>Feature sequence001 292 642 gene locus_tag LOCUS_00010 292 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 837 1187 gene locus_tag LOCUS_00020 837 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1547 2746 gene locus_tag LOCUS_00030 1547 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3269 3129 gene locus_tag LOCUS_00040 3269 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3795 3262 gene locus_tag LOCUS_00050 3795 3262 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598657.1 protein_id gnl|my_center|LOCUS_00050 5161 3968 gene locus_tag LOCUS_00060 5161 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5822 5331 gene locus_tag LOCUS_00070 5822 5331 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_00070 6173 8767 gene locus_tag LOCUS_00080 6173 8767 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876190.1 protein_id gnl|my_center|LOCUS_00080 10045 8831 gene locus_tag LOCUS_00090 10045 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 10234 10413 gene locus_tag LOCUS_00100 10234 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10394 12769 gene locus_tag LOCUS_00110 10394 12769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12998 16750 gene locus_tag LOCUS_00120 12998 16750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16752 19925 gene locus_tag LOCUS_00130 16752 19925 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_00130 19961 20368 gene locus_tag LOCUS_00140 19961 20368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 20382 20903 gene locus_tag LOCUS_00150 20382 20903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20918 21184 gene locus_tag LOCUS_00160 20918 21184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21181 23826 gene locus_tag LOCUS_00170 21181 23826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23813 25144 gene locus_tag LOCUS_00180 23813 25144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 25104 25343 gene locus_tag LOCUS_00190 25104 25343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 >Feature sequence002 291 1001 gene locus_tag LOCUS_00200 gene cobI 291 1001 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876960.1 protein_id gnl|my_center|LOCUS_00200 1202 6262 gene locus_tag LOCUS_00210 1202 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 6322 7290 gene locus_tag LOCUS_00220 6322 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 8090 7320 gene locus_tag LOCUS_00230 8090 7320 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876961.1 protein_id gnl|my_center|LOCUS_00230 8277 9497 gene locus_tag LOCUS_00240 8277 9497 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870253.1 protein_id gnl|my_center|LOCUS_00240 9744 10160 gene locus_tag LOCUS_00250 9744 10160 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870251.1 protein_id gnl|my_center|LOCUS_00250 10209 10820 gene locus_tag LOCUS_00260 10209 10820 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876964.1 protein_id gnl|my_center|LOCUS_00260 12327 10975 gene locus_tag LOCUS_00270 12327 10975 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876966.1 protein_id gnl|my_center|LOCUS_00270 12591 13358 gene locus_tag LOCUS_00280 gene arsM 12591 13358 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_00280 13408 13779 gene locus_tag LOCUS_00290 13408 13779 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892103.1 protein_id gnl|my_center|LOCUS_00290 13787 14176 gene locus_tag LOCUS_00300 13787 14176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 14273 14926 gene locus_tag LOCUS_00310 14273 14926 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876968.1 protein_id gnl|my_center|LOCUS_00310 15088 15468 gene locus_tag LOCUS_00320 15088 15468 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876969.1 protein_id gnl|my_center|LOCUS_00320 15473 15835 gene locus_tag LOCUS_00330 15473 15835 CDS product DsrH/TusB family sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876970.1 protein_id gnl|my_center|LOCUS_00330 15862 16476 gene locus_tag LOCUS_00340 15862 16476 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061295.1 protein_id gnl|my_center|LOCUS_00340 16515 16835 gene locus_tag LOCUS_00350 gene tusB 16515 16835 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876972.1 protein_id gnl|my_center|LOCUS_00350 18272 17109 gene locus_tag LOCUS_00360 18272 17109 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_00360 19676 18462 gene locus_tag LOCUS_00370 19676 18462 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876981.1 protein_id gnl|my_center|LOCUS_00370 20206 20712 gene locus_tag LOCUS_00380 20206 20712 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948539.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00380 20998 21915 gene locus_tag LOCUS_00390 20998 21915 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876982.1 protein_id gnl|my_center|LOCUS_00390 22003 23184 gene locus_tag LOCUS_00400 22003 23184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876983.1 protein_id gnl|my_center|LOCUS_00400 23353 23769 gene locus_tag LOCUS_00410 23353 23769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 23881 24087 gene locus_tag LOCUS_00420 23881 24087 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876941.1 protein_id gnl|my_center|LOCUS_00420 24175 25260 gene locus_tag LOCUS_00430 24175 25260 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_00430 >Feature sequence003 289 98 gene locus_tag LOCUS_00440 289 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 613 1380 gene locus_tag LOCUS_00450 613 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 1407 1697 gene locus_tag LOCUS_00460 1407 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 1996 2181 gene locus_tag LOCUS_00470 1996 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2178 2444 gene locus_tag LOCUS_00480 2178 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 2445 2921 gene locus_tag LOCUS_00490 2445 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 3188 3616 gene locus_tag LOCUS_00500 3188 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 3619 4119 gene locus_tag LOCUS_00510 3619 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 4119 4862 gene locus_tag LOCUS_00520 4119 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 4933 5079 gene locus_tag LOCUS_00530 4933 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 5081 5299 gene locus_tag LOCUS_00540 5081 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 5223 5876 gene locus_tag LOCUS_00550 5223 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 5783 7930 gene locus_tag LOCUS_00560 5783 7930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 8217 8627 gene locus_tag LOCUS_00570 8217 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 8633 8974 gene locus_tag LOCUS_00580 8633 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 9105 9473 gene locus_tag LOCUS_00590 9105 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 9484 9642 gene locus_tag LOCUS_00600 9484 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 9926 10534 gene locus_tag LOCUS_00610 9926 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 10653 10724 gene locus_tag LOCUS_t00010 10653 10724 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 10759 11163 gene locus_tag LOCUS_00620 10759 11163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 11193 11564 gene locus_tag LOCUS_00630 11193 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 11606 12199 gene locus_tag LOCUS_00640 11606 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 12165 13637 gene locus_tag LOCUS_00650 12165 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 13684 15258 gene locus_tag LOCUS_00660 13684 15258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 15167 16117 gene locus_tag LOCUS_00670 15167 16117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 16425 16114 gene locus_tag LOCUS_00680 16425 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 16520 17827 gene locus_tag LOCUS_00690 16520 17827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 17841 18830 gene locus_tag LOCUS_00700 17841 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 18853 19299 gene locus_tag LOCUS_00710 18853 19299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 19319 19768 gene locus_tag LOCUS_00720 19319 19768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 19765 20232 gene locus_tag LOCUS_00730 19765 20232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 20245 21285 gene locus_tag LOCUS_00740 20245 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 21338 21799 gene locus_tag LOCUS_00750 21338 21799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 21786 21911 gene locus_tag LOCUS_00760 21786 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence004 <1 916 gene locus_tag LOCUS_00770 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875787.1:HD domain-containing protein 973 1527 gene locus_tag LOCUS_00780 973 1527 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060752.1 protein_id gnl|my_center|LOCUS_00780 1530 2108 gene locus_tag LOCUS_00790 gene cbiT 1530 2108 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875785.1 protein_id gnl|my_center|LOCUS_00790 2309 3079 gene locus_tag LOCUS_00800 2309 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875784.1 protein_id gnl|my_center|LOCUS_00800 3264 3509 gene locus_tag LOCUS_00810 3264 3509 CDS product pseudomurein-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060751.1 protein_id gnl|my_center|LOCUS_00810 4242 3595 gene locus_tag LOCUS_00820 4242 3595 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061245.1 protein_id gnl|my_center|LOCUS_00820 4974 4348 gene locus_tag LOCUS_00830 4974 4348 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892791.1 protein_id gnl|my_center|LOCUS_00830 5814 5128 gene locus_tag LOCUS_00840 5814 5128 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875869.1 protein_id gnl|my_center|LOCUS_00840 7714 6227 gene locus_tag LOCUS_00850 gene guaB 7714 6227 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871141.1 protein_id gnl|my_center|LOCUS_00850 8717 8004 gene locus_tag LOCUS_00860 8717 8004 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875780.1 protein_id gnl|my_center|LOCUS_00860 10001 8799 gene locus_tag LOCUS_00870 10001 8799 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875779.1 protein_id gnl|my_center|LOCUS_00870 10701 9988 gene locus_tag LOCUS_00880 10701 9988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 11891 10887 gene locus_tag LOCUS_00890 11891 10887 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147151.1 protein_id gnl|my_center|LOCUS_00890 12138 13559 gene locus_tag LOCUS_00900 12138 13559 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_00900 14473 13610 gene locus_tag LOCUS_00910 14473 13610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 15430 14483 gene locus_tag LOCUS_00920 15430 14483 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_00920 15591 15427 gene locus_tag LOCUS_00930 15591 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 16110 16739 gene locus_tag LOCUS_00940 16110 16739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 16760 17866 gene locus_tag LOCUS_00950 16760 17866 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023662.1 protein_id gnl|my_center|LOCUS_00950 19058 17859 gene locus_tag LOCUS_00960 19058 17859 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_00960 20299 19109 gene locus_tag LOCUS_00970 20299 19109 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_00970 20806 20411 gene locus_tag LOCUS_00980 20806 20411 CDS product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875776.1 protein_id gnl|my_center|LOCUS_00980 21541 20864 gene locus_tag LOCUS_00990 21541 20864 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892786.1 protein_id gnl|my_center|LOCUS_00990 22293 21709 gene locus_tag LOCUS_01000 22293 21709 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_01000 22740 23096 gene locus_tag LOCUS_01010 22740 23096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01010 >Feature sequence005 17 388 gene locus_tag LOCUS_01020 17 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 802 506 gene locus_tag LOCUS_01030 802 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1922 1176 gene locus_tag LOCUS_01040 1922 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 2431 1952 gene locus_tag LOCUS_01050 2431 1952 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_01050 3361 2546 gene locus_tag LOCUS_01060 3361 2546 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876144.1 protein_id gnl|my_center|LOCUS_01060 3994 3419 gene locus_tag LOCUS_01070 gene hisB 3994 3419 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061060.1 protein_id gnl|my_center|LOCUS_01070 4193 3960 gene locus_tag LOCUS_01080 4193 3960 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870227.1 protein_id gnl|my_center|LOCUS_01080 5063 4368 gene locus_tag LOCUS_01090 5063 4368 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_01090 5964 5380 gene locus_tag LOCUS_01100 5964 5380 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879016.1 protein_id gnl|my_center|LOCUS_01100 6211 15207 gene locus_tag LOCUS_01110 6211 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 15344 16219 gene locus_tag LOCUS_01120 15344 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 16842 18371 gene locus_tag LOCUS_01130 16842 18371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 18417 19268 gene locus_tag LOCUS_01140 18417 19268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 19416 20201 gene locus_tag LOCUS_01150 19416 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 20615 21085 gene locus_tag LOCUS_01160 20615 21085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 21990 21163 gene locus_tag LOCUS_01170 21990 21163 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892320.1 protein_id gnl|my_center|LOCUS_01170 22345 22019 gene locus_tag LOCUS_01180 22345 22019 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767610.1 protein_id gnl|my_center|LOCUS_01180 22967 22626 gene locus_tag LOCUS_01190 22967 22626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence006 136 1332 gene locus_tag LOCUS_01200 136 1332 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545988.1 protein_id gnl|my_center|LOCUS_01200 1736 2362 gene locus_tag LOCUS_01210 1736 2362 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041443401.1 protein_id gnl|my_center|LOCUS_01210 2369 2794 gene locus_tag LOCUS_01220 2369 2794 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024120.1 protein_id gnl|my_center|LOCUS_01220 2939 4477 gene locus_tag LOCUS_01230 2939 4477 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065424.1 protein_id gnl|my_center|LOCUS_01230 4538 5017 gene locus_tag LOCUS_01240 4538 5017 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485761.1 protein_id gnl|my_center|LOCUS_01240 5384 5725 gene locus_tag LOCUS_01250 5384 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 5858 7894 gene locus_tag LOCUS_01260 5858 7894 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_01260 8355 8816 gene locus_tag LOCUS_01270 8355 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8840 9274 gene locus_tag LOCUS_01280 8840 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 9300 9725 gene locus_tag LOCUS_01290 9300 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 9745 10167 gene locus_tag LOCUS_01300 9745 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 10566 10841 gene locus_tag LOCUS_01310 10566 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 10916 12295 gene locus_tag LOCUS_01320 10916 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 12604 12677 gene locus_tag LOCUS_t00020 12604 12677 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13465 12800 gene locus_tag LOCUS_01330 13465 12800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 13743 13570 gene locus_tag LOCUS_01340 13743 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 14521 14147 gene locus_tag LOCUS_01350 14521 14147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 14798 15193 gene locus_tag LOCUS_01360 14798 15193 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206529.1 protein_id gnl|my_center|LOCUS_01360 16201 15239 gene locus_tag LOCUS_01370 16201 15239 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892639.1 protein_id gnl|my_center|LOCUS_01370 17205 16483 gene locus_tag LOCUS_01380 17205 16483 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061096.1 protein_id gnl|my_center|LOCUS_01380 18318 17218 gene locus_tag LOCUS_01390 gene hisC 18318 17218 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877195.1 protein_id gnl|my_center|LOCUS_01390 18923 18441 gene locus_tag LOCUS_01400 18923 18441 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877196.1 protein_id gnl|my_center|LOCUS_01400 20466 19192 gene locus_tag LOCUS_01410 20466 19192 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877197.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence007 467 87 gene locus_tag LOCUS_01420 467 87 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_01420 1018 2028 gene locus_tag LOCUS_01430 gene hypE 1018 2028 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060768.1 protein_id gnl|my_center|LOCUS_01430 2329 2772 gene locus_tag LOCUS_01440 2329 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3277 3014 gene locus_tag LOCUS_01450 3277 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 3555 4184 gene locus_tag LOCUS_01460 3555 4184 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060776.1 protein_id gnl|my_center|LOCUS_01460 4456 5718 gene locus_tag LOCUS_01470 gene hemL 4456 5718 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_01470 5965 6678 gene locus_tag LOCUS_01480 gene mtxX 5965 6678 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875870.1 protein_id gnl|my_center|LOCUS_01480 6919 7707 gene locus_tag LOCUS_01490 gene uppS 6919 7707 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875871.1 protein_id gnl|my_center|LOCUS_01490 7879 8637 gene locus_tag LOCUS_01500 7879 8637 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_01500 9183 8800 gene locus_tag LOCUS_01510 9183 8800 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463606.1 protein_id gnl|my_center|LOCUS_01510 9376 9642 gene locus_tag LOCUS_01520 9376 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 9831 10484 gene locus_tag LOCUS_01530 9831 10484 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875874.1 protein_id gnl|my_center|LOCUS_01530 10762 10610 gene locus_tag LOCUS_01540 10762 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 11491 10994 gene locus_tag LOCUS_01550 11491 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 11746 11985 gene locus_tag LOCUS_01560 11746 11985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01560 11978 12628 gene locus_tag LOCUS_01570 11978 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 13546 12743 gene locus_tag LOCUS_01580 13546 12743 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875802.1 protein_id gnl|my_center|LOCUS_01580 15039 13636 gene locus_tag LOCUS_01590 gene recJ 15039 13636 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875803.1 protein_id gnl|my_center|LOCUS_01590 15572 15300 gene locus_tag LOCUS_01600 15572 15300 CDS product signal recognition particle subunit SRP19/SEC65 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875804.1 protein_id gnl|my_center|LOCUS_01600 16416 15631 gene locus_tag LOCUS_01610 16416 15631 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875805.1 protein_id gnl|my_center|LOCUS_01610 17117 16413 gene locus_tag LOCUS_01620 gene cobA 17117 16413 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060761.1 protein_id gnl|my_center|LOCUS_01620 17931 17281 gene locus_tag LOCUS_01630 gene purQ 17931 17281 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875807.1 protein_id gnl|my_center|LOCUS_01630 18200 17946 gene locus_tag LOCUS_01640 gene purS 18200 17946 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875808.1 protein_id gnl|my_center|LOCUS_01640 18984 18238 gene locus_tag LOCUS_01650 18984 18238 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875809.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence008 1212 757 gene locus_tag LOCUS_01660 1212 757 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060917.1 protein_id gnl|my_center|LOCUS_01660 1521 1913 gene locus_tag LOCUS_01670 gene eif5A 1521 1913 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_01670 1991 2875 gene locus_tag LOCUS_01680 gene speB 1991 2875 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876501.1 protein_id gnl|my_center|LOCUS_01680 3250 4467 gene locus_tag LOCUS_01690 3250 4467 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_01690 5363 4551 gene locus_tag LOCUS_01700 5363 4551 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_01700 5619 7238 gene locus_tag LOCUS_01710 gene ade 5619 7238 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876499.1 protein_id gnl|my_center|LOCUS_01710 8003 7386 gene locus_tag LOCUS_01720 8003 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 8564 8103 gene locus_tag LOCUS_01730 8564 8103 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876495.1 protein_id gnl|my_center|LOCUS_01730 8905 8753 gene locus_tag LOCUS_01740 8905 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 9153 9719 gene locus_tag LOCUS_01750 9153 9719 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060887.1 protein_id gnl|my_center|LOCUS_01750 9787 11205 gene locus_tag LOCUS_01760 9787 11205 CDS product DUF2142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963353.1 protein_id gnl|my_center|LOCUS_01760 11340 12266 gene locus_tag LOCUS_01770 gene guaA 11340 12266 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060888.1 protein_id gnl|my_center|LOCUS_01770 12784 12452 gene locus_tag LOCUS_01780 12784 12452 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098568.1 protein_id gnl|my_center|LOCUS_01780 13025 13252 gene locus_tag LOCUS_01790 13025 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 13490 14665 gene locus_tag LOCUS_01800 13490 14665 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061240.1 protein_id gnl|my_center|LOCUS_01800 14774 15730 gene locus_tag LOCUS_01810 14774 15730 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876360.1 protein_id gnl|my_center|LOCUS_01810 16432 15914 gene locus_tag LOCUS_01820 gene cgi121 16432 15914 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876361.1 protein_id gnl|my_center|LOCUS_01820 17152 16535 gene locus_tag LOCUS_01830 17152 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 18838 17336 gene locus_tag LOCUS_01840 18838 17336 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876362.1 protein_id gnl|my_center|LOCUS_01840 >Feature sequence009 1140 340 gene locus_tag LOCUS_01850 1140 340 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904003.1 protein_id gnl|my_center|LOCUS_01850 1693 1544 gene locus_tag LOCUS_01860 1693 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 2400 1801 gene locus_tag LOCUS_01870 2400 1801 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990722.1 protein_id gnl|my_center|LOCUS_01870 3010 2411 gene locus_tag LOCUS_01880 3010 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3764 3012 gene locus_tag LOCUS_01890 3764 3012 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876558.1 protein_id gnl|my_center|LOCUS_01890 4347 3781 gene locus_tag LOCUS_01900 4347 3781 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255938.1 protein_id gnl|my_center|LOCUS_01900 7140 4537 gene locus_tag LOCUS_01910 7140 4537 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061029.1 protein_id gnl|my_center|LOCUS_01910 9904 7439 gene locus_tag LOCUS_01920 9904 7439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 11295 10297 gene locus_tag LOCUS_01930 11295 10297 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 protein_id gnl|my_center|LOCUS_01930 11530 11339 gene locus_tag LOCUS_01940 11530 11339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 12080 11871 gene locus_tag LOCUS_01950 12080 11871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 12201 12695 gene locus_tag LOCUS_01960 gene tsaA 12201 12695 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_01960 14577 12886 gene locus_tag LOCUS_01970 14577 12886 CDS product DUF128 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061091.1 protein_id gnl|my_center|LOCUS_01970 16002 14746 gene locus_tag LOCUS_01980 gene glnA 16002 14746 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877179.1 protein_id gnl|my_center|LOCUS_01980 17024 16272 gene locus_tag LOCUS_01990 17024 16272 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877180.1 protein_id gnl|my_center|LOCUS_01990 17247 17474 gene locus_tag LOCUS_02000 17247 17474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060757.1 protein_id gnl|my_center|LOCUS_02000 17773 17597 gene locus_tag LOCUS_02010 17773 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 18014 17721 gene locus_tag LOCUS_02020 18014 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 18982 18047 gene locus_tag LOCUS_02030 18982 18047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence010 706 485 gene locus_tag LOCUS_02040 706 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 1281 799 gene locus_tag LOCUS_02050 1281 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02050 2117 1371 gene locus_tag LOCUS_02060 2117 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876163.1 protein_id gnl|my_center|LOCUS_02060 2481 3551 gene locus_tag LOCUS_02070 gene cfbD 2481 3551 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877132.1 protein_id gnl|my_center|LOCUS_02070 3802 4809 gene locus_tag LOCUS_02080 3802 4809 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877133.1 protein_id gnl|my_center|LOCUS_02080 4909 5517 gene locus_tag LOCUS_02090 gene hisH 4909 5517 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_02090 5707 7068 gene locus_tag LOCUS_02100 5707 7068 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061078.1 protein_id gnl|my_center|LOCUS_02100 7253 7690 gene locus_tag LOCUS_02110 7253 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 7924 8520 gene locus_tag LOCUS_02120 7924 8520 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932444.1 protein_id gnl|my_center|LOCUS_02120 8569 9033 gene locus_tag LOCUS_02130 8569 9033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 9195 9268 gene locus_tag LOCUS_t00030 9195 9268 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9736 9422 gene locus_tag LOCUS_02140 9736 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 10773 9739 gene locus_tag LOCUS_02150 10773 9739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 12634 10961 gene locus_tag LOCUS_02160 12634 10961 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061070.1 protein_id gnl|my_center|LOCUS_02160 12869 14467 gene locus_tag LOCUS_02170 gene sepS 12869 14467 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877111.1 protein_id gnl|my_center|LOCUS_02170 15424 14741 gene locus_tag LOCUS_02180 15424 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 15911 16288 gene locus_tag LOCUS_02190 15911 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 16478 17161 gene locus_tag LOCUS_02200 gene ribB 16478 17161 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877109.1 protein_id gnl|my_center|LOCUS_02200 <17921 17292 gene locus_tag LOCUS_02210 <17921 17292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061066.1:AAA family ATPase >Feature sequence011 1724 1269 gene locus_tag LOCUS_02220 1724 1269 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202877.1 protein_id gnl|my_center|LOCUS_02220 2426 1863 gene locus_tag LOCUS_02230 2426 1863 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020386.1 protein_id gnl|my_center|LOCUS_02230 2543 2992 gene locus_tag LOCUS_02240 2543 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3158 3373 gene locus_tag LOCUS_02250 3158 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876238.1 protein_id gnl|my_center|LOCUS_02250 3659 4489 gene locus_tag LOCUS_02260 3659 4489 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061092.1 protein_id gnl|my_center|LOCUS_02260 5299 4547 gene locus_tag LOCUS_02270 5299 4547 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020462.1 protein_id gnl|my_center|LOCUS_02270 5884 5354 gene locus_tag LOCUS_02280 5884 5354 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_02280 6622 5987 gene locus_tag LOCUS_02290 6622 5987 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990728.1 protein_id gnl|my_center|LOCUS_02290 7211 6768 gene locus_tag LOCUS_02300 7211 6768 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020469.1 protein_id gnl|my_center|LOCUS_02300 7879 7313 gene locus_tag LOCUS_02310 7879 7313 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020463.1 protein_id gnl|my_center|LOCUS_02310 9122 7953 gene locus_tag LOCUS_02320 9122 7953 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460576.1 protein_id gnl|my_center|LOCUS_02320 10735 9575 gene locus_tag LOCUS_02330 10735 9575 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_02330 11960 11022 gene locus_tag LOCUS_02340 11960 11022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 12145 12540 gene locus_tag LOCUS_02350 12145 12540 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020467.1 protein_id gnl|my_center|LOCUS_02350 13449 12622 gene locus_tag LOCUS_02360 gene dapB 13449 12622 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876435.1 protein_id gnl|my_center|LOCUS_02360 14918 13482 gene locus_tag LOCUS_02370 14918 13482 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437634.1 protein_id gnl|my_center|LOCUS_02370 15728 15042 gene locus_tag LOCUS_02380 15728 15042 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876108.1 protein_id gnl|my_center|LOCUS_02380 16443 15799 gene locus_tag LOCUS_02390 16443 15799 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990882.1 protein_id gnl|my_center|LOCUS_02390 16484 16660 gene locus_tag LOCUS_02400 16484 16660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence012 1936 461 gene locus_tag LOCUS_02410 1936 461 CDS product nitrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877172.1 protein_id gnl|my_center|LOCUS_02410 2802 2434 gene locus_tag LOCUS_02420 2802 2434 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877171.1 protein_id gnl|my_center|LOCUS_02420 3130 2813 gene locus_tag LOCUS_02430 3130 2813 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061089.1 protein_id gnl|my_center|LOCUS_02430 4024 3197 gene locus_tag LOCUS_02440 gene nifH 4024 3197 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061088.1 protein_id gnl|my_center|LOCUS_02440 4606 6180 gene locus_tag LOCUS_02450 4606 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876291.1 protein_id gnl|my_center|LOCUS_02450 6500 8215 gene locus_tag LOCUS_02460 gene oadA 6500 8215 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876731.1 protein_id gnl|my_center|LOCUS_02460 9153 8464 gene locus_tag LOCUS_02470 gene queC 9153 8464 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876732.1 protein_id gnl|my_center|LOCUS_02470 10517 9315 gene locus_tag LOCUS_02480 gene larC 10517 9315 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 protein_id gnl|my_center|LOCUS_02480 11119 10952 gene locus_tag LOCUS_02490 11119 10952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 11640 11116 gene locus_tag LOCUS_02500 11640 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 11701 12768 gene locus_tag LOCUS_02510 11701 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 12995 13783 gene locus_tag LOCUS_02520 gene cobS 12995 13783 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876736.1 protein_id gnl|my_center|LOCUS_02520 14006 14557 gene locus_tag LOCUS_02530 14006 14557 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061280.1 protein_id gnl|my_center|LOCUS_02530 14919 15104 gene locus_tag LOCUS_02540 14919 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02540 15115 15537 gene locus_tag LOCUS_02550 15115 15537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02550 16077 15562 gene locus_tag LOCUS_02560 16077 15562 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_02560 >Feature sequence013 <1 1653 gene locus_tag LOCUS_02570 <1 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146523.1:DEAD/DEAH box helicase 1863 2591 gene locus_tag LOCUS_02580 1863 2591 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061045.1 protein_id gnl|my_center|LOCUS_02580 2895 3815 gene locus_tag LOCUS_02590 gene pyrB 2895 3815 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877025.1 protein_id gnl|my_center|LOCUS_02590 5300 4155 gene locus_tag LOCUS_02600 gene cdc6-1 5300 4155 CDS product ORC1-type DNA replication protein Cdc6-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_02600 6745 7692 gene locus_tag LOCUS_02610 gene cbiB 6745 7692 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_02610 7814 8899 gene locus_tag LOCUS_02620 7814 8899 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877020.1 protein_id gnl|my_center|LOCUS_02620 9065 9322 gene locus_tag LOCUS_02630 9065 9322 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_02630 9916 9305 gene locus_tag LOCUS_02640 9916 9305 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892716.1 protein_id gnl|my_center|LOCUS_02640 11591 10074 gene locus_tag LOCUS_02650 11591 10074 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877017.1 protein_id gnl|my_center|LOCUS_02650 11696 12202 gene locus_tag LOCUS_02660 11696 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892718.1 protein_id gnl|my_center|LOCUS_02660 12291 13352 gene locus_tag LOCUS_02670 gene cobJ 12291 13352 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877015.1 protein_id gnl|my_center|LOCUS_02670 13858 13550 gene locus_tag LOCUS_02680 13858 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 15263 14076 gene locus_tag LOCUS_02690 15263 14076 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_02690 <16164 15276 gene locus_tag LOCUS_02700 <16164 15276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193330372.1:DHH family phosphoesterase >Feature sequence014 <1 1100 gene locus_tag LOCUS_02710 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060895.1:valine--tRNA ligase 1256 2536 gene locus_tag LOCUS_02720 gene aroA 1256 2536 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_02720 2533 3000 gene locus_tag LOCUS_02730 2533 3000 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876403.1 protein_id gnl|my_center|LOCUS_02730 3122 3769 gene locus_tag LOCUS_02740 3122 3769 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485759.1 protein_id gnl|my_center|LOCUS_02740 4230 6443 gene locus_tag LOCUS_02750 4230 6443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 9013 6839 gene locus_tag LOCUS_02760 9013 6839 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060894.1 protein_id gnl|my_center|LOCUS_02760 9621 9130 gene locus_tag LOCUS_02770 9621 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876397.1 protein_id gnl|my_center|LOCUS_02770 12147 9895 gene locus_tag LOCUS_02780 12147 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 12702 12322 gene locus_tag LOCUS_02790 12702 12322 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876395.1 protein_id gnl|my_center|LOCUS_02790 13299 12715 gene locus_tag LOCUS_02800 13299 12715 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060893.