUS_06420 gene pstB 10587 11405 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986851.1 protein_id gnl|my_center|LOCUS_06420 11439 12083 gene locus_tag LOCUS_06430 gene phoU 11439 12083 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_06430 12076 12759 gene locus_tag LOCUS_06440 12076 12759 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_06440 12756 14423 gene locus_tag LOCUS_06450 12756 14423 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986853.1 protein_id gnl|my_center|LOCUS_06450 14502 14825 gene locus_tag LOCUS_06460 14502 14825 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_06460 14848 14921 gene locus_tag LOCUS_t00230 14848 14921 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 15117 16085 gene locus_tag LOCUS_06470 gene yhdJ 15117 16085 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258883.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence024 1904 624 gene locus_tag LOCUS_06480 1904 624 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842981.1 protein_id gnl|my_center|LOCUS_06480 3087 1897 gene locus_tag LOCUS_06490 3087 1897 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048277.1 protein_id gnl|my_center|LOCUS_06490 3405 3178 gene locus_tag LOCUS_06500 gene acpP 3405 3178 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_06500 4324 3395 gene locus_tag LOCUS_06510 4324 3395 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927052.1 protein_id gnl|my_center|LOCUS_06510 6612 4336 gene locus_tag LOCUS_06520 6612 4336 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477896.1 protein_id gnl|my_center|LOCUS_06520 7843 6632 gene locus_tag LOCUS_06530 7843 6632 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015925.1 protein_id gnl|my_center|LOCUS_06530 8937 7840 gene locus_tag LOCUS_06540 gene ychF 8937 7840 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524657.1 protein_id gnl|my_center|LOCUS_06540 10133 8967 gene locus_tag LOCUS_06550 10133 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 10881 10120 gene locus_tag LOCUS_06560 10881 10120 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_06560 11395 10871 gene locus_tag LOCUS_06570 11395 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 12725 11541 gene locus_tag LOCUS_06580 gene tuf 12725 11541 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290442.1 protein_id gnl|my_center|LOCUS_06580 14868 12796 gene locus_tag LOCUS_06590 gene fusA 14868 12796 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090364.1 protein_id gnl|my_center|LOCUS_06590 15345 14875 gene locus_tag LOCUS_06600 gene rpsG 15345 14875 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_06600 15791 15372 gene locus_tag LOCUS_06610 gene rpsL 15791 15372 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225781.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence025 261 1052 gene locus_tag LOCUS_06620 261 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1054 9699 gene locus_tag LOCUS_06630 1054 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 9711 12743 gene locus_tag LOCUS_06640 9711 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 12866 13087 gene locus_tag LOCUS_06650 12866 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 13089 13286 gene locus_tag LOCUS_06660 13089 13286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 13301 13738 gene locus_tag LOCUS_06670 13301 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 14315 13809 gene locus_tag LOCUS_06680 14315 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 14955 14302 gene locus_tag LOCUS_06690 14955 14302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 15535 14936 gene locus_tag LOCUS_06700 15535 14936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence026 366 707 gene locus_tag LOCUS_06710 366 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 811 2055 gene locus_tag LOCUS_06720 811 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2057 3058 gene locus_tag LOCUS_06730 gene aroF 2057 3058 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_06730 3051 4289 gene locus_tag LOCUS_06740 gene aroA 3051 4289 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896990.1 protein_id gnl|my_center|LOCUS_06740 4507 4370 gene locus_tag LOCUS_06750 4507 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4721 5518 gene locus_tag LOCUS_06760 gene yidA 4721 5518 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048269.1 protein_id gnl|my_center|LOCUS_06760 5528 6943 gene locus_tag LOCUS_06770 gene pyk 5528 6943 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_06770 7004 8014 gene locus_tag LOCUS_06780 7004 8014 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757575.1 protein_id gnl|my_center|LOCUS_06780 8075 8806 gene locus_tag LOCUS_06790 8075 8806 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_06790 8806 9438 gene locus_tag LOCUS_06800 8806 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 9623 11110 gene locus_tag LOCUS_06810 9623 11110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 11119 11412 gene locus_tag LOCUS_06820 11119 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 11412 12566 gene locus_tag LOCUS_06830 11412 12566 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966253.1 protein_id gnl|my_center|LOCUS_06830 12639 13394 gene locus_tag LOCUS_06840 gene estA 12639 13394 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761976.1 protein_id gnl|my_center|LOCUS_06840 13397 15262 gene locus_tag LOCUS_06850 13397 15262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence027 2793 1546 gene locus_tag LOCUS_06860 2793 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3301 2795 gene locus_tag LOCUS_06870 3301 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 6803 3426 gene locus_tag LOCUS_06880 6803 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 10336 6935 gene locus_tag LOCUS_06890 10336 6935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 11282 10347 gene locus_tag LOCUS_06900 11282 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 13125 11353 gene locus_tag LOCUS_06910 13125 11353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 13576 13196 gene locus_tag LOCUS_06920 13576 13196 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459713.1 protein_id gnl|my_center|LOCUS_06920 <14851 13586 gene locus_tag LOCUS_06930 <14851 13586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546517.1:DNA translocase FtsK >Feature sequence028 775 86 gene locus_tag LOCUS_06940 775 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1070 756 gene locus_tag LOCUS_06950 1070 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1572 1045 gene locus_tag LOCUS_06960 1572 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2611 1565 gene locus_tag LOCUS_06970 2611 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 3009 2611 gene locus_tag LOCUS_06980 3009 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5610 3010 gene locus_tag LOCUS_06990 5610 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 6747 5623 gene locus_tag LOCUS_07000 6747 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 7225 6770 gene locus_tag LOCUS_07010 7225 6770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 8578 7478 gene locus_tag LOCUS_07020 8578 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 9671 8580 gene locus_tag LOCUS_07030 9671 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 11391 9673 gene locus_tag LOCUS_07040 11391 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 11939 11607 gene locus_tag LOCUS_07050 11939 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 12401 11946 gene locus_tag LOCUS_07060 12401 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12835 12398 gene locus_tag LOCUS_07070 12835 12398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 