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence015 1980 808 gene locus_tag LOCUS_02810 1980 808 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876364.1 protein_id gnl|my_center|LOCUS_02810 2869 2213 gene locus_tag LOCUS_02820 2869 2213 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876365.1 protein_id gnl|my_center|LOCUS_02820 3104 3859 gene locus_tag LOCUS_02830 3104 3859 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060890.1 protein_id gnl|my_center|LOCUS_02830 5208 3955 gene locus_tag LOCUS_02840 5208 3955 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060944.1 protein_id gnl|my_center|LOCUS_02840 5603 5908 gene locus_tag LOCUS_02850 gene eif1A 5603 5908 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876635.1 protein_id gnl|my_center|LOCUS_02850 6058 6834 gene locus_tag LOCUS_02860 6058 6834 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_02860 6895 7473 gene locus_tag LOCUS_02870 6895 7473 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_02870 7592 9157 gene locus_tag LOCUS_02880 gene top6B 7592 9157 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876638.1 protein_id gnl|my_center|LOCUS_02880 9150 10202 gene locus_tag LOCUS_02890 9150 10202 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_02890 10667 11683 gene locus_tag LOCUS_02900 10667 11683 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 protein_id gnl|my_center|LOCUS_02900 11915 12553 gene locus_tag LOCUS_02910 11915 12553 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence016 348 782 gene locus_tag LOCUS_02920 348 782 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485814.1 protein_id gnl|my_center|LOCUS_02920 1876 929 gene locus_tag LOCUS_02930 1876 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2117 2413 gene locus_tag LOCUS_02940 2117 2413 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_02940 2431 2754 gene locus_tag LOCUS_02950 2431 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877049.1 protein_id gnl|my_center|LOCUS_02950 3148 3723 gene locus_tag LOCUS_02960 gene bcrC 3148 3723 CDS product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 protein_id gnl|my_center|LOCUS_02960 3743 4360 gene locus_tag LOCUS_02970 3743 4360 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007140.1 protein_id gnl|my_center|LOCUS_02970 4379 4642 gene locus_tag LOCUS_02980 4379 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 5605 5162 gene locus_tag LOCUS_02990 5605 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02990 5957 5628 gene locus_tag LOCUS_03000 5957 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 6904 5954 gene locus_tag LOCUS_03010 6904 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 7543 7908 gene locus_tag LOCUS_03020 7543 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 7942 8781 gene locus_tag LOCUS_03030 gene nudC 7942 8781 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021453.1 protein_id gnl|my_center|LOCUS_03030 9166 10128 gene locus_tag LOCUS_03040 9166 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 10331 10642 gene locus_tag LOCUS_03050 10331 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 10757 11203 gene locus_tag LOCUS_03060 10757 11203 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876624.1 protein_id gnl|my_center|LOCUS_03060 11739 11284 gene locus_tag LOCUS_03070 11739 11284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876158.1 protein_id gnl|my_center|LOCUS_03070 12049 11762 gene locus_tag LOCUS_03080 12049 11762 CDS product DUF4064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876159.1 protein_id gnl|my_center|LOCUS_03080 12395 12871 gene locus_tag LOCUS_03090 12395 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 <13588 12910 gene locus_tag LOCUS_03100 <13588 12910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546236.1:DUF763 domain-containing protein >Feature sequence017 2808 2981 gene locus_tag LOCUS_03110 2808 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3029 4009 gene locus_tag LOCUS_03120 3029 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6823 4277 gene locus_tag LOCUS_03130 6823 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 8898 6952 gene locus_tag LOCUS_03140 8898 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 9400 10764 gene locus_tag LOCUS_03150 9400 10764 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876469.1 protein_id gnl|my_center|LOCUS_03150 11553 12881 gene locus_tag LOCUS_03160 11553 12881 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence018 59 910 gene locus_tag LOCUS_03170 59 910 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_03170 907 2424 gene locus_tag LOCUS_03180 gene cfbE 907 2424 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485764.1 protein_id gnl|my_center|LOCUS_03180 2665 3537 gene locus_tag LOCUS_03190 gene hemC 2665 3537 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876507.1 protein_id gnl|my_center|LOCUS_03190 3534 4487 gene locus_tag LOCUS_03200 3534 4487 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876508.1 protein_id gnl|my_center|LOCUS_03200 4579 5178 gene locus_tag LOCUS_03210 4579 5178 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_03210 6750 5521 gene locus_tag LOCUS_03220 gene prf1 6750 5521 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_03220 7969 7091 gene locus_tag LOCUS_03230 7969 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10723 7985 gene locus_tag LOCUS_03240 10723 7985 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964115.1 protein_id gnl|my_center|LOCUS_03240 11064 11741 gene locus_tag LOCUS_03250 gene pyrH 11064 11741 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876512.1 protein_id gnl|my_center|LOCUS_03250 11842 12039 gene locus_tag LOCUS_03260 11842 12039 CDS product DUF2116 family Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876513.1 protein_id gnl|my_center|LOCUS_03260 13321 12326 gene locus_tag LOCUS_03270 13321 12326 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence019 <1 1100 gene locus_tag LOCUS_03280 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876684.1:translation elongation factor EF-1 subunit alpha 1182 1490 gene locus_tag LOCUS_03290 gene rpsJ 1182 1490 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_03290 1523 1609 gene locus_tag LOCUS_t00040 1523 1609 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1781 2257 gene locus_tag LOCUS_03300 1781 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 2428 3093 gene locus_tag LOCUS_03310 2428 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 3309 3767 gene locus_tag LOCUS_03320 3309 3767 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060861.1 protein_id gnl|my_center|LOCUS_03320 3902 4414 gene locus_tag LOCUS_03330 3902 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4613 5440 gene locus_tag LOCUS_03340 4613 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 5454 5951 gene locus_tag LOCUS_03350 5454 5951 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876564.1 protein_id gnl|my_center|LOCUS_03350 6076 6618 gene locus_tag LOCUS_03360 6076 6618 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_03360 6779 6627 gene locus_tag LOCUS_03370 6779 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6814 7182 gene locus_tag LOCUS_03380 6814 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7365 8096 gene locus_tag LOCUS_03390 7365 8096 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022003.1 protein_id gnl|my_center|LOCUS_03390 9409 8165 gene locus_tag LOCUS_03400 9409 8165 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020474.1 protein_id gnl|my_center|LOCUS_03400 10057 9497 gene locus_tag LOCUS_03410 10057 9497 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020425.1 protein_id gnl|my_center|LOCUS_03410 11649 10192 gene locus_tag LOCUS_03420 11649 10192 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024491.1 protein_id gnl|my_center|LOCUS_03420 12150 11695 gene locus_tag LOCUS_03430 12150 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 12429 12923 gene locus_tag LOCUS_03440 12429 12923 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877509.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence020 <1 1308 gene locus_tag LOCUS_03450 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875810.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 1655 1936 gene locus_tag LOCUS_03460 1655 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 2334 2909 gene locus_tag LOCUS_03470 2334 2909 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021440.1 protein_id gnl|my_center|LOCUS_03470 3061 3513 gene locus_tag LOCUS_03480 3061 3513 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021439.1 protein_id gnl|my_center|LOCUS_03480 3577 5235 gene locus_tag LOCUS_03490 3577 5235 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876295.1 protein_id gnl|my_center|LOCUS_03490 5720 8206 gene locus_tag LOCUS_03500 5720 8206 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060872.1 protein_id gnl|my_center|LOCUS_03500 9174 8479 gene locus_tag LOCUS_03510 gene arfB 9174 8479 CDS product 2-amino-5-formylamino-6-ribosylaminopyrimidin-4(3H)-one 5'-monophosphate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876289.1 protein_id gnl|my_center|LOCUS_03510 9756 9280 gene locus_tag LOCUS_03520 9756 9280 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876288.1 protein_id gnl|my_center|LOCUS_03520 9908 10150 gene locus_tag LOCUS_03530 9908 10150 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_03530 10243 10425 gene locus_tag LOCUS_03540 10243 10425 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_03540 10466 11356 gene locus_tag LOCUS_03550 10466 11356 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876285.1 protein_id gnl|my_center|LOCUS_03550 11419 12819 gene locus_tag LOCUS_03560 gene purF 11419 12819 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060868.1 protein_id gnl|my_center|LOCUS_03560 >Feature sequence021 303 791 gene locus_tag LOCUS_03570 303 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 1049 1321 gene locus_tag LOCUS_03580 1049 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1469 3748 gene locus_tag LOCUS_03590 1469 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4647 4450 gene locus_tag LOCUS_03600 4647 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4646 5686 gene locus_tag LOCUS_03610 4646 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 6604 5693 gene locus_tag LOCUS_03620 6604 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 8462 7560 gene locus_tag LOCUS_03630 8462 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 9532 8462 gene locus_tag LOCUS_03640 9532 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 10592 9522 gene locus_tag LOCUS_03650 10592 9522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 11628 10627 gene locus_tag LOCUS_03660 11628 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 12761 11625 gene locus_tag LOCUS_03670 12761 11625 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876015.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence022 1943 558 gene locus_tag LOCUS_03680 gene cysS 1943 558 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_03680 2345 2275 gene locus_tag LOCUS_t00050 2345 2275 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3068 2673 gene locus_tag LOCUS_03690 3068 2673 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_03690 3574 3987 gene locus_tag LOCUS_03700 3574 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03700 4076 4984 gene locus_tag LOCUS_03710 4076 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03710 5182 6651 gene locus_tag LOCUS_03720 5182 6651 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990604.1 protein_id gnl|my_center|LOCUS_03720 6821 7984 gene locus_tag LOCUS_03730 gene nifS 6821 7984 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_03730 7986 8375 gene locus_tag LOCUS_03740 gene nifU 7986 8375 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_03740 9181 8456 gene locus_tag LOCUS_03750 9181 8456 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_03750 9406 9254 gene locus_tag LOCUS_03760 9406 9254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 9597 9887 gene locus_tag LOCUS_03770 9597 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 9887 10144 gene locus_tag LOCUS_03780 9887 10144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 10305 10604 gene locus_tag LOCUS_03790 10305 10604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11827 10874 gene locus_tag LOCUS_03800 11827 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 11787 12002 gene locus_tag LOCUS_03810 11787 12002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 12231 12100 gene locus_tag LOCUS_03820 12231 12100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence023 <1 975 gene locus_tag LOCUS_03830 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061009.1:argininosuccinate synthase 3053 1554 gene locus_tag LOCUS_03840 3053 1554 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876880.1 protein_id gnl|my_center|LOCUS_03840 3284 5224 gene locus_tag LOCUS_03850 3284 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 6416 5523 gene locus_tag LOCUS_03860 gene fhcD 6416 5523 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061010.1 protein_id gnl|my_center|LOCUS_03860 7724 6705 gene locus_tag LOCUS_03870 7724 6705 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_03870 8460 7978 gene locus_tag LOCUS_03880 8460 7978 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084126250.1 protein_id gnl|my_center|LOCUS_03880 8949 9209 gene locus_tag LOCUS_03890 8949 9209 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_03890 9607 10386 gene locus_tag LOCUS_03900 9607 10386 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061142.1 protein_id gnl|my_center|LOCUS_03900 10619 12052 gene locus_tag LOCUS_03910 10619 12052 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061013.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence024 357 764 gene locus_tag LOCUS_03920 357 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 781 1161 gene locus_tag LOCUS_03930 781 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1199 1369 gene locus_tag LOCUS_03940 1199 1369 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496448.1 protein_id gnl|my_center|LOCUS_03940 1470 2156 gene locus_tag LOCUS_03950 1470 2156 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895864.1 protein_id gnl|my_center|LOCUS_03950 3021 2317 gene locus_tag LOCUS_03960 3021 2317 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892283.1 protein_id gnl|my_center|LOCUS_03960 3692 3204 gene locus_tag LOCUS_03970 3692 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023265.1 protein_id gnl|my_center|LOCUS_03970 3814 3659 gene locus_tag LOCUS_03980 3814 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4085 6034 gene locus_tag LOCUS_03990 4085 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 6597 6427 gene locus_tag LOCUS_04000 6597 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 6816 7892 gene locus_tag LOCUS_04010 6816 7892 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065824.1 protein_id gnl|my_center|LOCUS_04010 8216 8725 gene locus_tag LOCUS_04020 8216 8725 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060842.1 protein_id gnl|my_center|LOCUS_04020 8728 8874 gene locus_tag LOCUS_04030 8728 8874 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876192.1 protein_id gnl|my_center|LOCUS_04030 9153 9890 gene locus_tag LOCUS_04040 9153 9890 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_04040 10201 10881 gene locus_tag LOCUS_04050 10201 10881 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876165.1 protein_id gnl|my_center|LOCUS_04050 11038 11241 gene locus_tag LOCUS_04060 11038 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 12043 11381 gene locus_tag LOCUS_04070 12043 11381 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060837.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence025 155 514 gene locus_tag LOCUS_04080 155 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 786 1703 gene locus_tag LOCUS_04090 gene nadA 786 1703 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_04090 1719 2588 gene locus_tag LOCUS_04100 1719 2588 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_04100 2925 3461 gene locus_tag LOCUS_04110 2925 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 3951 3658 gene locus_tag LOCUS_04120 3951 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04120 4178 4032 gene locus_tag LOCUS_04130 4178 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 5687 4353 gene locus_tag LOCUS_04140 5687 4353 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965647.1 protein_id gnl|my_center|LOCUS_04140 7299 6313 gene locus_tag LOCUS_04150 7299 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 7874 7296 gene locus_tag LOCUS_04160 7874 7296 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583447.1 protein_id gnl|my_center|LOCUS_04160 9802 8858 gene locus_tag LOCUS_04170 9802 8858 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877094.1 protein_id gnl|my_center|LOCUS_04170 11066 9918 gene locus_tag LOCUS_04180 11066 9918 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_04180 11112 11264 gene locus_tag LOCUS_04190 11112 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence026 1627 461 gene locus_tag LOCUS_04200 1627 461 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061302.1 protein_id gnl|my_center|LOCUS_04200 1797 2348 gene locus_tag LOCUS_04210 1797 2348 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_04210 2358 4181 gene locus_tag LOCUS_04220 2358 4181 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022623.1 protein_id gnl|my_center|LOCUS_04220 4409 5779 gene locus_tag LOCUS_04230 gene cfbB 4409 5779 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877070.1 protein_id gnl|my_center|LOCUS_04230 6032 6862 gene locus_tag LOCUS_04240 6032 6862 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877074.1 protein_id gnl|my_center|LOCUS_04240 7188 9167 gene locus_tag LOCUS_04250 7188 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 9444 10199 gene locus_tag LOCUS_04260 9444 10199 CDS product DUF2162 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261160.1 protein_id gnl|my_center|LOCUS_04260 10281 10943 gene locus_tag LOCUS_04270 10281 10943 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_04270 10915 11217 gene locus_tag LOCUS_04280 10915 11217 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_04280 11336 12469 gene locus_tag LOCUS_04290 11336 12469 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066011.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence027 911 117 gene locus_tag LOCUS_04300 911 117 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876218.1 protein_id gnl|my_center|LOCUS_04300 1483 944 gene locus_tag LOCUS_04310 1483 944 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876217.1 protein_id gnl|my_center|LOCUS_04310 2298 4439 gene locus_tag LOCUS_04320 2298 4439 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_04320 4860 5474 gene locus_tag LOCUS_04330 4860 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5611 5970 gene locus_tag LOCUS_04340 5611 5970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 7302 6049 gene locus_tag LOCUS_04350 7302 6049 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986386.1 protein_id gnl|my_center|LOCUS_04350 8913 7594 gene locus_tag LOCUS_04360 gene aspS 8913 7594 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875865.1 protein_id gnl|my_center|LOCUS_04360 10609 9314 gene locus_tag LOCUS_04370 gene hisD 10609 9314 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060775.1 protein_id gnl|my_center|LOCUS_04370 11230 11559 gene locus_tag LOCUS_04380 11230 11559 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875863.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence028 1849 497 gene locus_tag LOCUS_04390 1849 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 3208 1988 gene locus_tag LOCUS_04400 3208 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3852 3205 gene locus_tag LOCUS_04410 3852 3205 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085042.1 protein_id gnl|my_center|LOCUS_04410 3973 4431 gene locus_tag LOCUS_04420 3973 4431 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022180.1 protein_id gnl|my_center|LOCUS_04420 4607 5263 gene locus_tag LOCUS_04430 4607 5263 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876859.1 protein_id gnl|my_center|LOCUS_04430 5641 5357 gene locus_tag LOCUS_04440 5641 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061001.1 protein_id gnl|my_center|LOCUS_04440 6160 5879 gene locus_tag LOCUS_04450 6160 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061001.1 protein_id gnl|my_center|LOCUS_04450 6805 8862 gene locus_tag LOCUS_04460 6805 8862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 9260 9787 gene locus_tag LOCUS_04470 9260 9787 CDS product DUF6448 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967592.1 protein_id gnl|my_center|LOCUS_04470 9868 10155 gene locus_tag LOCUS_04480 9868 10155 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_04480 11018 10203 gene locus_tag LOCUS_04490 11018 10203 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485777.1 protein_id gnl|my_center|LOCUS_04490 <12243 11271 gene locus_tag LOCUS_04500 <12243 11271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876856.1:homoserine dehydrogenase >Feature sequence029 1006 1167 gene locus_tag LOCUS_04510 1006 1167 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295425.1 protein_id gnl|my_center|LOCUS_04510 1831 1214 gene locus_tag LOCUS_04520 1831 1214 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060758.1 protein_id gnl|my_center|LOCUS_04520 2664 1987 gene locus_tag LOCUS_04530 2664 1987 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875798.1 protein_id gnl|my_center|LOCUS_04530 3540 3031 gene locus_tag LOCUS_04540 3540 3031 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_04540 3755 3594 gene locus_tag LOCUS_04550 3755 3594 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_04550 4080 3919 gene locus_tag LOCUS_04560 4080 3919 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295425.1 protein_id gnl|my_center|LOCUS_04560 4498 4824 gene locus_tag LOCUS_04570 4498 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 5313 4951 gene locus_tag LOCUS_04580 5313 4951 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582775.1 protein_id gnl|my_center|LOCUS_04580 5867 5472 gene locus_tag LOCUS_04590 5867 5472 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875792.1 protein_id gnl|my_center|LOCUS_04590 6434 5883 gene locus_tag LOCUS_04600 6434 5883 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892795.1 protein_id gnl|my_center|LOCUS_04600 8169 6436 gene locus_tag LOCUS_04610 8169 6436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060755.1 protein_id gnl|my_center|LOCUS_04610 8796 8927 gene locus_tag LOCUS_04620 8796 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 9461 9835 gene locus_tag LOCUS_04630 9461 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 11229 9925 gene locus_tag LOCUS_04640 gene hcp 11229 9925 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750458.1 protein_id gnl|my_center|LOCUS_04640 11404 11246 gene locus_tag LOCUS_04650 11404 11246 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_04650 11863 11669 gene locus_tag LOCUS_04660 11863 11669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060921.1 protein_id gnl|my_center|LOCUS_04660 12137 11886 gene locus_tag LOCUS_04670 12137 11886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 >Feature sequence030 1475 1621 gene locus_tag LOCUS_04680 1475 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 1868 3184 gene locus_tag LOCUS_04690 gene priL 1868 3184 CDS product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876225.1 protein_id gnl|my_center|LOCUS_04690 3634 3320 gene locus_tag LOCUS_04700 3634 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 4889 3903 gene locus_tag LOCUS_04710 gene bsh 4889 3903 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355428.1 protein_id gnl|my_center|LOCUS_04710 7105 5270 gene locus_tag LOCUS_04720 7105 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 8208 7243 gene locus_tag LOCUS_04730 8208 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 9379 8192 gene locus_tag LOCUS_04740 9379 8192 CDS product YaaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000554292.1 protein_id gnl|my_center|LOCUS_04740 10066 10569 gene locus_tag LOCUS_04750 10066 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 11361 11035 gene locus_tag LOCUS_04760 11361 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 11657 11367 gene locus_tag LOCUS_04770 11657 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence031 146 787 gene locus_tag LOCUS_04780 146 787 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060845.1 protein_id gnl|my_center|LOCUS_04780 1080 1277 gene locus_tag LOCUS_04790 1080 1277 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_04790 2434 1475 gene locus_tag LOCUS_04800 2434 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 3285 2662 gene locus_tag LOCUS_04810 3285 2662 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812028.1 protein_id gnl|my_center|LOCUS_04810 4423 3494 gene locus_tag LOCUS_04820 4423 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875877.1 protein_id gnl|my_center|LOCUS_04820 4680 5051 gene locus_tag LOCUS_04830 4680 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 5259 6008 gene locus_tag LOCUS_04840 5259 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892482.1 protein_id gnl|my_center|LOCUS_04840 7710 6154 gene locus_tag LOCUS_04850 7710 6154 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875879.1 protein_id gnl|my_center|LOCUS_04850 8678 7725 gene locus_tag LOCUS_04860 8678 7725 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060778.1 protein_id gnl|my_center|LOCUS_04860 10267 8963 gene locus_tag LOCUS_04870 10267 8963 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877430.1 protein_id gnl|my_center|LOCUS_04870 <11815 10677 gene locus_tag LOCUS_04880 <11815 10677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582502.1:Ni/Fe hydrogenase subunit alpha >Feature sequence032 15 590 gene locus_tag LOCUS_04890 15 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 744 1502 gene locus_tag LOCUS_04900 744 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 1751 2164 gene locus_tag LOCUS_04910 1751 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875858.1 protein_id gnl|my_center|LOCUS_04910 2430 3851 gene locus_tag LOCUS_04920 2430 3851 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024491.1 protein_id gnl|my_center|LOCUS_04920 3915 4082 gene locus_tag LOCUS_04930 3915 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 4228 4662 gene locus_tag LOCUS_04940 gene mcrD 4228 4662 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876791.1 protein_id gnl|my_center|LOCUS_04940 4812 5447 gene locus_tag LOCUS_04950 4812 5447 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021943.1 protein_id gnl|my_center|LOCUS_04950 6269 5568 gene locus_tag LOCUS_04960 6269 5568 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060845.1 protein_id gnl|my_center|LOCUS_04960 6788 6300 gene locus_tag LOCUS_04970 6788 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 7485 6895 gene locus_tag LOCUS_04980 7485 6895 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875693.1 protein_id gnl|my_center|LOCUS_04980 7756 8277 gene locus_tag LOCUS_04990 7756 8277 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485761.1 protein_id gnl|my_center|LOCUS_04990 9195 9476 gene locus_tag