13383 13021 gene locus_tag LOCUS_07080 13383 13021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence029 426 677 gene locus_tag LOCUS_07090 426 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 667 1071 gene locus_tag LOCUS_07100 667 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 1058 2299 gene locus_tag LOCUS_07110 1058 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2296 3528 gene locus_tag LOCUS_07120 2296 3528 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_07120 3532 4668 gene locus_tag LOCUS_07130 3532 4668 CDS product PTS transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903941.1 protein_id gnl|my_center|LOCUS_07130 4935 6530 gene locus_tag LOCUS_07140 4935 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6527 7060 gene locus_tag LOCUS_07150 6527 7060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 7053 7934 gene locus_tag LOCUS_07160 7053 7934 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812450.1 protein_id gnl|my_center|LOCUS_07160 7907 9547 gene locus_tag LOCUS_07170 7907 9547 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225543.1 protein_id gnl|my_center|LOCUS_07170 9531 10238 gene locus_tag LOCUS_07180 9531 10238 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 protein_id gnl|my_center|LOCUS_07180 10307 10801 gene locus_tag LOCUS_07190 10307 10801 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476359.1 protein_id gnl|my_center|LOCUS_07190 11113 12090 gene locus_tag LOCUS_07200 11113 12090 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724426.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence030 739 1278 gene locus_tag LOCUS_07210 gene hpt 739 1278 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905038.1 protein_id gnl|my_center|LOCUS_07210 1282 3324 gene locus_tag LOCUS_07220 gene ftsH 1282 3324 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079674.1 protein_id gnl|my_center|LOCUS_07220 3314 3568 gene locus_tag LOCUS_07230 3314 3568 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048379.1 protein_id gnl|my_center|LOCUS_07230 3580 4122 gene locus_tag LOCUS_07240 3580 4122 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_07240 4950 4135 gene locus_tag LOCUS_07250 gene hslO 4950 4135 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_07250 5032 5583 gene locus_tag LOCUS_07260 5032 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5592 6194 gene locus_tag LOCUS_07270 5592 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 6184 6708 gene locus_tag LOCUS_07280 6184 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 8220 6739 gene locus_tag LOCUS_07290 gene lysS 8220 6739 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989378.1 protein_id gnl|my_center|LOCUS_07290 8331 9182 gene locus_tag LOCUS_07300 8331 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 9293 9377 gene locus_tag LOCUS_t00240 9293 9377 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9383 9456 gene locus_tag LOCUS_t00250 9383 9456 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9782 11452 gene locus_tag LOCUS_07310 9782 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence031 3231 661 gene locus_tag LOCUS_07320 gene mutS 3231 661 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244841.1 protein_id gnl|my_center|LOCUS_07320 5154 3316 gene locus_tag LOCUS_07330 5154 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 7241 5151 gene locus_tag LOCUS_07340 7241 5151 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_07340 7392 7979 gene locus_tag LOCUS_07350 7392 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 8630 8007 gene locus_tag LOCUS_07360 8630 8007 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295844.1 protein_id gnl|my_center|LOCUS_07360 9988 8726 gene locus_tag LOCUS_07370 gene obgE 9988 8726 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_07370 10319 10038 gene locus_tag LOCUS_07380 gene rpmA 10319 10038 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830822.1 protein_id gnl|my_center|LOCUS_07380 10633 10316 gene locus_tag LOCUS_07390 10633 10316 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476071.1 protein_id gnl|my_center|LOCUS_07390 10933 10634 gene locus_tag LOCUS_07400 gene rplU 10933 10634 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388997.1 protein_id gnl|my_center|LOCUS_07400 12207 11071 gene locus_tag LOCUS_07410 12207 11071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence032 38 308 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq agtaagaattgaattgacccgtttgaggggattgagac 1336 437 gene locus_tag LOCUS_07420 1336 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1745 1347 gene locus_tag LOCUS_07430 1745 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2138 1827 gene locus_tag LOCUS_07440 2138 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2490 2110 gene locus_tag LOCUS_07450 2490 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2915 2481 gene locus_tag LOCUS_07460 2915 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 3291 2884 gene locus_tag LOCUS_07470 3291 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3649 3284 gene locus_tag LOCUS_07480 3649 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4167 3658 gene locus_tag LOCUS_07490 4167 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5969 4167 gene locus_tag LOCUS_07500 5969 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 6577 5978 gene locus_tag LOCUS_07510 6577 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 7471 6578 gene locus_tag LOCUS_07520 7471 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 7824 7525 gene locus_tag LOCUS_07530 7824 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 8107 7805 gene locus_tag LOCUS_07540 8107 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 8633 8109 gene locus_tag LOCUS_07550 8633 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 8785 8642 gene locus_tag LOCUS_07560 8785 8642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 9164 8778 gene locus_tag LOCUS_07570 9164 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 9949 9161 gene locus_tag LOCUS_07580 9949 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 11273 9930 gene locus_tag LOCUS_07590 11273 9930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 11886 11260 gene locus_tag LOCUS_07600 11886 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 12053 11889 gene locus_tag LOCUS_07610 12053 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 12235 12041 gene locus_tag LOCUS_07620 12235 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence033 944 378 gene locus_tag LOCUS_07630 944 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1376 966 gene locus_tag LOCUS_07640 1376 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1849 1379 gene locus_tag LOCUS_07650 1849 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2175 1846 gene locus_tag LOCUS_07660 2175 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2746 2177 gene locus_tag LOCUS_07670 2746 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3160 2762 gene locus_tag LOCUS_07680 3160 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 4040 3174 gene locus_tag LOCUS_07690 4040 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889358.1 protein_id gnl|my_center|LOCUS_07690 4713 4063 gene locus_tag LOCUS_07700 4713 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 4970 4761 gene locus_tag LOCUS_07710 4970 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 5282 5103 gene locus_tag LOCUS_07720 5282 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5464 5279 gene locus_tag LOCUS_07730 5464 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5700 5548 gene locus_tag LOCUS_07740 5700 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6635 5700 gene locus_tag