LOCUS_05000 9195 9476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 9804 10337 gene locus_tag LOCUS_05010 9804 10337 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_05010 10439 11185 gene locus_tag LOCUS_05020 10439 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 11396 11686 gene locus_tag LOCUS_05030 11396 11686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 >Feature sequence033 560 15 gene locus_tag LOCUS_05040 560 15 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750468.1 protein_id gnl|my_center|LOCUS_05040 1174 854 gene locus_tag LOCUS_05050 1174 854 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060879.1 protein_id gnl|my_center|LOCUS_05050 1961 1503 gene locus_tag LOCUS_05060 gene ribC 1961 1503 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061180.1 protein_id gnl|my_center|LOCUS_05060 3226 2264 gene locus_tag LOCUS_05070 gene mch 3226 2264 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876411.1 protein_id gnl|my_center|LOCUS_05070 4261 3644 gene locus_tag LOCUS_05080 4261 3644 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061245.1 protein_id gnl|my_center|LOCUS_05080 5217 4249 gene locus_tag LOCUS_05090 5217 4249 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876413.1 protein_id gnl|my_center|LOCUS_05090 5525 5220 gene locus_tag LOCUS_05100 5525 5220 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876414.1 protein_id gnl|my_center|LOCUS_05100 5989 5528 gene locus_tag LOCUS_05110 5989 5528 CDS product DUF1890 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876415.1 protein_id gnl|my_center|LOCUS_05110 7153 6071 gene locus_tag LOCUS_05120 7153 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060897.1 protein_id gnl|my_center|LOCUS_05120 7904 7416 gene locus_tag LOCUS_05130 7904 7416 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296330.1 protein_id gnl|my_center|LOCUS_05130 7973 8045 gene locus_tag LOCUS_t00060 7973 8045 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8866 8204 gene locus_tag LOCUS_05140 gene hypB 8866 8204 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876419.1 protein_id gnl|my_center|LOCUS_05140 9428 9054 gene locus_tag LOCUS_05150 gene hypA 9428 9054 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060898.1 protein_id gnl|my_center|LOCUS_05150 9755 10618 gene locus_tag LOCUS_05160 9755 10618 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876421.1 protein_id gnl|my_center|LOCUS_05160 11468 10872 gene locus_tag LOCUS_05170 11468 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 >Feature sequence034 192 515 gene locus_tag LOCUS_05180 gene tusB 192 515 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876972.1 protein_id gnl|my_center|LOCUS_05180 563 943 gene locus_tag LOCUS_05190 563 943 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876969.1 protein_id gnl|my_center|LOCUS_05190 945 1298 gene locus_tag LOCUS_05200 945 1298 CDS product DsrH/TusB family sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876970.1 protein_id gnl|my_center|LOCUS_05200 1311 1925 gene locus_tag LOCUS_05210 1311 1925 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061295.1 protein_id gnl|my_center|LOCUS_05210 2130 2912 gene locus_tag LOCUS_05220 2130 2912 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876976.1 protein_id gnl|my_center|LOCUS_05220 2931 3242 gene locus_tag LOCUS_05230 2931 3242 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061032.1 protein_id gnl|my_center|LOCUS_05230 3338 4237 gene locus_tag LOCUS_05240 3338 4237 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875860.1 protein_id gnl|my_center|LOCUS_05240 4278 4619 gene locus_tag LOCUS_05250 4278 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 4716 5201 gene locus_tag LOCUS_05260 4716 5201 CDS product DUF2703 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546393.1 protein_id gnl|my_center|LOCUS_05260 5750 5397 gene locus_tag LOCUS_05270 5750 5397 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892103.1 protein_id gnl|my_center|LOCUS_05270 5844 6539 gene locus_tag LOCUS_05280 5844 6539 CDS product DUF166 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876968.1 protein_id gnl|my_center|LOCUS_05280 6740 6549 gene locus_tag LOCUS_05290 6740 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 7119 6727 gene locus_tag LOCUS_05300 7119 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 8790 7408 gene locus_tag LOCUS_05310 gene cca 8790 7408 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876223.1 protein_id gnl|my_center|LOCUS_05310 9469 8921 gene locus_tag LOCUS_05320 gene thpR 9469 8921 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876222.1 protein_id gnl|my_center|LOCUS_05320 10416 9475 gene locus_tag LOCUS_05330 10416 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 <11778 10691 gene locus_tag LOCUS_05340 <11778 10691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060849.1:3-dehydroquinate synthase II >Feature sequence035 <1 580 gene locus_tag LOCUS_05350 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877457.1:phenylacetate--CoA ligase 623 1054 gene locus_tag LOCUS_05360 623 1054 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877456.1 protein_id gnl|my_center|LOCUS_05360 1832 1176 gene locus_tag LOCUS_05370 1832 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 2742 1966 gene locus_tag LOCUS_05380 gene thiD 2742 1966 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876253.1 protein_id gnl|my_center|LOCUS_05380 3431 2742 gene locus_tag LOCUS_05390 gene cofC 3431 2742 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 protein_id gnl|my_center|LOCUS_05390 4225 3524 gene locus_tag LOCUS_05400 4225 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5746 4337 gene locus_tag LOCUS_05410 gene proS 5746 4337 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060857.1 protein_id gnl|my_center|LOCUS_05410 6323 6472 gene locus_tag LOCUS_05420 6323 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05420 6506 7366 gene locus_tag LOCUS_05430 6506 7366 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876249.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05430 7661 8092 gene locus_tag LOCUS_05440 7661 8092 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876248.1 protein_id gnl|my_center|LOCUS_05440 8221 8895 gene locus_tag LOCUS_05450 gene rpiA 8221 8895 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060856.1 protein_id gnl|my_center|LOCUS_05450 9144 9500 gene locus_tag LOCUS_05460 9144 9500 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_05460 9648 10121 gene locus_tag LOCUS_05470 9648 10121 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869796.1 protein_id gnl|my_center|LOCUS_05470 10084 10224 gene locus_tag LOCUS_05480 10084 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 10595 10440 gene locus_tag LOCUS_05490 10595 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 11153 10980 gene locus_tag LOCUS_05500 11153 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence036 2788 1649 gene locus_tag LOCUS_05510 2788 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 4004 3060 gene locus_tag LOCUS_05520 4004 3060 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_05520 4618 3974 gene locus_tag LOCUS_05530 4618 3974 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_05530 5576 4698 gene locus_tag LOCUS_05540 5576 4698 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_05540 6970 5927 gene locus_tag LOCUS_05550 gene cofH 6970 5927 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021503.1 protein_id gnl|my_center|LOCUS_05550 8265 7885 gene locus_tag LOCUS_05560 8265 7885 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061093.1 protein_id gnl|my_center|LOCUS_05560 9450 8389 gene locus_tag LOCUS_05570 9450 8389 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876835.1 protein_id gnl|my_center|LOCUS_05570 11083 9722 gene locus_tag LOCUS_05580 11083 9722 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021944.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence037 560 201 gene locus_tag LOCUS_05590 560 201 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_05590 1615 800 gene locus_tag LOCUS_05600 1615 800 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933364.1 protein_id gnl|my_center|LOCUS_05600 2490 1720 gene locus_tag LOCUS_05610 2490 1720 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876497.1 protein_id gnl|my_center|LOCUS_05610 3081 3236 gene locus_tag LOCUS_05620 3081 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3476 3625 gene locus_tag LOCUS_05630 3476 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4609 4827 gene locus_tag LOCUS_05640 4609 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 5589 4870 gene locus_tag LOCUS_05650 5589 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 5789 6442 gene locus_tag LOCUS_05660 gene rnc 5789 6442 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903151.1 protein_id gnl|my_center|LOCUS_05660 6904 6494 gene locus_tag LOCUS_05670 6904 6494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 7528 7214 gene locus_tag LOCUS_05680 7528 7214 CDS product DUF2769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875739.1 protein_id gnl|my_center|LOCUS_05680 8030 8248 gene locus_tag LOCUS_05690 8030 8248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8659 9063 gene locus_tag LOCUS_05700 8659 9063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 9063 9545 gene locus_tag LOCUS_05710 9063 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 10670 9624 gene locus_tag LOCUS_05720 gene pseI 10670 9624 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_05720 <11507 10673 gene locus_tag LOCUS_05730 <11507 10673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148881916.1:GNAT family protein >Feature sequence038 <1 891 gene locus_tag LOCUS_05740 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878769.1:carbamoyl-phosphate synthase large subunit 1300 2412 gene locus_tag LOCUS_05750 1300 2412 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_05750 2417 2866 gene locus_tag LOCUS_05760 2417 2866 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876624.1 protein_id gnl|my_center|LOCUS_05760 2939 3775 gene locus_tag LOCUS_05770 2939 3775 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060939.1 protein_id gnl|my_center|LOCUS_05770 3777 4199 gene locus_tag LOCUS_05780 3777 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 5400 4348 gene locus_tag LOCUS_05790 gene larE 5400 4348 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876621.1 protein_id gnl|my_center|LOCUS_05790 6262 5603 gene locus_tag LOCUS_05800 6262 5603 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_05800 7047 6538 gene locus_tag LOCUS_05810 7047 6538 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877275.1 protein_id gnl|my_center|LOCUS_05810 7603 7115 gene locus_tag LOCUS_05820 gene tfe 7603 7115 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877276.1 protein_id gnl|my_center|LOCUS_05820 8808 7951 gene locus_tag LOCUS_05830 8808 7951 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877277.1 protein_id gnl|my_center|LOCUS_05830 9628 8942 gene locus_tag LOCUS_05840 9628 8942 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_05840 10420 9719 gene locus_tag LOCUS_05850 10420 9719 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 protein_id gnl|my_center|LOCUS_05850 10858 10784 gene locus_tag LOCUS_t00070 10858 10784 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence039 <1 1601 gene locus_tag LOCUS_05860 <1 1601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319494.1:acetate--CoA ligase 2189 1731 gene locus_tag LOCUS_05870 2189 1731 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061315.1 protein_id gnl|my_center|LOCUS_05870 2398 3078 gene locus_tag LOCUS_05880 2398 3078 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_05880 4809 3148 gene locus_tag LOCUS_05890 4809 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6341 5067 gene locus_tag LOCUS_05900 gene ftsY 6341 5067 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877216.1 protein_id gnl|my_center|LOCUS_05900 6782 6357 gene locus_tag LOCUS_05910 gene pfdA 6782 6357 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877217.1 protein_id gnl|my_center|LOCUS_05910 7017 6787 gene locus_tag LOCUS_05920 gene rpl18a 7017 6787 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061100.1 protein_id gnl|my_center|LOCUS_05920 7688 7014 gene locus_tag LOCUS_05930 7688 7014 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_05930 7932 7699 gene locus_tag LOCUS_05940 7932 7699 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877220.1 protein_id gnl|my_center|LOCUS_05940 8100 7945 gene locus_tag LOCUS_05950 8100 7945 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877221.1 protein_id gnl|my_center|LOCUS_05950 8689 8093 gene locus_tag LOCUS_05960 8689 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877222.1 protein_id gnl|my_center|LOCUS_05960 9033 8686 gene locus_tag LOCUS_05970 9033 8686 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877223.1 protein_id gnl|my_center|LOCUS_05970 9487 9047 gene locus_tag LOCUS_05980 9487 9047 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_05980 9735 9502 gene locus_tag LOCUS_05990 9735 9502 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061101.1 protein_id gnl|my_center|LOCUS_05990 10096 9728 gene locus_tag LOCUS_06000 10096 9728 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877226.1 protein_id gnl|my_center|LOCUS_06000 10951 10391 gene locus_tag LOCUS_06010 10951 10391 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877227.1 protein_id gnl|my_center|LOCUS_06010 11340 11143 gene locus_tag LOCUS_06020 11340 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence040 1031 867 gene locus_tag LOCUS_06030 1031 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 1030 1191 gene locus_tag LOCUS_06040 1030 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1618 1836 gene locus_tag LOCUS_06050 1618 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2021 2185 gene locus_tag LOCUS_06060 2021 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2224 3369 gene locus_tag LOCUS_06070 2224 3369 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065470411.1 protein_id gnl|my_center|LOCUS_06070 3373 3846 gene locus_tag LOCUS_06080 3373 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4542 4063 gene locus_tag LOCUS_06090 4542 4063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4973 4620 gene locus_tag LOCUS_06100 4973 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 6530 4995 gene locus_tag LOCUS_06110 6530 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06110 8085 6628 gene locus_tag LOCUS_06120 8085 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06120 8473 9792 gene locus_tag LOCUS_06130 8473 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 10845 10066 gene locus_tag LOCUS_06140 10845 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 11083 11223 gene locus_tag LOCUS_06150 11083 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence041 374 937 gene locus_tag LOCUS_06160 374 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061169.1 protein_id gnl|my_center|LOCUS_06160 1199 1011 gene locus_tag LOCUS_06170 1199 1011 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061337.1 protein_id gnl|my_center|LOCUS_06170 1409 2569 gene locus_tag LOCUS_06180 1409 2569 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020503.1 protein_id gnl|my_center|LOCUS_06180 2609 4039 gene locus_tag LOCUS_06190 2609 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877497.1 protein_id gnl|my_center|LOCUS_06190 4036 4734 gene locus_tag LOCUS_06200 4036 4734 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877498.1 protein_id gnl|my_center|LOCUS_06200 4748 5383 gene locus_tag LOCUS_06210 4748 5383 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877499.1 protein_id gnl|my_center|LOCUS_06210 5405 5788 gene locus_tag LOCUS_06220 5405 5788 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877500.1 protein_id gnl|my_center|LOCUS_06220 5772 6077 gene locus_tag LOCUS_06230 5772 6077 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877501.1 protein_id gnl|my_center|LOCUS_06230 10245 6469 gene locus_tag LOCUS_06240 10245 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence042 471 1103 gene locus_tag LOCUS_06250 471 1103 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990882.1 protein_id gnl|my_center|LOCUS_06250 1187 2581 gene locus_tag LOCUS_06260 1187 2581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024491.1 protein_id gnl|my_center|LOCUS_06260 2849 3499 gene locus_tag LOCUS_06270 2849 3499 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022715.1 protein_id gnl|my_center|LOCUS_06270 3553 4353 gene locus_tag LOCUS_06280 3553 4353 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945998.1 protein_id gnl|my_center|LOCUS_06280 4502 5296 gene locus_tag LOCUS_06290 4502 5296 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461573.1 protein_id gnl|my_center|LOCUS_06290 5469 6425 gene locus_tag LOCUS_06300 5469 6425 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030964.1 protein_id gnl|my_center|LOCUS_06300 7107 6481 gene locus_tag LOCUS_06310 7107 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 7356 7658 gene locus_tag LOCUS_06320 7356 7658 CDS product DUF6506 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966779.1 protein_id gnl|my_center|LOCUS_06320 7756 8508 gene locus_tag LOCUS_06330 7756 8508 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721993.1 protein_id gnl|my_center|LOCUS_06330 8545 9378 gene locus_tag LOCUS_06340 8545 9378 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064335.1 protein_id gnl|my_center|LOCUS_06340 9469 9909 gene locus_tag LOCUS_06350 9469 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 10529 9924 gene locus_tag LOCUS_06360 10529 9924 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279161.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence043 <1 617 gene locus_tag LOCUS_06370 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876661.1:sortase 695 1126 gene locus_tag LOCUS_06380 695 1126 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060955.1 protein_id gnl|my_center|LOCUS_06380 1255 1503 gene locus_tag LOCUS_06390 1255 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1937 3265 gene locus_tag LOCUS_06400 1937 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3575 3784 gene locus_tag LOCUS_06410 3575 3784 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869641.1 protein_id gnl|my_center|LOCUS_06410 3774 4898 gene locus_tag LOCUS_06420 3774 4898 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191216118.1 protein_id gnl|my_center|LOCUS_06420 5074 5940 gene locus_tag LOCUS_06430 gene korB 5074 5940 CDS product 2-oxoglutarate synthase subunit KorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876665.1 protein_id gnl|my_center|LOCUS_06430 5944 6501 gene locus_tag LOCUS_06440 5944 6501 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060957.1 protein_id gnl|my_center|LOCUS_06440 6503 7609 gene locus_tag LOCUS_06450 gene sucC 6503 7609 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876667.1 protein_id gnl|my_center|LOCUS_06450 9021 7939 gene locus_tag LOCUS_06460 9021 7939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876668.1 protein_id gnl|my_center|LOCUS_06460 10210 9338 gene locus_tag LOCUS_06470 10210 9338 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060958.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence044 1762 434 gene locus_tag LOCUS_06480 1762 434 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876255.1 protein_id gnl|my_center|LOCUS_06480 2495 2100 gene locus_tag LOCUS_06490 2495 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06490 2773 2492 gene locus_tag LOCUS_06500 2773 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06500 3533 3715 gene locus_tag LOCUS_06510 3533 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 4123 3794 gene locus_tag LOCUS_06520 4123 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 6819 4234 gene locus_tag LOCUS_06530 6819 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 7371 7658 gene locus_tag LOCUS_06540 7371 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 7666 7965 gene locus_tag LOCUS_06550 7666 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 8112 10601 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatcctaaaatagtctgattttagc >Feature sequence045 317 739 gene locus_tag LOCUS_06560 317 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 801 1406 gene locus_tag LOCUS_06570 801 1406 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877352.1 protein_id gnl|my_center|LOCUS_06570 1631 2458 gene locus_tag LOCUS_06580 1631 2458 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877353.1 protein_id gnl|my_center|LOCUS_06580 2541 2750 gene locus_tag LOCUS_06590 2541 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3097 4218 gene locus_tag LOCUS_06600 3097 4218 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_06600 4211 4972 gene locus_tag LOCUS_06610 4211 4972 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_06610 6758 5460 gene locus_tag LOCUS_06620 6758 5460 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892544.1 protein_id gnl|my_center|LOCUS_06620 8376 7129 gene locus_tag LOCUS_06630 8376 7129 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876388.1 protein_id gnl|my_center|LOCUS_06630 8592 10268 gene locus_tag LOCUS_06640 8592 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence046 659 1210 gene locus_tag LOCUS_06650 659 1210 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020496.1 protein_id gnl|my_center|LOCUS_06650 1305 1826 gene locus_tag LOCUS_06660 1305 1826 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986565.1 protein_id gnl|my_center|LOCUS_06660 1879 2538 gene locus_tag LOCUS_06670 1879 2538 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021861.1 protein_id gnl|my_center|LOCUS_06670 3164 2799 gene locus_tag LOCUS_06680 3164 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3742 3251 gene locus_tag LOCUS_06690 gene comD 3742 3251 CDS product sulfopyruvate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876830.1 protein_id gnl|my_center|LOCUS_06690 4763 3732 gene locus_tag LOCUS_06700 gene comC 4763 3732 CDS product L-sulfolactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876829.1 protein_id gnl|my_center|LOCUS_06700 5810 4782 gene locus_tag LOCUS_06710 gene purM 5810 4782 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876828.1 protein_id gnl|my_center|LOCUS_06710 6608 5901 gene locus_tag LOCUS_06720 6608 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 9176 7272 gene locus_tag LOCUS_06730 9176 7272 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_06730 9939 9316 gene locus_tag LOCUS_06740 gene psmB 9939 9316 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence047 530 1051 gene locus_tag LOCUS_06750 530 1051 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_06750 1362 1697 gene locus_tag LOCUS_06760 1362 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 2061 1837 gene locus_tag LOCUS_06770 2061 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2305 2850 gene locus_tag LOCUS_06780 2305 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3239 2877 gene locus_tag LOCUS_06790 3239 2877 CDS product DUF5518 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061141.1 protein_id gnl|my_center|LOCUS_06790 3429 3920 gene locus_tag LOCUS_06800 3429 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4474 4112 gene locus_tag LOCUS_06810 4474 4112 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434678.1 protein_id gnl|my_center|LOCUS_06810 4735 4580 gene locus_tag LOCUS_06820 4735 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 6755 4866 gene locus_tag LOCUS_06830 6755 4866 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061138.1 protein_id gnl|my_center|LOCUS_06830 7198 8034 gene locus_tag LOCUS_06840 7198 8034 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_06840 <10470 8175 gene locus_tag LOCUS_06850 <10470 8175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877365.1:U32 family peptidase >Feature sequence048 559 1278 gene locus_tag LOCUS_06860 559 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1293 2021 gene locus_tag LOCUS_06870 1293 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 2028 2303 gene locus_tag LOCUS_06880 2028 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2733 3782 gene locus_tag LOCUS_06890 2733 3782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_06890 3775 4434 gene locus_tag LOCUS_06900 3775 4434 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_06900 4669 6762 gene locus_tag LOCUS_06910 4669 6762 CDS product ATP-dependent endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095325.1 protein_id gnl|my_center|LOCUS_06910 6791 7534 gene locus_tag LOCUS_06920 6791 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 7566 8099 gene locus_tag LOCUS_06930 7566 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 8670 8215 gene locus_tag LOCUS_06940 8670 8215 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020435.1 protein_id gnl|my_center|LOCUS_06940 9256 8696 gene locus_tag LOCUS_06950 9256 8696 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941232.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence049 1674 700 gene locus_tag LOCUS_06960 1674 700 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060981.1 protein_id gnl|my_center|LOCUS_06960 2246 1794 gene locus_tag LOCUS_06970 2246 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 2909 3526 gene locus_tag LOCUS_06980 2909 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4971 3616 gene locus_tag LOCUS_06990 4971 3616 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_06990 6262 5375 gene locus_tag LOCUS_07000 6262 5375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 7954 6494 gene locus_tag LOCUS_07010 7954 6494 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437634.1 protein_id gnl|my_center|LOCUS_07010 8476 8006 gene locus_tag LOCUS_07020 8476 8006 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358480.1 protein_id gnl|my_center|LOCUS_07020 8811 9290 gene locus_tag LOCUS_07030 8811 9290 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876282.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence050 1160 504 gene locus_tag LOCUS_07040 1160 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2100 3458 gene locus_tag LOCUS_07050 gene cas8a1 2100 3458 CDS product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023575.1 protein_id gnl|my_center|LOCUS_07050 3459 4457 gene locus_tag LOCUS_07060 gene cas7i 3459 4457 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_07060 4454 5071 gene locus_tag LOCUS_07070 gene cas5b 4454 5071 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023573.1 protein_id gnl|my_center|LOCUS_07070 5081 7291 gene locus_tag LOCUS_07080 5081 7291 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065767.1 protein_id gnl|my_center|LOCUS_07080 7305 7919 gene locus_tag LOCUS_07090 7305 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07090 7876 8028 gene locus_tag LOCUS_07100 7876 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07100 8030 8260 gene locus_tag LOCUS_07110 8030 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8298 8816 gene locus_tag LOCUS_07120 gene cas4 8298 8816 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876709.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence051 2315 1914 gene locus_tag LOCUS_07130 2315 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2723 3268 gene locus_tag LOCUS_07140 2723 3268 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877235.1 protein_id gnl|my_center|LOCUS_07140 3303 4826 gene locus_tag LOCUS_07150 gene serB 3303 4826 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061103.1 protein_id gnl|my_center|LOCUS_07150 5207 6610 gene locus_tag LOCUS_07160 5207 6610 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_07160 9383 6681 gene locus_tag LOCUS_07170 gene rad50 9383 6681 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846723.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence052 628 798 gene locus_tag LOCUS_07180 628 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1798 803 gene locus_tag LOCUS_07190 gene aksF 1798 803 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_07190 2195 2752 gene locus_tag LOCUS_07200 2195 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2969 3922 gene locus_tag LOCUS_07210 2969 3922 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875827.1 protein_id gnl|my_center|LOCUS_07210 4458 4189 gene locus_tag LOCUS_07220 4458 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 4947 5525 gene locus_tag LOCUS_07230 gene pdxT 4947 5525 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875829.1 protein_id gnl|my_center|LOCUS_07230 5513 6430 gene locus_tag LOCUS_07240 5513 6430 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875830.1 protein_id gnl|my_center|LOCUS_07240 6471 7160 gene locus_tag LOCUS_07250 6471 7160 CDS product GXGXG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875831.1 protein_id gnl|my_center|LOCUS_07250 7160 8254 gene locus_tag LOCUS_07260 7160 8254 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875832.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence053 1740 580 gene locus_tag LOCUS_07270 1740 580 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877301.1 protein_id gnl|my_center|LOCUS_07270 2942 2235 gene locus_tag LOCUS_07280 gene radB 2942 2235 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877300.1 protein_id gnl|my_center|LOCUS_07280 3346 4776 gene locus_tag LOCUS_07290 3346 4776 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_07290 5612 4986 gene locus_tag LOCUS_07300 5612 4986 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877299.1 protein_id gnl|my_center|LOCUS_07300 5830 6405 gene locus_tag LOCUS_07310 gene pgsA 5830 6405 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061121.1 protein_id gnl|my_center|LOCUS_07310 6477 6758 gene locus_tag LOCUS_07320 6477 6758 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877297.1 protein_id gnl|my_center|LOCUS_07320 6906 7562 gene locus_tag LOCUS_07330 6906 7562 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877296.1 protein_id gnl|my_center|LOCUS_07330 7686 8357 gene locus_tag LOCUS_07340 7686 8357 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870449.1 protein_id gnl|my_center|LOCUS_07340 8937 8629 gene locus_tag LOCUS_07350 8937 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence054 <1 833 gene locus_tag LOCUS_07360 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877008.1:thiamine-phosphate kinase 918 1922 gene locus_tag LOCUS_07370 gene amrS 918 1922 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877007.1 protein_id gnl|my_center|LOCUS_07370 2645 1959 gene locus_tag LOCUS_07380 2645 1959 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531709.1 protein_id gnl|my_center|LOCUS_07380 3062 2688 gene locus_tag LOCUS_07390 3062 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4604 3318 gene locus_tag LOCUS_07400 4604 3318 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_07400 4892 4746 gene locus_tag LOCUS_07410 4892 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 6010 4994 gene locus_tag LOCUS_07420 gene purE 6010 4994 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061041.1 protein_id gnl|my_center|LOCUS_07420 6270 7982 gene locus_tag LOCUS_07430 6270 7982 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877004.1 protein_id gnl|my_center|LOCUS_07430 <8836 8241 gene locus_tag LOCUS_07440 <8836 8241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877003.1:DUF1743 domain-containing protein >Feature sequence055 1578 1015 gene locus_tag LOCUS_07450 1578 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2955 2449 gene locus_tag LOCUS_07460 2955 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892171.1 protein_id gnl|my_center|LOCUS_07460 3530 2961 gene locus_tag LOCUS_07470 3530 2961 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876433.1 protein_id gnl|my_center|LOCUS_07470 4760 3843 gene locus_tag LOCUS_07480 4760 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5486 4938 gene locus_tag LOCUS_07490 5486 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6663 5992 gene locus_tag LOCUS_07500 6663 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7406 6771 gene locus_tag LOCUS_07510 7406 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 <8807 7848 gene locus_tag LOCUS_07520 <8807 7848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876434.1:aspartate-semialdehyde dehydrogenase >Feature sequence056 1073 2503 gene locus_tag LOCUS_07530 1073 2503 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227999.1 protein_id gnl|my_center|LOCUS_07530 3445 2882 gene locus_tag LOCUS_07540 3445 2882 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060967.1 protein_id gnl|my_center|LOCUS_07540 4099 3446 gene locus_tag LOCUS_07550 4099 3446 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061278.1 protein_id gnl|my_center|LOCUS_07550 4415 4990 gene locus_tag LOCUS_07560 gene tmk 4415 4990 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877367.1 protein_id gnl|my_center|LOCUS_07560 5132 5479 gene locus_tag LOCUS_07570 5132 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 5542 5700 gene locus_tag LOCUS_07580 5542 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 6071 5724 gene locus_tag LOCUS_07590 6071 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 7095 6133 gene locus_tag LOCUS_07600 7095 6133 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877369.1 protein_id gnl|my_center|LOCUS_07600 8359 7307 gene locus_tag LOCUS_07610 8359 7307 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877370.