LOCUS_07750 6635 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7110 6637 gene locus_tag LOCUS_07760 7110 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 8724 7123 gene locus_tag LOCUS_07770 8724 7123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 10756 8735 gene locus_tag LOCUS_07780 10756 8735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 11173 10760 gene locus_tag LOCUS_07790 11173 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 11448 11630 gene locus_tag LOCUS_07800 11448 11630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence034 <1 1593 gene locus_tag LOCUS_07810 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015803369.1:AMP-binding protein 1605 3512 gene locus_tag LOCUS_07820 1605 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 3505 4146 gene locus_tag LOCUS_07830 3505 4146 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583518.1 protein_id gnl|my_center|LOCUS_07830 4190 4795 gene locus_tag LOCUS_07840 4190 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4804 6321 gene locus_tag LOCUS_07850 4804 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07850 6322 6567 gene locus_tag LOCUS_07860 6322 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 6567 6971 gene locus_tag LOCUS_07870 6567 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 6968 7549 gene locus_tag LOCUS_07880 6968 7549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 7748 8155 gene locus_tag LOCUS_07890 7748 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 8221 8907 gene locus_tag LOCUS_07900 8221 8907 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 protein_id gnl|my_center|LOCUS_07900 8894 10234 gene locus_tag LOCUS_07910 8894 10234 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_07910 10188 10922 gene locus_tag LOCUS_07920 10188 10922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence035 433 765 gene locus_tag LOCUS_07930 433 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 828 1160 gene locus_tag LOCUS_07940 828 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 1141 3480 gene locus_tag LOCUS_07950 1141 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3491 3850 gene locus_tag LOCUS_07960 3491 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3900 5261 gene locus_tag LOCUS_07970 3900 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 5273 5710 gene locus_tag LOCUS_07980 5273 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 5700 6767 gene locus_tag LOCUS_07990 5700 6767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 6868 7482 gene locus_tag LOCUS_08000 6868 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 7518 7817 gene locus_tag LOCUS_08010 7518 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 7833 8876 gene locus_tag LOCUS_08020 7833 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 9009 9344 gene locus_tag LOCUS_08030 9009 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 9431 10381 gene locus_tag LOCUS_08040 9431 10381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence036 739 1623 gene locus_tag LOCUS_08050 739 1623 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965945.1 protein_id gnl|my_center|LOCUS_08050 2427 1639 gene locus_tag LOCUS_08060 2427 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3334 2420 gene locus_tag LOCUS_08070 3334 2420 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_08070 4108 3434 gene locus_tag LOCUS_08080 4108 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5415 4132 gene locus_tag LOCUS_08090 5415 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 6866 5583 gene locus_tag LOCUS_08100 6866 5583 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963553.1 protein_id gnl|my_center|LOCUS_08100 8263 6863 gene locus_tag LOCUS_08110 8263 6863 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_08110 9538 8264 gene locus_tag LOCUS_08120 9538 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 10848 9535 gene locus_tag LOCUS_08130 10848 9535 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence037 46 282 gene locus_tag LOCUS_08140 46 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 282 869 gene locus_tag LOCUS_08150 282 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 1006 1536 gene locus_tag LOCUS_08160 1006 1536 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965782.1 protein_id gnl|my_center|LOCUS_08160 1560 1796 gene locus_tag LOCUS_08170 1560 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1892 2881 gene locus_tag LOCUS_08180 1892 2881 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_08180 2906 3064 gene locus_tag LOCUS_08190 2906 3064 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_08190 3067 4233 gene locus_tag LOCUS_08200 3067 4233 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496601.1 protein_id gnl|my_center|LOCUS_08200 4325 5668 gene locus_tag LOCUS_08210 4325 5668 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963042.1 protein_id gnl|my_center|LOCUS_08210 5746 7269 gene locus_tag LOCUS_08220 5746 7269 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290558.1 protein_id gnl|my_center|LOCUS_08220 7279 8733 gene locus_tag LOCUS_08230 7279 8733 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680122.1 protein_id gnl|my_center|LOCUS_08230 8761 10032 gene locus_tag LOCUS_08240 8761 10032 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680122.1 protein_id gnl|my_center|LOCUS_08240 10029 10442 gene locus_tag LOCUS_08250 10029 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence038 820 2940 gene locus_tag LOCUS_08260 820 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2997 3470 gene locus_tag LOCUS_08270 2997 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 3467 3736 gene locus_tag LOCUS_08280 3467 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3733 4032 gene locus_tag LOCUS_08290 3733 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4029 4622 gene locus_tag LOCUS_08300 4029 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4612 5070 gene locus_tag LOCUS_08310 4612 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 5067 5525 gene locus_tag LOCUS_08320 5067 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 5515 9648 gene locus_tag LOCUS_08330 5515 9648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 9663 10295 gene locus_tag LOCUS_08340 9663 10295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 10306 10650 gene locus_tag LOCUS_08350 10306 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence039 592 122 gene locus_tag LOCUS_08360 gene dfrA 592 122 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_08360 1467 589 gene locus_tag LOCUS_08370 1467 589 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874676.1 protein_id gnl|my_center|LOCUS_08370 2818 1550 gene locus_tag LOCUS_08380 2818 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 3629 3114 gene locus_tag LOCUS_08390 gene trmL 3629 3114 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722757.1 protein_id gnl|my_center|LOCUS_08390 4545 3622 gene locus_tag LOCUS_08400 4545 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 4600 5442 gene locus_tag LOCUS_08410 4600 5442 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_08410 5443 5991 gene locus_tag LOCUS_08420 5443 5991 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_08420 6762 6001 gene locus_tag LOCUS_08430 gene murI 6762 6001 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880160.1 protein_id gnl|my_center|LOCUS_08430 8056 6755 gene locus_tag LOCUS_08440 gene citX 8056 6755 CDS product citrate lyase holo-[acyl-carrier protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679170.1 protein_id gnl|my_center|LOCUS_08440 9628 8123 gene locus_tag LOCUS_08450 gene citF 9628 8123 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272879.1 