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence057 6 920 gene locus_tag LOCUS_07620 6 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1889 933 gene locus_tag LOCUS_07630 1889 933 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479894.1 protein_id gnl|my_center|LOCUS_07630 2816 2058 gene locus_tag LOCUS_07640 gene nucS 2816 2058 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061145.1 protein_id gnl|my_center|LOCUS_07640 2903 3118 gene locus_tag LOCUS_07650 2903 3118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3009 3542 gene locus_tag LOCUS_07660 3009 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 3721 4476 gene locus_tag LOCUS_07670 3721 4476 CDS product ZIP family zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225190.1 protein_id gnl|my_center|LOCUS_07670 4526 5032 gene locus_tag LOCUS_07680 4526 5032 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061149.1 protein_id gnl|my_center|LOCUS_07680 5218 6189 gene locus_tag LOCUS_07690 5218 6189 CDS product alpha/beta fold hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877422.1 protein_id gnl|my_center|LOCUS_07690 6720 6268 gene locus_tag LOCUS_07700 6720 6268 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249062.1 protein_id gnl|my_center|LOCUS_07700 6936 6775 gene locus_tag LOCUS_07710 6936 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 8695 6974 gene locus_tag LOCUS_07720 8695 6974 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence058 <1 798 gene locus_tag LOCUS_07730 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877207.1:ORC1-type DNA replication protein Cdc6-2 985 800 gene locus_tag LOCUS_07740 985 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1247 1720 gene locus_tag LOCUS_07750 1247 1720 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_07750 1902 3350 gene locus_tag LOCUS_07760 1902 3350 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061099.1 protein_id gnl|my_center|LOCUS_07760 3491 4279 gene locus_tag LOCUS_07770 gene mtnP 3491 4279 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877204.1 protein_id gnl|my_center|LOCUS_07770 4515 5429 gene locus_tag LOCUS_07780 gene nadA 4515 5429 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877429.1 protein_id gnl|my_center|LOCUS_07780 5521 6525 gene locus_tag LOCUS_07790 5521 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876516.1 protein_id gnl|my_center|LOCUS_07790 6716 8512 gene locus_tag LOCUS_07800 6716 8512 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876517.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence059 856 647 gene locus_tag LOCUS_07810 856 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1642 2898 gene locus_tag LOCUS_07820 1642 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 3132 4016 gene locus_tag LOCUS_07830 3132 4016 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060745.1 protein_id gnl|my_center|LOCUS_07830 4171 5085 gene locus_tag LOCUS_07840 4171 5085 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060746.1 protein_id gnl|my_center|LOCUS_07840 5129 5746 gene locus_tag LOCUS_07850 5129 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875767.1 protein_id gnl|my_center|LOCUS_07850 6331 5681 gene locus_tag LOCUS_07860 gene pyrF 6331 5681 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060747.1 protein_id gnl|my_center|LOCUS_07860 6489 6716 gene locus_tag LOCUS_07870 6489 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 7040 7726 gene locus_tag LOCUS_07880 gene cbiM 7040 7726 CDS product cobalt ECF transporter S component CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870603.1 protein_id gnl|my_center|LOCUS_07880 7728 8072 gene locus_tag LOCUS_07890 7728 8072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence060 260 1609 gene locus_tag LOCUS_07900 gene purB 260 1609 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877146.1 protein_id gnl|my_center|LOCUS_07900 1966 2868 gene locus_tag LOCUS_07910 1966 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3086 3991 gene locus_tag LOCUS_07920 3086 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877147.1 protein_id gnl|my_center|LOCUS_07920 4211 4621 gene locus_tag LOCUS_07930 4211 4621 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877139.1 protein_id gnl|my_center|LOCUS_07930 5162 4755 gene locus_tag LOCUS_07940 5162 4755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 5656 5198 gene locus_tag LOCUS_07950 5656 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6151 5792 gene locus_tag LOCUS_07960 6151 5792 CDS product DUF5518 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061141.1 protein_id gnl|my_center|LOCUS_07960 6441 7715 gene locus_tag LOCUS_07970 6441 7715 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457408.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence061 2342 1074 gene locus_tag LOCUS_07980 2342 1074 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876171.1 protein_id gnl|my_center|LOCUS_07980 2600 3646 gene locus_tag LOCUS_07990 gene hypD 2600 3646 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876696.1 protein_id gnl|my_center|LOCUS_07990 3694 4371 gene locus_tag LOCUS_08000 3694 4371 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_08000 4368 5666 gene locus_tag LOCUS_08010 4368 5666 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_08010 5947 6369 gene locus_tag LOCUS_08020 5947 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 7834 6575 gene locus_tag LOCUS_08030 7834 6575 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877291.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence062 515 1174 gene locus_tag LOCUS_08040 515 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1260 1332 gene locus_tag LOCUS_t00080 1260 1332 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1357 2493 gene locus_tag LOCUS_08050 1357 2493 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296134.1 protein_id gnl|my_center|LOCUS_08050 4103 2619 gene locus_tag LOCUS_08060 4103 2619 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_08060 4801 4145 gene locus_tag LOCUS_08070 4801 4145 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_08070 5244 5095 gene locus_tag LOCUS_08080 5244 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 5653 5249 gene locus_tag LOCUS_08090 5653 5249 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876580.1 protein_id gnl|my_center|LOCUS_08090 5719 6057 gene locus_tag LOCUS_08100 5719 6057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876581.1 protein_id gnl|my_center|LOCUS_08100 6149 6571 gene locus_tag LOCUS_08110 6149 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7385 7002 gene locus_tag LOCUS_08120 7385 7002 CDS product DUF22 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876583.1 protein_id gnl|my_center|LOCUS_08120 8029 7385 gene locus_tag LOCUS_08130 8029 7385 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876584.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence063 3255 958 gene locus_tag LOCUS_08140 gene ppsA 3255 958 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_08140 3760 3278 gene locus_tag LOCUS_08150 gene rplJ 3760 3278 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876743.1 protein_id gnl|my_center|LOCUS_08150 3882 4679 gene locus_tag LOCUS_08160 3882 4679 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060971.1 protein_id gnl|my_center|LOCUS_08160 4706 4957 gene locus_tag LOCUS_08170 4706 4957 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876745.1 protein_id gnl|my_center|LOCUS_08170 5172 6731 gene locus_tag LOCUS_08180 gene serS 5172 6731 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876746.1 protein_id gnl|my_center|LOCUS_08180 6824 6985 gene locus_tag LOCUS_08190 6824 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6933 7076 gene locus_tag LOCUS_08200 6933 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8138 7374 gene locus_tag LOCUS_08210 8138 7374 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876749.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence064 1725 1537 gene locus_tag LOCUS_08220 1725 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 2169 1786 gene locus_tag LOCUS_08230 2169 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583103.1 protein_id gnl|my_center|LOCUS_08230 2511 2326 gene locus_tag LOCUS_08240 2511 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2833 2525 gene locus_tag LOCUS_08250 2833 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3073 3435 gene locus_tag LOCUS_08260 3073 3435 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_08260 4199 3708 gene locus_tag LOCUS_08270 4199 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5160 4345 gene locus_tag LOCUS_08280 5160 4345 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434727.1 protein_id gnl|my_center|LOCUS_08280 5550 6275 gene locus_tag LOCUS_08290 5550 6275 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_08290 7275 6433 gene locus_tag LOCUS_08300 gene hisF 7275 6433 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061292.1 protein_id gnl|my_center|LOCUS_08300 7649 8197 gene locus_tag LOCUS_08310 7649 8197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence065 <1 842 gene locus_tag LOCUS_08320 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877176.1:molybdopterin-dependent oxidoreductase 953 1762 gene locus_tag LOCUS_08330 953 1762 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927097.1 protein_id gnl|my_center|LOCUS_08330 2123 3010 gene locus_tag LOCUS_08340 2123 3010 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903919.1 protein_id gnl|my_center|LOCUS_08340 4464 3361 gene locus_tag LOCUS_08350 4464 3361 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_08350 5075 4773 gene locus_tag LOCUS_08360 5075 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 6292 5345 gene locus_tag LOCUS_08370 6292 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876728.1 protein_id gnl|my_center|LOCUS_08370 7020 6478 gene locus_tag LOCUS_08380 7020 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 7136 8104 gene locus_tag LOCUS_08390 7136 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence066 393 1199 gene locus_tag LOCUS_08400 393 1199 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877328.1 protein_id gnl|my_center|LOCUS_08400 1865 2479 gene locus_tag LOCUS_08410 1865 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877329.1 protein_id gnl|my_center|LOCUS_08410 2472 3368 gene locus_tag LOCUS_08420 2472 3368 CDS product PhoU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877330.1 protein_id gnl|my_center|LOCUS_08420 4127 3846 gene locus_tag LOCUS_08430 4127 3846 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 protein_id gnl|my_center|LOCUS_08430 5124 4465 gene locus_tag LOCUS_08440 5124 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 5439 6248 gene locus_tag LOCUS_08450 5439 6248 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_08450 6413 7225 gene locus_tag LOCUS_08460 6413 7225 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330362.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence067 1696 542 gene locus_tag LOCUS_08470 1696 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3312 1687 gene locus_tag LOCUS_08480 3312 1687 CDS product DUF2206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875978.1 protein_id gnl|my_center|LOCUS_08480 3195 3407 gene locus_tag LOCUS_08490 3195 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5113 3998 gene locus_tag LOCUS_08500 5113 3998 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_08500 6411 5257 gene locus_tag LOCUS_08510 6411 5257 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060795.1 protein_id gnl|my_center|LOCUS_08510 7192 6500 gene locus_tag LOCUS_08520 7192 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 7724 7464 gene locus_tag LOCUS_08530 7724 7464 CDS product TIGR00304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060854.1 protein_id gnl|my_center|LOCUS_08530 8123 7785 gene locus_tag LOCUS_08540 8123 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence068 2415 319 gene locus_tag LOCUS_08550 2415 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 4522 2516 gene locus_tag LOCUS_08560 4522 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08560 5571 4669 gene locus_tag LOCUS_08570 5571 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08570 6597 6025 gene locus_tag LOCUS_08580 6597 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 7539 6751 gene locus_tag LOCUS_08590 7539 6751 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_08590 <8100 7593 gene locus_tag LOCUS_08600 <8100 7593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021255.1:iron ABC transporter permease >Feature sequence069 <1 1175 gene locus_tag LOCUS_08610 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877210.1:thiamine pyrophosphate-binding protein 1172 2530 gene locus_tag LOCUS_08620 1172 2530 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_08620 2942 3178 gene locus_tag LOCUS_08630 2942 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3175 4476 gene locus_tag LOCUS_08640 3175 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5704 4547 gene locus_tag LOCUS_08650 5704 4547 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061314.1 protein_id gnl|my_center|LOCUS_08650 5893 5705 gene locus_tag LOCUS_08660 5893 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 5801 6538 gene locus_tag LOCUS_08670 5801 6538 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877208.1 protein_id gnl|my_center|LOCUS_08670 7351 6608 gene locus_tag LOCUS_08680 7351 6608 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence070 124 199 gene locus_tag LOCUS_t00090 124 199 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 780 1295 gene locus_tag LOCUS_08690 780 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2699 1485 gene locus_tag LOCUS_08700 2699 1485 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876918.1 protein_id gnl|my_center|LOCUS_08700 3839 3066 gene locus_tag LOCUS_08710 3839 3066 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_08710 4013 3840 gene locus_tag LOCUS_08720 4013 3840 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876920.1 protein_id gnl|my_center|LOCUS_08720 4795 4016 gene locus_tag LOCUS_08730 4795 4016 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_08730 5213 5028 gene locus_tag LOCUS_08740 5213 5028 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876922.1 protein_id gnl|my_center|LOCUS_08740 5502 5224 gene locus_tag LOCUS_08750 5502 5224 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876923.1 protein_id gnl|my_center|LOCUS_08750 6678 5626 gene locus_tag LOCUS_08760 6678 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 7415 6681 gene locus_tag LOCUS_08770 gene pcn 7415 6681 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876925.1 protein_id gnl|my_center|LOCUS_08770 7804 7436 gene locus_tag LOCUS_08780 7804 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence071 3 1013 gene locus_tag LOCUS_08790 3 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1239 1880 gene locus_tag LOCUS_08800 1239 1880 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750438.1 protein_id gnl|my_center|LOCUS_08800 1979 3067 gene locus_tag LOCUS_08810 1979 3067 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_08810 3327 3803 gene locus_tag LOCUS_08820 3327 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 3763 4473 gene locus_tag LOCUS_08830 3763 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 4703 5971 gene locus_tag LOCUS_08840 4703 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 6023 7075 gene locus_tag LOCUS_08850 6023 7075 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence072 1574 3346 gene locus_tag LOCUS_08860 gene uvrC 1574 3346 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 protein_id gnl|my_center|LOCUS_08860 3506 4762 gene locus_tag LOCUS_08870 3506 4762 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876079.1 protein_id gnl|my_center|LOCUS_08870 4940 5653 gene locus_tag LOCUS_08880 4940 5653 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061067.1 protein_id gnl|my_center|LOCUS_08880 6531 6055 gene locus_tag LOCUS_08890 6531 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 <7838 7209 gene locus_tag LOCUS_08900 <7838 7209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060820.1:M42 family metallopeptidase >Feature sequence073 1468 986 gene locus_tag LOCUS_08910 1468 986 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060987.1 protein_id gnl|my_center|LOCUS_08910 1598 1819 gene locus_tag LOCUS_08920 1598 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060739.1 protein_id gnl|my_center|LOCUS_08920 2670 2122 gene locus_tag LOCUS_08930 2670 2122 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061179.1 protein_id gnl|my_center|LOCUS_08930 2865 3542 gene locus_tag LOCUS_08940 2865 3542 CDS product tributyrin esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875745.1 protein_id gnl|my_center|LOCUS_08940 3554 5413 gene locus_tag LOCUS_08950 3554 5413 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060738.1 protein_id gnl|my_center|LOCUS_08950 6356 5649 gene locus_tag LOCUS_08960 6356 5649 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_08960 7287 6604 gene locus_tag LOCUS_08970 7287 6604 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence074 533 1141 gene locus_tag LOCUS_08980 533 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1512 1153 gene locus_tag LOCUS_08990 1512 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2141 1731 gene locus_tag LOCUS_09000 2141 1731 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061150.1 protein_id gnl|my_center|LOCUS_09000 2720 2313 gene locus_tag LOCUS_09010 2720 2313 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064953.1 protein_id gnl|my_center|LOCUS_09010 3427 2927 gene locus_tag LOCUS_09020 gene msrA 3427 2927 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_09020 5092 3683 gene locus_tag LOCUS_09030 5092 3683 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932603.1 protein_id gnl|my_center|LOCUS_09030 7008 5257 gene locus_tag LOCUS_09040 7008 5257 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876085.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence075 131 472 gene locus_tag LOCUS_09050 131 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 475 786 gene locus_tag LOCUS_09060 475 786 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_09060 991 1149 gene locus_tag LOCUS_09070 991 1149 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875907.1 protein_id gnl|my_center|LOCUS_09070 1282 2691 gene locus_tag LOCUS_09080 gene argH 1282 2691 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875908.1 protein_id gnl|my_center|LOCUS_09080 3146 3286 gene locus_tag LOCUS_09090 3146 3286 CDS product DUF3096 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828722.1 protein_id gnl|my_center|LOCUS_09090 4373 3291 gene locus_tag LOCUS_09100 4373 3291 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892473.1 protein_id gnl|my_center|LOCUS_09100 5014 4556 gene locus_tag LOCUS_09110 5014 4556 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_09110 5653 5826 gene locus_tag LOCUS_09120 5653 5826 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence076 654 298 gene locus_tag LOCUS_09130 654 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1196 618 gene locus_tag LOCUS_09140 1196 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2182 1778 gene locus_tag LOCUS_09150 2182 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2389 2580 gene locus_tag LOCUS_09160 2389 2580 CDS product tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992809.1 protein_id gnl|my_center|LOCUS_09160 2661 3956 gene locus_tag LOCUS_09170 2661 3956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103412.1 protein_id gnl|my_center|LOCUS_09170 4132 6276 gene locus_tag LOCUS_09180 4132 6276 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_09180 6772 6389 gene locus_tag LOCUS_09190 6772 6389 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence077 336 701 gene locus_tag LOCUS_09200 336 701 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_09200 1820 708 gene locus_tag LOCUS_09210 1820 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 2541 1864 gene locus_tag LOCUS_09220 2541 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3426 2794 gene locus_tag LOCUS_09230 3426 2794 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 protein_id gnl|my_center|LOCUS_09230 3584 4771 gene locus_tag LOCUS_09240 3584 4771 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_09240 5483 4812 gene locus_tag LOCUS_09250 5483 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 7023 5644 gene locus_tag LOCUS_09260 7023 5644 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868782.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence078 1270 767 gene locus_tag LOCUS_09270 1270 767 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060993.1 protein_id gnl|my_center|LOCUS_09270 2557 1769 gene locus_tag LOCUS_09280 2557 1769 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113847.1 protein_id gnl|my_center|LOCUS_09280 3599 3054 gene locus_tag LOCUS_09290 3599 3054 CDS product PsbP-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876842.1 protein_id gnl|my_center|LOCUS_09290 4316 3654 gene locus_tag LOCUS_09300 4316 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 5022 4309 gene locus_tag LOCUS_09310 gene pheA 5022 4309 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060994.1 protein_id gnl|my_center|LOCUS_09310 6359 5145 gene locus_tag LOCUS_09320 gene mthRnl 6359 5145 CDS product ATP-dependent RNA/DNA ligase MthRnl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060995.1 protein_id gnl|my_center|LOCUS_09320 6869 6399 gene locus_tag LOCUS_09330 6869 6399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09330 7212 6805 gene locus_tag LOCUS_09340 7212 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09340 >Feature sequence079 527 135 gene locus_tag LOCUS_09350 527 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1080 811 gene locus_tag LOCUS_09360 gene rpl37A 1080 811 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876320.1 protein_id gnl|my_center|LOCUS_09360 2117 1326 gene locus_tag LOCUS_09370 gene rrp42 2117 1326 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 protein_id gnl|my_center|LOCUS_09370 2836 2120 gene locus_tag LOCUS_09380 gene rrp41 2836 2120 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876322.1 protein_id gnl|my_center|LOCUS_09380 3641 2853 gene locus_tag LOCUS_09390 gene rrp4 3641 2853 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876323.1 protein_id gnl|my_center|LOCUS_09390 4407 3712 gene locus_tag LOCUS_09400 4407 3712 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_09400 5160 4411 gene locus_tag LOCUS_09410 gene psmA 5160 4411 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 protein_id gnl|my_center|LOCUS_09410 5734 5369 gene locus_tag LOCUS_09420 5734 5369 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876326.1 protein_id gnl|my_center|LOCUS_09420 6708 5998 gene locus_tag LOCUS_09430 6708 5998 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876327.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence080 827 369 gene locus_tag LOCUS_09440 827 369 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060861.1 protein_id gnl|my_center|LOCUS_09440 1289 975 gene locus_tag LOCUS_09450 1289 975 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_09450 2195 1521 gene locus_tag LOCUS_09460 2195 1521 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024089.1 protein_id gnl|my_center|LOCUS_09460 3920 2298 gene locus_tag LOCUS_09470 3920 2298 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296335.1 protein_id gnl|my_center|LOCUS_09470 4160 4840 gene locus_tag LOCUS_09480 4160 4840 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877030.1 protein_id gnl|my_center|LOCUS_09480 4844 5674 gene locus_tag LOCUS_09490 4844 5674 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892707.1 protein_id gnl|my_center|LOCUS_09490 5685 6011 gene locus_tag LOCUS_09500 5685 6011 CDS product DUF5400 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877028.1 protein_id gnl|my_center|LOCUS_09500 6714 6481 gene locus_tag LOCUS_09510 6714 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 6909 6715 gene locus_tag LOCUS_09520 6909 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence081 744 1424 gene locus_tag LOCUS_09530 744 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876815.1 protein_id gnl|my_center|LOCUS_09530 2877 1696 gene locus_tag LOCUS_09540 2877 1696 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_09540 3048 3962 gene locus_tag LOCUS_09550 3048 3962 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876813.1 protein_id gnl|my_center|LOCUS_09550 4243 5337 gene locus_tag LOCUS_09560 4243 5337 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_09560 5922 5620 gene locus_tag LOCUS_09570 5922 5620 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876811.1 protein_id gnl|my_center|LOCUS_09570 6021 6695 gene locus_tag LOCUS_09580 6021 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09580 >Feature sequence082 1031 720 gene locus_tag LOCUS_09590 1031 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1856 2086 gene locus_tag LOCUS_09600 1856 2086 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877678.1 protein_id gnl|my_center|LOCUS_09600 2118 2540 gene locus_tag LOCUS_09610 2118 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876177.1 protein_id gnl|my_center|LOCUS_09610 2598 2819 gene locus_tag LOCUS_09620 2598 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2921 3793 gene locus_tag LOCUS_09630 2921 3793 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 protein_id gnl|my_center|LOCUS_09630 3875 5041 gene locus_tag LOCUS_09640 3875 5041 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061331.1 protein_id gnl|my_center|LOCUS_09640 5310 5774 gene locus_tag LOCUS_09650 5310 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 6562 5783 gene locus_tag LOCUS_09660 6562 5783 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169980830.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence083 2598 1255 gene locus_tag LOCUS_09670 2598 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 4210 2909 gene locus_tag LOCUS_09680 4210 2909 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890088.1 protein_id gnl|my_center|LOCUS_09680 5170 4211 gene locus_tag LOCUS_09690 5170 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 6116 5160 gene locus_tag LOCUS_09700 6116 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09700 6686 6228 gene locus_tag LOCUS_09710 6686 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09710 >Feature sequence084 548 1321 gene locus_tag LOCUS_09720 gene sufC 548 1321 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_09720 1294 1767 gene locus_tag LOCUS_09730 1294 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09730 1844 2512 gene locus_tag LOCUS_09740 1844 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09740 2742 3233 gene locus_tag LOCUS_09750 gene fae 2742 3233 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326305.1 protein_id gnl|my_center|LOCUS_09750 3795 3523 gene locus_tag LOCUS_09760 3795 3523 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876775.1 protein_id gnl|my_center|LOCUS_09760 4416 3814 gene locus_tag LOCUS_09770 4416 3814 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457366.1 protein_id gnl|my_center|LOCUS_09770 4667 5515 gene locus_tag LOCUS_09780 4667 5515 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868260.1 protein_id gnl|my_center|LOCUS_09780 <7247 5904 gene locus_tag LOCUS_09790 <7247 5904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060979.1:methanogenesis marker 14 protein >Feature sequence085 2 178 gene locus_tag LOCUS_09800 2 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1540 368 gene locus_tag LOCUS_09810 1540 368 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876950.1 protein_id gnl|my_center|LOCUS_09810 1814 2239 gene locus_tag LOCUS_09820 1814 2239 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_09820 2933 2370 gene locus_tag LOCUS_09830 2933 2370 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876952.1 protein_id gnl|my_center|LOCUS_09830 3056 3346 gene locus_tag LOCUS_09840 3056 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3996 3349 gene locus_tag LOCUS_09850 3996 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 4254 4526 gene locus_tag LOCUS_09860 4254 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5410 4559 gene locus_tag LOCUS_09870 5410 4559 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876955.1 protein_id gnl|my_center|LOCUS_09870 6231 5782 gene locus_tag LOCUS_09880 6231 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6730 6203 gene locus_tag LOCUS_09890 6730 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence086 2175 565 gene locus_tag LOCUS_09900 2175 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 3631 2168 gene locus_tag LOCUS_09910 3631 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 5747 4200 gene locus_tag LOCUS_09920 5747 4200 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016996.1 protein_id gnl|my_center|LOCUS_09920 6871 5798 gene locus_tag LOCUS_09930 6871 5798 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876374.