protein_id gnl|my_center|LOCUS_08450 <10436 9628 gene locus_tag LOCUS_08460 <10436 9628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679317.1:CoA ester lyase >Feature sequence040 69 635 gene locus_tag LOCUS_08470 69 635 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459927.1 protein_id gnl|my_center|LOCUS_08470 632 1168 gene locus_tag LOCUS_08480 632 1168 CDS product DUF5698 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966729.1 protein_id gnl|my_center|LOCUS_08480 1176 1252 gene locus_tag LOCUS_t00260 1176 1252 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1342 2346 gene locus_tag LOCUS_08490 1342 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 2387 3262 gene locus_tag LOCUS_08500 2387 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 4043 3306 gene locus_tag LOCUS_08510 4043 3306 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039237.1 protein_id gnl|my_center|LOCUS_08510 4878 4018 gene locus_tag LOCUS_08520 4878 4018 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448350.1 protein_id gnl|my_center|LOCUS_08520 5912 4875 gene locus_tag LOCUS_08530 5912 4875 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921852.1 protein_id gnl|my_center|LOCUS_08530 6081 7706 gene locus_tag LOCUS_08540 6081 7706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence041 2546 2208 gene locus_tag LOCUS_08550 2546 2208 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545111.1 protein_id gnl|my_center|LOCUS_08550 2995 2540 gene locus_tag LOCUS_08560 2995 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4374 3109 gene locus_tag LOCUS_08570 4374 3109 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020862867.1 protein_id gnl|my_center|LOCUS_08570 5101 4391 gene locus_tag LOCUS_08580 5101 4391 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680712.1 protein_id gnl|my_center|LOCUS_08580 5448 5116 gene locus_tag LOCUS_08590 5448 5116 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_08590 5911 5441 gene locus_tag LOCUS_08600 5911 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 7267 6071 gene locus_tag LOCUS_08610 7267 6071 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878082.1 protein_id gnl|my_center|LOCUS_08610 7722 7901 gene locus_tag LOCUS_08620 7722 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 7885 9330 gene locus_tag LOCUS_08630 7885 9330 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence042 389 820 gene locus_tag LOCUS_08640 389 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1024 1377 gene locus_tag LOCUS_08650 1024 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1428 1796 gene locus_tag LOCUS_08660 1428 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2219 2812 gene locus_tag LOCUS_08670 gene yihA 2219 2812 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_08670 2814 3416 gene locus_tag LOCUS_08680 2814 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 3515 3898 gene locus_tag LOCUS_08690 3515 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3933 4157 gene locus_tag LOCUS_08700 3933 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 4368 4796 gene locus_tag LOCUS_08710 gene mraZ 4368 4796 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 protein_id gnl|my_center|LOCUS_08710 4789 5751 gene locus_tag LOCUS_08720 gene rsmH 4789 5751 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905597.1 protein_id gnl|my_center|LOCUS_08720 5944 6501 gene locus_tag LOCUS_08730 gene nadD 5944 6501 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965087.1 protein_id gnl|my_center|LOCUS_08730 6510 8408 gene locus_tag LOCUS_08740 6510 8408 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964368.1 protein_id gnl|my_center|LOCUS_08740 8507 9631 gene locus_tag LOCUS_08750 8507 9631 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence043 470 1708 gene locus_tag LOCUS_08760 470 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1796 2410 gene locus_tag LOCUS_08770 1796 2410 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830827.1 protein_id gnl|my_center|LOCUS_08770 2407 3219 gene locus_tag LOCUS_08780 2407 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3216 4397 gene locus_tag LOCUS_08790 3216 4397 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229802.1 protein_id gnl|my_center|LOCUS_08790 4456 4935 gene locus_tag LOCUS_08800 gene greA 4456 4935 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179966.1 protein_id gnl|my_center|LOCUS_08800 4947 6323 gene locus_tag LOCUS_08810 4947 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 6323 7327 gene locus_tag LOCUS_08820 gene asnA 6323 7327 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476128.1 protein_id gnl|my_center|LOCUS_08820 7401 7946 gene locus_tag LOCUS_08830 7401 7946 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287626.1 protein_id gnl|my_center|LOCUS_08830 7943 8866 gene locus_tag LOCUS_08840 7943 8866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence044 283 591 gene locus_tag LOCUS_08850 283 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 588 2474 gene locus_tag LOCUS_08860 588 2474 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_08860 2474 2935 gene locus_tag LOCUS_08870 2474 2935 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869602.1 protein_id gnl|my_center|LOCUS_08870 2947 3570 gene locus_tag LOCUS_08880 2947 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3570 4520 gene locus_tag LOCUS_08890 3570 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4513 4827 gene locus_tag LOCUS_08900 4513 4827 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_08900 4840 6612 gene locus_tag LOCUS_08910 4840 6612 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_08910 6612 7985 gene locus_tag LOCUS_08920 6612 7985 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_08920 7987 8619 gene locus_tag LOCUS_08930 7987 8619 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295103.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence045 2988 937 gene locus_tag LOCUS_08940 2988 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 3463 2975 gene locus_tag LOCUS_08950 3463 2975 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459411.1 protein_id gnl|my_center|LOCUS_08950 3692 3616 gene locus_tag LOCUS_t00270 3692 3616 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4796 3720 gene locus_tag LOCUS_08960 4796 3720 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229495.1 protein_id gnl|my_center|LOCUS_08960 6446 4809 gene locus_tag LOCUS_08970 gene argS 6446 4809 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227570.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence046 >Feature sequence047 308 87 gene locus_tag LOCUS_08980 308 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4075 305 gene locus_tag LOCUS_08990 4075 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4332 4075 gene locus_tag LOCUS_09000 4332 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6124 4766 gene locus_tag LOCUS_09010 6124 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 6673 6236 gene locus_tag LOCUS_09020 6673 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 7935 6670 gene locus_tag LOCUS_09030 7935 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence048 231 731 gene locus_tag LOCUS_09040 231 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 765 1916 gene locus_tag LOCUS_09050 gene maeB 765 1916 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229415.1 protein_id gnl|my_center|LOCUS_09050 1941 3068 gene locus_tag LOCUS_09060 1941 3068 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_09060 3892 3089 gene locus_tag LOCUS_09070 3892 3089 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_09070 4014 4826 gene locus_tag LOCUS_09080 4014 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4831 5349 gene locus_tag LOCUS_09090 4831 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 5352 6095 gene locus_tag LOCUS_09100 5352 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 6088 6744 gene locus_tag LOCUS_09110 6088 6744 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810083.