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence087 1328 126 gene locus_tag LOCUS_09940 1328 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2333 1401 gene locus_tag LOCUS_09950 2333 1401 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_09950 2861 2616 gene locus_tag LOCUS_09960 2861 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3628 6540 gene locus_tag LOCUS_09970 3628 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence088 78 548 gene locus_tag LOCUS_09980 78 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 662 1900 gene locus_tag LOCUS_09990 662 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1894 3381 gene locus_tag LOCUS_10000 1894 3381 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_10000 3547 4737 gene locus_tag LOCUS_10010 3547 4737 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905157.1 protein_id gnl|my_center|LOCUS_10010 5207 6202 gene locus_tag LOCUS_10020 5207 6202 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496672.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence089 1959 952 gene locus_tag LOCUS_10030 gene moaA 1959 952 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061083.1 protein_id gnl|my_center|LOCUS_10030 2667 1972 gene locus_tag LOCUS_10040 gene mobB 2667 1972 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877160.1 protein_id gnl|my_center|LOCUS_10040 4276 3059 gene locus_tag LOCUS_10050 4276 3059 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876981.1 protein_id gnl|my_center|LOCUS_10050 4762 5217 gene locus_tag LOCUS_10060 4762 5217 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061085.1 protein_id gnl|my_center|LOCUS_10060 5207 6265 gene locus_tag LOCUS_10070 5207 6265 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 protein_id gnl|my_center|LOCUS_10070 6282 6512 gene locus_tag LOCUS_10080 6282 6512 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877164.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence090 2485 944 gene locus_tag LOCUS_10090 2485 944 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875946.1 protein_id gnl|my_center|LOCUS_10090 3570 2482 gene locus_tag LOCUS_10100 3570 2482 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875945.1 protein_id gnl|my_center|LOCUS_10100 3849 4310 gene locus_tag LOCUS_10110 3849 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052457324.1 protein_id gnl|my_center|LOCUS_10110 4504 4734 gene locus_tag LOCUS_10120 4504 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5408 4872 gene locus_tag LOCUS_10130 5408 4872 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485739.1 protein_id gnl|my_center|LOCUS_10130 6178 5609 gene locus_tag LOCUS_10140 6178 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence091 1011 2396 gene locus_tag LOCUS_10150 1011 2396 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875743.1 protein_id gnl|my_center|LOCUS_10150 2547 3149 gene locus_tag LOCUS_10160 2547 3149 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279091.1 protein_id gnl|my_center|LOCUS_10160 3283 4725 gene locus_tag LOCUS_10170 gene lmr(B) 3283 4725 CDS product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 protein_id gnl|my_center|LOCUS_10170 5048 6487 gene locus_tag LOCUS_10180 gene lmr(B) 5048 6487 CDS product lincomycin efflux MFS transporter Lmr(B) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886396.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence092 1189 1908 gene locus_tag LOCUS_10190 1189 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1915 4425 gene locus_tag LOCUS_10200 1915 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 4772 4482 gene locus_tag LOCUS_10210 4772 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 5082 4801 gene locus_tag LOCUS_10220 5082 4801 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_10220 5424 5116 gene locus_tag LOCUS_10230 5424 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 5351 5518 gene locus_tag LOCUS_10240 5351 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6385 5720 gene locus_tag LOCUS_10250 6385 5720 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence093 837 1922 gene locus_tag LOCUS_10260 837 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485732.1 protein_id gnl|my_center|LOCUS_10260 1936 2358 gene locus_tag LOCUS_10270 1936 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2367 2783 gene locus_tag LOCUS_10280 2367 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876069.1 protein_id gnl|my_center|LOCUS_10280 2849 3652 gene locus_tag LOCUS_10290 2849 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060818.1 protein_id gnl|my_center|LOCUS_10290 3904 4545 gene locus_tag LOCUS_10300 3904 4545 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_10300 5059 4685 gene locus_tag LOCUS_10310 5059 4685 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250286.1 protein_id gnl|my_center|LOCUS_10310 5621 5037 gene locus_tag LOCUS_10320 5621 5037 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060819.1 protein_id gnl|my_center|LOCUS_10320 6373 5624 gene locus_tag LOCUS_10330 6373 5624 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876074.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence094 <1 647 gene locus_tag LOCUS_10340 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876594.1:fumarate hydratase 804 1688 gene locus_tag LOCUS_10350 804 1688 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876593.1 protein_id gnl|my_center|LOCUS_10350 1798 2112 gene locus_tag LOCUS_10360 gene ahaH 1798 2112 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060933.1 protein_id gnl|my_center|LOCUS_10360 2123 4123 gene locus_tag LOCUS_10370 2123 4123 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060932.1 protein_id gnl|my_center|LOCUS_10370 4129 4617 gene locus_tag LOCUS_10380 4129 4617 CDS product ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876590.1 protein_id gnl|my_center|LOCUS_10380 4650 5273 gene locus_tag LOCUS_10390 4650 5273 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876589.1 protein_id gnl|my_center|LOCUS_10390 5288 6445 gene locus_tag LOCUS_10400 5288 6445 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876588.1 protein_id gnl|my_center|LOCUS_10400 6442 6762 gene locus_tag LOCUS_10410 6442 6762 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876587.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence095 258 1088 gene locus_tag LOCUS_10420 258 1088 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 protein_id gnl|my_center|LOCUS_10420 1099 2088 gene locus_tag LOCUS_10430 1099 2088 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060801.1 protein_id gnl|my_center|LOCUS_10430 2091 3266 gene locus_tag LOCUS_10440 2091 3266 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876015.1 protein_id gnl|my_center|LOCUS_10440 3263 4408 gene locus_tag LOCUS_10450 3263 4408 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296321.1 protein_id gnl|my_center|LOCUS_10450 4460 5686 gene locus_tag LOCUS_10460 4460 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6559 5690 gene locus_tag LOCUS_10470 6559 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence096 399 911 gene locus_tag LOCUS_10480 399 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1025 1495 gene locus_tag LOCUS_10490 1025 1495 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869796.1 protein_id gnl|my_center|LOCUS_10490 2425 1577 gene locus_tag LOCUS_10500 2425 1577 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_10500 3073 2582 gene locus_tag LOCUS_10510 3073 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10510 3499 6240 gene locus_tag LOCUS_10520 3499 6240 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065303.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence097 1213 272 gene locus_tag LOCUS_10530 1213 272 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060741.1 protein_id gnl|my_center|LOCUS_10530 2242 1421 gene locus_tag LOCUS_10540 2242 1421 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121737.1 protein_id gnl|my_center|LOCUS_10540 3437 5155 gene locus_tag LOCUS_10550 3437 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 5797 5177 gene locus_tag LOCUS_10560 5797 5177 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875754.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence098 893 1522 gene locus_tag LOCUS_10570 893 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876656.1 protein_id gnl|my_center|LOCUS_10570 1524 2600 gene locus_tag LOCUS_10580 1524 2600 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_10580 2956 2798 gene locus_tag LOCUS_10590 2956 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3004 3615 gene locus_tag LOCUS_10600 gene rnhB 3004 3615 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_10600 3623 4462 gene locus_tag LOCUS_10610 3623 4462 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876653.1 protein_id gnl|my_center|LOCUS_10610 4489 4884 gene locus_tag LOCUS_10620 4489 4884 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876652.1 protein_id gnl|my_center|LOCUS_10620 5045 5650 gene locus_tag LOCUS_10630 gene purO 5045 5650 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876651.1 protein_id gnl|my_center|LOCUS_10630 5796 6557 gene locus_tag LOCUS_10640 gene cofE 5796 6557 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence099 551 153 gene locus_tag LOCUS_10650 551 153 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061298.1 protein_id gnl|my_center|LOCUS_10650 986 1972 gene locus_tag LOCUS_10660 986 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877011.1 protein_id gnl|my_center|LOCUS_10660 2031 3038 gene locus_tag LOCUS_10670 2031 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3460 3912 gene locus_tag LOCUS_10680 3460 3912 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_10680 3972 5210 gene locus_tag LOCUS_10690 3972 5210 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence100 1056 154 gene locus_tag LOCUS_10700 1056 154 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876994.1 protein_id gnl|my_center|LOCUS_10700 2245 1310 gene locus_tag LOCUS_10710 gene radA 2245 1310 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876995.1 protein_id gnl|my_center|LOCUS_10710 4754 2367 gene locus_tag LOCUS_10720 4754 2367 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115891889.1 protein_id gnl|my_center|LOCUS_10720 5030 5452 gene locus_tag LOCUS_10730 5030 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence101 1225 314 gene locus_tag LOCUS_10740 1225 314 CDS product methyl viologen-reducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943055.1 protein_id gnl|my_center|LOCUS_10740 1785 1225 gene locus_tag LOCUS_10750 1785 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943054.1 protein_id gnl|my_center|LOCUS_10750 2044 1796 gene locus_tag LOCUS_10760 2044 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 3118 2513 gene locus_tag LOCUS_10770 3118 2513 CDS product sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877431.1 protein_id gnl|my_center|LOCUS_10770 3848 3111 gene locus_tag LOCUS_10780 3848 3111 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877432.1 protein_id gnl|my_center|LOCUS_10780 4746 3835 gene locus_tag LOCUS_10790 gene rnz 4746 3835 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_10790 5103 5933 gene locus_tag LOCUS_10800 gene nadC 5103 5933 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877434.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence102 3078 1636 gene locus_tag LOCUS_10810 3078 1636 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_10810 3808 5286 gene locus_tag LOCUS_10820 3808 5286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence103 745 1998 gene locus_tag LOCUS_10830 gene ahcY 745 1998 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877244.1 protein_id gnl|my_center|LOCUS_10830 2150 2764 gene locus_tag LOCUS_10840 2150 2764 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061105.1 protein_id gnl|my_center|LOCUS_10840 2857 2940 gene locus_tag LOCUS_t00100 2857 2940 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5423 3249 gene locus_tag LOCUS_10850 gene katG 5423 3249 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021009.1 protein_id gnl|my_center|LOCUS_10850 <6377 5839 gene locus_tag LOCUS_10860 <6377 5839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877241.1:flap endonuclease-1 >Feature sequence104 953 1594 gene locus_tag LOCUS_10870 953 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1606 4317 gene locus_tag LOCUS_10880 1606 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence105 1478 312 gene locus_tag LOCUS_10890 1478 312 CDS product DUF1512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877450.1 protein_id gnl|my_center|LOCUS_10890 2342 1641 gene locus_tag LOCUS_10900 2342 1641 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877451.1 protein_id gnl|my_center|LOCUS_10900 3950 2418 gene locus_tag LOCUS_10910 3950 2418 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061157.1 protein_id gnl|my_center|LOCUS_10910 4883 4308 gene locus_tag LOCUS_10920 4883 4308 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876572.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence106 496 1368 gene locus_tag LOCUS_10930 496 1368 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250673.1 protein_id gnl|my_center|LOCUS_10930 1527 2663 gene locus_tag LOCUS_10940 1527 2663 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878121.1 protein_id gnl|my_center|LOCUS_10940 2873 4975 gene locus_tag LOCUS_10950 2873 4975 CDS product DUF2206 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021084.1 protein_id gnl|my_center|LOCUS_10950 6234 5116 gene locus_tag LOCUS_10960 6234 5116 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023662.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence107 670 939 gene locus_tag LOCUS_10970 670 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1266 1616 gene locus_tag LOCUS_10980 1266 1616 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876396.1 protein_id gnl|my_center|LOCUS_10980 2112 4079 gene locus_tag LOCUS_10990 2112 4079 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485824.1 protein_id gnl|my_center|LOCUS_10990 4284 4631 gene locus_tag LOCUS_11000 4284 4631 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060783.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence108 909 403 gene locus_tag LOCUS_11010 909 403 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_11010 1138 1764 gene locus_tag LOCUS_11020 1138 1764 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022247.1 protein_id gnl|my_center|LOCUS_11020 1838 2701 gene locus_tag LOCUS_11030 1838 2701 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876384.1 protein_id gnl|my_center|LOCUS_11030 2847 3827 gene locus_tag LOCUS_11040 gene hemB 2847 3827 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060891.1 protein_id gnl|my_center|LOCUS_11040 3967 4881 gene locus_tag LOCUS_11050 3967 4881 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876382.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence109 <1 2382 gene locus_tag LOCUS_11060 <1 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061075.1:cation-transporting P-type ATPase 3802 2687 gene locus_tag LOCUS_11070 3802 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5129 3777 gene locus_tag LOCUS_11080 5129 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 5455 5117 gene locus_tag LOCUS_11090 5455 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence110 <1 1500 gene locus_tag LOCUS_11100 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060813.1:asparagine synthase (glutamine-hydrolyzing) 1593 1808 gene locus_tag LOCUS_11110 gene gatC 1593 1808 CDS product Asp-tRNA(Asn) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876054.1 protein_id gnl|my_center|LOCUS_11110 1920 2408 gene locus_tag LOCUS_11120 1920 2408 CDS product allosteric regulator of homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060814.1 protein_id gnl|my_center|LOCUS_11120 2484 3494 gene locus_tag LOCUS_11130 2484 3494 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876056.1 protein_id gnl|my_center|LOCUS_11130 3722 4927 gene locus_tag LOCUS_11140 3722 4927 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060815.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence111 <1 1212 gene locus_tag LOCUS_11150 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876486.1:GMC family oxidoreductase 1317 2333 gene locus_tag LOCUS_11160 1317 2333 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_11160 2330 2944 gene locus_tag LOCUS_11170 2330 2944 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023065.1 protein_id gnl|my_center|LOCUS_11170 3371 4318 gene locus_tag LOCUS_11180 3371 4318 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023064.1 protein_id gnl|my_center|LOCUS_11180 4522 5916 gene locus_tag LOCUS_11190 4522 5916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11190 >Feature sequence112 1586 1398 gene locus_tag LOCUS_11200 1586 1398 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_11200 2022 1702 gene locus_tag LOCUS_11210 2022 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3468 2023 gene locus_tag LOCUS_11220 3468 2023 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877175.1 protein_id gnl|my_center|LOCUS_11220 4828 3470 gene locus_tag LOCUS_11230 gene nifE 4828 3470 CDS product nitrogenase iron-molybdenum cofactor biosynthesis protein NifE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877174.1 protein_id gnl|my_center|LOCUS_11230 <6002 5077 gene locus_tag LOCUS_11240 <6002 5077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877173.1:nitrogenase component 1 >Feature sequence113 <1 784 gene locus_tag LOCUS_11250 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877404.1:ATP-dependent helicase 1422 2300 gene locus_tag LOCUS_11260 1422 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2861 4240 gene locus_tag LOCUS_11270 2861 4240 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061146.1 protein_id gnl|my_center|LOCUS_11270 4417 5019 gene locus_tag LOCUS_11280 4417 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence114 <1 536 gene locus_tag LOCUS_11290 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020389.1:epoxyqueuosine reductase 784 1956 gene locus_tag LOCUS_11300 784 1956 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939637.1 protein_id gnl|my_center|LOCUS_11300 2184 3329 gene locus_tag LOCUS_11310 2184 3329 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485794.1 protein_id gnl|my_center|LOCUS_11310 3465 4769 gene locus_tag LOCUS_11320 3465 4769 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877360.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence115 1112 1918 gene locus_tag LOCUS_11330 1112 1918 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061072.1 protein_id gnl|my_center|LOCUS_11330 2010 2324 gene locus_tag LOCUS_11340 2010 2324 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_11340 2582 5458 gene locus_tag LOCUS_11350 gene leuS 2582 5458 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061305.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence116 1570 665 gene locus_tag LOCUS_11360 1570 665 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876848.1 protein_id gnl|my_center|LOCUS_11360 2637 1831 gene locus_tag LOCUS_11370 2637 1831 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876849.1 protein_id gnl|my_center|LOCUS_11370 3196 2639 gene locus_tag LOCUS_11380 3196 2639 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876850.1 protein_id gnl|my_center|LOCUS_11380 3909 3208 gene locus_tag LOCUS_11390 3909 3208 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060998.1 protein_id gnl|my_center|LOCUS_11390 4415 3933 gene locus_tag LOCUS_11400 4415 3933 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060999.1 protein_id gnl|my_center|LOCUS_11400 5183 4611 gene locus_tag LOCUS_11410 5183 4611 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061000.1 protein_id gnl|my_center|LOCUS_11410 5744 5421 gene locus_tag LOCUS_11420 5744 5421 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876854.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence117 539 1357 gene locus_tag LOCUS_11430 539 1357 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877187.1 protein_id gnl|my_center|LOCUS_11430 1603 3306 gene locus_tag LOCUS_11440 1603 3306 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061094.1 protein_id gnl|my_center|LOCUS_11440 3752 5769 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctaaaatcagactattttaggattgaaat >Feature sequence118 565 888 gene locus_tag LOCUS_11450 565 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1010 1372 gene locus_tag LOCUS_11460 1010 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1415 1996 gene locus_tag LOCUS_11470 1415 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2064 2345 gene locus_tag LOCUS_11480 2064 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2440 2775 gene locus_tag LOCUS_11490 2440 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2962 3327 gene locus_tag LOCUS_11500 2962 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3610 3410 gene locus_tag LOCUS_11510 3610 3410 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066331.1 protein_id gnl|my_center|LOCUS_11510 4170 3607 gene locus_tag LOCUS_11520 4170 3607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence119 631 1518 gene locus_tag LOCUS_11530 631 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 2314 1586 gene locus_tag LOCUS_11540 2314 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 3297 2617 gene locus_tag LOCUS_11550 3297 2617 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870305.1 protein_id gnl|my_center|LOCUS_11550 4441 3311 gene locus_tag LOCUS_11560 4441 3311 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence120 211 837 gene locus_tag LOCUS_11570 211 837 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_11570 1283 2293 gene locus_tag LOCUS_11580 1283 2293 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876491.1 protein_id gnl|my_center|LOCUS_11580 2259 2690 gene locus_tag LOCUS_11590 2259 2690 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485814.1 protein_id gnl|my_center|LOCUS_11590 3935 2931 gene locus_tag LOCUS_11600 3935 2931 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876493.1 protein_id gnl|my_center|LOCUS_11600 5058 3925 gene locus_tag LOCUS_11610 5058 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence121 1498 992 gene locus_tag LOCUS_11620 1498 992 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877464.1 protein_id gnl|my_center|LOCUS_11620 2097 2621 gene locus_tag LOCUS_11630 2097 2621 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061158.1 protein_id gnl|my_center|LOCUS_11630 2876 3418 gene locus_tag LOCUS_11640 2876 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 4028 3501 gene locus_tag LOCUS_11650 gene pyrE 4028 3501 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877462.1 protein_id gnl|my_center|LOCUS_11650 4256 4077 gene locus_tag LOCUS_11660 4256 4077 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209582242.1 protein_id gnl|my_center|LOCUS_11660 4578 4324 gene locus_tag LOCUS_11670 4578 4324 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877461.1 protein_id gnl|my_center|LOCUS_11670 4999 4874 gene locus_tag LOCUS_11680 4999 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence122 757 149 gene locus_tag LOCUS_11690 757 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11690 1275 805 gene locus_tag LOCUS_11700 1275 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11700 2250 2432 gene locus_tag LOCUS_11710 2250 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060862.1 protein_id gnl|my_center|LOCUS_11710 2446 3099 gene locus_tag LOCUS_11720 2446 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876274.1 protein_id gnl|my_center|LOCUS_11720 3193 3792 gene locus_tag LOCUS_11730 3193 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060796.1 protein_id gnl|my_center|LOCUS_11730 3938 4267 gene locus_tag LOCUS_11740 3938 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4257 4631 gene locus_tag LOCUS_11750 4257 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence123 <1 977 gene locus_tag LOCUS_11760 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158908668.1:HsdR family type I site-specific deoxyribonuclease 1025 1606 gene locus_tag LOCUS_11770 1025 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1875 2453 gene locus_tag LOCUS_11780 1875 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2578 2712 gene locus_tag LOCUS_11790 2578 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2868 3155 gene locus_tag LOCUS_11800 2868 3155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4935 3487 gene locus_tag LOCUS_11810 4935 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 <5668 4958 gene locus_tag LOCUS_11820 <5668 4958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065524.1:DUF2341 domain-containing protein >Feature sequence124 53 904 gene locus_tag LOCUS_11830 gene ahbD 53 904 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_11830 2098 1052 gene locus_tag LOCUS_11840 gene wtpC 2098 1052 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_11840 2876 2085 gene locus_tag LOCUS_11850 2876 2085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020339.1 protein_id gnl|my_center|LOCUS_11850 3768 3061 gene locus_tag LOCUS_11860 3768 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11860 4096 3785 gene locus_tag LOCUS_11870 4096 3785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11870 4695 4378 gene locus_tag LOCUS_11880 4695 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5007 4714 gene locus_tag LOCUS_11890 5007 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 <5620 5121 gene locus_tag LOCUS_11900 <5620 5121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877167.1:formylmethanofuran dehydrogenase subunit C >Feature sequence125 <1 1000 gene locus_tag LOCUS_11910 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876987.1:isoleucine--tRNA ligase 1009 3171 gene locus_tag LOCUS_11920 gene purL 1009 3171 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876986.1 protein_id gnl|my_center|LOCUS_11920 3178 3738 gene locus_tag LOCUS_11930 3178 3738 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876985.1 protein_id gnl|my_center|LOCUS_11930 4995 3856 gene locus_tag LOCUS_11940 4995 3856 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876984.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence126 <1 812 gene locus_tag LOCUS_11950 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876870.1:energy conserving hydrogenase EhbF 828 1166 gene locus_tag LOCUS_11960 828 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876869.1 protein_id gnl|my_center|LOCUS_11960 1159 1440 gene locus_tag LOCUS_11970 1159 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061006.1 protein_id gnl|my_center|LOCUS_11970 1441 1920 gene locus_tag LOCUS_11980 1441 1920 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876867.1 protein_id gnl|my_center|LOCUS_11980 1921 2193 gene locus_tag LOCUS_11990 1921 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876866.1 protein_id gnl|my_center|LOCUS_11990 2416 3780 gene locus_tag LOCUS_12000 2416 3780 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061005.1 protein_id gnl|my_center|LOCUS_12000 3777 4262 gene locus_tag LOCUS_12010 3777 4262 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061004.1 protein_id gnl|my_center|LOCUS_12010 4346 4792 gene locus_tag LOCUS_12020 4346 4792 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876863.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence127 61 1233 gene locus_tag LOCUS_12030 61 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1999 1595 gene locus_tag LOCUS_12040 1999 1595 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_12040 2515 2045 gene locus_tag LOCUS_12050 gene pyrI 2515 2045 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060913.1 protein_id gnl|my_center|LOCUS_12050 3047 2628 gene locus_tag LOCUS_12060 3047 2628 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060980.1 protein_id gnl|my_center|LOCUS_12060 4050 3052 gene locus_tag LOCUS_12070 4050 3052 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060981.1 protein_id gnl|my_center|LOCUS_12070 <5495 4408 gene locus_tag LOCUS_12080 <5495 4408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876482.1:preprotein translocase subunit SecD >Feature sequence128 <1 744 gene locus_tag LOCUS_12090 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061154.1:TatD family hydrolase 1660 809 gene locus_tag LOCUS_12100 1660 809 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061153.1 protein_id gnl|my_center|LOCUS_12100 2704 1925 gene locus_tag LOCUS_12110 2704 1925 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_12110 3563 2784 gene locus_tag LOCUS_12120 3563 2784 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_12120 4728 3574 gene locus_tag LOCUS_12130 4728 3574 CDS product DUF2226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061152.1 protein_id gnl|my_center|LOCUS_12130 5355 5005 gene locus_tag LOCUS_12140 gene sepF 5355 5005 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877440.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence129 1585 464 gene locus_tag LOCUS_12150 1585 464 CDS product histidine kinase dimerization/phosphoacceptor domain -containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876616.1 protein_id gnl|my_center|LOCUS_12150 2741 1575 gene locus_tag LOCUS_12160 2741 1575 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088548.1 protein_id gnl|my_center|LOCUS_12160 3122 3574 gene locus_tag LOCUS_12170 3122 3574 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485767.1 protein_id gnl|my_center|LOCUS_12170 3798 4796 gene locus_tag LOCUS_12180 3798 4796 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485766.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence130 905 348 gene locus_tag LOCUS_12190 905 348 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876906.1 protein_id gnl|my_center|LOCUS_12190 1062 1532 gene locus_tag LOCUS_12200 1062 1532 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876905.1 protein_id gnl|my_center|LOCUS_12200 4081 1763 gene locus_tag LOCUS_12210 gene hypF 4081 1763 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496588.1 protein_id gnl|my_center|LOCUS_12210 4247 5014 gene locus_tag LOCUS_12220 gene larB 4247 5014 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061016.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence131 1910 1113 gene locus_tag LOCUS_12230 1910 1113 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061059.1 protein_id gnl|my_center|LOCUS_12230 2157 2921 gene locus_tag LOCUS_12240 2157 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 2918 3334 gene locus_tag LOCUS_12250 2918 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 3216 4064 gene locus_tag LOCUS_12260 3216 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 5094 4177 gene locus_tag LOCUS_12270 5094 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877252.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence132 1548 1123 gene locus_tag LOCUS_12280 gene hisI 1548 1123 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061191.1 protein_id gnl|my_center|LOCUS_12280 2976 1696 gene locus_tag LOCUS_12290 gene hisS 2976 1696 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061190.1 protein_id gnl|my_center|LOCUS_12290 3064 3297 gene locus_tag LOCUS_12300 3064 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 4063 3401 gene locus_tag LOCUS_12310 4063 3401 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875882.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence133 2038 1439 gene locus_tag LOCUS_12320 2038 1439 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485785.1 protein_id gnl|my_center|LOCUS_12320 2665 2462 gene locus_tag LOCUS_12330 2665 2462 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877303.1 protein_id gnl|my_center|LOCUS_12330 3346 2903 gene locus_tag LOCUS_12340 3346 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12340 4095 3436 gene locus_tag LOCUS_12350 4095 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12350 5093 4461 gene locus_tag LOCUS_12360 5093 4461 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892541.1 protein_id gnl|my_center|LOCUS_12360 5344 5153 gene locus_tag LOCUS_12370 5344 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence134 2399 1404 gene locus_tag LOCUS_12380 2399 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 4048 2549 gene locus_tag LOCUS_12390 4048 2549 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877273.1 protein_id gnl|my_center|LOCUS_12390 <5288 4200 gene locus_tag LOCUS_12400 <5288 4200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876115.1:thiamine pyrophosphate-binding protein >Feature sequence135 1193 1801 gene locus_tag LOCUS_12410 1193 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2028 2372 gene locus_tag LOCUS_12420 2028 2372 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_12420 2365 2967 gene locus_tag LOCUS_12430 2365 2967 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031387.1 protein_id gnl|my_center|LOCUS_12430 2991 3272 gene locus_tag LOCUS_12440 2991 3272 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence136 986 459 gene locus_tag LOCUS_12450 986 459 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_12450 1422 1075 gene locus_tag LOCUS_12460 1422 1075 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990680.1 protein_id gnl|my_center|LOCUS_12460 1803 1438 gene locus_tag LOCUS_12470 1803 1438 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_12470 1989 2297 gene locus_tag LOCUS_12480 1989 2297 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892103.1 protein_id gnl|my_center|LOCUS_12480 2307 3383 gene locus_tag LOCUS_12490 gene arsB 2307 3383 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876533.1 protein_id gnl|my_center|LOCUS_12490 3474 3863 gene locus_tag LOCUS_12500 3474 3863 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892103.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence137 850 134 gene locus_tag LOCUS_12510 850 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1318 1100 gene locus_tag LOCUS_12520 1318 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 2041 1325 gene locus_tag LOCUS_12530 2041 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 <5189 2071 gene locus_tag LOCUS_12540 <5189 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001111655.1:Ig-like domain-containing protein >Feature sequence138 2339 339 gene locus_tag LOCUS_12550 2339 339 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877372.1 protein_id gnl|my_center|LOCUS_12550 2733 3167 gene locus_tag LOCUS_12560 2733 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061140.1 protein_id gnl|my_center|LOCUS_12560 4058 3441 gene locus_tag LOCUS_12570 gene rrmJ 4058 3441 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_12570 4699 4166 gene locus_tag LOCUS_12580 4699 4166 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence139 1 135 gene locus_tag LOCUS_12590 1 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1352 288 gene locus_tag LOCUS_12600 1352 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2560 1463 gene locus_tag LOCUS_12610 2560 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3689 2904 gene locus_tag LOCUS_12620 3689 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 <5141 3887 gene locus_tag LOCUS_12630 <5141 3887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965641.1:glycosyltransferase >Feature sequence140 <1 1493 gene locus_tag LOCUS_12640 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877980.1:copper-translocating P-type ATPase CopA 1584 1730 gene locus_tag LOCUS_12650 1584 1730 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755885.1 protein_id gnl|my_center|LOCUS_12650 1753 1878 gene locus_tag LOCUS_12660 1753 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2114 2344 gene locus_tag LOCUS_12670 2114 2344 CDS product TIGR04165 family Cys-rich peptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875760.1 protein_id gnl|my_center|LOCUS_12670 3800 2547 gene locus_tag LOCUS_12680 gene truD 3800 2547 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877138.1 protein_id gnl|my_center|LOCUS_12680 4527 3970 gene locus_tag LOCUS_12690 4527 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 5015 4608 gene locus_tag LOCUS_12700 5015 4608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence141 <1 961 gene locus_tag LOCUS_12710 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877460.1:YhgE/Pip domain-containing protein 1179 2009 gene locus_tag LOCUS_12720 1179 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2557 3024 gene locus_tag LOCUS_12730 2557 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3039 3935 gene locus_tag LOCUS_12740 3039 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4407 4186 gene locus_tag LOCUS_12750 4407 4186 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_12750 4502 4320 gene locus_tag LOCUS_12760 4502 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence142 680 1672 gene locus_tag LOCUS_12770 gene ilvC 680 1672 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061053.1 protein_id gnl|my_center|LOCUS_12770 1938 2927 gene locus_tag LOCUS_12780 1938 2927 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061052.1 protein_id gnl|my_center|LOCUS_12780 4950 3337 gene locus_tag LOCUS_12790 4950 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence143 1319 2875 gene locus_tag LOCUS_12800 1319 2875 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876488.1 protein_id gnl|my_center|LOCUS_12800 2872 3258 gene locus_tag LOCUS_12810 2872 3258 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876487.1 protein_id gnl|my_center|LOCUS_12810 4700 3540 gene locus_tag LOCUS_12820 4700 3540 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876410.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence144 <1 670 gene locus_tag LOCUS_12830 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876201.1:hydroxymethylglutaryl-CoA reductase (NADPH) 893 1474 gene locus_tag LOCUS_12840 893 1474 CDS product TIGR00267 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876200.1 protein_id gnl|my_center|LOCUS_12840 2595 1723 gene locus_tag LOCUS_12850 2595 1723 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876199.1 protein_id gnl|my_center|LOCUS_12850 3513 2653 gene locus_tag LOCUS_12860 3513 2653 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_12860 3906 3601 gene locus_tag LOCUS_12870 3906 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4205 3924 gene locus_tag LOCUS_12880 4205 3924 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_12880 4947 4420 gene locus_tag LOCUS_12890 4947 4420 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence145 <1 1113 gene locus_tag LOCUS_12900 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000809373.1:amino acid permease 1876 1187 gene locus_tag LOCUS_12910 1876 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2236 1895 gene locus_tag LOCUS_12920 2236 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2427 2248 gene locus_tag LOCUS_12930 2427 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 <4930 3146 gene locus_tag LOCUS_12940 <4930 3146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876085.1:response regulator >Feature sequence146 981 1148 gene locus_tag LOCUS_12950 981 1148 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061197.1 protein_id gnl|my_center|LOCUS_12950 1166 2353 gene locus_tag LOCUS_12960 1166 2353 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061196.1 protein_id gnl|my_center|LOCUS_12960 3274 2477 gene locus_tag LOCUS_12970 3274 2477 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875914.1 protein_id gnl|my_center|LOCUS_12970 4226 3459 gene locus_tag LOCUS_12980 4226 3459 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892471.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence147 898 2379 gene locus_tag LOCUS_12990 898 2379 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023666.1 protein_id gnl|my_center|LOCUS_12990 2498 2848 gene locus_tag LOCUS_13000 2498 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 4259 3108 gene locus_tag LOCUS_13010 4259 3108 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence148 118 909 gene locus_tag LOCUS_13020 118 909 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_13020 976 1338 gene locus_tag LOCUS_13030 976 1338 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875679.1 protein_id gnl|my_center|LOCUS_13030 1418 1840 gene locus_tag LOCUS_13040 gene rplM 1418 1840 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_13040 1863 2264 gene locus_tag LOCUS_13050 1863 2264 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_13050 2276 2443 gene locus_tag LOCUS_13060 2276 2443 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875681.1 protein_id gnl|my_center|LOCUS_13060 2795 2971 gene locus_tag LOCUS_13070 2795 2971 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162828720.1 protein_id gnl|my_center|LOCUS_13070 3123 4379 gene locus_tag LOCUS_13080 gene eno 3123 4379 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_13080 4492 4680 gene locus_tag LOCUS_13090 4492 4680 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061279.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence149 <1 1765 gene locus_tag LOCUS_13100 <1 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255917.1:acetate--CoA ligase 1827 2432 gene locus_tag LOCUS_13110 1827 2432 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060771.1 protein_id gnl|my_center|LOCUS_13110 3898 2699 gene locus_tag LOCUS_13120 3898 2699 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876486.1 protein_id gnl|my_center|LOCUS_13120 4445 3999 gene locus_tag LOCUS_13130 4445 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence150 281 622 gene locus_tag LOCUS_13140 281 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877508.1 protein_id gnl|my_center|LOCUS_13140 960 1463 gene locus_tag LOCUS_13150 960 1463 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877509.1 protein_id gnl|my_center|LOCUS_13150 1465 2649 gene locus_tag LOCUS_13160 1465 2649 CDS product TIGR03576 family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877510.1 protein_id gnl|my_center|LOCUS_13160 2708 3724 gene locus_tag LOCUS_13170 gene rtcA 2708 3724 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877511.1 protein_id gnl|my_center|LOCUS_13170 <4847 3892 gene locus_tag LOCUS_13180 <4847 3892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877512.1:biotin--[acetyl-CoA-carboxylase] ligase >Feature sequence151 1122 454 gene locus_tag LOCUS_13190 1122 454 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877200.1 protein_id gnl|my_center|LOCUS_13190 1730 1152 gene locus_tag LOCUS_13200 1730 1152 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877201.1 protein_id gnl|my_center|LOCUS_13200 2492 2034 gene locus_tag LOCUS_13210 2492 2034 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963527.1 protein_id gnl|my_center|LOCUS_13210 3208 2873 gene locus_tag LOCUS_13220 3208 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4212 3463 gene locus_tag LOCUS_13230 4212 3463 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865221.1 protein_id gnl|my_center|LOCUS_13230 4796 4230 gene locus_tag LOCUS_13240 4796 4230 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197538709.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence152 1083 778 gene locus_tag LOCUS_13250 1083 778 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877314.1 protein_id gnl|my_center|LOCUS_13250 1415 1080 gene locus_tag LOCUS_13260 1415 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13260 1761 1297 gene locus_tag LOCUS_13270 1761 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13270 2435 2160 gene locus_tag LOCUS_13280 2435 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence153 1121 711 gene locus_tag LOCUS_13290 gene ribH 1121 711 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877002.1 protein_id gnl|my_center|LOCUS_13290 2485 1277 gene locus_tag LOCUS_13300 2485 1277 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061297.1 protein_id gnl|my_center|LOCUS_13300 3746 2757 gene locus_tag LOCUS_13310 3746 2757 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061040.1 protein_id gnl|my_center|LOCUS_13310 4499 4005 gene locus_tag LOCUS_13320 4499 4005 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876999.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence154 1466 2773 gene locus_tag LOCUS_13330 1466 2773 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_13330 3054 3590 gene locus_tag LOCUS_13340 3054 3590 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024403.1 protein_id gnl|my_center|LOCUS_13340 <4739 3891 gene locus_tag LOCUS_13350 <4739 3891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066378.1:AI-2E family transporter >Feature sequence155 3543 688 gene locus_tag LOCUS_13360 3543 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13360 4663 3749 gene locus_tag LOCUS_13370 4663 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence156 189 701 gene locus_tag LOCUS_13380 189 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 826 900 gene locus_tag LOCUS_t00110 826 900 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1893 1090 gene locus_tag LOCUS_13390 1893 1090 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061050.1 protein_id gnl|my_center|LOCUS_13390 2060 2836 gene locus_tag LOCUS_13400 gene surE 2060 2836 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_13400 3407 3739 gene locus_tag LOCUS_13410 3407 3739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877046.1 protein_id gnl|my_center|LOCUS_13410 3736 4560 gene locus_tag LOCUS_13420 3736 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877047.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence157 325 663 gene locus_tag LOCUS_13430 325 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 743 2428 gene locus_tag LOCUS_13440 743 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13440 2454 3116 gene locus_tag LOCUS_13450 2454 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13450 3894 3547 gene locus_tag LOCUS_13460 3894 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 <4665 4101 gene locus_tag LOCUS_13470 <4665 4101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461019.1:undecaprenyl-phosphate glucose phosphotransferase >Feature sequence158 <1 2120 gene locus_tag LOCUS_13480 <1 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223224.1:phage holin family protein 2285 2443 gene locus_tag LOCUS_13490 2285 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 2895 2494 gene locus_tag LOCUS_13500 2895 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 3902 3210 gene locus_tag LOCUS_13510 3902 3210 CDS product dihydromethanopterin reductase (acceptor) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876991.1 protein_id gnl|my_center|LOCUS_13510 <4635 4050 gene locus_tag LOCUS_13520 <4635 4050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061037.1:serine hydroxymethyltransferase >Feature sequence159 206 1201 gene locus_tag LOCUS_13530 206 1201 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877487.1 protein_id gnl|my_center|LOCUS_13530 1498 2724 gene locus_tag LOCUS_13540 1498 2724 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870253.1 protein_id gnl|my_center|LOCUS_13540 2779 3198 gene locus_tag LOCUS_13550 2779 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875858.1 protein_id gnl|my_center|LOCUS_13550 3972 3577 gene locus_tag LOCUS_13560 3972 3577 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877486.1 protein_id gnl|my_center|LOCUS_13560 <4617 3950 gene locus_tag LOCUS_13570 <4617 3950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877485.1:2-phosphoglycerate kinase >Feature sequence160 430 53 gene locus_tag LOCUS_13580 430 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13580 744 1676 gene locus_tag LOCUS_13590 744 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13590 1714 2538 gene locus_tag LOCUS_13600 1714 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13600 2890 3279 gene locus_tag LOCUS_13610 2890 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3558 4343 gene locus_tag LOCUS_13620 3558 4343 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence161 162 88 gene locus_tag LOCUS_t00120 162 88 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1720 485 gene locus_tag LOCUS_13630 gene pgk 1720 485 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061271.1 protein_id gnl|my_center|LOCUS_13630 2644 1964 gene locus_tag LOCUS_13640 gene tpiA 2644 1964 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876672.1 protein_id gnl|my_center|LOCUS_13640 3891 3193 gene locus_tag LOCUS_13650 3891 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence162 983 192 gene locus_tag LOCUS_13660 983 192 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876899.1 protein_id gnl|my_center|LOCUS_13660 1351 1124 gene locus_tag LOCUS_13670 1351 1124 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876898.1 protein_id gnl|my_center|LOCUS_13670 2850 1495 gene locus_tag LOCUS_13680 gene gatB 2850 1495 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876897.1 protein_id gnl|my_center|LOCUS_13680 3932 2919 gene locus_tag LOCUS_13690 3932 2919 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496555.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence163 256 681 gene locus_tag LOCUS_13700 256 681 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877058.1 protein_id gnl|my_center|LOCUS_13700 985 2685 gene locus_tag LOCUS_13710 gene argS 985 2685 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877057.1 protein_id gnl|my_center|LOCUS_13710 3960 3052 gene locus_tag LOCUS_13720 gene argF 3960 3052 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877056.1 protein_id gnl|my_center|LOCUS_13720 4529 4104 gene locus_tag LOCUS_13730 4529 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence164 2269 1355 gene locus_tag LOCUS_13740 2269 1355 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877153.1 protein_id gnl|my_center|LOCUS_13740 3382 2519 gene locus_tag LOCUS_13750 3382 2519 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061082.1 protein_id gnl|my_center|LOCUS_13750 3579 4163 gene locus_tag LOCUS_13760 gene hxlB 3579 4163 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061311.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence165 1020 1922 gene locus_tag LOCUS_13770 1020 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2539 2207 gene locus_tag LOCUS_13780 2539 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3477 2644 gene locus_tag LOCUS_13790 3477 2644 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence166 <1 800 gene locus_tag LOCUS_13800 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876345.1:Glu-tRNA(Gln) amidotransferase subunit GatD 951 2816 gene locus_tag LOCUS_13810 gene gatE 951 2816 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876346.1 protein_id gnl|my_center|LOCUS_13810 2951 3865 gene locus_tag LOCUS_13820 gene trxB 2951 3865 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060886.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence167 810 409 gene locus_tag LOCUS_13830 810 409 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061047.1 protein_id gnl|my_center|LOCUS_13830 1579 1022 gene locus_tag LOCUS_13840 1579 1022 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877036.1 protein_id gnl|my_center|LOCUS_13840 3416 1776 gene locus_tag LOCUS_13850 3416 1776 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877037.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence168 2160 1282 gene locus_tag LOCUS_13860 gene nifH 2160 1282 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461519.1 protein_id gnl|my_center|LOCUS_13860 3854 2484 gene locus_tag LOCUS_13870 3854 2484 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388551.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence169 <1 562 gene locus_tag LOCUS_13880 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061119.1:50S ribosomal protein L1 563 1567 gene locus_tag LOCUS_13890 563 1567 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_13890 1672 1974 gene locus_tag LOCUS_13900 1672 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence170 194 27 gene locus_tag LOCUS_13910 194 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 409 1131 gene locus_tag LOCUS_13920 409 1131 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061008.1 protein_id gnl|my_center|LOCUS_13920 1293 1991 gene locus_tag LOCUS_13930 1293 1991 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876876.1 protein_id gnl|my_center|LOCUS_13930 2209 2520 gene locus_tag LOCUS_13940 2209 2520 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876875.1 protein_id gnl|my_center|LOCUS_13940 2517 2777 gene locus_tag LOCUS_13950 2517 2777 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876874.1 protein_id gnl|my_center|LOCUS_13950 2778 3050 gene locus_tag LOCUS_13960 2778 3050 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496454.1 protein_id gnl|my_center|LOCUS_13960 3047 3280 gene locus_tag LOCUS_13970 3047 3280 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869936.1 protein_id gnl|my_center|LOCUS_13970 3282 3644 gene locus_tag LOCUS_13980 3282 3644 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330371.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence171 234 536 gene locus_tag LOCUS_13990 234 536 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869636.1 protein_id gnl|my_center|LOCUS_13990 529 900 gene locus_tag LOCUS_14000 529 900 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546762.1 protein_id gnl|my_center|LOCUS_14000 1107 3455 gene locus_tag LOCUS_14010 1107 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence172 <1 2405 gene locus_tag LOCUS_14020 <1 2405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907996.1:long-chain fatty acid--CoA ligase 2395 3003 gene locus_tag LOCUS_14030 2395 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 3090 4373 gene locus_tag LOCUS_14040 3090 4373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence173 3690 1078 gene locus_tag LOCUS_14050 gene rpoA1 3690 1078 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876677.1 protein_id gnl|my_center|LOCUS_14050 <4441 3831 gene locus_tag LOCUS_14060 <4441 3831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876676.1:DNA-directed RNA polymerase subunit B >Feature sequence174 <1 1148 gene locus_tag LOCUS_14070 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256120.1:Ig-like domain-containing protein 2087 1374 gene locus_tag LOCUS_14080 2087 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876122.1 protein_id gnl|my_center|LOCUS_14080 2474 3058 gene locus_tag LOCUS_14090 2474 3058 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875750.1 protein_id gnl|my_center|LOCUS_14090 3977 3213 gene locus_tag LOCUS_14100 gene cobM 3977 3213 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876241.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence175 1233 1553 gene locus_tag LOCUS_14110 1233 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1831 3144 gene locus_tag LOCUS_14120 1831 3144 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877248.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence176 1233 79 gene locus_tag LOCUS_14130 1233 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2071 1250 gene locus_tag LOCUS_14140 gene dapB 2071 1250 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876435.1 protein_id gnl|my_center|LOCUS_14140 3356 2466 gene locus_tag LOCUS_14150 gene dapA 3356 2466 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869742.1 protein_id gnl|my_center|LOCUS_14150 <4406 3353 gene locus_tag LOCUS_14160 <4406 3353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876437.1:aspartate kinase >Feature sequence177 1406 531 gene locus_tag LOCUS_14170 gene rfbA 1406 531 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_14170 2602 1766 gene locus_tag LOCUS_14180 2602 1766 CDS product DUF4012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875869.1 protein_id gnl|my_center|LOCUS_14180 3258 2947 gene locus_tag LOCUS_14190 3258 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 <4401 3447 gene locus_tag LOCUS_14200 <4401 3447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875869.1:DUF4012 domain-containing protein >Feature sequence178 1864 959 gene locus_tag LOCUS_14210 1864 959 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877489.1 protein_id gnl|my_center|LOCUS_14210 3431 2316 gene locus_tag LOCUS_14220 gene gntC 3431 2316 CDS product guanitoxin biosynthesis PLP-dependent (S)-gamma-hydroxy-L-arginine cyclodehydratase GntC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061335.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence179 1405 563 gene locus_tag LOCUS_14230 1405 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14230 1433 1579 gene locus_tag LOCUS_14240 1433 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2055 2765 gene locus_tag LOCUS_14250 2055 2765 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796792.1 protein_id gnl|my_center|LOCUS_14250 <4345 2937 gene locus_tag LOCUS_14260 <4345 2937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256205.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence180 539 117 gene locus_tag LOCUS_14270 539 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1323 790 gene locus_tag LOCUS_14280 1323 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2121 1339 gene locus_tag LOCUS_14290 2121 1339 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065064.1 protein_id gnl|my_center|LOCUS_14290 3137 2118 gene locus_tag LOCUS_14300 3137 2118 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_14300 <4340 3453 gene locus_tag LOCUS_14310 <4340 3453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065059.1:iron ABC transporter substrate-binding protein >Feature sequence181 493 810 gene locus_tag LOCUS_14320 493 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 771 1865 gene locus_tag LOCUS_14330 771 1865 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022859.1 protein_id gnl|my_center|LOCUS_14330 1867 3333 gene locus_tag LOCUS_14340 1867 3333 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060885.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence182 261 1187 gene locus_tag LOCUS_14350 gene ilvE 261 1187 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_14350 1706 2530 gene locus_tag LOCUS_14360 1706 2530 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_14360 3399 2707 gene locus_tag LOCUS_14370 3399 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877039.1 protein_id gnl|my_center|LOCUS_14370 <4313 3534 gene locus_tag LOCUS_14380 <4313 3534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061048.1:TIGR00303 family protein >Feature sequence183 1642 881 gene locus_tag LOCUS_14390 1642 881 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_14390 3114 1720 gene locus_tag LOCUS_14400 gene cdhC 3114 1720 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877318.1 protein_id gnl|my_center|LOCUS_14400 3981 3466 gene locus_tag LOCUS_14410 gene cdhB 3981 3466 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877317.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence184 56 1057 gene locus_tag LOCUS_14420 56 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1393 2529 gene locus_tag LOCUS_14430 1393 2529 CDS product TIGR04083 family peptide-modifying radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023249.1 protein_id gnl|my_center|LOCUS_14430 3800 2856 gene locus_tag LOCUS_14440 3800 2856 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence185 1445 1173 gene locus_tag LOCUS_14450 1445 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 1549 2010 gene locus_tag LOCUS_14460 gene rimI 1549 2010 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876630.1 protein_id gnl|my_center|LOCUS_14460 2254 3336 gene locus_tag LOCUS_14470 gene carA 2254 3336 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060942.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence186 929 360 gene locus_tag LOCUS_14480 929 360 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_14480 1665 1108 gene locus_tag LOCUS_14490 1665 1108 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060730.1 protein_id gnl|my_center|LOCUS_14490 3047 1704 gene locus_tag LOCUS_14500 gene secY 3047 1704 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_14500 3621 3184 gene locus_tag LOCUS_14510 3621 3184 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875667.1 protein_id gnl|my_center|LOCUS_14510 4139 3681 gene locus_tag LOCUS_14520 gene rpmD 4139 3681 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence187 <1 637 gene locus_tag LOCUS_14530 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875685.1:AmmeMemoRadiSam system protein B 1093 2067 gene locus_tag LOCUS_14540 gene mvk 1093 2067 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875686.1 protein_id gnl|my_center|LOCUS_14540 2969 3781 gene locus_tag LOCUS_14550 2969 3781 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence188 2161 791 gene locus_tag LOCUS_14560 2161 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3572 2415 gene locus_tag LOCUS_14570 3572 2415 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_14570 3745 3569 gene locus_tag LOCUS_14580 3745 3569 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_14580 4162 4245 gene locus_tag LOCUS_t00130 4162 4245 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence189 375 1523 gene locus_tag LOCUS_14590 gene dnaG 375 1523 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876524.1 protein_id gnl|my_center|LOCUS_14590 1648 3159 gene locus_tag LOCUS_14600 1648 3159 CDS product Lon protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876525.1 protein_id gnl|my_center|LOCUS_14600 3249 3998 gene locus_tag LOCUS_14610 3249 3998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14610 >Feature sequence190 <1 891 gene locus_tag LOCUS_14620 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876467.1:hydantoinase/oxoprolinase family protein 1180 1866 gene locus_tag LOCUS_14630 1180 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876466.1 protein_id gnl|my_center|LOCUS_14630 2819 2301 gene locus_tag LOCUS_14640 2819 2301 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060908.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence191 1388 1200 gene locus_tag LOCUS_14650 1388 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1627 1821 gene locus_tag LOCUS_14660 1627 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2088 3179 gene locus_tag LOCUS_14670 2088 3179 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272581.