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence049 439 783 gene locus_tag LOCUS_09120 439 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 883 1266 gene locus_tag LOCUS_09130 883 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1279 2418 gene locus_tag LOCUS_09140 1279 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2455 2838 gene locus_tag LOCUS_09150 2455 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2828 3052 gene locus_tag LOCUS_09160 2828 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3039 3839 gene locus_tag LOCUS_09170 3039 3839 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966069.1 protein_id gnl|my_center|LOCUS_09170 3839 5044 gene locus_tag LOCUS_09180 3839 5044 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_09180 5059 6729 gene locus_tag LOCUS_09190 gene pilB 5059 6729 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546881.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence050 664 1332 gene locus_tag LOCUS_09200 gene rpiA 664 1332 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052314.1 protein_id gnl|my_center|LOCUS_09200 1345 1875 gene locus_tag LOCUS_09210 1345 1875 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233562.1 protein_id gnl|my_center|LOCUS_09210 1875 2675 gene locus_tag LOCUS_09220 1875 2675 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732982.1 protein_id gnl|my_center|LOCUS_09220 2737 3030 gene locus_tag LOCUS_09230 2737 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4743 3367 gene locus_tag LOCUS_09240 gene mgtE 4743 3367 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294561.1 protein_id gnl|my_center|LOCUS_09240 4877 5893 gene locus_tag LOCUS_09250 4877 5893 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986709.1 protein_id gnl|my_center|LOCUS_09250 5894 6937 gene locus_tag LOCUS_09260 5894 6937 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_09260 6930 7598 gene locus_tag LOCUS_09270 6930 7598 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence051 158 1750 gene locus_tag LOCUS_09280 158 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1754 3193 gene locus_tag LOCUS_09290 1754 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3198 4238 gene locus_tag LOCUS_09300 3198 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4242 6815 gene locus_tag LOCUS_09310 4242 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6799 7146 gene locus_tag LOCUS_09320 6799 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence052 655 416 gene locus_tag LOCUS_09330 655 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1647 754 gene locus_tag LOCUS_09340 1647 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2266 1679 gene locus_tag LOCUS_09350 2266 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2610 2389 gene locus_tag LOCUS_09360 2610 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4307 2613 gene locus_tag LOCUS_09370 4307 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5612 4311 gene locus_tag LOCUS_09380 5612 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531618.1 protein_id gnl|my_center|LOCUS_09380 5955 5575 gene locus_tag LOCUS_09390 5955 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 6345 6076 gene locus_tag LOCUS_09400 6345 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 6808 6599 gene locus_tag LOCUS_09410 6808 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 7004 6840 gene locus_tag LOCUS_09420 7004 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence053 119 1024 gene locus_tag LOCUS_09430 119 1024 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_09430 1160 1927 gene locus_tag LOCUS_09440 1160 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2130 3020 gene locus_tag LOCUS_09450 2130 3020 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_09450 3069 4478 gene locus_tag LOCUS_09460 3069 4478 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681245.1 protein_id gnl|my_center|LOCUS_09460 4602 5657 gene locus_tag LOCUS_09470 4602 5657 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_09470 6093 5722 gene locus_tag LOCUS_09480 6093 5722 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_09480 6272 6547 gene locus_tag LOCUS_09490 6272 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 6688 7095 gene locus_tag LOCUS_09500 6688 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence054 268 993 gene locus_tag LOCUS_09510 268 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09510 1006 1953 gene locus_tag LOCUS_09520 1006 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09520 1966 4485 gene locus_tag LOCUS_09530 gene pglZ 1966 4485 CDS product BREX-1 system phosphatase PglZ type A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022339.1 protein_id gnl|my_center|LOCUS_09530 4498 6516 gene locus_tag LOCUS_09540 gene brxL 4498 6516 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence055 2029 1202 gene locus_tag LOCUS_09550 2029 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2645 2013 gene locus_tag LOCUS_09560 2645 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3507 2632 gene locus_tag LOCUS_09570 3507 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 5007 3520 gene locus_tag LOCUS_09580 5007 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 6089 5028 gene locus_tag LOCUS_09590 6089 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence056 3457 4029 gene locus_tag LOCUS_09600 3457 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 4022 4825 gene locus_tag LOCUS_09610 4022 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4834 5187 gene locus_tag LOCUS_09620 gene mgsA 4834 5187 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684755.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence057 25 351 gene locus_tag LOCUS_09630 25 351 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903515.1 protein_id gnl|my_center|LOCUS_09630 341 2632 gene locus_tag LOCUS_09640 341 2632 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_09640 2709 3218 gene locus_tag LOCUS_09650 2709 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 3470 3219 gene locus_tag LOCUS_09660 3470 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 3603 4613 gene locus_tag LOCUS_09670 gene aroB 3603 4613 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583419.1 protein_id gnl|my_center|LOCUS_09670 4603 5589 gene locus_tag LOCUS_09680 gene aroC 4603 5589 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence058 <1 1393 gene locus_tag LOCUS_09690 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459549.1:ABC transporter ATP-binding protein 1386 2723 gene locus_tag LOCUS_09700 1386 2723 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_09700 2716 3714 gene locus_tag LOCUS_09710 2716 3714 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence059 912 28 gene locus_tag LOCUS_09720 912 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1469 912 gene locus_tag LOCUS_09730 1469 912 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783551.1 protein_id gnl|my_center|LOCUS_09730 2773 1466 gene locus_tag LOCUS_09740 2773 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3053 2781 gene locus_tag LOCUS_09750 3053 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4149 3145 gene locus_tag LOCUS_09760 4149 3145 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724031.1 protein_id gnl|my_center|LOCUS_09760 5455 4139 gene locus_tag LOCUS_09770 gene engA 5455 4139 CDS product ribosome-associated GTPase EngA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125893.1 protein_id gnl|my_center|LOCUS_09770 <6172 5463 gene locus_tag LOCUS_09780 <6172 5463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081719.1:30S ribosomal protein S1 >Feature sequence060 1730 315 gene locus_tag LOCUS_09790 1730 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2467 1928 gene locus_tag LOCUS_09800 2467 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 5718 2500 gene locus_tag LOCUS_09810 gene addA 5718 2500 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926142.