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence192 <1 919 gene locus_tag LOCUS_14680 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052261150.1:pseudomurein-binding repeat-containing protein 1576 2544 gene locus_tag LOCUS_14690 1576 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence193 674 351 gene locus_tag LOCUS_14700 gene pth2 674 351 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 protein_id gnl|my_center|LOCUS_14700 1604 1071 gene locus_tag LOCUS_14710 1604 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2601 2017 gene locus_tag LOCUS_14720 2601 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3938 2751 gene locus_tag LOCUS_14730 3938 2751 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876618.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence194 1847 1104 gene locus_tag LOCUS_14740 1847 1104 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890403.1 protein_id gnl|my_center|LOCUS_14740 2208 2056 gene locus_tag LOCUS_14750 2208 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2695 3126 gene locus_tag LOCUS_14760 2695 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence195 1440 430 gene locus_tag LOCUS_14770 gene argC 1440 430 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876479.1 protein_id gnl|my_center|LOCUS_14770 3423 2542 gene locus_tag LOCUS_14780 gene argB 3423 2542 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875822.1 protein_id gnl|my_center|LOCUS_14780 4137 3631 gene locus_tag LOCUS_14790 4137 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 >Feature sequence196 1887 1009 gene locus_tag LOCUS_14800 1887 1009 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_14800 2418 2876 gene locus_tag LOCUS_14810 2418 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2937 3737 gene locus_tag LOCUS_14820 2937 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14820 >Feature sequence197 <1 697 gene locus_tag LOCUS_14830 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876794.1:methyl coenzyme M reductase-arginine methyltransferase Mmp10 906 2228 gene locus_tag LOCUS_14840 906 2228 CDS product methyl-coenzyme M reductase glutamine C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876795.1 protein_id gnl|my_center|LOCUS_14840 3310 2498 gene locus_tag LOCUS_14850 3310 2498 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_14850 3779 3444 gene locus_tag LOCUS_14860 3779 3444 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876801.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence198 1447 332 gene locus_tag LOCUS_14870 1447 332 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876468.1 protein_id gnl|my_center|LOCUS_14870 2824 1508 gene locus_tag LOCUS_14880 gene wecB 2824 1508 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060909.1 protein_id gnl|my_center|LOCUS_14880 <4124 2919 gene locus_tag LOCUS_14890 <4124 2919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143485763.1:DUF460 domain-containing protein >Feature sequence199 647 69 gene locus_tag LOCUS_14900 647 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 884 1582 gene locus_tag LOCUS_14910 884 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2921 1731 gene locus_tag LOCUS_14920 gene hemA 2921 1731 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060949.1 protein_id gnl|my_center|LOCUS_14920 3817 3191 gene locus_tag LOCUS_14930 3817 3191 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060950.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence200 1514 792 gene locus_tag LOCUS_14940 1514 792 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477233.1 protein_id gnl|my_center|LOCUS_14940 1994 2176 gene locus_tag LOCUS_14950 1994 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060744.1 protein_id gnl|my_center|LOCUS_14950 2436 2768 gene locus_tag LOCUS_14960 2436 2768 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060937.1 protein_id gnl|my_center|LOCUS_14960 2780 3544 gene locus_tag LOCUS_14970 2780 3544 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence201 12 1097 gene locus_tag LOCUS_14980 12 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1271 1846 gene locus_tag LOCUS_14990 1271 1846 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877478.1 protein_id gnl|my_center|LOCUS_14990 2698 1970 gene locus_tag LOCUS_15000 2698 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877479.1 protein_id gnl|my_center|LOCUS_15000 3142 4062 gene locus_tag LOCUS_15010 3142 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence202 <1 935 gene locus_tag LOCUS_15020 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876597.1:tRNA(Ile)(2)-agmatinylcytidine synthase 1214 2590 gene locus_tag LOCUS_15030 1214 2590 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876596.1 protein_id gnl|my_center|LOCUS_15030 2739 3641 gene locus_tag LOCUS_15040 2739 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence203 <4059 3087 gene locus_tag LOCUS_15050 <4059 3087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021765.1:DUF2341 domain-containing protein >Feature sequence204 2654 1911 gene locus_tag LOCUS_15060 2654 1911 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877405.1 protein_id gnl|my_center|LOCUS_15060 3168 3746 gene locus_tag LOCUS_15070 3168 3746 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877408.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence205 67 954 gene locus_tag LOCUS_15080 67 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 1902 1111 gene locus_tag LOCUS_15090 1902 1111 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060846.1 protein_id gnl|my_center|LOCUS_15090 2586 1963 gene locus_tag LOCUS_15100 2586 1963 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876213.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence206 1052 477 gene locus_tag LOCUS_15110 1052 477 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877264.1 protein_id gnl|my_center|LOCUS_15110 2500 1049 gene locus_tag LOCUS_15120 gene trpE 2500 1049 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_15120 2726 3229 gene locus_tag LOCUS_15130 2726 3229 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061113.1 protein_id gnl|my_center|LOCUS_15130 3746 3504 gene locus_tag LOCUS_15140 3746 3504 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877257.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence207 1436 360 gene locus_tag LOCUS_15150 1436 360 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876803.1 protein_id gnl|my_center|LOCUS_15150 2493 1582 gene locus_tag LOCUS_15160 2493 1582 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876804.1 protein_id gnl|my_center|LOCUS_15160 3029 2478 gene locus_tag LOCUS_15170 3029 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060984.1 protein_id gnl|my_center|LOCUS_15170 3480 3689 gene locus_tag LOCUS_15180 3480 3689 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876887.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence208 513 1214 gene locus_tag LOCUS_15190 513 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2774 2388 gene locus_tag LOCUS_15200 2774 2388 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875703.1 protein_id gnl|my_center|LOCUS_15200 <3884 3016 gene locus_tag LOCUS_15210 <3884 3016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876908.1:molecular chaperone DnaJ >Feature sequence209 3 407 gene locus_tag LOCUS_15220 3 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 623 3523 gene locus_tag LOCUS_15230 gene uvrA 623 3523 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence210 486 1007 gene locus_tag LOCUS_15240 486 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1084 1557 gene locus_tag LOCUS_15250 1084 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15250 1600 1881 gene locus_tag LOCUS_15260 1600 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1919 2722 gene locus_tag LOCUS_15270 gene proG 1919 2722 CDS product pyrroline-5-carboxylate reductase ProG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232626.1 protein_id gnl|my_center|LOCUS_15270 3056 2799 gene locus_tag LOCUS_15280 3056 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3308 3688 gene locus_tag LOCUS_15290 3308 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence211 764 228 gene locus_tag LOCUS_15300 764 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876909.1 protein_id gnl|my_center|LOCUS_15300 1183 782 gene locus_tag LOCUS_15310 1183 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876910.1 protein_id gnl|my_center|LOCUS_15310 1557 1315 gene locus_tag LOCUS_15320 1557 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 1850 2782 gene locus_tag LOCUS_15330 gene map 1850 2782 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061017.1 protein_id gnl|my_center|LOCUS_15330 <3853 3150 gene locus_tag LOCUS_15340 <3853 3150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876912.1:coenzyme F420 hydrogenase subunit beta >Feature sequence212 1138 1485 gene locus_tag LOCUS_15350 1138 1485 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877438.1 protein_id gnl|my_center|LOCUS_15350 1531 2496 gene locus_tag LOCUS_15360 1531 2496 CDS product 3H domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877437.1 protein_id gnl|my_center|LOCUS_15360 2612 3175 gene locus_tag LOCUS_15370 2612 3175 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877436.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence213 482 757 gene locus_tag LOCUS_15380 482 757 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_15380 873 1172 gene locus_tag LOCUS_15390 873 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1355 2263 gene locus_tag LOCUS_15400 1355 2263 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963433.1 protein_id gnl|my_center|LOCUS_15400 3152 2385 gene locus_tag LOCUS_15410 3152 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022686.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence214 343 62 gene locus_tag LOCUS_15420 343 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1314 439 gene locus_tag LOCUS_15430 1314 439 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485757.1 protein_id gnl|my_center|LOCUS_15430 2181 1687 gene locus_tag LOCUS_15440 gene hycI 2181 1687 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485809.1 protein_id gnl|my_center|LOCUS_15440 2992 2150 gene locus_tag LOCUS_15450 2992 2150 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876377.1 protein_id gnl|my_center|LOCUS_15450 3513 3094 gene locus_tag LOCUS_15460 gene nikR 3513 3094 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876378.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence215 1719 1216 gene locus_tag LOCUS_15470 gene endA 1719 1216 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_15470 2472 1876 gene locus_tag LOCUS_15480 gene hxlB 2472 1876 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061192.1 protein_id gnl|my_center|LOCUS_15480 3258 2587 gene locus_tag LOCUS_15490 gene npdG 3258 2587 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence216 729 316 gene locus_tag LOCUS_15500 729 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3044 804 gene locus_tag LOCUS_15510 3044 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3283 3149 gene locus_tag LOCUS_15520 3283 3149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence217 884 2656 gene locus_tag LOCUS_15530 884 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence218 905 2254 gene locus_tag LOCUS_15540 gene glmM 905 2254 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877192.1 protein_id gnl|my_center|LOCUS_15540 2550 2350 gene locus_tag LOCUS_15550 2550 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2724 3299 gene locus_tag LOCUS_15560 gene afpA 2724 3299 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876336.1 protein_id gnl|my_center|LOCUS_15560 3614 3291 gene locus_tag LOCUS_15570 3614 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060881.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence219 788 573 gene locus_tag LOCUS_15580 788 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1270 845 gene locus_tag LOCUS_15590 1270 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1523 2389 gene locus_tag LOCUS_15600 1523 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence220 2286 763 gene locus_tag LOCUS_15610 2286 763 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073935.1 protein_id gnl|my_center|LOCUS_15610 <3658 2283 gene locus_tag LOCUS_15620 <3658 2283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546856.1:type I restriction-modification enzyme R subunit C-terminal domain-containing protein >Feature sequence221 3146 1167 gene locus_tag LOCUS_15630 gene hdrA 3146 1167 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence222 523 1938 gene locus_tag LOCUS_15640 523 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2004 3104 gene locus_tag LOCUS_15650 2004 3104 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876835.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence223 2161 1781 gene locus_tag LOCUS_15660 2161 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2691 3464 gene locus_tag LOCUS_15670 2691 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence224 807 154 gene locus_tag LOCUS_15680 807 154 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876460.1 protein_id gnl|my_center|LOCUS_15680 1470 838 gene locus_tag LOCUS_15690 1470 838 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876461.1 protein_id gnl|my_center|LOCUS_15690 2559 2059 gene locus_tag LOCUS_15700 gene hacB 2559 2059 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876462.1 protein_id gnl|my_center|LOCUS_15700 3574 2582 gene locus_tag LOCUS_15710 3574 2582 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876463.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence225 <1 1263 gene locus_tag LOCUS_15720 <1 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876698.1:DUF11 domain-containing protein 1867 2361 gene locus_tag LOCUS_15730 1867 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 3136 2492 gene locus_tag LOCUS_15740 3136 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence226 724 1881 gene locus_tag LOCUS_15750 724 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2032 2244 gene locus_tag LOCUS_15760 2032 2244 CDS product DUF1922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876808.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence227 185 15 gene locus_tag LOCUS_15770 185 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 603 286 gene locus_tag LOCUS_15780 603 286 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061022.1 protein_id gnl|my_center|LOCUS_15780 1346 939 gene locus_tag LOCUS_15790 1346 939 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876928.1 protein_id gnl|my_center|LOCUS_15790 2126 1497 gene locus_tag LOCUS_15800 2126 1497 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061023.1 protein_id gnl|my_center|LOCUS_15800 2468 2205 gene locus_tag LOCUS_15810 2468 2205 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876930.1 protein_id gnl|my_center|LOCUS_15810 3097 2762 gene locus_tag LOCUS_15820 3097 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence228 1407 685 gene locus_tag LOCUS_15830 1407 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 <3577 2366 gene locus_tag LOCUS_15840 <3577 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876459.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase >Feature sequence229 1359 2147 gene locus_tag LOCUS_15850 1359 2147 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393681.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence230 <1 914 gene locus_tag LOCUS_15860 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061035.1:methionine adenosyltransferase >Feature sequence231 <1 1424 gene locus_tag LOCUS_15870 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877491.1:radical SAM protein 1988 2485 gene locus_tag LOCUS_15880 1988 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 <3490 2876 gene locus_tag LOCUS_15890 <3490 2876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876185.1:amino acid permease >Feature sequence232 679 296 gene locus_tag LOCUS_15900 679 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1317 748 gene locus_tag LOCUS_15910 1317 748 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_15910 2029 1520 gene locus_tag LOCUS_15920 2029 1520 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_15920 2336 2515 gene locus_tag LOCUS_15930 2336 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence233 1419 433 gene locus_tag LOCUS_15940 gene dph2 1419 433 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_15940 2043 1468 gene locus_tag LOCUS_15950 gene hpt 2043 1468 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence234 <1 731 gene locus_tag LOCUS_15960 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022297.1:rhodanese-like domain-containing protein 736 1257 gene locus_tag LOCUS_15970 736 1257 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876721.1 protein_id gnl|my_center|LOCUS_15970 1364 1852 gene locus_tag LOCUS_15980 1364 1852 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_15980 3028 2012 gene locus_tag LOCUS_15990 3028 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence235 2095 2382 gene locus_tag LOCUS_16000 2095 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 <3428 2671 gene locus_tag LOCUS_16010 <3428 2671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877505.1:DUF2070 family protein >Feature sequence236 445 726 gene locus_tag LOCUS_16020 445 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1761 802 gene locus_tag LOCUS_16030 1761 802 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142703.1 protein_id gnl|my_center|LOCUS_16030 2152 1880 gene locus_tag LOCUS_16040 2152 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16040 2622 2149 gene locus_tag LOCUS_16050 2622 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16050 2866 3408 gene locus_tag LOCUS_16060 2866 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence237 1087 377 gene locus_tag LOCUS_16070 1087 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1460 1831 gene locus_tag LOCUS_16080 1460 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 1841 2272 gene locus_tag LOCUS_16090 1841 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2317 2688 gene locus_tag LOCUS_16100 2317 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 2698 3129 gene locus_tag LOCUS_16110 2698 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence238 355 696 gene locus_tag LOCUS_16120 355 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 988 914 gene locus_tag LOCUS_t00140 988 914 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1242 1658 gene locus_tag LOCUS_16130 1242 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1670 2620 gene locus_tag LOCUS_16140 1670 2620 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104632.1 protein_id gnl|my_center|LOCUS_16140 2664 3293 gene locus_tag LOCUS_16150 2664 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence239 440 640 gene locus_tag LOCUS_16160 440 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 777 2183 gene locus_tag LOCUS_16170 777 2183 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_16170 <3404 2390 gene locus_tag LOCUS_16180 <3404 2390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060924.1:MBL fold metallo-hydrolase >Feature sequence240 231 659 gene locus_tag LOCUS_16190 231 659 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143485784.1 protein_id gnl|my_center|LOCUS_16190 662 1735 gene locus_tag LOCUS_16200 662 1735 CDS product DrrA-related ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877097.1 protein_id gnl|my_center|LOCUS_16200 1737 2927 gene locus_tag LOCUS_16210 1737 2927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877096.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence241 1470 184 gene locus_tag LOCUS_16220 1470 184 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437464.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16220 1747 1403 gene locus_tag LOCUS_16230 1747 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16230 <3367 2166 gene locus_tag LOCUS_16240 <3367 2166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876422.1:ATP-dependent protease LonB >Feature sequence242 2 640 gene locus_tag LOCUS_16250 2 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 621 1610 gene locus_tag LOCUS_16260 gene gshAB 621 1610 CDS product bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964848.1 protein_id gnl|my_center|LOCUS_16260 2125 2382 gene locus_tag LOCUS_16270 2125 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2917 2495 gene locus_tag LOCUS_16280 2917 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence243 >Feature sequence244 1585 479 gene locus_tag LOCUS_16290 1585 479 CDS product methyltransferase dimerization domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392934.1 protein_id gnl|my_center|LOCUS_16290 3270 1663 gene locus_tag LOCUS_16300 3270 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence245 3 2588 gene locus_tag LOCUS_16310 gene polC 3 2588 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061308.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence246 897 1766 gene locus_tag LOCUS_16320 897 1766 CDS product methanogen output domain 1-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876086.1 protein_id gnl|my_center|LOCUS_16320 2421 1828 gene locus_tag LOCUS_16330 gene iorB 2421 1828 CDS product indolepyruvate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877455.1 protein_id gnl|my_center|LOCUS_16330 <3318 2550 gene locus_tag LOCUS_16340 <3318 2550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877454.1:indolepyruvate ferredoxin oxidoreductase subunit alpha >Feature sequence247 541 17 gene locus_tag LOCUS_16350 541 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2046 907 gene locus_tag LOCUS_16360 2046 907 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358342.1 protein_id gnl|my_center|LOCUS_16360 2945 2310 gene locus_tag LOCUS_16370 2945 2310 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876045.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence248 71 304 gene locus_tag LOCUS_16380 71 304 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876674.1 protein_id gnl|my_center|LOCUS_16380 351 1841 gene locus_tag LOCUS_16390 351 1841 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060959.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence249 625 80 gene locus_tag LOCUS_16400 625 80 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877270.1 protein_id gnl|my_center|LOCUS_16400 918 628 gene locus_tag LOCUS_16410 918 628 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061319.1 protein_id gnl|my_center|LOCUS_16410 2015 1104 gene locus_tag LOCUS_16420 2015 1104 CDS product DUF5591 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061115.1 protein_id gnl|my_center|LOCUS_16420 <3307 2439 gene locus_tag LOCUS_16430 <3307 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152082941.1:DUF3320 domain-containing protein >Feature sequence250 1891 548 gene locus_tag LOCUS_16440 gene ftsA 1891 548 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877137.1 protein_id gnl|my_center|LOCUS_16440 2011 2787 gene locus_tag LOCUS_16450 2011 2787 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361083.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence251 1083 154 gene locus_tag LOCUS_16460 1083 154 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876306.1 protein_id gnl|my_center|LOCUS_16460 1790 1107 gene locus_tag LOCUS_16470 1790 1107 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876307.1 protein_id gnl|my_center|LOCUS_16470 2643 2362 gene locus_tag LOCUS_16480 2643 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3035 2685 gene locus_tag LOCUS_16490 3035 2685 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876316.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence252 1339 1782 gene locus_tag LOCUS_16500 1339 1782 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876477.1 protein_id gnl|my_center|LOCUS_16500 <3282 2076 gene locus_tag LOCUS_16510 <3282 2076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052261150.1:pseudomurein-binding repeat-containing protein >Feature sequence253 955 2187 gene locus_tag LOCUS_16520 955 2187 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 protein_id gnl|my_center|LOCUS_16520 2251 2589 gene locus_tag LOCUS_16530 2251 2589 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence254 722 264 gene locus_tag LOCUS_16540 722 264 CDS product DUF1959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876035.1 protein_id gnl|my_center|LOCUS_16540 1045 719 gene locus_tag LOCUS_16550 1045 719 CDS product DUF2104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876034.1 protein_id gnl|my_center|LOCUS_16550 1319 1059 gene locus_tag LOCUS_16560 1319 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2357 1491 gene locus_tag LOCUS_16570 2357 1491 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876032.1 protein_id gnl|my_center|LOCUS_16570 2637 2422 gene locus_tag LOCUS_16580 2637 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060808.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence255 1744 449 gene locus_tag LOCUS_16590 1744 449 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_16590 1960 2820 gene locus_tag LOCUS_16600 gene hisG 1960 2820 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877116.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence256 1071 676 gene locus_tag LOCUS_16610 1071 676 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876052.1 protein_id gnl|my_center|LOCUS_16610 1428 3167 gene locus_tag LOCUS_16620 1428 3167 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061055.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence257 1314 598 gene locus_tag LOCUS_16630 1314 598 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876647.1 protein_id gnl|my_center|LOCUS_16630 2302 1538 gene locus_tag LOCUS_16640 2302 1538 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_16640 <3207 2299 gene locus_tag LOCUS_16650 <3207 2299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060952.1:2-phospho-L-lactate transferase >Feature sequence258 2488 1661 gene locus_tag LOCUS_16660 gene mtaC 2488 1661 CDS product methanol--corrinoid protein MtaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021627.1 protein_id gnl|my_center|LOCUS_16660 <3166 2502 gene locus_tag LOCUS_16670 <3166 2502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024271.1:methanol--corrinoid protein co-methyltransferase MtaB >Feature sequence259 1695 742 gene locus_tag LOCUS_16680 1695 742 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876130.1 protein_id gnl|my_center|LOCUS_16680 2972 2232 gene locus_tag LOCUS_16690 2972 2232 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875742.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence260 511 17 gene locus_tag LOCUS_16700 511 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1352 555 gene locus_tag LOCUS_16710 1352 555 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876400.1 protein_id gnl|my_center|LOCUS_16710 2544 1390 gene locus_tag LOCUS_16720 2544 1390 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_16720 3008 2891 gene locus_tag LOCUS_r00010 3008 2891 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence261 988 443 gene locus_tag LOCUS_16730 988 443 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144143.1 protein_id gnl|my_center|LOCUS_16730 1639 1310 gene locus_tag LOCUS_16740 1639 1310 CDS product DUF2098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060902.1 protein_id gnl|my_center|LOCUS_16740 1959 1666 gene locus_tag LOCUS_16750 1959 1666 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892157.1 protein_id gnl|my_center|LOCUS_16750 2167 3114 gene locus_tag LOCUS_16760 2167 3114 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876451.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence262 1709 1209 gene locus_tag LOCUS_16770 1709 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 2617 1856 gene locus_tag LOCUS_16780 2617 1856 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence263 1329 667 gene locus_tag LOCUS_16790 1329 667 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963355.1 protein_id gnl|my_center|LOCUS_16790 2147 1671 gene locus_tag LOCUS_16800 2147 1671 CDS product DUF2124 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876495.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence264 1079 1420 gene locus_tag LOCUS_16810 1079 1420 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061225.1 protein_id gnl|my_center|LOCUS_16810 1590 2345 gene locus_tag LOCUS_16820 1590 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061265.1 protein_id gnl|my_center|LOCUS_16820 <3084 2477 gene locus_tag LOCUS_16830 <3084 2477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876598.1:transcriptional regulator >Feature sequence265 110 1783 gene locus_tag LOCUS_16840 110 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence266 1279 221 gene locus_tag LOCUS_16850 1279 221 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061258.1 protein_id gnl|my_center|LOCUS_16850 1976 1308 gene locus_tag LOCUS_16860 1976 1308 CDS product RraA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876521.1 protein_id gnl|my_center|LOCUS_16860 2415 2125 gene locus_tag LOCUS_16870 2415 2125 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876522.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence267 1168 779 gene locus_tag LOCUS_16880 1168 779 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_16880 <3048 1339 gene locus_tag LOCUS_16890 <3048 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875898.1:translation initiation factor IF-2 >Feature sequence268 1 858 gene locus_tag LOCUS_16900 1 858 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892670.1 protein_id gnl|my_center|LOCUS_16900 1059 1706 gene locus_tag LOCUS_16910 1059 1706 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_16910 1806 2591 gene locus_tag LOCUS_16920 1806 2591 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877090.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence269 1525 587 gene locus_tag LOCUS_16930 1525 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 2182 2796 gene locus_tag LOCUS_16940 2182 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence270 1563 436 gene locus_tag LOCUS_16950 gene cbiD 1563 436 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876443.1 protein_id gnl|my_center|LOCUS_16950 1954 1697 gene locus_tag LOCUS_16960 1954 1697 CDS product MJ0307 family thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876442.1 protein_id gnl|my_center|LOCUS_16960 2945 2025 gene locus_tag LOCUS_16970 gene sppA 2945 2025 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876441.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence271 112 477 gene locus_tag LOCUS_16980 112 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1052 1798 gene locus_tag LOCUS_16990 1052 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence272 1410 193 gene locus_tag LOCUS_17000 1410 193 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876838.1 protein_id gnl|my_center|LOCUS_17000 1511 2410 gene locus_tag LOCUS_17010 1511 2410 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060992.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence273 1776 397 gene locus_tag LOCUS_17020 1776 397 CDS product DUF515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876659.1 protein_id gnl|my_center|LOCUS_17020 2488 1766 gene locus_tag LOCUS_17030 2488 1766 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060953.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence274 <1 611 gene locus_tag LOCUS_17040 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877341.1:fumarate hydratase 1334 654 gene locus_tag LOCUS_17050 1334 654 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_17050 2327 1653 gene locus_tag LOCUS_17060 gene phoU 2327 1653 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877340.1 protein_id gnl|my_center|LOCUS_17060 2776 2330 gene locus_tag LOCUS_17070 2776 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence275 1701 1156 gene locus_tag LOCUS_17080 1701 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 2387 2001 gene locus_tag LOCUS_17090 2387 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2797 2405 gene locus_tag LOCUS_17100 2797 2405 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870858.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence276 547 215 gene locus_tag LOCUS_17110 547 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1205 627 gene locus_tag LOCUS_17120 1205 627 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_17120 1607 1275 gene locus_tag LOCUS_17130 1607 1275 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_17130 1906 1613 gene locus_tag LOCUS_17140 1906 1613 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876936.1 protein_id gnl|my_center|LOCUS_17140 <2929 2242 gene locus_tag LOCUS_17150 <2929 2242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876935.1:tRNA pseudouridine(54/55) synthase Pus10 >Feature sequence277 238 621 gene locus_tag LOCUS_17160 238 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 687 1082 gene locus_tag LOCUS_17170 gene tsaA 687 1082 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877752.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence278 610 810 gene locus_tag LOCUS_17180 610 810 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061136.1 protein_id gnl|my_center|LOCUS_17180 918 1934 gene locus_tag LOCUS_17190 918 1934 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868734.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence279 <1 702 gene locus_tag LOCUS_17200 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060911.1:1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase 2040 799 gene locus_tag LOCUS_17210 2040 799 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876099.1 protein_id gnl|my_center|LOCUS_17210 2814 2329 gene locus_tag LOCUS_17220 2814 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 >Feature sequence280 1847 981 gene locus_tag LOCUS_17230 1847 981 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_17230 1908 2372 gene locus_tag LOCUS_17240 1908 2372 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence281 1181 549 gene locus_tag LOCUS_17250 1181 549 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877104.1 protein_id gnl|my_center|LOCUS_17250 1574 1398 gene locus_tag LOCUS_17260 1574 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2619 1627 gene locus_tag LOCUS_17270 gene ala 2619 1627 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061064.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence282 <1 1652 gene locus_tag LOCUS_17280 <1 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193330373.1:anaerobic ribonucleoside-triphosphate reductase 1751 2206 gene locus_tag LOCUS_17290 1751 2206 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071603.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence283 1822 1484 gene locus_tag LOCUS_17300 1822 1484 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060878.1 protein_id gnl|my_center|LOCUS_17300 2459 1785 gene locus_tag LOCUS_17310 2459 1785 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876309.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence284 320 988 gene locus_tag LOCUS_17320 gene deoC 320 988 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060904.1 protein_id gnl|my_center|LOCUS_17320 1220 1573 gene locus_tag LOCUS_17330 1220 1573 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061251.1 protein_id gnl|my_center|LOCUS_17330 <2804 1704 gene locus_tag LOCUS_17340 <2804 1704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060905.1:5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH >Feature sequence285 1248 430 gene locus_tag LOCUS_17350 gene truA 1248 430 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 protein_id gnl|my_center|LOCUS_17350 1524 2489 gene locus_tag LOCUS_17360 1524 2489 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876474.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence286 1203 745 gene locus_tag LOCUS_17370 1203 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1409 1573 gene locus_tag LOCUS_17380 1409 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 2467 1745 gene locus_tag LOCUS_17390 2467 1745 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence287 877 755 gene locus_tag LOCUS_17400 877 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1006 1380 gene locus_tag LOCUS_17410 1006 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1396 2001 gene locus_tag LOCUS_17420 1396 2001 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877352.1 protein_id gnl|my_center|LOCUS_17420 <2782 2181 gene locus_tag LOCUS_17430 <2782 2181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876832.1:DNA polymerase PolB subunit 1 >Feature sequence288 2239 1559 gene locus_tag LOCUS_17440 2239 1559 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875848.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence289 1593 1889 gene locus_tag LOCUS_17450 1593 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1982 2515 gene locus_tag LOCUS_17460 1982 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence290 70 1218 gene locus_tag LOCUS_17470 gene pseC 70 1218 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_17470 1231 2076 gene locus_tag LOCUS_17480 1231 2076 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence291 996 328 gene locus_tag LOCUS_17490 996 328 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_17490 1785 1258 gene locus_tag LOCUS_17500 1785 1258 CDS product DUF2096 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877483.1 protein_id gnl|my_center|LOCUS_17500 2048 1782 gene locus_tag LOCUS_17510 2048 1782 CDS product DUF749 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877482.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence292 1622 579 gene locus_tag LOCUS_17520 gene trpD 1622 579 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877269.1 protein_id gnl|my_center|LOCUS_17520 2474 1662 gene locus_tag LOCUS_17530 gene trpA 2474 1662 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750470.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence293 1647 2015 gene locus_tag LOCUS_17540 1647 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 2242 2703 gene locus_tag LOCUS_17550 2242 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence294 238 531 gene locus_tag LOCUS_17560 238 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence295 955 422 gene locus_tag LOCUS_17570 955 422 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877240.1 protein_id gnl|my_center|LOCUS_17570 2231 957 gene locus_tag LOCUS_17580 gene hacA 2231 957 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061104.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence296 <1 795 gene locus_tag LOCUS_17590 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876390.1:DUF2121 family protein 904 1680 gene locus_tag LOCUS_17600 904 1680 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876389.1 protein_id gnl|my_center|LOCUS_17600 2439 1813 gene locus_tag LOCUS_17610 2439 1813 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860254.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence297 196 1032 gene locus_tag LOCUS_17620 196 1032 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877445.1 protein_id gnl|my_center|LOCUS_17620 1200 1352 gene locus_tag LOCUS_17630 1200 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 <2643 1549 gene locus_tag LOCUS_17640 <2643 1549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061155.1:glycine--tRNA ligase >Feature sequence298 572 1186 gene locus_tag LOCUS_17650 572 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1771 1241 gene locus_tag LOCUS_17660 gene yjjX 1771 1241 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061167.1 protein_id gnl|my_center|LOCUS_17660 2285 1815 gene locus_tag LOCUS_17670 2285 1815 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence299 744 1418 gene locus_tag LOCUS_17680 744 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 2279 1614 gene locus_tag LOCUS_17690 2279 1614 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876839.1 protein_id gnl|my_center|LOCUS_17690 2614 2333 gene locus_tag LOCUS_17700 2614 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence300 445 1233 gene locus_tag LOCUS_17710 445 1233 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877103.1 protein_id gnl|my_center|LOCUS_17710 2612 1506 gene locus_tag LOCUS_17720 2612 1506 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877428.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence301 725 1420 gene locus_tag LOCUS_17730 725 1420 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531970.1 protein_id gnl|my_center|LOCUS_17730 2170 1421 gene locus_tag LOCUS_17740 2170 1421 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892471.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence302 <2572 1873 gene locus_tag LOCUS_17750 <2572 1873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061109.1:AarF/ABC1/UbiB kinase family protein >Feature sequence303 <2563 66 gene locus_tag LOCUS_17760 <2563 66 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393289.1:AAA family ATPase >Feature sequence304 <1 546 gene locus_tag LOCUS_17770 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990768.1:CDGSH iron-sulfur domain-containing protein 578 934 gene locus_tag LOCUS_17780 578 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 <2525 1053 gene locus_tag LOCUS_17790 <2525 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876959.1:ATP-dependent DNA helicase >Feature sequence305 261 512 gene locus_tag LOCUS_17800 261 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 543 917 gene locus_tag LOCUS_17810 543 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875901.1 protein_id gnl|my_center|LOCUS_17810 1140 1658 gene locus_tag LOCUS_17820 1140 1658 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_17820 1821 2405 gene locus_tag LOCUS_17830 gene rpoE 1821 2405 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence306 503 66 gene locus_tag LOCUS_17840 503 66 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875788.1 protein_id gnl|my_center|LOCUS_17840 1179 643 gene locus_tag LOCUS_17850 1179 643 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060754.1 protein_id gnl|my_center|LOCUS_17850 2040 1276 gene locus_tag LOCUS_17860 2040 1276 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876961.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence307 422 509 gene locus_tag LOCUS_t00150 422 509 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1011 652 gene locus_tag LOCUS_17870 1011 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1471 1070 gene locus_tag LOCUS_17880 1471 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1785 1624 gene locus_tag LOCUS_17890 1785 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence308 1195 596 gene locus_tag LOCUS_17900 1195 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence309 966 1205 gene locus_tag LOCUS_17910 966 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17910 1262 1477 gene locus_tag LOCUS_17920 1262 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17920 >Feature sequence310 1831 482 gene locus_tag LOCUS_17930 1831 482 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875689.1 protein_id gnl|my_center|LOCUS_17930 <2430 1828 gene locus_tag LOCUS_17940 <2430 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875688.1:type 2 isopentenyl-diphosphate Delta-isomerase >Feature sequence311 1736 738 gene locus_tag LOCUS_17950 1736 738 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876717.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence312 >Feature sequence313 2064 1270 gene locus_tag LOCUS_17960 2064 1270 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927154.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence314 2230 1394 gene locus_tag LOCUS_17970 2230 1394 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence315 2123 555 gene locus_tag LOCUS_17980 2123 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence316 >Feature sequence317 635 1000 gene locus_tag LOCUS_17990 635 1000 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889330.1 protein_id gnl|my_center|LOCUS_17990 981 2306 gene locus_tag LOCUS_18000 981 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence318 1882 1205 gene locus_tag LOCUS_18010 1882 1205 CDS product DUF2100 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876819.1 protein_id gnl|my_center|LOCUS_18010 >Feature sequence319 1133 681 gene locus_tag LOCUS_18020 1133 681 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876265.1 protein_id gnl|my_center|LOCUS_18020 1863 2057 gene locus_tag LOCUS_18030 1863 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence320 1375 650 gene locus_tag LOCUS_18040 1375 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060844.1 protein_id gnl|my_center|LOCUS_18040 1690 1812 gene locus_tag LOCUS_18050 1690 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 >Feature sequence321 >Feature sequence322 1825 1283 gene locus_tag LOCUS_18060 gene cyaB 1825 1283 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877237.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence323 <1 563 gene locus_tag LOCUS_18070 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877231.1:STT3 domain-containing protein 839 1933 gene locus_tag LOCUS_18080 839 1933 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence324 691 1470 gene locus_tag LOCUS_18090 691 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1897 1631 gene locus_tag LOCUS_18100 1897 1631 CDS product energy-converting hydrogenase B subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061002.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence325 348 1727 gene locus_tag LOCUS_18110 gene acsC 348 1727 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877321.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence326 1067 765 gene locus_tag LOCUS_18120 1067 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence327 770 1297 gene locus_tag LOCUS_18130 770 1297 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941475.1 protein_id gnl|my_center|LOCUS_18130 1328 1654 gene locus_tag LOCUS_18140 1328 1654 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence328 1475 489 gene locus_tag LOCUS_18150 1475 489 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061160.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence329 26 1150 gene locus_tag LOCUS_18160 26 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1353 1754 gene locus_tag LOCUS_18170 1353 1754 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876369.1 protein_id gnl|my_center|LOCUS_18170 2220 1813 gene locus_tag LOCUS_18180 2220 1813 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence330 294 596 gene locus_tag LOCUS_18190 294 596 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_18190 589 732 gene locus_tag LOCUS_18200 589 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1075 779 gene locus_tag LOCUS_18210 1075 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1454 1633 gene locus_tag LOCUS_18220 1454 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence331 448 1368 gene locus_tag LOCUS_18230 448 1368 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061249.1 protein_id gnl|my_center|LOCUS_18230 1361 1666 gene locus_tag LOCUS_18240 1361 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 1659 1847 gene locus_tag LOCUS_18250 1659 1847 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence332 <1 1381 gene locus_tag LOCUS_18260 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876975.1:cobaltochelatase subunit CobN >Feature sequence333 1530 391 gene locus_tag LOCUS_18270 1530 391 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877311.1 protein_id gnl|my_center|LOCUS_18270 <2195 1671 gene locus_tag LOCUS_18280 <2195 1671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083750460.1:CpaF family protein >Feature sequence334 884 420 gene locus_tag LOCUS_18290 884 420 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060850.1 protein_id gnl|my_center|LOCUS_18290 <2189 901 gene locus_tag LOCUS_18300 <2189 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876227.1:DUF530 domain-containing protein >Feature sequence335 1597 1043 gene locus_tag LOCUS_18310 1597 1043 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877472.1 protein_id gnl|my_center|LOCUS_18310 <2188 1608 gene locus_tag LOCUS_18320 <2188 1608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877471.1:methanogenesis marker 15 protein >Feature sequence336 1774 413 gene locus_tag LOCUS_18330 1774 413 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061005.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence337 <1 639 gene locus_tag LOCUS_18340 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022720.1:TetR/AcrR family transcriptional regulator 1001 1939 gene locus_tag LOCUS_18350 1001 1939 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence338 573 998 gene locus_tag LOCUS_18360 573 998 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_18360 1014 1577 gene locus_tag LOCUS_18370 gene rpsG 1014 1577 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876682.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence339 90 1394 gene locus_tag LOCUS_18380 90 1394 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892604.1 protein_id gnl|my_center|LOCUS_18380 1757 1551 gene locus_tag LOCUS_18390 1757 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence340 100 1017 gene locus_tag LOCUS_18400 gene dapF 100 1017 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876947.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence341 676 266 gene locus_tag LOCUS_18410 676 266 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061234.1 protein_id gnl|my_center|LOCUS_18410 1007 1459 gene locus_tag LOCUS_18420 1007 1459 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence342 <1 1147 gene locus_tag LOCUS_18430 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877283.1:cell division protein FtsZ 1418 1600 gene locus_tag LOCUS_18440 1418 1600 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877284.1 protein_id gnl|my_center|LOCUS_18440 1799 2098 gene locus_tag LOCUS_18450 1799 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence343 835 71 gene locus_tag LOCUS_18460 835 71 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 protein_id gnl|my_center|LOCUS_18460 1475 1197 gene locus_tag LOCUS_18470 1475 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892859.1 protein_id gnl|my_center|LOCUS_18470 1966 1595 gene locus_tag LOCUS_18480 1966 1595 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876989.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence344 49 1323 gene locus_tag LOCUS_18490 gene thiC 49 1323 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877184.1 protein_id gnl|my_center|LOCUS_18490 1565 1843 gene locus_tag LOCUS_18500 1565 1843 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877185.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence345 >Feature sequence346 598 230 gene locus_tag LOCUS_18510 598 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 733 1272 gene locus_tag LOCUS_18520 733 1272 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060923.1 protein_id gnl|my_center|LOCUS_18520 1620 1958 gene locus_tag LOCUS_18530 1620 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence347 17 634 gene locus_tag LOCUS_18540 17 634 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016134873.1 protein_id gnl|my_center|LOCUS_18540 1059 1349 gene locus_tag LOCUS_18550 1059 1349 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791253.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence348 1028 426 gene locus_tag LOCUS_18560 1028 426 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_18560 1428 1120 gene locus_tag LOCUS_18570 1428 1120 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389410.1 protein_id gnl|my_center|LOCUS_18570 <2058 1526 gene locus_tag LOCUS_18580 <2058 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876939.1:16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA >Feature sequence349 262 143 gene locus_tag LOCUS_18590 262 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 600 319 gene locus_tag LOCUS_18600 600 319 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245674.1 protein_id gnl|my_center|LOCUS_18600 >Feature sequence350 606 4 gene locus_tag LOCUS_18610 606 4 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064452.1 protein_id gnl|my_center|LOCUS_18610 1232 750 gene locus_tag LOCUS_18620 1232 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 1903 1565 gene locus_tag LOCUS_18630 1903 1565 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060875.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence351 >Feature sequence352 1993 1538 gene locus_tag LOCUS_18640 1993 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence353 <1989 294 gene locus_tag LOCUS_18650 <1989 294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086596.1:HAD-IC family P-type ATPase >Feature sequence354 401 3 gene locus_tag LOCUS_18660 401 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 925 407 gene locus_tag LOCUS_18670 925 407 CDS product UGSC family (seleno)protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877150.1 protein_id gnl|my_center|LOCUS_18670 <1983 1161 gene locus_tag LOCUS_18680 <1983 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061081.1:lysine--tRNA ligase >Feature sequence355 815 1717 gene locus_tag LOCUS_18690 815 1717 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence356 988 413 gene locus_tag LOCUS_18700 988 413 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231388.1 protein_id gnl|my_center|LOCUS_18700 1362 1075 gene locus_tag LOCUS_18710 1362 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 1900 1628 gene locus_tag LOCUS_18720 1900 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence357 >Feature sequence358 932 696 gene locus_tag LOCUS_18730 932 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence359 1046 423 gene locus_tag LOCUS_18740 1046 423 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892753.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence360 1658 579 gene locus_tag LOCUS_18750 gene cofG 1658 579 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876822.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence361 350 1312 gene locus_tag LOCUS_18760 350 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1414 1605 gene locus_tag LOCUS_18770 1414 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892228.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence362 1208 345 gene locus_tag LOCUS_18780 gene porB 1208 345 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_18780 <1860 1209 gene locus_tag LOCUS_18790 <1860 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877345.1:pyruvate synthase subunit PorA >Feature sequence363 436 1599 gene locus_tag LOCUS_18800 436 1599 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949066.1 protein_id gnl|my_center|LOCUS_18800 >Feature sequence364 1057 1452 gene locus_tag LOCUS_18810 1057 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence365 1062 127 gene locus_tag LOCUS_18820 1062 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 1665 1210 gene locus_tag LOCUS_18830 1665 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence366 >Feature sequence367 1196 441 gene locus_tag LOCUS_18840 gene pstB 1196 441 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061132.1 protein_id gnl|my_center|LOCUS_18840 1665 1198 gene locus_tag LOCUS_18850 1665 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence368 399 800 gene locus_tag LOCUS_18860 399 800 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060934.1 protein_id gnl|my_center|LOCUS_18860 <1755 1122 gene locus_tag LOCUS_18870 <1755 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061266.1:phosphoglycerate dehydrogenase >Feature sequence369 >Feature sequence370 423 854 gene locus_tag LOCUS_18880 423 854 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875801.1 protein_id gnl|my_center|LOCUS_18880 1061 1471 gene locus_tag LOCUS_18890 1061 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence371 >Feature sequence372 <1 1118 gene locus_tag LOCUS_18900 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061247.1:cobyric acid synthase CobQ >Feature sequence373 846 37 gene locus_tag LOCUS_18910 gene frhG 846 37 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876913.1 protein_id gnl|my_center|LOCUS_18910 1321 851 gene locus_tag LOCUS_18920 gene frhD 1321 851 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876914.1 protein_id gnl|my_center|LOCUS_18920 1698 1330 gene locus_tag LOCUS_18930 1698 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence374 >Feature sequence375 739 1512 gene locus_tag LOCUS_18940 gene comA 739 1512 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869753.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence376 506 1039 gene locus_tag LOCUS_18950 506 1039 CDS product DUF2115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876447.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence377 859 179 gene locus_tag LOCUS_18960 859 179 CDS product EhaG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060806.1 protein_id gnl|my_center|LOCUS_18960 1338 856 gene locus_tag LOCUS_18970 1338 856 CDS product DUF2106 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261153.1 protein_id gnl|my_center|LOCUS_18970 1595 1335 gene locus_tag LOCUS_18980 1595 1335 CDS product EhaE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060805.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence378 1443 619 gene locus_tag LOCUS_18990 gene cobK 1443 619 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876633.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence379 164 547 gene locus_tag LOCUS_19000 164 547 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877469.1 protein_id gnl|my_center|LOCUS_19000 544 990 gene locus_tag LOCUS_19010 544 990 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877470.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence380 >Feature sequence381 301 5 gene locus_tag LOCUS_19020 301 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 572 321 gene locus_tag LOCUS_19030 gene mtrG 572 321 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876781.1 protein_id gnl|my_center|LOCUS_19030 779 576 gene locus_tag LOCUS_19040 gene mtrF 779 576 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876782.1 protein_id gnl|my_center|LOCUS_19040 1514 792 gene locus_tag LOCUS_19050 gene mtrA 1514 792 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876783.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence382 <1 663 gene locus_tag LOCUS_19060 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061231.1:DNA primase catalytic subunit PriS 1139 759 gene locus_tag LOCUS_19070 1139 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1545 1243 gene locus_tag LOCUS_19080 1545 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 >Feature sequence383 658 1113 gene locus_tag LOCUS_19090 658 1113 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943409.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence384 167 6 gene locus_tag LOCUS_19100 167 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 1519 383 gene locus_tag LOCUS_19110 1519 383 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876037.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence385 3 272 gene locus_tag LOCUS_19120 3 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 289 1038 gene locus_tag LOCUS_19130 289 1038 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461000.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence386 444 1142 gene locus_tag LOCUS_19140 444 1142 CDS product nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870604.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence387 >Feature sequence388 <1509 759 gene locus_tag LOCUS_19150 <1509 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876722.1:UbiA family prenyltransferase >Feature sequence389 <1475 277 gene locus_tag LOCUS_19160 <1475 277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021816.1:CDC48 family AAA ATPase >Feature sequence390 370 1056 gene locus_tag LOCUS_19170 370 1056 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence391 <1 587 gene locus_tag LOCUS_19180 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000086363.1:heavy metal translocating P-type ATPase 1433 1284 gene locus_tag LOCUS_19190 1433 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence392 <1 1355 gene locus_tag LOCUS_19200 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875981.1:flippase >Feature sequence393 <1 910 gene locus_tag LOCUS_19210 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060867.1:peptidase U32 family protein >Feature sequence394 >Feature sequence395 >Feature sequence396 1319 378 gene locus_tag LOCUS_19220 gene mtnA 1319 378 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061163.1 protein_id gnl|my_center|LOCUS_19220 >Feature sequence397 239 96 gene locus_tag LOCUS_19230 239 96 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295326.1 protein_id gnl|my_center|LOCUS_19230 755 249 gene locus_tag LOCUS_19240 755 249 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_19240 <1401 758 gene locus_tag LOCUS_19250 <1401 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875657.1:30S ribosomal protein S4e >Feature sequence398 <1 1099 gene locus_tag LOCUS_19260 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061056.1:phosphoribosylamine--glycine ligase >Feature sequence399 309 7 gene locus_tag LOCUS_19270 309 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence400 >Feature sequence401 >Feature sequence402 <1313 437 gene locus_tag LOCUS_19280 <1313 437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876855.1:DNA polymerase subunit beta >Feature sequence403 >Feature sequence404 <1 1050 gene locus_tag LOCUS_19290 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060774.1:cyclic 2,3-diphosphoglycerate synthase 1214 1095 gene locus_tag LOCUS_19300 1214 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 >Feature sequence405 208 1125 gene locus_tag LOCUS_19310 208 1125 CDS product DUF6282 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_19310 >Feature sequence406 >Feature sequence407 >Feature sequence408 <1226 191 gene locus_tag LOCUS_19320 <1226 191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177221317.1:DNA repair exonuclease >Feature sequence409 >Feature sequence410 >Feature sequence411 >Feature sequence412 >Feature sequence413 >Feature sequence414 <1 527 gene locus_tag LOCUS_19330 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060982.1:coenzyme-B sulfoethylthiotransferase subunit gamma >Feature sequence415 459 800 gene locus_tag LOCUS_19340 459 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence416 975 433 gene locus_tag LOCUS_19350 gene mtrA 975 433 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060961.1 protein_id gnl|my_center|LOCUS_19350