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence061 1672 350 gene locus_tag LOCUS_09820 1672 350 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262091.1 protein_id gnl|my_center|LOCUS_09820 2960 1662 gene locus_tag LOCUS_09830 gene mtaB 2960 1662 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230017.1 protein_id gnl|my_center|LOCUS_09830 3682 2960 gene locus_tag LOCUS_09840 3682 2960 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190120.1 protein_id gnl|my_center|LOCUS_09840 4891 3776 gene locus_tag LOCUS_09850 gene dnaJ 4891 3776 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043938.1 protein_id gnl|my_center|LOCUS_09850 <5898 4910 gene locus_tag LOCUS_09860 <5898 4910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357825.1:molecular chaperone DnaK >Feature sequence062 3028 1727 gene locus_tag LOCUS_09870 3028 1727 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_09870 4283 3117 gene locus_tag LOCUS_09880 4283 3117 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666702.1 protein_id gnl|my_center|LOCUS_09880 4399 4962 gene locus_tag LOCUS_09890 4399 4962 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003289268.1 protein_id gnl|my_center|LOCUS_09890 <5797 4979 gene locus_tag LOCUS_09900 <5797 4979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964283.1:lysophospholipid acyltransferase family protein >Feature sequence063 246 896 gene locus_tag LOCUS_09910 246 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 889 1959 gene locus_tag LOCUS_09920 889 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1956 2831 gene locus_tag LOCUS_09930 1956 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2848 3090 gene locus_tag LOCUS_09940 2848 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3087 3722 gene locus_tag LOCUS_09950 3087 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3725 4705 gene locus_tag LOCUS_09960 3725 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 5041 4688 gene locus_tag LOCUS_09970 5041 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 5664 5134 gene locus_tag LOCUS_09980 5664 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence064 2751 274 gene locus_tag LOCUS_09990 gene parC 2751 274 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231550.1 protein_id gnl|my_center|LOCUS_09990 4687 2744 gene locus_tag LOCUS_10000 gene parE 4687 2744 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905666.1 protein_id gnl|my_center|LOCUS_10000 4895 5545 gene locus_tag LOCUS_10010 gene plsY 4895 5545 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258978.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence065 >Feature sequence066 805 254 gene locus_tag LOCUS_10020 805 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 1932 808 gene locus_tag LOCUS_10030 1932 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 2134 1952 gene locus_tag LOCUS_10040 2134 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 2669 2139 gene locus_tag LOCUS_10050 2669 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3106 2666 gene locus_tag LOCUS_10060 3106 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 3612 3106 gene locus_tag LOCUS_10070 3612 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4024 3605 gene locus_tag LOCUS_10080 4024 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence067 422 934 gene locus_tag LOCUS_10090 422 934 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295813.1 protein_id gnl|my_center|LOCUS_10090 985 3174 gene locus_tag LOCUS_10100 gene relA 985 3174 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229747.1 protein_id gnl|my_center|LOCUS_10100 3171 3608 gene locus_tag LOCUS_10110 gene dtd 3171 3608 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887535.1 protein_id gnl|my_center|LOCUS_10110 3673 5412 gene locus_tag LOCUS_10120 3673 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence068 1922 399 gene locus_tag LOCUS_10130 1922 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 3184 1928 gene locus_tag LOCUS_10140 3184 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3670 3197 gene locus_tag LOCUS_10150 3670 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4506 3784 gene locus_tag LOCUS_10160 4506 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 4880 4509 gene locus_tag LOCUS_10170 4880 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence069 585 151 gene locus_tag LOCUS_10180 585 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2874 712 gene locus_tag LOCUS_10190 gene pnp 2874 712 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_10190 3204 2932 gene locus_tag LOCUS_10200 gene rpsO 3204 2932 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289282.1 protein_id gnl|my_center|LOCUS_10200 4014 3319 gene locus_tag LOCUS_10210 gene mtnN 4014 3319 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967881.1 protein_id gnl|my_center|LOCUS_10210 4935 4018 gene locus_tag LOCUS_10220 gene ribF 4935 4018 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864185.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence070 1250 501 gene locus_tag LOCUS_10230 1250 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1681 1259 gene locus_tag LOCUS_10240 1681 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2141 1671 gene locus_tag LOCUS_10250 2141 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2633 2148 gene locus_tag LOCUS_10260 2633 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3115 2843 gene locus_tag LOCUS_10270 3115 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3515 3135 gene locus_tag LOCUS_10280 3515 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3717 3478 gene locus_tag LOCUS_10290 3717 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4279 3692 gene locus_tag LOCUS_10300 4279 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 4586 4284 gene locus_tag LOCUS_10310 4586 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence071 86 568 gene locus_tag LOCUS_10320 86 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 582 1487 gene locus_tag LOCUS_10330 582 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1462 2058 gene locus_tag LOCUS_10340 1462 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2503 3390 gene locus_tag LOCUS_10350 2503 3390 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109637.1 protein_id gnl|my_center|LOCUS_10350 3380 3553 gene locus_tag LOCUS_10360 3380 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3537 3857 gene locus_tag LOCUS_10370 3537 3857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3859 4257 gene locus_tag LOCUS_10380 3859 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence072 770 973 gene locus_tag LOCUS_10390 770 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 973 2583 gene locus_tag LOCUS_10400 973 2583 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680024.1 protein_id gnl|my_center|LOCUS_10400 3167 2646 gene locus_tag LOCUS_10410 3167 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3495 3280 gene locus_tag LOCUS_10420 3495 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3622 3789 gene locus_tag LOCUS_10430 3622 3789 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_10430 <4495 3885 gene locus_tag LOCUS_10440 <4495 3885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962345.1:leucine-rich repeat domain-containing protein >Feature sequence073 2740 461 gene locus_tag LOCUS_10450 2740 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4046 2730 gene locus_tag LOCUS_10460 4046 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence074 <1 1973 gene locus_tag LOCUS_10470 <1 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233292.1:multidrug resistance ABC transporter ATP-binding protein/permease BmrD 1975 2688 gene locus_tag LOCUS_10480 1975 2688 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287788.1 protein_id gnl|my_center|LOCUS_10480 2729 2813 gene locus_tag LOCUS_t00280 2729 2813 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2905 3624 gene locus_tag LOCUS_10490 2905 3624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 3747 3872 gene locus_tag LOCUS_10500 3747 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence075 <1 1291 gene locus_tag LOCUS_10510 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965032.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB 1288 2322 gene locus_tag LOCUS_10520 gene rlmN 1288 2322 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626897.1 protein_id gnl|my_center|LOCUS_10520 2322 3164 gene locus_tag LOCUS_10530 gene rsgA 2322 3164 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162036.1 protein_id gnl|my_center|LOCUS_10530 3174 3818 gene locus_tag LOCUS_10540 gene rpe 3174 3818 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence076 866 147 gene locus_tag LOCUS_10550 866 147 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861199.1 protein_id gnl|my_center|LOCUS_10550 1116 1826 gene locus_tag LOCUS_10560 1116 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2537 2031 gene locus_tag LOCUS_10570 2537 2031 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932068.1 protein_id gnl|my_center|LOCUS_10570 3814 2549 gene locus_tag LOCUS_10580 3814 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4046 3973 gene locus_tag LOCUS_t00290 4046 3973 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 1504 398 gene locus_tag LOCUS_10590 1504 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2664 1561 gene locus_tag LOCUS_10600 2664 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence078 1 318 gene locus_tag LOCUS_10610 1 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 330 1562 gene locus_tag LOCUS_10620 330 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 1505 1846 gene locus_tag LOCUS_10630 1505 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1836 2321 gene locus_tag LOCUS_10640 1836 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2342 2566 gene locus_tag LOCUS_10650 2342 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2583 3077 gene locus_tag LOCUS_10660 2583 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence079 823 650 gene locus_tag LOCUS_10670 823 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1216 977 gene locus_tag LOCUS_10680 1216 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3190 3053 gene locus_tag LOCUS_10690 3190 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3613 3407 gene locus_tag LOCUS_10700 3613 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence080 214 1077 gene locus_tag LOCUS_10710 214 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 1124 1468 gene locus_tag LOCUS_10720 1124 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 1461 1688 gene locus_tag LOCUS_10730 1461 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1826 2083 gene locus_tag LOCUS_10740 1826 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2207 2689 gene locus_tag LOCUS_10750 2207 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2673 2867 gene locus_tag LOCUS_10760 2673 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2886 3068 gene locus_tag LOCUS_10770 2886 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3087 3284 gene locus_tag LOCUS_10780 3087 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 3314 3535 gene locus_tag LOCUS_10790 3314 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence081 758 330 gene locus_tag LOCUS_10800 758 330 CDS product recombination protein NinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793653.1 protein_id gnl|my_center|LOCUS_10800 1200 745 gene locus_tag LOCUS_10810 1200 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1850 1260 gene locus_tag LOCUS_10820 1850 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2443 1847 gene locus_tag LOCUS_10830 2443 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2743 2498 gene locus_tag LOCUS_10840 2743 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3366 2944 gene locus_tag LOCUS_10850 3366 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence082 274 1788 gene locus_tag LOCUS_10860 274 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1781 3235 gene locus_tag LOCUS_10870 1781 3235 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence083 2172 88 gene locus_tag LOCUS_10880 2172 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2402 2187 gene locus_tag LOCUS_10890 2402 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 <3790 2463 gene locus_tag LOCUS_10900 <3790 2463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860311.1:GLUG motif-containing protein >Feature sequence084 273 2360 gene locus_tag LOCUS_10910 273 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence085 2259 1675 gene locus_tag LOCUS_10920 2259 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2973 2374 gene locus_tag LOCUS_10930 2973 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence086 2153 573 gene locus_tag LOCUS_10940 2153 573 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301254.1 protein_id gnl|my_center|LOCUS_10940 3364 2153 gene locus_tag LOCUS_10950 3364 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence087 1088 360 gene locus_tag LOCUS_10960 1088 360 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900606.1 protein_id gnl|my_center|LOCUS_10960 1816 1085 gene locus_tag LOCUS_10970 1816 1085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836790.1 protein_id gnl|my_center|LOCUS_10970 2043 1816 gene locus_tag LOCUS_10980 2043 1816 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890776.1 protein_id gnl|my_center|LOCUS_10980 2564 2421 gene locus_tag LOCUS_10990 2564 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence088 2746 2489 gene locus_tag LOCUS_11000 2746 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence089 >Feature sequence090 569 2080 gene locus_tag LOCUS_11010 569 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2077 2775 gene locus_tag LOCUS_11020 2077 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence091 805 38 gene locus_tag LOCUS_11030 805 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1028 741 gene locus_tag LOCUS_11040 1028 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1358 1041 gene locus_tag LOCUS_11050 1358 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1858 1367 gene locus_tag LOCUS_11060 1858 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2225 2106 gene locus_tag LOCUS_11070 2225 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 2397 2798 gene locus_tag LOCUS_11080 2397 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2838 3176 gene locus_tag LOCUS_11090 2838 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence092 284 45 gene locus_tag LOCUS_11100 284 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2554 281 gene locus_tag LOCUS_11110 2554 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3060 2551 gene locus_tag LOCUS_11120 3060 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence093 1 1098 gene locus_tag LOCUS_11130 1 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 1095 2003 gene locus_tag LOCUS_11140 gene miaA 1095 2003 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_11140 1975 2712 gene locus_tag LOCUS_11150 1975 2712 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294391.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence094 <1 905 gene locus_tag LOCUS_11160 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398500.1:replication-associated recombination protein A 967 1122 gene locus_tag LOCUS_11170 gene rpmG 967 1122 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583730.1 protein_id gnl|my_center|LOCUS_11170 1163 1630 gene locus_tag LOCUS_11180 1163 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1617 2672 gene locus_tag LOCUS_11190 gene ispG 1617 2672 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902396.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence095 216 815 gene locus_tag LOCUS_11200 216 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1125 1304 gene locus_tag LOCUS_11210 1125 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1379 1786 gene locus_tag LOCUS_11220 1379 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1788 2219 gene locus_tag LOCUS_11230 1788 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2348 3013 gene locus_tag LOCUS_11240 2348 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence096 321 133 gene locus_tag LOCUS_11250 321 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1080 325 gene locus_tag LOCUS_11260 1080 325 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819520.1 protein_id gnl|my_center|LOCUS_11260 1960 1130 gene locus_tag LOCUS_11270 1960 1130 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080851.1 protein_id gnl|my_center|LOCUS_11270 2466 2116 gene locus_tag LOCUS_11280 2466 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence097 382 1401 gene locus_tag LOCUS_11290 gene hrcA 382 1401 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954957.1 protein_id gnl|my_center|LOCUS_11290 1410 2033 gene locus_tag LOCUS_11300 1410 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence098 1087 410 gene locus_tag LOCUS_11310 1087 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2232 1087 gene locus_tag LOCUS_11320 2232 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 2129 2779 gene locus_tag LOCUS_11330 2129 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence099 2364 2687 gene locus_tag LOCUS_11340 2364 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence100 617 1045 gene locus_tag LOCUS_11350 617 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence101 >Feature sequence102 1126 386 gene locus_tag LOCUS_11360 1126 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1301 1119 gene locus_tag LOCUS_11370 1301 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1683 1294 gene locus_tag LOCUS_11380 1683 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1894 1727 gene locus_tag LOCUS_11390 1894 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 <2599 1903 gene locus_tag LOCUS_11400 <2599 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003394606.1:DNA polymerase III subunit gamma/tau >Feature sequence103 >Feature sequence104 486 851 gene locus_tag LOCUS_11410 486 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 832 1023 gene locus_tag LOCUS_11420 832 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1033 1782 gene locus_tag LOCUS_11430 1033 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence105 689 1486 gene locus_tag LOCUS_11440 689 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1576 1761 gene locus_tag LOCUS_11450 1576 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence106 118 339 gene locus_tag LOCUS_11460 118 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 336 1172 gene locus_tag LOCUS_11470 336 1172 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932825.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence107 <1 797 gene locus_tag LOCUS_11480 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001057959.1:glycosyltransferase 818 1351 gene locus_tag LOCUS_11490 818 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1290 1814 gene locus_tag LOCUS_11500 1290 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1842 2039 gene locus_tag LOCUS_11510 1842 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2103 2240 gene locus_tag LOCUS_11520 2103 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence108 >Feature sequence109 1434 973 gene locus_tag LOCUS_11530 1434 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1673 1431 gene locus_tag LOCUS_11540 1673 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence110 1442 759 gene locus_tag LOCUS_11550 1442 759 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390536.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence111 740 555 gene locus_tag LOCUS_11560 740 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1068 1238 gene locus_tag LOCUS_11570 1068 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1594 1217 gene locus_tag LOCUS_11580 1594 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence112 >Feature sequence113 1055 1314 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccttgatttaatggactgtagagtaaaaac >Feature sequence114 >Feature sequence115 >Feature sequence116 700 191 gene locus_tag LOCUS_11590 700 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence117 113 280 gene locus_tag LOCUS_11600 113 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 258 1202 gene locus_tag LOCUS_11610 258 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence118 706 221 gene locus_tag LOCUS_11620 706 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1049 717 gene locus_tag LOCUS_11630 1049 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence119 >Feature sequence120 452 592 gene locus_tag LOCUS_11640 452 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 608 808 gene locus_tag LOCUS_11650 608 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1382 1510 gene locus_tag LOCUS_11660 1382 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence121 88 243 gene locus_tag LOCUS_11670 88 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 558 274 gene locus_tag LOCUS_11680 558 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 <1579 555 gene locus_tag LOCUS_11690 <1579 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000343910.1:replicative DNA helicase >Feature sequence122 >Feature sequence123 376 152 gene locus_tag LOCUS_11700 376 152 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994645.1 protein_id gnl|my_center|LOCUS_11700 1286 546 gene locus_tag LOCUS_11710 1286 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence124 >Feature sequence125 979 641 gene locus_tag LOCUS_11720 979 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence126 333 52 gene locus_tag LOCUS_11730 333 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 720 580 gene locus_tag LOCUS_11740 720 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 830 711 gene locus_tag LOCUS_11750 830 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence127 <1 1240 gene locus_tag LOCUS_11760 <1 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903785.1:ABC transporter substrate-binding protein >Feature sequence128 170 544 gene locus_tag LOCUS_11770 170 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 564 989 gene locus_tag LOCUS_11780 564 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence129 <1084 311 gene locus_tag LOCUS_11790 <1084 311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000700554.1:AAA family ATPase >Feature sequence130 >Feature sequence131 >Feature sequence132 <1001 89 gene locus_tag LOCUS_11800 <1001 89 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861287.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA