>Feature sequence001 1032 67 gene locus_tag LOCUS_00010 1032 67 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476067.1 protein_id gnl|my_center|LOCUS_00010 2907 1231 gene locus_tag LOCUS_00020 2907 1231 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700012.1 protein_id gnl|my_center|LOCUS_00020 3121 2894 gene locus_tag LOCUS_00030 3121 2894 CDS product DNA-directed RNA polymerase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640827.1 protein_id gnl|my_center|LOCUS_00030 3363 3830 gene locus_tag LOCUS_00040 3363 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475852.1 protein_id gnl|my_center|LOCUS_00040 4512 3958 gene locus_tag LOCUS_00050 gene def 4512 3958 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700015.1 protein_id gnl|my_center|LOCUS_00050 4669 4962 gene locus_tag LOCUS_00060 4669 4962 CDS product UPF0223 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475854.1 protein_id gnl|my_center|LOCUS_00060 4974 5753 gene locus_tag LOCUS_00070 4974 5753 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700019.1 protein_id gnl|my_center|LOCUS_00070 5899 7746 gene locus_tag LOCUS_00080 gene typA 5899 7746 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700020.1 protein_id gnl|my_center|LOCUS_00080 8198 8473 gene locus_tag LOCUS_00090 8198 8473 CDS product YlaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356684.1 protein_id gnl|my_center|LOCUS_00090 8486 9655 gene locus_tag LOCUS_00100 8486 9655 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700026.1 protein_id gnl|my_center|LOCUS_00100 9727 13155 gene locus_tag LOCUS_00110 9727 13155 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700028.1 protein_id gnl|my_center|LOCUS_00110 13159 14304 gene locus_tag LOCUS_00120 13159 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14304 14606 gene locus_tag LOCUS_00130 14304 14606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14611 15168 gene locus_tag LOCUS_00140 gene rsmD 14611 15168 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475855.1 protein_id gnl|my_center|LOCUS_00140 15172 15648 gene locus_tag LOCUS_00150 gene coaD 15172 15648 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565253.1 protein_id gnl|my_center|LOCUS_00150 15645 16682 gene locus_tag LOCUS_00160 15645 16682 CDS product SepM family pheromone-processing serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700035.1 protein_id gnl|my_center|LOCUS_00160 16701 17069 gene locus_tag LOCUS_00170 16701 17069 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700212.1 protein_id gnl|my_center|LOCUS_00170 17355 18065 gene locus_tag LOCUS_00180 17355 18065 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836677.1 protein_id gnl|my_center|LOCUS_00180 18137 18634 gene locus_tag LOCUS_00190 18137 18634 CDS product ComE operon protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706127.1 protein_id gnl|my_center|LOCUS_00190 18829 20898 gene locus_tag LOCUS_00200 18829 20898 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475863.1 protein_id gnl|my_center|LOCUS_00200 20895 21920 gene locus_tag LOCUS_00210 gene holA 20895 21920 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700067.1 protein_id gnl|my_center|LOCUS_00210 22213 21959 gene locus_tag LOCUS_00220 gene rpsT 22213 21959 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699999.1 protein_id gnl|my_center|LOCUS_00220 22493 22762 gene locus_tag LOCUS_00230 gene rpsO 22493 22762 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701713.1 protein_id gnl|my_center|LOCUS_00230 22998 24047 gene locus_tag LOCUS_00240 22998 24047 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101830.1 protein_id gnl|my_center|LOCUS_00240 24063 24935 gene locus_tag LOCUS_00250 gene dapA 24063 24935 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700003.1 protein_id gnl|my_center|LOCUS_00250 24951 26639 gene locus_tag LOCUS_00260 24951 26639 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700005.1 protein_id gnl|my_center|LOCUS_00260 26814 27704 gene locus_tag LOCUS_00270 26814 27704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475850.1 protein_id gnl|my_center|LOCUS_00270 27915 29102 gene locus_tag LOCUS_00280 gene tuf 27915 29102 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700007.1 protein_id gnl|my_center|LOCUS_00280 29287 30597 gene locus_tag LOCUS_00290 gene tig 29287 30597 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700008.1 protein_id gnl|my_center|LOCUS_00290 30817 32064 gene locus_tag LOCUS_00300 gene clpX 30817 32064 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700010.1 protein_id gnl|my_center|LOCUS_00300 32343 33764 gene locus_tag LOCUS_00310 gene gndA 32343 33764 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700011.1 protein_id gnl|my_center|LOCUS_00310 33962 34648 gene locus_tag LOCUS_00320 33962 34648 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290973.1 protein_id gnl|my_center|LOCUS_00320 34645 36192 gene locus_tag LOCUS_00330 34645 36192 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475803.1 protein_id gnl|my_center|LOCUS_00330 36427 37092 gene locus_tag LOCUS_00340 36427 37092 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476465.1 protein_id gnl|my_center|LOCUS_00340 37313 38215 gene locus_tag LOCUS_00350 37313 38215 CDS product DNA/RNA non-specific endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709392.1 protein_id gnl|my_center|LOCUS_00350 38240 38923 gene locus_tag LOCUS_00360 38240 38923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 41550 39253 gene locus_tag LOCUS_00370 41550 39253 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476055.1 protein_id gnl|my_center|LOCUS_00370 42179 41562 gene locus_tag LOCUS_00380 gene recU 42179 41562 CDS product Holliday junction resolvase RecU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700298.1 protein_id gnl|my_center|LOCUS_00380 42324 42887 gene locus_tag LOCUS_00390 42324 42887 CDS product DUF1273 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640485.1 protein_id gnl|my_center|LOCUS_00390 42955 43296 gene locus_tag LOCUS_00400 gene gpsB 42955 43296 CDS product cell division regulator GpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475986.1 protein_id gnl|my_center|LOCUS_00400 43771 44910 gene locus_tag LOCUS_00410 43771 44910 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644375.1 protein_id gnl|my_center|LOCUS_00410 45517 45113 gene locus_tag LOCUS_00420 45517 45113 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707834.1 protein_id gnl|my_center|LOCUS_00420 45536 45913 gene locus_tag LOCUS_00430 45536 45913 CDS product EbsA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475988.1 protein_id gnl|my_center|LOCUS_00430 46040 47698 gene locus_tag LOCUS_00440 46040 47698 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475989.1 protein_id gnl|my_center|LOCUS_00440 48226 48522 gene locus_tag LOCUS_00450 48226 48522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 49750 49055 gene locus_tag LOCUS_00460 49750 49055 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674036.1 protein_id gnl|my_center|LOCUS_00460 50576 49788 gene locus_tag LOCUS_00470 gene metF 50576 49788 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089991.1 protein_id gnl|my_center|LOCUS_00470 50683 51384 gene locus_tag LOCUS_00480 50683 51384 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475861.1 protein_id gnl|my_center|LOCUS_00480 51537 51800 gene locus_tag LOCUS_00490 51537 51800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 52151 53365 gene locus_tag LOCUS_00500 52151 53365 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044005378.1 protein_id gnl|my_center|LOCUS_00500 53701 53372 gene locus_tag LOCUS_00510 53701 53372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644663.1 protein_id gnl|my_center|LOCUS_00510 53795 54454 gene locus_tag LOCUS_00520 53795 54454 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645837.1 protein_id gnl|my_center|LOCUS_00520 54454 55458 gene locus_tag LOCUS_00530 54454 55458 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475830.1 protein_id gnl|my_center|LOCUS_00530 55493 56461 gene locus_tag LOCUS_00540 gene manA 55493 56461 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476470.1 protein_id gnl|my_center|LOCUS_00540 57523 56819 gene locus_tag LOCUS_00550 57523 56819 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699925.1 protein_id gnl|my_center|LOCUS_00550 58872 57523 gene locus_tag LOCUS_00560 58872 57523 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475833.1 protein_id gnl|my_center|LOCUS_00560 59242 59814 gene locus_tag LOCUS_00570 59242 59814 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644660.1 protein_id gnl|my_center|LOCUS_00570 59861 60943 gene locus_tag LOCUS_00580 gene prfA 59861 60943 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475834.1 protein_id gnl|my_center|LOCUS_00580 60936 61775 gene locus_tag LOCUS_00590 gene prmC 60936 61775 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475835.1 protein_id gnl|my_center|LOCUS_00590 61787 62800 gene locus_tag LOCUS_00600 61787 62800 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699933.1 protein_id gnl|my_center|LOCUS_00600 62875 63504 gene locus_tag LOCUS_00610 gene upp 62875 63504 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699935.1 protein_id gnl|my_center|LOCUS_00610 63991 64704 gene locus_tag LOCUS_00620 gene atpB 63991 64704 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699936.1 protein_id gnl|my_center|LOCUS_00620 64722 64946 gene locus_tag LOCUS_00630 gene atpE 64722 64946 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699937.1 protein_id gnl|my_center|LOCUS_00630 64993 65520 gene locus_tag LOCUS_00640 gene atpF 64993 65520 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699938.1 protein_id gnl|my_center|LOCUS_00640 65507 66049 gene locus_tag LOCUS_00650 gene atpH 65507 66049 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475836.1 protein_id gnl|my_center|LOCUS_00650 66073 67587 gene locus_tag LOCUS_00660 gene atpA 66073 67587 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475837.1 protein_id gnl|my_center|LOCUS_00660 67606 68559 gene locus_tag LOCUS_00670 67606 68559 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699944.1 protein_id gnl|my_center|LOCUS_00670 68584 69987 gene locus_tag LOCUS_00680 gene atpD 68584 69987 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699945.1 protein_id gnl|my_center|LOCUS_00680 70002 70427 gene locus_tag LOCUS_00690 70002 70427 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699947.1 protein_id gnl|my_center|LOCUS_00690 70612 70848 gene locus_tag LOCUS_00700 70612 70848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 70883 72190 gene locus_tag LOCUS_00710 gene murA 70883 72190 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699949.1 protein_id gnl|my_center|LOCUS_00710 72350 73336 gene locus_tag LOCUS_00720 72350 73336 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701754.1 protein_id gnl|my_center|LOCUS_00720 73674 73898 gene locus_tag LOCUS_00730 73674 73898 CDS product DUF2969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699952.1 protein_id gnl|my_center|LOCUS_00730 74006 75205 gene locus_tag LOCUS_00740 74006 75205 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699953.1 protein_id gnl|my_center|LOCUS_00740 75415 75768 gene locus_tag LOCUS_00750 75415 75768 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254429.1 protein_id gnl|my_center|LOCUS_00750 75899 76678 gene locus_tag LOCUS_00760 gene sufC 75899 76678 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702968.1 protein_id gnl|my_center|LOCUS_00760 76693 77985 gene locus_tag LOCUS_00770 gene sufD 76693 77985 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702957.1 protein_id gnl|my_center|LOCUS_00770 77966 79204 gene locus_tag LOCUS_00780 77966 79204 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287683.1 protein_id gnl|my_center|LOCUS_00780 79191 79667 gene locus_tag LOCUS_00790 79191 79667 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356768.1 protein_id gnl|my_center|LOCUS_00790 79682 81085 gene locus_tag LOCUS_00800 gene sufB 79682 81085 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702990.1 protein_id gnl|my_center|LOCUS_00800 81078 81356 gene locus_tag LOCUS_00810 81078 81356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 81689 81348 gene locus_tag LOCUS_00820 81689 81348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 82033 82302 gene locus_tag LOCUS_00830 gene rpsN 82033 82302 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640872.1 protein_id gnl|my_center|LOCUS_00830 82322 82480 gene locus_tag LOCUS_00840 82322 82480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 82491 82883 gene locus_tag LOCUS_00850 82491 82883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358585.1 protein_id gnl|my_center|LOCUS_00850 83402 83133 gene locus_tag LOCUS_00860 83402 83133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 83943 84362 gene locus_tag LOCUS_00870 83943 84362 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548115.1 protein_id gnl|my_center|LOCUS_00870 84380 86002 gene locus_tag LOCUS_00880 84380 86002 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254631.1 protein_id gnl|my_center|LOCUS_00880 86111 86455 gene locus_tag LOCUS_00890 86111 86455 CDS product YisL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573035.1 protein_id gnl|my_center|LOCUS_00890 87100 88077 gene locus_tag LOCUS_00900 87100 88077 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263247.1 protein_id gnl|my_center|LOCUS_00900 88448 88233 gene locus_tag LOCUS_00910 88448 88233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 88619 88828 gene locus_tag LOCUS_00920 88619 88828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 89524 90822 gene locus_tag LOCUS_00930 89524 90822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 90840 91979 gene locus_tag LOCUS_00940 90840 91979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 93363 92548 gene locus_tag LOCUS_00950 93363 92548 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102282.1 protein_id gnl|my_center|LOCUS_00950 94175 93957 gene locus_tag LOCUS_00960 94175 93957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00960 94348 95187 gene locus_tag LOCUS_00970 94348 95187 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475838.1 protein_id gnl|my_center|LOCUS_00970 95863 95720 gene locus_tag LOCUS_00980 95863 95720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 96079 96154 gene locus_tag LOCUS_t00010 96079 96154 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 96361 96669 gene locus_tag LOCUS_00990 gene rplU 96361 96669 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289450.1 protein_id gnl|my_center|LOCUS_00990 96688 97020 gene locus_tag LOCUS_01000 96688 97020 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476071.1 protein_id gnl|my_center|LOCUS_01000 97036 97317 gene locus_tag LOCUS_01010 gene rpmA 97036 97317 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700332.1 protein_id gnl|my_center|LOCUS_01010 97411 98472 gene locus_tag LOCUS_01020 97411 98472 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476154.1 protein_id gnl|my_center|LOCUS_01020 98609 99166 gene locus_tag LOCUS_01030 gene efp 98609 99166 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699839.1 protein_id gnl|my_center|LOCUS_01030 99186 99617 gene locus_tag LOCUS_01040 99186 99617 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699841.1 protein_id gnl|my_center|LOCUS_01040 99635 100024 gene locus_tag LOCUS_01050 gene nusB 99635 100024 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101470.1 protein_id gnl|my_center|LOCUS_01050 100412 101251 gene locus_tag LOCUS_01060 gene folD 100412 101251 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475808.1 protein_id gnl|my_center|LOCUS_01060 101267 102619 gene locus_tag LOCUS_01070 gene xseA 101267 102619 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645161.1 protein_id gnl|my_center|LOCUS_01070 102612 102842 gene locus_tag LOCUS_01080 102612 102842 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640351.1 protein_id gnl|my_center|LOCUS_01080 102835 103719 gene locus_tag LOCUS_01090 102835 103719 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708049.1 protein_id gnl|my_center|LOCUS_01090 103719 104534 gene locus_tag LOCUS_01100 103719 104534 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704070.1 protein_id gnl|my_center|LOCUS_01100 104620 105081 gene locus_tag LOCUS_01110 104620 105081 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640354.1 protein_id gnl|my_center|LOCUS_01110 105097 106779 gene locus_tag LOCUS_01120 gene recN 105097 106779 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_01120 107558 106932 gene locus_tag LOCUS_01130 gene lexA 107558 106932 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640747.1 protein_id gnl|my_center|LOCUS_01130 107708 107956 gene locus_tag LOCUS_01140 107708 107956 CDS product DUF896 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704077.1 protein_id gnl|my_center|LOCUS_01140 108033 108257 gene locus_tag LOCUS_01150 108033 108257 CDS product YneF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699860.1 protein_id gnl|my_center|LOCUS_01150 109011 108388 gene locus_tag LOCUS_01160 109011 108388 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475794.1 protein_id gnl|my_center|LOCUS_01160 109104 109853 gene locus_tag LOCUS_01170 109104 109853 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699813.1 protein_id gnl|my_center|LOCUS_01170 109837 110130 gene locus_tag LOCUS_01180 109837 110130 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640742.1 protein_id gnl|my_center|LOCUS_01180 110308 111297 gene locus_tag LOCUS_01190 110308 111297 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640741.1 protein_id gnl|my_center|LOCUS_01190 111465 112259 gene locus_tag LOCUS_01200 gene rpsB 111465 112259 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475795.1 protein_id gnl|my_center|LOCUS_01200 112353 113231 gene locus_tag LOCUS_01210 gene tsf 112353 113231 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699817.1 protein_id gnl|my_center|LOCUS_01210 113429 114151 gene locus_tag LOCUS_01220 gene pyrH 113429 114151 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640737.1 protein_id gnl|my_center|LOCUS_01220 114155 114718 gene locus_tag LOCUS_01230 gene frr 114155 114718 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705950.1 protein_id gnl|my_center|LOCUS_01230 114872 115648 gene locus_tag LOCUS_01240 114872 115648 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475819.1 protein_id gnl|my_center|LOCUS_01240 115655 116440 gene locus_tag LOCUS_01250 115655 116440 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709894.1 protein_id gnl|my_center|LOCUS_01250 116470 117753 gene locus_tag LOCUS_01260 gene rseP 116470 117753 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475820.1 protein_id gnl|my_center|LOCUS_01260 117810 119525 gene locus_tag LOCUS_01270 117810 119525 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475821.1 protein_id gnl|my_center|LOCUS_01270 119708 124045 gene locus_tag LOCUS_01280 119708 124045 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475822.1 protein_id gnl|my_center|LOCUS_01280 124192 124665 gene locus_tag LOCUS_01290 gene rimP 124192 124665 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699900.1 protein_id gnl|my_center|LOCUS_01290 124688 125773 gene locus_tag LOCUS_01300 gene nusA 124688 125773 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699901.1 protein_id gnl|my_center|LOCUS_01300 125805 126107 gene locus_tag LOCUS_01310 125805 126107 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640726.1 protein_id gnl|my_center|LOCUS_01310 126097 126402 gene locus_tag LOCUS_01320 126097 126402 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699904.1 protein_id gnl|my_center|LOCUS_01320 126479 128848 gene locus_tag LOCUS_01330 gene infB 126479 128848 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475823.1 protein_id gnl|my_center|LOCUS_01330 128879 129235 gene locus_tag LOCUS_01340 gene rbfA 128879 129235 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101640.1 protein_id gnl|my_center|LOCUS_01340 129472 130380 gene locus_tag LOCUS_01350 gene truB 129472 130380 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475825.1 protein_id gnl|my_center|LOCUS_01350 130394 131344 gene locus_tag LOCUS_01360 gene ribF 130394 131344 CDS product riboflavin biosynthesis protein RibF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101639.1 protein_id gnl|my_center|LOCUS_01360 131444 132478 gene locus_tag LOCUS_01370 gene hrcA 131444 132478 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703155.1 protein_id gnl|my_center|LOCUS_01370 132494 133144 gene locus_tag LOCUS_01380 gene grpE 132494 133144 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824484.1 protein_id gnl|my_center|LOCUS_01380 133176 135023 gene locus_tag LOCUS_01390 gene dnaK 133176 135023 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475828.1 protein_id gnl|my_center|LOCUS_01390 135134 136276 gene locus_tag LOCUS_01400 gene dnaJ 135134 136276 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703154.1 protein_id gnl|my_center|LOCUS_01400 136424 138247 gene locus_tag LOCUS_01410 gene lepA 136424 138247 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699919.1 protein_id gnl|my_center|LOCUS_01410 139710 138751 gene locus_tag LOCUS_01420 139710 138751 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475972.1 protein_id gnl|my_center|LOCUS_01420 139902 140507 gene locus_tag LOCUS_01430 139902 140507 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966053.1 protein_id gnl|my_center|LOCUS_01430 140755 141252 gene locus_tag LOCUS_01440 140755 141252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 141294 142190 gene locus_tag LOCUS_01450 gene prmA 141294 142190 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101614.1 protein_id gnl|my_center|LOCUS_01450 142194 142952 gene locus_tag LOCUS_01460 142194 142952 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475974.1 protein_id gnl|my_center|LOCUS_01460 142987 143313 gene locus_tag LOCUS_01470 142987 143313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 143461 145686 gene locus_tag LOCUS_01480 143461 145686 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710060.1 protein_id gnl|my_center|LOCUS_01480 145702 146151 gene locus_tag LOCUS_01490 gene dtd 145702 146151 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640695.1 protein_id gnl|my_center|LOCUS_01490 146164 147108 gene locus_tag LOCUS_01500 146164 147108 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303627.1 protein_id gnl|my_center|LOCUS_01500 147126 147740 gene locus_tag LOCUS_01510 147126 147740 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475976.1 protein_id gnl|my_center|LOCUS_01510 147884 148741 gene locus_tag LOCUS_01520 147884 148741 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476026.1 protein_id gnl|my_center|LOCUS_01520 149046 150347 gene locus_tag LOCUS_01530 gene hisS 149046 150347 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475997.1 protein_id gnl|my_center|LOCUS_01530 150357 152117 gene locus_tag LOCUS_01540 gene aspS 150357 152117 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475998.1 protein_id gnl|my_center|LOCUS_01540 152286 152804 gene locus_tag LOCUS_01550 gene msrA 152286 152804 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706147.1 protein_id gnl|my_center|LOCUS_01550 152838 153713 gene locus_tag LOCUS_01560 152838 153713 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710005.1 protein_id gnl|my_center|LOCUS_01560 153733 154635 gene locus_tag LOCUS_01570 153733 154635 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357396.1 protein_id gnl|my_center|LOCUS_01570 155705 154896 gene locus_tag LOCUS_01580 155705 154896 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703800.1 protein_id gnl|my_center|LOCUS_01580 155925 156110 gene locus_tag LOCUS_01590 155925 156110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 156133 156576 gene locus_tag LOCUS_01600 156133 156576 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475872.1 protein_id gnl|my_center|LOCUS_01600 156909 157886 gene locus_tag LOCUS_01610 156909 157886 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476025.1 protein_id gnl|my_center|LOCUS_01610 157891 158370 gene locus_tag LOCUS_01620 gene ybeY 157891 158370 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710168.1 protein_id gnl|my_center|LOCUS_01620 158348 158755 gene locus_tag LOCUS_01630 158348 158755 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130653.1 protein_id gnl|my_center|LOCUS_01630 158768 159670 gene locus_tag LOCUS_01640 gene era 158768 159670 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476024.1 protein_id gnl|my_center|LOCUS_01640 159703 160503 gene locus_tag LOCUS_01650 gene recO 159703 160503 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476023.1 protein_id gnl|my_center|LOCUS_01650 160803 161720 gene locus_tag LOCUS_01660 gene glyQ 160803 161720 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700278.1 protein_id gnl|my_center|LOCUS_01660 161722 163797 gene locus_tag LOCUS_01670 gene glyS 161722 163797 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476035.1 protein_id gnl|my_center|LOCUS_01670 164101 165948 gene locus_tag LOCUS_01680 gene dnaG 164101 165948 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476034.1 protein_id gnl|my_center|LOCUS_01680 165960 167084 gene locus_tag LOCUS_01690 gene rpoD 165960 167084 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476033.1 protein_id gnl|my_center|LOCUS_01690 167356 168273 gene locus_tag LOCUS_01700 167356 168273 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056996568.1 protein_id gnl|my_center|LOCUS_01700 168289 169434 gene locus_tag LOCUS_01710 168289 169434 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100941.1 protein_id gnl|my_center|LOCUS_01710 169512 170282 gene locus_tag LOCUS_01720 169512 170282 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837515.1 protein_id gnl|my_center|LOCUS_01720 170441 170292 gene locus_tag LOCUS_01730 170441 170292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 170507 171205 gene locus_tag LOCUS_01740 170507 171205 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475993.1 protein_id gnl|my_center|LOCUS_01740 171198 172313 gene locus_tag LOCUS_01750 171198 172313 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379409.1 protein_id gnl|my_center|LOCUS_01750 172329 173576 gene locus_tag LOCUS_01760 gene pepT 172329 173576 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475995.1 protein_id gnl|my_center|LOCUS_01760 173714 176311 gene locus_tag LOCUS_01770 gene clpB 173714 176311 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476005.1 protein_id gnl|my_center|LOCUS_01770 >Feature sequence002 56 703 gene locus_tag LOCUS_01780 56 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 755 1969 gene locus_tag LOCUS_01790 755 1969 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_01790 2013 2903 gene locus_tag LOCUS_01800 2013 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2916 4019 gene locus_tag LOCUS_01810 2916 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4798 5160 gene locus_tag LOCUS_01820 4798 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 5150 6085 gene locus_tag LOCUS_01830 5150 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 6104 6766 gene locus_tag LOCUS_01840 6104 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6763 7692 gene locus_tag LOCUS_01850 6763 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7699 9129 gene locus_tag LOCUS_01860 7699 9129 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101282.1 protein_id gnl|my_center|LOCUS_01860 9175 10128 gene locus_tag LOCUS_01870 9175 10128 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476418.1 protein_id gnl|my_center|LOCUS_01870 10144 10917 gene locus_tag LOCUS_01880 10144 10917 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476421.1 protein_id gnl|my_center|LOCUS_01880 10935 11702 gene locus_tag LOCUS_01890 10935 11702 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476420.1 protein_id gnl|my_center|LOCUS_01890 11644 12456 gene locus_tag LOCUS_01900 11644 12456 CDS product tyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476419.1 protein_id gnl|my_center|LOCUS_01900 12809 14089 gene locus_tag LOCUS_01910 12809 14089 CDS product Firmicu-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101668.1 protein_id gnl|my_center|LOCUS_01910 14086 14706 gene locus_tag LOCUS_01920 gene xrtG 14086 14706 CDS product exosortase family protein XrtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101667.1 protein_id gnl|my_center|LOCUS_01920 14699 16048 gene locus_tag LOCUS_01930 14699 16048 CDS product putative glycosyltransferase, exosortase G system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101666.1 protein_id gnl|my_center|LOCUS_01930 16041 16430 gene locus_tag LOCUS_01940 16041 16430 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646169.1 protein_id gnl|my_center|LOCUS_01940 17101 16550 gene locus_tag LOCUS_01950 17101 16550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 17211 17426 gene locus_tag LOCUS_01960 17211 17426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 18330 19442 gene locus_tag LOCUS_01970 18330 19442 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476121.1 protein_id gnl|my_center|LOCUS_01970 19575 21881 gene locus_tag LOCUS_01980 19575 21881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 22672 23265 gene locus_tag LOCUS_01990 22672 23265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 23365 24138 gene locus_tag LOCUS_02000 23365 24138 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549071.1 protein_id gnl|my_center|LOCUS_02000 24457 24236 gene locus_tag LOCUS_02010 24457 24236 CDS product DUF2922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643208.1 protein_id gnl|my_center|LOCUS_02010 24695 24495 gene locus_tag LOCUS_02020 24695 24495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 25089 26498 gene locus_tag LOCUS_02030 25089 26498 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051261.1 protein_id gnl|my_center|LOCUS_02030 26819 28180 gene locus_tag LOCUS_02040 26819 28180 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102128.1 protein_id gnl|my_center|LOCUS_02040 28181 29419 gene locus_tag LOCUS_02050 gene codA 28181 29419 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117530778.1 protein_id gnl|my_center|LOCUS_02050 29529 30563 gene locus_tag LOCUS_02060 29529 30563 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003715873.1 protein_id gnl|my_center|LOCUS_02060 30606 31541 gene locus_tag LOCUS_02070 30606 31541 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289148.1 protein_id gnl|my_center|LOCUS_02070 31902 32459 gene locus_tag LOCUS_02080 31902 32459 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641748.1 protein_id gnl|my_center|LOCUS_02080 32461 34164 gene locus_tag LOCUS_02090 32461 34164 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100903.1 protein_id gnl|my_center|LOCUS_02090 34164 35000 gene locus_tag LOCUS_02100 34164 35000 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641746.1 protein_id gnl|my_center|LOCUS_02100 35696 35130 gene locus_tag LOCUS_02110 35696 35130 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394583.1 protein_id gnl|my_center|LOCUS_02110 35811 36200 gene locus_tag LOCUS_02120 35811 36200 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476362.1 protein_id gnl|my_center|LOCUS_02120 36197 36553 gene locus_tag LOCUS_02130 gene crcB 36197 36553 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547161.1 protein_id gnl|my_center|LOCUS_02130 36832 37602 gene locus_tag LOCUS_02140 36832 37602 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702269.1 protein_id gnl|my_center|LOCUS_02140 37857 39020 gene locus_tag LOCUS_02150 37857 39020 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475806.1 protein_id gnl|my_center|LOCUS_02150 39146 40036 gene locus_tag LOCUS_02160 39146 40036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699835.1 protein_id gnl|my_center|LOCUS_02160 40029 41030 gene locus_tag LOCUS_02170 40029 41030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704088.1 protein_id gnl|my_center|LOCUS_02170 41054 41548 gene locus_tag LOCUS_02180 41054 41548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475807.1 protein_id gnl|my_center|LOCUS_02180 42671 41742 gene locus_tag LOCUS_02190 gene ppx 42671 41742 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641094.1 protein_id gnl|my_center|LOCUS_02190 44835 42676 gene locus_tag LOCUS_02200 44835 42676 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641095.1 protein_id gnl|my_center|LOCUS_02200 46340 44832 gene locus_tag LOCUS_02210 46340 44832 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641096.1 protein_id gnl|my_center|LOCUS_02210 46707 47834 gene locus_tag LOCUS_02220 46707 47834 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476153.1 protein_id gnl|my_center|LOCUS_02220 48074 48634 gene locus_tag LOCUS_02230 48074 48634 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166578.1 protein_id gnl|my_center|LOCUS_02230 48712 48912 gene locus_tag LOCUS_02240 48712 48912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 49451 48984 gene locus_tag LOCUS_02250 49451 48984 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703973.1 protein_id gnl|my_center|LOCUS_02250 49728 49868 gene locus_tag LOCUS_02260 49728 49868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 51472 50189 gene locus_tag LOCUS_02270 51472 50189 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476151.1 protein_id gnl|my_center|LOCUS_02270 52200 51592 gene locus_tag LOCUS_02280 gene rpsD 52200 51592 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703954.1 protein_id gnl|my_center|LOCUS_02280 52859 52407 gene locus_tag LOCUS_02290 52859 52407 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703982.1 protein_id gnl|my_center|LOCUS_02290 53046 54761 gene locus_tag LOCUS_02300 gene ezrA 53046 54761 CDS product septation ring formation regulator EzrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476149.1 protein_id gnl|my_center|LOCUS_02300 55076 56224 gene locus_tag LOCUS_02310 55076 56224 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700480.1 protein_id gnl|my_center|LOCUS_02310 56244 57461 gene locus_tag LOCUS_02320 gene thiI 56244 57461 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700478.1 protein_id gnl|my_center|LOCUS_02320 57771 60428 gene locus_tag LOCUS_02330 57771 60428 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476148.1 protein_id gnl|my_center|LOCUS_02330 60705 61625 gene locus_tag LOCUS_02340 60705 61625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 61841 63151 gene locus_tag LOCUS_02350 61841 63151 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700475.1 protein_id gnl|my_center|LOCUS_02350 63167 63820 gene locus_tag LOCUS_02360 63167 63820 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476443.1 protein_id gnl|my_center|LOCUS_02360 63868 64539 gene locus_tag LOCUS_02370 gene radC 63868 64539 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700474.1 protein_id gnl|my_center|LOCUS_02370 64576 64827 gene locus_tag LOCUS_02380 64576 64827 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700473.1 protein_id gnl|my_center|LOCUS_02380 65008 66012 gene locus_tag LOCUS_02390 65008 66012 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700472.1 protein_id gnl|my_center|LOCUS_02390 66107 66955 gene locus_tag LOCUS_02400 gene mreC 66107 66955 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700471.1 protein_id gnl|my_center|LOCUS_02400 66967 67482 gene locus_tag LOCUS_02410 gene mreD 66967 67482 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700469.1 protein_id gnl|my_center|LOCUS_02410 67499 68176 gene locus_tag LOCUS_02420 67499 68176 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476147.1 protein_id gnl|my_center|LOCUS_02420 68179 68985 gene locus_tag LOCUS_02430 gene minD 68179 68985 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700467.1 protein_id gnl|my_center|LOCUS_02430 69147 70598 gene locus_tag LOCUS_02440 gene cls 69147 70598 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015381020.1 protein_id gnl|my_center|LOCUS_02440 70705 71640 gene locus_tag LOCUS_02450 70705 71640 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476145.1 protein_id gnl|my_center|LOCUS_02450 72648 71746 gene locus_tag LOCUS_02460 72648 71746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 72786 73148 gene locus_tag LOCUS_02470 72786 73148 CDS product iron-sulfur cluster biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701399.1 protein_id gnl|my_center|LOCUS_02470 74666 73233 gene locus_tag LOCUS_02480 74666 73233 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476108.1 protein_id gnl|my_center|LOCUS_02480 74785 75675 gene locus_tag LOCUS_02490 74785 75675 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289114.1 protein_id gnl|my_center|LOCUS_02490 75791 75976 gene locus_tag LOCUS_02500 75791 75976 CDS product 4-oxalocrotonate tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638693.1 protein_id gnl|my_center|LOCUS_02500 76059 77363 gene locus_tag LOCUS_02510 gene lysA 76059 77363 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476107.1 protein_id gnl|my_center|LOCUS_02510 77714 78619 gene locus_tag LOCUS_02520 77714 78619 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129898.1 protein_id gnl|my_center|LOCUS_02520 79621 78809 gene locus_tag LOCUS_02530 79621 78809 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476106.1 protein_id gnl|my_center|LOCUS_02530 79744 80499 gene locus_tag LOCUS_02540 79744 80499 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476105.1 protein_id gnl|my_center|LOCUS_02540 80521 80841 gene locus_tag LOCUS_02550 80521 80841 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703477.1 protein_id gnl|my_center|LOCUS_02550 80863 81843 gene locus_tag LOCUS_02560 80863 81843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476104.1 protein_id gnl|my_center|LOCUS_02560 81848 83239 gene locus_tag LOCUS_02570 81848 83239 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704152.1 protein_id gnl|my_center|LOCUS_02570 84571 83489 gene locus_tag LOCUS_02580 gene bdhA 84571 83489 CDS product (R,R)-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645822.1 protein_id gnl|my_center|LOCUS_02580 86667 85639 gene locus_tag LOCUS_02590 gene fni 86667 85639 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700069.1 protein_id gnl|my_center|LOCUS_02590 87760 86687 gene locus_tag LOCUS_02600 87760 86687 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700070.1 protein_id gnl|my_center|LOCUS_02600 88754 87786 gene locus_tag LOCUS_02610 gene mvaD 88754 87786 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703781.1 protein_id gnl|my_center|LOCUS_02610 89722 88754 gene locus_tag LOCUS_02620 gene mvk 89722 88754 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475864.1 protein_id gnl|my_center|LOCUS_02620 89960 92761 gene locus_tag LOCUS_02630 89960 92761 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475865.1 protein_id gnl|my_center|LOCUS_02630 92853 93347 gene locus_tag LOCUS_02640 92853 93347 CDS product DUF5590 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475866.1 protein_id gnl|my_center|LOCUS_02640 93367 94548 gene locus_tag LOCUS_02650 93367 94548 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475867.1 protein_id gnl|my_center|LOCUS_02650 94562 95863 gene locus_tag LOCUS_02660 gene asnS 94562 95863 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700078.1 protein_id gnl|my_center|LOCUS_02660 95947 96675 gene locus_tag LOCUS_02670 95947 96675 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706143.1 protein_id gnl|my_center|LOCUS_02670 96680 97327 gene locus_tag LOCUS_02680 gene nth 96680 97327 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706145.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence003 242 63 gene locus_tag LOCUS_02690 242 63 CDS product YjzD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700204.1 protein_id gnl|my_center|LOCUS_02690 373 3720 gene locus_tag LOCUS_02700 gene dnaE 373 3720 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101583.1 protein_id gnl|my_center|LOCUS_02700 3839 4801 gene locus_tag LOCUS_02710 gene pfkA 3839 4801 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700206.1 protein_id gnl|my_center|LOCUS_02710 4874 6634 gene locus_tag LOCUS_02720 gene pyk 4874 6634 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700208.1 protein_id gnl|my_center|LOCUS_02720 6929 7387 gene locus_tag LOCUS_02730 6929 7387 CDS product DUF441 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476058.1 protein_id gnl|my_center|LOCUS_02730 7400 8266 gene locus_tag LOCUS_02740 7400 8266 CDS product S1 RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476057.1 protein_id gnl|my_center|LOCUS_02740 8299 8754 gene locus_tag LOCUS_02750 8299 8754 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294385.1 protein_id gnl|my_center|LOCUS_02750 8875 9675 gene locus_tag LOCUS_02760 gene xerD 8875 9675 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_02760 9760 10122 gene locus_tag LOCUS_02770 9760 10122 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700315.1 protein_id gnl|my_center|LOCUS_02770 10112 10882 gene locus_tag LOCUS_02780 10112 10882 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476059.1 protein_id gnl|my_center|LOCUS_02780 10854 11447 gene locus_tag LOCUS_02790 gene scpB 10854 11447 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700312.1 protein_id gnl|my_center|LOCUS_02790 11466 12185 gene locus_tag LOCUS_02800 11466 12185 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701782.1 protein_id gnl|my_center|LOCUS_02800 12474 13052 gene locus_tag LOCUS_02810 12474 13052 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701777.1 protein_id gnl|my_center|LOCUS_02810 13280 14305 gene locus_tag LOCUS_02820 13280 14305 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476028.1 protein_id gnl|my_center|LOCUS_02820 14298 15731 gene locus_tag LOCUS_02830 14298 15731 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476027.1 protein_id gnl|my_center|LOCUS_02830 15822 16445 gene locus_tag LOCUS_02840 15822 16445 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101580.1 protein_id gnl|my_center|LOCUS_02840 16516 17187 gene locus_tag LOCUS_02850 gene cmk 16516 17187 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700259.1 protein_id gnl|my_center|LOCUS_02850 17279 18487 gene locus_tag LOCUS_02860 gene rpsA 17279 18487 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160994650.1 protein_id gnl|my_center|LOCUS_02860 18629 19939 gene locus_tag LOCUS_02870 gene der 18629 19939 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700239.1 protein_id gnl|my_center|LOCUS_02870 20178 20453 gene locus_tag LOCUS_02880 20178 20453 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357604.1 protein_id gnl|my_center|LOCUS_02880 20651 21916 gene locus_tag LOCUS_02890 20651 21916 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700190.1 protein_id gnl|my_center|LOCUS_02890 23503 22616 gene locus_tag LOCUS_02900 23503 22616 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475875.1 protein_id gnl|my_center|LOCUS_02900 23674 24462 gene locus_tag LOCUS_02910 gene dapB 23674 24462 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475876.1 protein_id gnl|my_center|LOCUS_02910 24459 25667 gene locus_tag LOCUS_02920 24459 25667 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475877.1 protein_id gnl|my_center|LOCUS_02920 25686 27584 gene locus_tag LOCUS_02930 25686 27584 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475878.1 protein_id gnl|my_center|LOCUS_02930 27607 28563 gene locus_tag LOCUS_02940 27607 28563 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700096.1 protein_id gnl|my_center|LOCUS_02940 28586 29089 gene locus_tag LOCUS_02950 28586 29089 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475879.1 protein_id gnl|my_center|LOCUS_02950 29418 30365 gene locus_tag LOCUS_02960 29418 30365 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475883.1 protein_id gnl|my_center|LOCUS_02960 30365 30991 gene locus_tag LOCUS_02970 30365 30991 CDS product YpmS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700105.1 protein_id gnl|my_center|LOCUS_02970 31003 31227 gene locus_tag LOCUS_02980 31003 31227 CDS product YozE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703777.1 protein_id gnl|my_center|LOCUS_02980 31254 32708 gene locus_tag LOCUS_02990 31254 32708 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101574.1 protein_id gnl|my_center|LOCUS_02990 33044 33589 gene locus_tag LOCUS_03000 gene lepB 33044 33589 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294418.1 protein_id gnl|my_center|LOCUS_03000 33617 34477 gene locus_tag LOCUS_03010 gene ylqF 33617 34477 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700107.1 protein_id gnl|my_center|LOCUS_03010 34467 35234 gene locus_tag LOCUS_03020 34467 35234 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707884.1 protein_id gnl|my_center|LOCUS_03020 35278 36147 gene locus_tag LOCUS_03030 gene dprA 35278 36147 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475884.1 protein_id gnl|my_center|LOCUS_03030 36226 38328 gene locus_tag LOCUS_03040 gene topA 36226 38328 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475885.1 protein_id gnl|my_center|LOCUS_03040 38419 39318 gene locus_tag LOCUS_03050 gene xerC 38419 39318 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707683.1 protein_id gnl|my_center|LOCUS_03050 39341 39886 gene locus_tag LOCUS_03060 gene hslV 39341 39886 CDS product HslU--HslV peptidase proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638820.1 protein_id gnl|my_center|LOCUS_03060 39907 41322 gene locus_tag LOCUS_03070 gene hslU 39907 41322 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476064.1 protein_id gnl|my_center|LOCUS_03070 41349 42224 gene locus_tag LOCUS_03080 41349 42224 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101568.1 protein_id gnl|my_center|LOCUS_03080 42970 42356 gene locus_tag LOCUS_03090 gene plsY 42970 42356 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476008.1 protein_id gnl|my_center|LOCUS_03090 43178 45163 gene locus_tag LOCUS_03100 gene parE 43178 45163 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476009.1 protein_id gnl|my_center|LOCUS_03100 45163 47619 gene locus_tag LOCUS_03110 gene parC 45163 47619 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476010.1 protein_id gnl|my_center|LOCUS_03110 47866 49011 gene locus_tag LOCUS_03120 47866 49011 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596134.1 protein_id gnl|my_center|LOCUS_03120 49011 50531 gene locus_tag LOCUS_03130 49011 50531 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674903.1 protein_id gnl|my_center|LOCUS_03130 50533 51504 gene locus_tag LOCUS_03140 50533 51504 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567455.1 protein_id gnl|my_center|LOCUS_03140 51523 52353 gene locus_tag LOCUS_03150 51523 52353 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674904.1 protein_id gnl|my_center|LOCUS_03150 52325 53044 gene locus_tag LOCUS_03160 gene ssuB 52325 53044 CDS product aliphatic sulfonates ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210036.1 protein_id gnl|my_center|LOCUS_03160 53940 53209 gene locus_tag LOCUS_03170 53940 53209 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640685.1 protein_id gnl|my_center|LOCUS_03170 55309 53924 gene locus_tag LOCUS_03180 55309 53924 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673958.1 protein_id gnl|my_center|LOCUS_03180 55631 57106 gene locus_tag LOCUS_03190 55631 57106 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644796.1 protein_id gnl|my_center|LOCUS_03190 57130 57693 gene locus_tag LOCUS_03200 57130 57693 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643707.1 protein_id gnl|my_center|LOCUS_03200 58798 57878 gene locus_tag LOCUS_03210 58798 57878 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642212.1 protein_id gnl|my_center|LOCUS_03210 58866 59285 gene locus_tag LOCUS_03220 gene lpdD 58866 59285 CDS product gallate decarboxylase subunit LpdD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100947.1 protein_id gnl|my_center|LOCUS_03220 61097 59394 gene locus_tag LOCUS_03230 61097 59394 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476011.1 protein_id gnl|my_center|LOCUS_03230 61294 61713 gene locus_tag LOCUS_03240 61294 61713 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640522.1 protein_id gnl|my_center|LOCUS_03240 61808 62671 gene locus_tag LOCUS_03250 61808 62671 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101553.1 protein_id gnl|my_center|LOCUS_03250 62772 63605 gene locus_tag LOCUS_03260 62772 63605 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660564.1 protein_id gnl|my_center|LOCUS_03260 64189 64779 gene locus_tag LOCUS_03270 gene lepB 64189 64779 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704639.1 protein_id gnl|my_center|LOCUS_03270 64881 65726 gene locus_tag LOCUS_03280 64881 65726 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837228.1 protein_id gnl|my_center|LOCUS_03280 67375 66224 gene locus_tag LOCUS_03290 67375 66224 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287934.1 protein_id gnl|my_center|LOCUS_03290 68224 67637 gene locus_tag LOCUS_03300 68224 67637 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 protein_id gnl|my_center|LOCUS_03300 68459 68229 gene locus_tag LOCUS_03310 68459 68229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 69417 68647 gene locus_tag LOCUS_03320 69417 68647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 69598 70032 gene locus_tag LOCUS_03330 69598 70032 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690774.1 protein_id gnl|my_center|LOCUS_03330 71527 70052 gene locus_tag LOCUS_03340 71527 70052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 72889 71642 gene locus_tag LOCUS_03350 gene dcm 72889 71642 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183205.1 protein_id gnl|my_center|LOCUS_03350 73865 73281 gene locus_tag LOCUS_03360 73865 73281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 75027 73876 gene locus_tag LOCUS_03370 75027 73876 CDS product phage tail tip lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222037.1 protein_id gnl|my_center|LOCUS_03370 75243 75076 gene locus_tag LOCUS_03380 75243 75076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 77061 75253 gene locus_tag LOCUS_03390 77061 75253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 79569 77074 gene locus_tag LOCUS_03400 gene conE 79569 77074 CDS product VirB4-like ATPase ConE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119122844.1 protein_id gnl|my_center|LOCUS_03400 79882 79583 gene locus_tag LOCUS_03410 79882 79583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 80379 79879 gene locus_tag LOCUS_03420 80379 79879 CDS product antirestriction protein ArdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369218.1 protein_id gnl|my_center|LOCUS_03420 80789 80379 gene locus_tag LOCUS_03430 80789 80379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 81044 80796 gene locus_tag LOCUS_03440 81044 80796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 82006 81047 gene locus_tag LOCUS_03450 82006 81047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 83223 82018 gene locus_tag LOCUS_03460 gene nicK 83223 82018 CDS product DNA relaxase NicK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966621.1 protein_id gnl|my_center|LOCUS_03460 84795 83395 gene locus_tag LOCUS_03470 gene conQ 84795 83395 CDS product coupling conjugation protein ConQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966620.1 protein_id gnl|my_center|LOCUS_03470 85201 84806 gene locus_tag LOCUS_03480 85201 84806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 85514 85203 gene locus_tag LOCUS_03490 85514 85203 CDS product YdcP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298798.1 protein_id gnl|my_center|LOCUS_03490 86247 85594 gene locus_tag LOCUS_03500 86247 85594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence004 186 101 gene locus_tag LOCUS_t00020 186 101 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 406 855 gene locus_tag LOCUS_03510 406 855 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700550.1 protein_id gnl|my_center|LOCUS_03510 872 1204 gene locus_tag LOCUS_03520 872 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 1331 1759 gene locus_tag LOCUS_03530 1331 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 1924 3366 gene locus_tag LOCUS_03540 1924 3366 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101523.1 protein_id gnl|my_center|LOCUS_03540 4074 3517 gene locus_tag LOCUS_03550 4074 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 4231 4049 gene locus_tag LOCUS_03560 4231 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 4247 5467 gene locus_tag LOCUS_03570 4247 5467 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476174.1 protein_id gnl|my_center|LOCUS_03570 5591 5794 gene locus_tag LOCUS_03580 5591 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 6031 6519 gene locus_tag LOCUS_03590 gene purE 6031 6519 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702363.1 protein_id gnl|my_center|LOCUS_03590 6512 7633 gene locus_tag LOCUS_03600 gene purK 6512 7633 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697988.1 protein_id gnl|my_center|LOCUS_03600 7646 8941 gene locus_tag LOCUS_03610 gene purB 7646 8941 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475797.1 protein_id gnl|my_center|LOCUS_03610 9491 10210 gene locus_tag LOCUS_03620 9491 10210 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700037.1 protein_id gnl|my_center|LOCUS_03620 10213 10461 gene locus_tag LOCUS_03630 gene purS 10213 10461 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700038.1 protein_id gnl|my_center|LOCUS_03630 10461 11150 gene locus_tag LOCUS_03640 gene purQ 10461 11150 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475857.1 protein_id gnl|my_center|LOCUS_03640 11150 13375 gene locus_tag LOCUS_03650 gene purL 11150 13375 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475858.1 protein_id gnl|my_center|LOCUS_03650 13360 14817 gene locus_tag LOCUS_03660 gene purF 13360 14817 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475859.1 protein_id gnl|my_center|LOCUS_03660 14814 15851 gene locus_tag LOCUS_03670 gene purM 14814 15851 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700044.1 protein_id gnl|my_center|LOCUS_03670 15862 16443 gene locus_tag LOCUS_03680 gene purN 15862 16443 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700046.1 protein_id gnl|my_center|LOCUS_03680 16450 17988 gene locus_tag LOCUS_03690 gene purH 16450 17988 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700048.1 protein_id gnl|my_center|LOCUS_03690 18005 19261 gene locus_tag LOCUS_03700 gene purD 18005 19261 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700050.1 protein_id gnl|my_center|LOCUS_03700 20571 19387 gene locus_tag LOCUS_03710 20571 19387 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567842.1 protein_id gnl|my_center|LOCUS_03710 20706 21596 gene locus_tag LOCUS_03720 20706 21596 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700054.1 protein_id gnl|my_center|LOCUS_03720 21703 23061 gene locus_tag LOCUS_03730 21703 23061 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_03730 23162 23374 gene locus_tag LOCUS_03740 23162 23374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700056.1 protein_id gnl|my_center|LOCUS_03740 23418 23488 gene locus_tag LOCUS_t00030 23418 23488 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23725 25419 gene locus_tag LOCUS_03750 gene argS 23725 25419 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475862.1 protein_id gnl|my_center|LOCUS_03750 25689 27254 gene locus_tag LOCUS_03760 gene rny 25689 27254 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476179.1 protein_id gnl|my_center|LOCUS_03760 27482 28279 gene locus_tag LOCUS_03770 27482 28279 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641506.1 protein_id gnl|my_center|LOCUS_03770 28303 30930 gene locus_tag LOCUS_03780 gene mutS 28303 30930 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476178.1 protein_id gnl|my_center|LOCUS_03780 30959 32917 gene locus_tag LOCUS_03790 gene mutL 30959 32917 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476177.1 protein_id gnl|my_center|LOCUS_03790 32934 33548 gene locus_tag LOCUS_03800 gene ruvA 32934 33548 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700560.1 protein_id gnl|my_center|LOCUS_03800 33573 34586 gene locus_tag LOCUS_03810 gene ruvB 33573 34586 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476176.1 protein_id gnl|my_center|LOCUS_03810 34601 35644 gene locus_tag LOCUS_03820 gene queA 34601 35644 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700557.1 protein_id gnl|my_center|LOCUS_03820 35674 36819 gene locus_tag LOCUS_03830 gene tgt 35674 36819 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641516.1 protein_id gnl|my_center|LOCUS_03830 36901 37266 gene locus_tag LOCUS_03840 gene yajC 36901 37266 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700554.1 protein_id gnl|my_center|LOCUS_03840 37809 38255 gene locus_tag LOCUS_03850 gene fabZ 37809 38255 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563897.1 protein_id gnl|my_center|LOCUS_03850 38332 38772 gene locus_tag LOCUS_03860 38332 38772 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699732.1 protein_id gnl|my_center|LOCUS_03860 38794 39768 gene locus_tag LOCUS_03870 38794 39768 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475763.1 protein_id gnl|my_center|LOCUS_03870 39788 40030 gene locus_tag LOCUS_03880 39788 40030 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699734.1 protein_id gnl|my_center|LOCUS_03880 40046 40984 gene locus_tag LOCUS_03890 40046 40984 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475764.1 protein_id gnl|my_center|LOCUS_03890 40997 41728 gene locus_tag LOCUS_03900 gene fabG 40997 41728 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699736.1 protein_id gnl|my_center|LOCUS_03900 41740 42975 gene locus_tag LOCUS_03910 gene fabF 41740 42975 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475765.1 protein_id gnl|my_center|LOCUS_03910 42978 43439 gene locus_tag LOCUS_03920 gene accB 42978 43439 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475766.1 protein_id gnl|my_center|LOCUS_03920 43442 43867 gene locus_tag LOCUS_03930 gene fabZ 43442 43867 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699740.1 protein_id gnl|my_center|LOCUS_03930 43882 45246 gene locus_tag LOCUS_03940 gene accC 43882 45246 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475767.1 protein_id gnl|my_center|LOCUS_03940 45250 46107 gene locus_tag LOCUS_03950 gene accD 45250 46107 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025022359.1 protein_id gnl|my_center|LOCUS_03950 46100 46888 gene locus_tag LOCUS_03960 gene accA 46100 46888 CDS product carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057868922.1 protein_id gnl|my_center|LOCUS_03960 46911 47669 gene locus_tag LOCUS_03970 gene fabI 46911 47669 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475769.1 protein_id gnl|my_center|LOCUS_03970 47771 49225 gene locus_tag LOCUS_03980 gene zwf 47771 49225 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475770.1 protein_id gnl|my_center|LOCUS_03980 49549 50634 gene locus_tag LOCUS_03990 gene dinB 49549 50634 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704482.1 protein_id gnl|my_center|LOCUS_03990 50709 51392 gene locus_tag LOCUS_04000 50709 51392 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245964.1 protein_id gnl|my_center|LOCUS_04000 51404 52354 gene locus_tag LOCUS_04010 51404 52354 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476173.1 protein_id gnl|my_center|LOCUS_04010 52354 53694 gene locus_tag LOCUS_04020 52354 53694 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476172.1 protein_id gnl|my_center|LOCUS_04020 53972 56614 gene locus_tag LOCUS_04030 gene alaS 53972 56614 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476171.1 protein_id gnl|my_center|LOCUS_04030 56855 58399 gene locus_tag LOCUS_04040 56855 58399 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254634.1 protein_id gnl|my_center|LOCUS_04040 58769 59668 gene locus_tag LOCUS_04050 58769 59668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 61036 59912 gene locus_tag LOCUS_04060 61036 59912 CDS product lactate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379830.1 protein_id gnl|my_center|LOCUS_04060 62087 62929 gene locus_tag LOCUS_04070 62087 62929 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254284.1 protein_id gnl|my_center|LOCUS_04070 62964 64043 gene locus_tag LOCUS_04080 62964 64043 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475540.1 protein_id gnl|my_center|LOCUS_04080 64036 64737 gene locus_tag LOCUS_04090 64036 64737 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475541.1 protein_id gnl|my_center|LOCUS_04090 65023 65286 gene locus_tag LOCUS_04100 65023 65286 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703962.1 protein_id gnl|my_center|LOCUS_04100 65283 65720 gene locus_tag LOCUS_04110 gene ruvX 65283 65720 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035765.1 protein_id gnl|my_center|LOCUS_04110 65747 66037 gene locus_tag LOCUS_04120 65747 66037 CDS product DUF1292 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706616.1 protein_id gnl|my_center|LOCUS_04120 66331 66588 gene locus_tag LOCUS_04130 66331 66588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 66597 67142 gene locus_tag LOCUS_04140 66597 67142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 67154 69514 gene locus_tag LOCUS_04150 67154 69514 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700526.1 protein_id gnl|my_center|LOCUS_04150 69589 69900 gene locus_tag LOCUS_04160 gene trxA 69589 69900 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700525.1 protein_id gnl|my_center|LOCUS_04160 70023 70352 gene locus_tag LOCUS_04170 70023 70352 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475524.1 protein_id gnl|my_center|LOCUS_04170 70345 70944 gene locus_tag LOCUS_04180 70345 70944 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102079.1 protein_id gnl|my_center|LOCUS_04180 70947 71888 gene locus_tag LOCUS_04190 70947 71888 CDS product DUF4097 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475526.1 protein_id gnl|my_center|LOCUS_04190 71900 72148 gene locus_tag LOCUS_04200 71900 72148 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475527.1 protein_id gnl|my_center|LOCUS_04200 72472 72621 gene locus_tag LOCUS_04210 72472 72621 CDS product teichoic acid D-Ala incorporation-associated protein DltX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706303.1 protein_id gnl|my_center|LOCUS_04210 72640 74160 gene locus_tag LOCUS_04220 gene dltA 72640 74160 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476022.1 protein_id gnl|my_center|LOCUS_04220 74160 75368 gene locus_tag LOCUS_04230 gene dltB 74160 75368 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476021.1 protein_id gnl|my_center|LOCUS_04230 75386 75619 gene locus_tag LOCUS_04240 gene dltC 75386 75619 CDS product D-alanine--poly(phosphoribitol) ligase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701982.1 protein_id gnl|my_center|LOCUS_04240 75622 76863 gene locus_tag LOCUS_04250 gene dltD 75622 76863 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701979.1 protein_id gnl|my_center|LOCUS_04250 77485 76997 gene locus_tag LOCUS_04260 77485 76997 CDS product YslB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703936.1 protein_id gnl|my_center|LOCUS_04260 77650 78249 gene locus_tag LOCUS_04270 77650 78249 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476167.1 protein_id gnl|my_center|LOCUS_04270 78249 78776 gene locus_tag LOCUS_04280 78249 78776 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386618.1 protein_id gnl|my_center|LOCUS_04280 79013 79087 gene locus_tag LOCUS_t00040 79013 79087 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 79237 79311 gene locus_tag LOCUS_t00050 79237 79311 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 80079 79432 gene locus_tag LOCUS_04290 80079 79432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04290 80573 80319 gene locus_tag LOCUS_04300 80573 80319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04300 81347 80745 gene locus_tag LOCUS_04310 81347 80745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 81745 81371 gene locus_tag LOCUS_04320 81745 81371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence005 99 1259 gene locus_tag LOCUS_04330 99 1259 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989388.1 protein_id gnl|my_center|LOCUS_04330 1346 2683 gene locus_tag LOCUS_04340 1346 2683 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645481.1 protein_id gnl|my_center|LOCUS_04340 4320 3295 gene locus_tag LOCUS_04350 4320 3295 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242482.1 protein_id gnl|my_center|LOCUS_04350 5728 4355 gene locus_tag LOCUS_04360 gene iolT 5728 4355 CDS product myo-inositol transporter IolT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234027.1 protein_id gnl|my_center|LOCUS_04360 7250 6246 gene locus_tag LOCUS_04370 gene iolG 7250 6246 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_04370 8405 7389 gene locus_tag LOCUS_04380 gene iolG 8405 7389 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102252.1 protein_id gnl|my_center|LOCUS_04380 9434 8418 gene locus_tag LOCUS_04390 gene iolG 9434 8418 CDS product bifunctional inositol 2-dehydrogenase/D-chiro-inositol 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244482.1 protein_id gnl|my_center|LOCUS_04390 10311 9454 gene locus_tag LOCUS_04400 10311 9454 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814851.1 protein_id gnl|my_center|LOCUS_04400 10525 11349 gene locus_tag LOCUS_04410 10525 11349 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357554.1 protein_id gnl|my_center|LOCUS_04410 12256 11723 gene locus_tag LOCUS_04420 12256 11723 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674847.1 protein_id gnl|my_center|LOCUS_04420 12420 14606 gene locus_tag LOCUS_04430 gene nrdJ 12420 14606 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_04430 14636 15016 gene locus_tag LOCUS_04440 14636 15016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 15003 15536 gene locus_tag LOCUS_04450 15003 15536 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549293.1 protein_id gnl|my_center|LOCUS_04450 16407 15865 gene locus_tag LOCUS_04460 16407 15865 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644211.1 protein_id gnl|my_center|LOCUS_04460 17489 16410 gene locus_tag LOCUS_04470 17489 16410 CDS product guanine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645283.1 protein_id gnl|my_center|LOCUS_04470 17708 18910 gene locus_tag LOCUS_04480 17708 18910 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705534.1 protein_id gnl|my_center|LOCUS_04480 19768 19058 gene locus_tag LOCUS_04490 19768 19058 CDS product DUF1129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476455.1 protein_id gnl|my_center|LOCUS_04490 20896 19796 gene locus_tag LOCUS_04500 gene ychF 20896 19796 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476456.1 protein_id gnl|my_center|LOCUS_04500 21115 20915 gene locus_tag LOCUS_04510 21115 20915 CDS product DUF951 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226838.1 protein_id gnl|my_center|LOCUS_04510 22023 21142 gene locus_tag LOCUS_04520 22023 21142 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476457.1 protein_id gnl|my_center|LOCUS_04520 22780 22013 gene locus_tag LOCUS_04530 22780 22013 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102075.1 protein_id gnl|my_center|LOCUS_04530 23654 22803 gene locus_tag LOCUS_04540 gene noc 23654 22803 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476458.1 protein_id gnl|my_center|LOCUS_04540 24414 23686 gene locus_tag LOCUS_04550 gene rsmG 24414 23686 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102076.1 protein_id gnl|my_center|LOCUS_04550 26767 24608 gene locus_tag LOCUS_04560 26767 24608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 27174 26785 gene locus_tag LOCUS_04570 gene fliS 27174 26785 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869575.1 protein_id gnl|my_center|LOCUS_04570 27521 27195 gene locus_tag LOCUS_04580 27521 27195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 28984 27533 gene locus_tag LOCUS_04590 gene fliD 28984 27533 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146762.1 protein_id gnl|my_center|LOCUS_04590 30187 29132 gene locus_tag LOCUS_04600 30187 29132 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392281.1 protein_id gnl|my_center|LOCUS_04600 30449 31084 gene locus_tag LOCUS_04610 30449 31084 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 protein_id gnl|my_center|LOCUS_04610 31554 31240 gene locus_tag LOCUS_04620 31554 31240 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563849.1 protein_id gnl|my_center|LOCUS_04620 32603 32019 gene locus_tag LOCUS_04630 32603 32019 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906104.1 protein_id gnl|my_center|LOCUS_04630 33662 32739 gene locus_tag LOCUS_04640 gene flgL 33662 32739 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987030.1 protein_id gnl|my_center|LOCUS_04640 35184 33670 gene locus_tag LOCUS_04650 gene flgK 35184 33670 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_04650 35556 35197 gene locus_tag LOCUS_04660 35556 35197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 35860 35558 gene locus_tag LOCUS_04670 35860 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 37058 35952 gene locus_tag LOCUS_04680 gene fliY 37058 35952 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965513.1 protein_id gnl|my_center|LOCUS_04680 38053 37055 gene locus_tag LOCUS_04690 gene fliM 38053 37055 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987033.1 protein_id gnl|my_center|LOCUS_04690 38462 38070 gene locus_tag LOCUS_04700 38462 38070 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987034.1 protein_id gnl|my_center|LOCUS_04700 38845 38483 gene locus_tag LOCUS_04710 38845 38483 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392324.1 protein_id gnl|my_center|LOCUS_04710 39446 38859 gene locus_tag LOCUS_04720 39446 38859 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965517.1 protein_id gnl|my_center|LOCUS_04720 41503 39446 gene locus_tag LOCUS_04730 41503 39446 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965518.1 protein_id gnl|my_center|LOCUS_04730 42297 41524 gene locus_tag LOCUS_04740 42297 41524 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965519.1 protein_id gnl|my_center|LOCUS_04740 43306 42302 gene locus_tag LOCUS_04750 43306 42302 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987036.1 protein_id gnl|my_center|LOCUS_04750 43814 43320 gene locus_tag LOCUS_04760 43814 43320 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541375.1 protein_id gnl|my_center|LOCUS_04760 44286 43795 gene locus_tag LOCUS_04770 44286 43795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 45630 44317 gene locus_tag LOCUS_04780 45630 44317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 46462 45749 gene locus_tag LOCUS_04790 gene ftsE 46462 45749 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173889.1 protein_id gnl|my_center|LOCUS_04790 47253 46486 gene locus_tag LOCUS_04800 gene flgG 47253 46486 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197257.1 protein_id gnl|my_center|LOCUS_04800 47969 47265 gene locus_tag LOCUS_04810 47969 47265 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860711.1 protein_id gnl|my_center|LOCUS_04810 48679 47966 gene locus_tag LOCUS_04820 48679 47966 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435969.1 protein_id gnl|my_center|LOCUS_04820 50786 48711 gene locus_tag LOCUS_04830 gene flhA 50786 48711 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965446.1 protein_id gnl|my_center|LOCUS_04830 51881 50814 gene locus_tag LOCUS_04840 51881 50814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04840 52643 51891 gene locus_tag LOCUS_04850 gene fliR 52643 51891 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_04850 52916 52653 gene locus_tag LOCUS_04860 gene fliQ 52916 52653 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220888.1 protein_id gnl|my_center|LOCUS_04860 53701 52934 gene locus_tag LOCUS_04870 gene fliP 53701 52934 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_04870 54069 53701 gene locus_tag LOCUS_04880 gene fliO 54069 53701 CDS product flagellar biosynthetic protein FliO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965450.1 protein_id gnl|my_center|LOCUS_04880 54576 54082 gene locus_tag LOCUS_04890 54576 54082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 54805 54587 gene locus_tag LOCUS_04900 54805 54587 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081092.1 protein_id gnl|my_center|LOCUS_04900 55736 54846 gene locus_tag LOCUS_04910 55736 54846 CDS product flagellar hook-basal body complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986954.1 protein_id gnl|my_center|LOCUS_04910 56178 55813 gene locus_tag LOCUS_04920 56178 55813 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965454.1 protein_id gnl|my_center|LOCUS_04920 56599 56162 gene locus_tag LOCUS_04930 56599 56162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 58136 56613 gene locus_tag LOCUS_04940 58136 56613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 58563 58129 gene locus_tag LOCUS_04950 gene fliJ 58563 58129 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865139.1 protein_id gnl|my_center|LOCUS_04950 59911 58580 gene locus_tag LOCUS_04960 gene fliI 59911 58580 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047906.1 protein_id gnl|my_center|LOCUS_04960 60620 59901 gene locus_tag LOCUS_04970 60620 59901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 61614 60604 gene locus_tag LOCUS_04980 gene fliG 61614 60604 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359190.1 protein_id gnl|my_center|LOCUS_04980 63184 61628 gene locus_tag LOCUS_04990 gene fliF 63184 61628 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986960.1 protein_id gnl|my_center|LOCUS_04990 63556 63227 gene locus_tag LOCUS_05000 63556 63227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 64007 63567 gene locus_tag LOCUS_05010 gene flgC 64007 63567 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986962.1 protein_id gnl|my_center|LOCUS_05010 64390 64031 gene locus_tag LOCUS_05020 gene flgB 64390 64031 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361361.1 protein_id gnl|my_center|LOCUS_05020 64828 65622 gene locus_tag LOCUS_05030 gene motA 64828 65622 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386207.1 protein_id gnl|my_center|LOCUS_05030 65600 66370 gene locus_tag LOCUS_05040 65600 66370 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986703.1 protein_id gnl|my_center|LOCUS_05040 67212 66733 gene locus_tag LOCUS_05050 67212 66733 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476083.1 protein_id gnl|my_center|LOCUS_05050 68095 67250 gene locus_tag LOCUS_05060 68095 67250 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476084.1 protein_id gnl|my_center|LOCUS_05060 69701 68376 gene locus_tag LOCUS_05070 69701 68376 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643745.1 protein_id gnl|my_center|LOCUS_05070 70362 69865 gene locus_tag LOCUS_05080 70362 69865 CDS product DUF1440 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563498.1 protein_id gnl|my_center|LOCUS_05080 70603 71532 gene locus_tag LOCUS_05090 gene rihA 70603 71532 CDS product pyrimidine-specific ribonucleoside hydrolase RihA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705366.1 protein_id gnl|my_center|LOCUS_05090 71549 72076 gene locus_tag LOCUS_05100 71549 72076 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642615.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence006 764 108 gene locus_tag LOCUS_05110 764 108 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475842.1 protein_id gnl|my_center|LOCUS_05110 1410 757 gene locus_tag LOCUS_05120 gene rpe 1410 757 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476680.1 protein_id gnl|my_center|LOCUS_05120 2295 1420 gene locus_tag LOCUS_05130 gene rsgA 2295 1420 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014568296.1 protein_id gnl|my_center|LOCUS_05130 4342 2327 gene locus_tag LOCUS_05140 gene pknB 4342 2327 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674550.1 protein_id gnl|my_center|LOCUS_05140 5088 4339 gene locus_tag LOCUS_05150 5088 4339 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101477.1 protein_id gnl|my_center|LOCUS_05150 6437 5106 gene locus_tag LOCUS_05160 gene rsmB 6437 5106 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701751.1 protein_id gnl|my_center|LOCUS_05160 7383 6430 gene locus_tag LOCUS_05170 gene fmt 7383 6430 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701719.1 protein_id gnl|my_center|LOCUS_05170 9784 7403 gene locus_tag LOCUS_05180 gene priA 9784 7403 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087118642.1 protein_id gnl|my_center|LOCUS_05180 11014 9836 gene locus_tag LOCUS_05190 gene coaBC 11014 9836 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475839.1 protein_id gnl|my_center|LOCUS_05190 11360 11148 gene locus_tag LOCUS_05200 gene rpoZ 11360 11148 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640362.1 protein_id gnl|my_center|LOCUS_05200 11977 11357 gene locus_tag LOCUS_05210 gene gmk 11977 11357 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699957.1 protein_id gnl|my_center|LOCUS_05210 12161 12484 gene locus_tag LOCUS_05220 12161 12484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 13929 12583 gene locus_tag LOCUS_05230 gene glnA 13929 12583 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475817.1 protein_id gnl|my_center|LOCUS_05230 14341 13952 gene locus_tag LOCUS_05240 14341 13952 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699881.1 protein_id gnl|my_center|LOCUS_05240 15691 14417 gene locus_tag LOCUS_05250 15691 14417 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475816.1 protein_id gnl|my_center|LOCUS_05250 16631 15699 gene locus_tag LOCUS_05260 gene miaA 16631 15699 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475815.1 protein_id gnl|my_center|LOCUS_05260 16752 16928 gene locus_tag LOCUS_05270 16752 16928 CDS product DUF3042 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705942.1 protein_id gnl|my_center|LOCUS_05270 17527 17120 gene locus_tag LOCUS_05280 17527 17120 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705941.1 protein_id gnl|my_center|LOCUS_05280 18517 17558 gene locus_tag LOCUS_05290 18517 17558 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699875.1 protein_id gnl|my_center|LOCUS_05290 18744 18544 gene locus_tag LOCUS_05300 18744 18544 CDS product YqgQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475814.1 protein_id gnl|my_center|LOCUS_05300 19428 18778 gene locus_tag LOCUS_05310 19428 18778 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475813.1 protein_id gnl|my_center|LOCUS_05310 19992 19441 gene locus_tag LOCUS_05320 19992 19441 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475812.1 protein_id gnl|my_center|LOCUS_05320 20231 20082 gene locus_tag LOCUS_05330 gene rpmG 20231 20082 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699868.1 protein_id gnl|my_center|LOCUS_05330 22436 20361 gene locus_tag LOCUS_05340 22436 20361 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476158.1 protein_id gnl|my_center|LOCUS_05340 23513 23253 gene locus_tag LOCUS_05350 23513 23253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 23980 25275 gene locus_tag LOCUS_05360 23980 25275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 26104 25439 gene locus_tag LOCUS_05370 26104 25439 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 protein_id gnl|my_center|LOCUS_05370 26734 26216 gene locus_tag LOCUS_05380 26734 26216 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700501.1 protein_id gnl|my_center|LOCUS_05380 29084 26754 gene locus_tag LOCUS_05390 gene recJ 29084 26754 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476160.1 protein_id gnl|my_center|LOCUS_05390 29453 29106 gene locus_tag LOCUS_05400 29453 29106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 30286 29477 gene locus_tag LOCUS_05410 30286 29477 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700506.1 protein_id gnl|my_center|LOCUS_05410 31235 30297 gene locus_tag LOCUS_05420 gene rnz 31235 30297 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476161.1 protein_id gnl|my_center|LOCUS_05420 31389 31712 gene locus_tag LOCUS_05430 31389 31712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 33760 31862 gene locus_tag LOCUS_05440 33760 31862 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700513.1 protein_id gnl|my_center|LOCUS_05440 35114 33798 gene locus_tag LOCUS_05450 gene obgE 35114 33798 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476163.1 protein_id gnl|my_center|LOCUS_05450 35365 35901 gene locus_tag LOCUS_05460 35365 35901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05460 35923 36276 gene locus_tag LOCUS_05470 35923 36276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05470 38046 36277 gene locus_tag LOCUS_05480 gene uvrC 38046 36277 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476164.1 protein_id gnl|my_center|LOCUS_05480 39037 38303 gene locus_tag LOCUS_05490 39037 38303 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701149.1 protein_id gnl|my_center|LOCUS_05490 40490 39030 gene locus_tag LOCUS_05500 40490 39030 CDS product ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476410.1 protein_id gnl|my_center|LOCUS_05500 40691 40828 gene locus_tag LOCUS_05510 40691 40828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 42026 40953 gene locus_tag LOCUS_05520 42026 40953 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592702.1 protein_id gnl|my_center|LOCUS_05520 42370 42071 gene locus_tag LOCUS_05530 42370 42071 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699862.1 protein_id gnl|my_center|LOCUS_05530 43013 42387 gene locus_tag LOCUS_05540 gene yihA 43013 42387 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709878.1 protein_id gnl|my_center|LOCUS_05540 43315 43139 gene locus_tag LOCUS_05550 gene rpmF 43315 43139 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699811.1 protein_id gnl|my_center|LOCUS_05550 43944 43402 gene locus_tag LOCUS_05560 43944 43402 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702323.1 protein_id gnl|my_center|LOCUS_05560 45169 44027 gene locus_tag LOCUS_05570 45169 44027 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475793.1 protein_id gnl|my_center|LOCUS_05570 45919 45182 gene locus_tag LOCUS_05580 45919 45182 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645186.1 protein_id gnl|my_center|LOCUS_05580 46275 45919 gene locus_tag LOCUS_05590 gene rsfS 46275 45919 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_05590 46881 46288 gene locus_tag LOCUS_05600 gene yqeK 46881 46288 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475791.1 protein_id gnl|my_center|LOCUS_05600 47515 46874 gene locus_tag LOCUS_05610 47515 46874 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640290.1 protein_id gnl|my_center|LOCUS_05610 47858 47544 gene locus_tag LOCUS_05620 gene yhbY 47858 47544 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699799.1 protein_id gnl|my_center|LOCUS_05620 48987 47869 gene locus_tag LOCUS_05630 gene yqeH 48987 47869 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703227.1 protein_id gnl|my_center|LOCUS_05630 49513 48980 gene locus_tag LOCUS_05640 49513 48980 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475789.1 protein_id gnl|my_center|LOCUS_05640 50115 49756 gene locus_tag LOCUS_05650 gene rplT 50115 49756 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699795.1 protein_id gnl|my_center|LOCUS_05650 50409 50209 gene locus_tag LOCUS_05660 gene rpmI 50409 50209 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699793.1 protein_id gnl|my_center|LOCUS_05660 50940 50440 gene locus_tag LOCUS_05670 gene infC 50940 50440 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705897.1 protein_id gnl|my_center|LOCUS_05670 53098 51161 gene locus_tag LOCUS_05680 gene thrS 53098 51161 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475786.1 protein_id gnl|my_center|LOCUS_05680 54329 53412 gene locus_tag LOCUS_05690 gene dnaI 54329 53412 CDS product primosomal protein DnaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475785.1 protein_id gnl|my_center|LOCUS_05690 55724 54345 gene locus_tag LOCUS_05700 55724 54345 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699787.1 protein_id gnl|my_center|LOCUS_05700 56230 55736 gene locus_tag LOCUS_05710 gene nrdR 56230 55736 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640274.1 protein_id gnl|my_center|LOCUS_05710 56865 56266 gene locus_tag LOCUS_05720 gene coaE 56865 56266 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_05720 57693 56866 gene locus_tag LOCUS_05730 gene mutM 57693 56866 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699782.1 protein_id gnl|my_center|LOCUS_05730 60396 57715 gene locus_tag LOCUS_05740 gene polA 60396 57715 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475783.1 protein_id gnl|my_center|LOCUS_05740 61237 60542 gene locus_tag LOCUS_05750 61237 60542 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824482.1 protein_id gnl|my_center|LOCUS_05750 61722 61237 gene locus_tag LOCUS_05760 61722 61237 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702490.1 protein_id gnl|my_center|LOCUS_05760 63300 61969 gene locus_tag LOCUS_05770 gene murC 63300 61969 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699774.1 protein_id gnl|my_center|LOCUS_05770 <65158 63375 gene locus_tag LOCUS_05780 <65158 63375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101414.1:DNA translocase FtsK >Feature sequence007 1444 176 gene locus_tag LOCUS_05790 gene serS 1444 176 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702338.1 protein_id gnl|my_center|LOCUS_05790 1641 1510 gene locus_tag LOCUS_05800 1641 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3205 1742 gene locus_tag LOCUS_05810 3205 1742 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475571.1 protein_id gnl|my_center|LOCUS_05810 5281 3599 gene locus_tag LOCUS_05820 gene alsS 5281 3599 CDS product acetolactate synthase AlsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700881.1 protein_id gnl|my_center|LOCUS_05820 6047 5529 gene locus_tag LOCUS_05830 6047 5529 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641234.1 protein_id gnl|my_center|LOCUS_05830 6579 6025 gene locus_tag LOCUS_05840 6579 6025 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 protein_id gnl|my_center|LOCUS_05840 7282 6611 gene locus_tag LOCUS_05850 7282 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 7611 8651 gene locus_tag LOCUS_05860 7611 8651 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701236.1 protein_id gnl|my_center|LOCUS_05860 9471 8815 gene locus_tag LOCUS_05870 9471 8815 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641873.1 protein_id gnl|my_center|LOCUS_05870 10918 9482 gene locus_tag LOCUS_05880 10918 9482 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643721.1 protein_id gnl|my_center|LOCUS_05880 11743 11309 gene locus_tag LOCUS_05890 11743 11309 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701235.1 protein_id gnl|my_center|LOCUS_05890 12499 11756 gene locus_tag LOCUS_05900 12499 11756 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476365.1 protein_id gnl|my_center|LOCUS_05900 13722 12553 gene locus_tag LOCUS_05910 13722 12553 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645896.1 protein_id gnl|my_center|LOCUS_05910 13989 13789 gene locus_tag LOCUS_05920 13989 13789 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355121.1 protein_id gnl|my_center|LOCUS_05920 14801 14154 gene locus_tag LOCUS_05930 14801 14154 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701679.1 protein_id gnl|my_center|LOCUS_05930 15782 14913 gene locus_tag LOCUS_05940 15782 14913 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563850.1 protein_id gnl|my_center|LOCUS_05940 16672 15794 gene locus_tag LOCUS_05950 16672 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 17538 16747 gene locus_tag LOCUS_05960 17538 16747 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101902.1 protein_id gnl|my_center|LOCUS_05960 18401 17535 gene locus_tag LOCUS_05970 18401 17535 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642573.1 protein_id gnl|my_center|LOCUS_05970 18823 18407 gene locus_tag LOCUS_05980 18823 18407 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701043.1 protein_id gnl|my_center|LOCUS_05980 20623 18830 gene locus_tag LOCUS_05990 20623 18830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101901.1 protein_id gnl|my_center|LOCUS_05990 21398 20640 gene locus_tag LOCUS_06000 21398 20640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642577.1 protein_id gnl|my_center|LOCUS_06000 22951 21719 gene locus_tag LOCUS_06010 22951 21719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 23769 22948 gene locus_tag LOCUS_06020 23769 22948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 25100 23880 gene locus_tag LOCUS_06030 25100 23880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476016.1 protein_id gnl|my_center|LOCUS_06030 25989 25102 gene locus_tag LOCUS_06040 25989 25102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476017.1 protein_id gnl|my_center|LOCUS_06040 26947 26057 gene locus_tag LOCUS_06050 26947 26057 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641317.1 protein_id gnl|my_center|LOCUS_06050 27087 28706 gene locus_tag LOCUS_06060 27087 28706 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601491.1 protein_id gnl|my_center|LOCUS_06060 28723 30138 gene locus_tag LOCUS_06070 28723 30138 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432352.1 protein_id gnl|my_center|LOCUS_06070 30473 31201 gene locus_tag LOCUS_06080 gene pxpB 30473 31201 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_06080 31214 32224 gene locus_tag LOCUS_06090 31214 32224 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_06090 32239 32658 gene locus_tag LOCUS_06100 gene accB 32239 32658 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428740.1 protein_id gnl|my_center|LOCUS_06100 32669 33988 gene locus_tag LOCUS_06110 32669 33988 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_06110 34004 34804 gene locus_tag LOCUS_06120 34004 34804 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886407.1 protein_id gnl|my_center|LOCUS_06120 34817 35566 gene locus_tag LOCUS_06130 34817 35566 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815133.1 protein_id gnl|my_center|LOCUS_06130 35597 36826 gene locus_tag LOCUS_06140 35597 36826 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234422.1 protein_id gnl|my_center|LOCUS_06140 37430 36945 gene locus_tag LOCUS_06150 37430 36945 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674307.1 protein_id gnl|my_center|LOCUS_06150 38119 37514 gene locus_tag LOCUS_06160 38119 37514 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594346.1 protein_id gnl|my_center|LOCUS_06160 39224 38112 gene locus_tag LOCUS_06170 39224 38112 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658355.1 protein_id gnl|my_center|LOCUS_06170 39978 39214 gene locus_tag LOCUS_06180 39978 39214 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565089.1 protein_id gnl|my_center|LOCUS_06180 40868 39981 gene locus_tag LOCUS_06190 40868 39981 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594351.1 protein_id gnl|my_center|LOCUS_06190 41432 40965 gene locus_tag LOCUS_06200 41432 40965 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032908745.1 protein_id gnl|my_center|LOCUS_06200 41813 41493 gene locus_tag LOCUS_06210 41813 41493 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003639489.1 protein_id gnl|my_center|LOCUS_06210 43278 41830 gene locus_tag LOCUS_06220 43278 41830 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262788.1 protein_id gnl|my_center|LOCUS_06220 44858 43512 gene locus_tag LOCUS_06230 gene celB 44858 43512 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014565762.1 protein_id gnl|my_center|LOCUS_06230 45377 46114 gene locus_tag LOCUS_06240 45377 46114 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722126.1 protein_id gnl|my_center|LOCUS_06240 47681 46290 gene locus_tag LOCUS_06250 47681 46290 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546978.1 protein_id gnl|my_center|LOCUS_06250 49425 47935 gene locus_tag LOCUS_06260 49425 47935 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674845.1 protein_id gnl|my_center|LOCUS_06260 50864 49473 gene locus_tag LOCUS_06270 50864 49473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566217.1 protein_id gnl|my_center|LOCUS_06270 51145 51642 gene locus_tag LOCUS_06280 51145 51642 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000379157.1 protein_id gnl|my_center|LOCUS_06280 52965 51766 gene locus_tag LOCUS_06290 52965 51766 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_06290 54163 53234 gene locus_tag LOCUS_06300 54163 53234 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949134.1 protein_id gnl|my_center|LOCUS_06300 55936 54194 gene locus_tag LOCUS_06310 55936 54194 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986745.1 protein_id gnl|my_center|LOCUS_06310 57696 55948 gene locus_tag LOCUS_06320 57696 55948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462213.1 protein_id gnl|my_center|LOCUS_06320 58612 58109 gene locus_tag LOCUS_06330 58612 58109 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642953.1 protein_id gnl|my_center|LOCUS_06330 59942 59067 gene locus_tag LOCUS_06340 59942 59067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence008 842 120 gene locus_tag LOCUS_06350 gene lrgB 842 120 CDS product antiholin-like protein LrgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421724.1 protein_id gnl|my_center|LOCUS_06350 1302 826 gene locus_tag LOCUS_06360 1302 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2155 1427 gene locus_tag LOCUS_06370 2155 1427 CDS product LytTR family transcriptional regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697630.1 protein_id gnl|my_center|LOCUS_06370 2973 2500 gene locus_tag LOCUS_06380 2973 2500 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701862.1 protein_id gnl|my_center|LOCUS_06380 3154 4635 gene locus_tag LOCUS_06390 3154 4635 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641223.1 protein_id gnl|my_center|LOCUS_06390 4635 5381 gene locus_tag LOCUS_06400 4635 5381 CDS product DUF4811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641222.1 protein_id gnl|my_center|LOCUS_06400 7300 5567 gene locus_tag LOCUS_06410 gene lytS 7300 5567 CDS product two-component system sensor histidine kinase LytS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262109.1 protein_id gnl|my_center|LOCUS_06410 7477 7905 gene locus_tag LOCUS_06420 7477 7905 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701862.1 protein_id gnl|my_center|LOCUS_06420 7924 8310 gene locus_tag LOCUS_06430 7924 8310 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027277.1 protein_id gnl|my_center|LOCUS_06430 8340 8936 gene locus_tag LOCUS_06440 8340 8936 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643718.1 protein_id gnl|my_center|LOCUS_06440 9393 9025 gene locus_tag LOCUS_06450 9393 9025 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475565.1 protein_id gnl|my_center|LOCUS_06450 9447 10268 gene locus_tag LOCUS_06460 gene menB 9447 10268 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704061.1 protein_id gnl|my_center|LOCUS_06460 10297 11739 gene locus_tag LOCUS_06470 10297 11739 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475566.1 protein_id gnl|my_center|LOCUS_06470 11990 12448 gene locus_tag LOCUS_06480 gene nrdI 11990 12448 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263681.1 protein_id gnl|my_center|LOCUS_06480 13099 12485 gene locus_tag LOCUS_06490 13099 12485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 13272 13481 gene locus_tag LOCUS_06500 13272 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 13474 13839 gene locus_tag LOCUS_06510 13474 13839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 13933 17094 gene locus_tag LOCUS_06520 13933 17094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 17880 17290 gene locus_tag LOCUS_06530 17880 17290 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594613.1 protein_id gnl|my_center|LOCUS_06530 18627 18055 gene locus_tag LOCUS_06540 18627 18055 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922631.1 protein_id gnl|my_center|LOCUS_06540 20449 19064 gene locus_tag LOCUS_06550 20449 19064 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101153.1 protein_id gnl|my_center|LOCUS_06550 20600 21280 gene locus_tag LOCUS_06560 20600 21280 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101152.1 protein_id gnl|my_center|LOCUS_06560 22358 21594 gene locus_tag LOCUS_06570 22358 21594 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596147.1 protein_id gnl|my_center|LOCUS_06570 24459 23074 gene locus_tag LOCUS_06580 24459 23074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074554.1 protein_id gnl|my_center|LOCUS_06580 24991 24473 gene locus_tag LOCUS_06590 24991 24473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 25719 25910 gene locus_tag LOCUS_06600 25719 25910 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795762.1 protein_id gnl|my_center|LOCUS_06600 25986 26282 gene locus_tag LOCUS_06610 25986 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 26767 26438 gene locus_tag LOCUS_06620 26767 26438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 27047 27823 gene locus_tag LOCUS_06630 27047 27823 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967177.1 protein_id gnl|my_center|LOCUS_06630 29784 30320 gene locus_tag LOCUS_06640 29784 30320 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704195.1 protein_id gnl|my_center|LOCUS_06640 30799 30482 gene locus_tag LOCUS_06650 30799 30482 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704272.1 protein_id gnl|my_center|LOCUS_06650 31860 30919 gene locus_tag LOCUS_06660 31860 30919 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085964407.1 protein_id gnl|my_center|LOCUS_06660 32092 33114 gene locus_tag LOCUS_06670 32092 33114 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905973.1 protein_id gnl|my_center|LOCUS_06670 33261 34784 gene locus_tag LOCUS_06680 33261 34784 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 protein_id gnl|my_center|LOCUS_06680 34799 35881 gene locus_tag LOCUS_06690 34799 35881 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935270.1 protein_id gnl|my_center|LOCUS_06690 35878 36837 gene locus_tag LOCUS_06700 35878 36837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000060306.1 protein_id gnl|my_center|LOCUS_06700 37363 41835 gene locus_tag LOCUS_06710 gene gltB 37363 41835 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674930.1 protein_id gnl|my_center|LOCUS_06710 41849 43273 gene locus_tag LOCUS_06720 41849 43273 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596237.1 protein_id gnl|my_center|LOCUS_06720 44774 43464 gene locus_tag LOCUS_06730 44774 43464 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102117.1 protein_id gnl|my_center|LOCUS_06730 45915 45088 gene locus_tag LOCUS_06740 45915 45088 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645539.1 protein_id gnl|my_center|LOCUS_06740 47682 46003 gene locus_tag LOCUS_06750 gene treC 47682 46003 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476387.1 protein_id gnl|my_center|LOCUS_06750 48433 47675 gene locus_tag LOCUS_06760 gene treR 48433 47675 CDS product trehalose operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703413.1 protein_id gnl|my_center|LOCUS_06760 48634 49119 gene locus_tag LOCUS_06770 48634 49119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06770 49135 50601 gene locus_tag LOCUS_06780 49135 50601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06780 50883 52688 gene locus_tag LOCUS_06790 50883 52688 CDS product PTS mannitol transporter subunit IICBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476473.1 protein_id gnl|my_center|LOCUS_06790 52704 54773 gene locus_tag LOCUS_06800 52704 54773 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476476.1 protein_id gnl|my_center|LOCUS_06800 54773 55225 gene locus_tag LOCUS_06810 54773 55225 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701041.1 protein_id gnl|my_center|LOCUS_06810 55225 56379 gene locus_tag LOCUS_06820 55225 56379 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476472.1 protein_id gnl|my_center|LOCUS_06820 56618 58438 gene locus_tag LOCUS_06830 gene glmS 56618 58438 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476475.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence009 580 957 gene locus_tag LOCUS_06840 580 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2089 1253 gene locus_tag LOCUS_06850 2089 1253 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723551.1 protein_id gnl|my_center|LOCUS_06850 2267 2761 gene locus_tag LOCUS_06860 2267 2761 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702666.1 protein_id gnl|my_center|LOCUS_06860 3940 3026 gene locus_tag LOCUS_06870 3940 3026 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317368.1 protein_id gnl|my_center|LOCUS_06870 4125 4964 gene locus_tag LOCUS_06880 4125 4964 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228409.1 protein_id gnl|my_center|LOCUS_06880 5056 6438 gene locus_tag LOCUS_06890 5056 6438 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641313.1 protein_id gnl|my_center|LOCUS_06890 6499 7890 gene locus_tag LOCUS_06900 6499 7890 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476282.1 protein_id gnl|my_center|LOCUS_06900 8032 8349 gene locus_tag LOCUS_06910 8032 8349 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286606.1 protein_id gnl|my_center|LOCUS_06910 8384 9862 gene locus_tag LOCUS_06920 8384 9862 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546937.1 protein_id gnl|my_center|LOCUS_06920 10163 12712 gene locus_tag LOCUS_06930 10163 12712 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101213.1 protein_id gnl|my_center|LOCUS_06930 13790 12846 gene locus_tag LOCUS_06940 13790 12846 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644739.1 protein_id gnl|my_center|LOCUS_06940 14553 15509 gene locus_tag LOCUS_06950 14553 15509 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101815.1 protein_id gnl|my_center|LOCUS_06950 15615 15878 gene locus_tag LOCUS_06960 15615 15878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824462.1 protein_id gnl|my_center|LOCUS_06960 16469 15960 gene locus_tag LOCUS_06970 gene yraA 16469 15960 CDS product cysteine protease YraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229836.1 protein_id gnl|my_center|LOCUS_06970 17705 16926 gene locus_tag LOCUS_06980 17705 16926 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101822.1 protein_id gnl|my_center|LOCUS_06980 18597 17695 gene locus_tag LOCUS_06990 18597 17695 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642727.1 protein_id gnl|my_center|LOCUS_06990 19601 18594 gene locus_tag LOCUS_07000 gene trpX 19601 18594 CDS product tryptophan ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101821.1 protein_id gnl|my_center|LOCUS_07000 20376 19921 gene locus_tag LOCUS_07010 20376 19921 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642935.1 protein_id gnl|my_center|LOCUS_07010 20638 21435 gene locus_tag LOCUS_07020 gene yidA 20638 21435 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824472.1 protein_id gnl|my_center|LOCUS_07020 21623 23050 gene locus_tag LOCUS_07030 21623 23050 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674454.1 protein_id gnl|my_center|LOCUS_07030 23856 23170 gene locus_tag LOCUS_07040 23856 23170 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101356.1 protein_id gnl|my_center|LOCUS_07040 25407 23968 gene locus_tag LOCUS_07050 25407 23968 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674006.1 protein_id gnl|my_center|LOCUS_07050 25615 28356 gene locus_tag LOCUS_07060 25615 28356 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100894.1 protein_id gnl|my_center|LOCUS_07060 28532 28738 gene locus_tag LOCUS_07070 28532 28738 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573729.1 protein_id gnl|my_center|LOCUS_07070 28775 29017 gene locus_tag LOCUS_07080 28775 29017 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643582.1 protein_id gnl|my_center|LOCUS_07080 29995 29453 gene locus_tag LOCUS_07090 29995 29453 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475501.1 protein_id gnl|my_center|LOCUS_07090 30153 31124 gene locus_tag LOCUS_07100 gene bioB 30153 31124 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009961.1 protein_id gnl|my_center|LOCUS_07100 31935 32870 gene locus_tag LOCUS_07110 31935 32870 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644460.1 protein_id gnl|my_center|LOCUS_07110 34993 33002 gene locus_tag LOCUS_07120 34993 33002 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101999.1 protein_id gnl|my_center|LOCUS_07120 35352 36227 gene locus_tag LOCUS_07130 35352 36227 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640443.1 protein_id gnl|my_center|LOCUS_07130 36338 37258 gene locus_tag LOCUS_07140 36338 37258 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675041.1 protein_id gnl|my_center|LOCUS_07140 40024 37385 gene locus_tag LOCUS_07150 40024 37385 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643866.1 protein_id gnl|my_center|LOCUS_07150 40192 40569 gene locus_tag LOCUS_07160 gene mscL 40192 40569 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701438.1 protein_id gnl|my_center|LOCUS_07160 42659 40821 gene locus_tag LOCUS_07170 42659 40821 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_07170 44165 43143 gene locus_tag LOCUS_07180 44165 43143 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810703.1 protein_id gnl|my_center|LOCUS_07180 45060 44191 gene locus_tag LOCUS_07190 45060 44191 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063663.1 protein_id gnl|my_center|LOCUS_07190 45850 45062 gene locus_tag LOCUS_07200 45850 45062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727461.1 protein_id gnl|my_center|LOCUS_07200 46662 47564 gene locus_tag LOCUS_07210 46662 47564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 47639 47779 gene locus_tag LOCUS_07220 47639 47779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 47922 49469 gene locus_tag LOCUS_07230 47922 49469 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642739.1 protein_id gnl|my_center|LOCUS_07230 49486 50124 gene locus_tag LOCUS_07240 49486 50124 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704946.1 protein_id gnl|my_center|LOCUS_07240 50494 52230 gene locus_tag LOCUS_07250 50494 52230 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563444.1 protein_id gnl|my_center|LOCUS_07250 52317 52952 gene locus_tag LOCUS_07260 52317 52952 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476674.1 protein_id gnl|my_center|LOCUS_07260 53263 53742 gene locus_tag LOCUS_07270 53263 53742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence010 641 240 gene locus_tag LOCUS_07280 641 240 CDS product CvfD/Ygs/GSP13 family RNA-binding post-transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475756.1 protein_id gnl|my_center|LOCUS_07280 1236 664 gene locus_tag LOCUS_07290 1236 664 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475488.1 protein_id gnl|my_center|LOCUS_07290 1363 2364 gene locus_tag LOCUS_07300 1363 2364 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703918.1 protein_id gnl|my_center|LOCUS_07300 2383 3015 gene locus_tag LOCUS_07310 2383 3015 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475755.1 protein_id gnl|my_center|LOCUS_07310 3596 3177 gene locus_tag LOCUS_07320 3596 3177 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_07320 4609 3599 gene locus_tag LOCUS_07330 4609 3599 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674791.1 protein_id gnl|my_center|LOCUS_07330 5789 4611 gene locus_tag LOCUS_07340 5789 4611 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286869.1 protein_id gnl|my_center|LOCUS_07340 6952 5792 gene locus_tag LOCUS_07350 6952 5792 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263589.1 protein_id gnl|my_center|LOCUS_07350 8261 6960 gene locus_tag LOCUS_07360 8261 6960 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390138.1 protein_id gnl|my_center|LOCUS_07360 9511 8357 gene locus_tag LOCUS_07370 9511 8357 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182586238.1 protein_id gnl|my_center|LOCUS_07370 11734 10964 gene locus_tag LOCUS_07380 11734 10964 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701519.1 protein_id gnl|my_center|LOCUS_07380 12386 11751 gene locus_tag LOCUS_07390 12386 11751 CDS product YutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475753.1 protein_id gnl|my_center|LOCUS_07390 13793 12414 gene locus_tag LOCUS_07400 13793 12414 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386634.1 protein_id gnl|my_center|LOCUS_07400 15125 13938 gene locus_tag LOCUS_07410 15125 13938 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476174.1 protein_id gnl|my_center|LOCUS_07410 16171 15164 gene locus_tag LOCUS_07420 16171 15164 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101695.1 protein_id gnl|my_center|LOCUS_07420 16539 16246 gene locus_tag LOCUS_07430 16539 16246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 16985 16545 gene locus_tag LOCUS_07440 16985 16545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 17211 16972 gene locus_tag LOCUS_07450 17211 16972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 17650 17219 gene locus_tag LOCUS_07460 17650 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 17981 17634 gene locus_tag LOCUS_07470 17981 17634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 18613 18023 gene locus_tag LOCUS_07480 18613 18023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 19025 18630 gene locus_tag LOCUS_07490 19025 18630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 20226 19171 gene locus_tag LOCUS_07500 20226 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 20616 20236 gene locus_tag LOCUS_07510 20616 20236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 21118 20633 gene locus_tag LOCUS_07520 21118 20633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 21458 21132 gene locus_tag LOCUS_07530 21458 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 24200 21519 gene locus_tag LOCUS_07540 24200 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 25346 24201 gene locus_tag LOCUS_07550 25346 24201 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101290.1 protein_id gnl|my_center|LOCUS_07550 26188 25358 gene locus_tag LOCUS_07560 26188 25358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 28087 26201 gene locus_tag LOCUS_07570 28087 26201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 28800 28084 gene locus_tag LOCUS_07580 28800 28084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 33102 28801 gene locus_tag LOCUS_07590 33102 28801 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475661.1 protein_id gnl|my_center|LOCUS_07590 33710 33312 gene locus_tag LOCUS_07600 33710 33312 CDS product phage tail tube assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475658.1 protein_id gnl|my_center|LOCUS_07600 34427 33777 gene locus_tag LOCUS_07610 34427 33777 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475657.1 protein_id gnl|my_center|LOCUS_07610 34808 34428 gene locus_tag LOCUS_07620 34808 34428 CDS product DUF806 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475656.1 protein_id gnl|my_center|LOCUS_07620 35206 34808 gene locus_tag LOCUS_07630 35206 34808 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475655.1 protein_id gnl|my_center|LOCUS_07630 35558 35211 gene locus_tag LOCUS_07640 35558 35211 CDS product phage head closure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475654.1 protein_id gnl|my_center|LOCUS_07640 35874 35548 gene locus_tag LOCUS_07650 35874 35548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 37215 35989 gene locus_tag LOCUS_07660 37215 35989 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475652.1 protein_id gnl|my_center|LOCUS_07660 37942 37232 gene locus_tag LOCUS_07670 37942 37232 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080656303.1 protein_id gnl|my_center|LOCUS_07670 39101 37902 gene locus_tag LOCUS_07680 39101 37902 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475650.1 protein_id gnl|my_center|LOCUS_07680 39298 39104 gene locus_tag LOCUS_07690 39298 39104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 40319 39288 gene locus_tag LOCUS_07700 40319 39288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07700 41161 40487 gene locus_tag LOCUS_07710 41161 40487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07710 41661 41191 gene locus_tag LOCUS_07720 41661 41191 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905938.1 protein_id gnl|my_center|LOCUS_07720 42150 41842 gene locus_tag LOCUS_07730 42150 41842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 42631 42158 gene locus_tag LOCUS_07740 42631 42158 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475646.1 protein_id gnl|my_center|LOCUS_07740 42809 42666 gene locus_tag LOCUS_07750 42809 42666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 43504 42944 gene locus_tag LOCUS_07760 43504 42944 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006993.1 protein_id gnl|my_center|LOCUS_07760 44741 43497 gene locus_tag LOCUS_07770 44741 43497 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674656.1 protein_id gnl|my_center|LOCUS_07770 45407 44970 gene locus_tag LOCUS_07780 45407 44970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 45892 45404 gene locus_tag LOCUS_07790 45892 45404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 46343 45894 gene locus_tag LOCUS_07800 46343 45894 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706850.1 protein_id gnl|my_center|LOCUS_07800 46533 46306 gene locus_tag LOCUS_07810 46533 46306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 46685 46530 gene locus_tag LOCUS_07820 46685 46530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 46858 46682 gene locus_tag LOCUS_07830 46858 46682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 47247 46855 gene locus_tag LOCUS_07840 47247 46855 CDS product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101104.1 protein_id gnl|my_center|LOCUS_07840 47423 47247 gene locus_tag LOCUS_07850 47423 47247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 47538 47407 gene locus_tag LOCUS_07860 47538 47407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 48350 47541 gene locus_tag LOCUS_07870 48350 47541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574014.1 protein_id gnl|my_center|LOCUS_07870 49112 48354 gene locus_tag LOCUS_07880 49112 48354 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132051.1 protein_id gnl|my_center|LOCUS_07880 49950 49123 gene locus_tag LOCUS_07890 49950 49123 CDS product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025480718.1 protein_id gnl|my_center|LOCUS_07890 50719 49895 gene locus_tag LOCUS_07900 50719 49895 CDS product recombinase RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229907.1 protein_id gnl|my_center|LOCUS_07900 50964 50719 gene locus_tag LOCUS_07910 50964 50719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 51312 50965 gene locus_tag LOCUS_07920 51312 50965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 51929 51324 gene locus_tag LOCUS_07930 51929 51324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 52132 52007 gene locus_tag LOCUS_07940 52132 52007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 52514 52392 gene locus_tag LOCUS_07950 52514 52392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 52833 52528 gene locus_tag LOCUS_07960 52833 52528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 53615 52836 gene locus_tag LOCUS_07970 53615 52836 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence011 842 1012 gene locus_tag LOCUS_07980 842 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1639 1082 gene locus_tag LOCUS_07990 1639 1082 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121269.1 protein_id gnl|my_center|LOCUS_07990 2477 1770 gene locus_tag LOCUS_08000 2477 1770 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385631.1 protein_id gnl|my_center|LOCUS_08000 3297 2767 gene locus_tag LOCUS_08010 3297 2767 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547298.1 protein_id gnl|my_center|LOCUS_08010 3625 3446 gene locus_tag LOCUS_08020 3625 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3882 4373 gene locus_tag LOCUS_08030 3882 4373 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470989.1 protein_id gnl|my_center|LOCUS_08030 5191 4913 gene locus_tag LOCUS_08040 5191 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 5545 6015 gene locus_tag LOCUS_08050 5545 6015 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_08050 6471 7409 gene locus_tag LOCUS_08060 6471 7409 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948261.1 protein_id gnl|my_center|LOCUS_08060 8133 7753 gene locus_tag LOCUS_08070 8133 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 8651 8361 gene locus_tag LOCUS_08080 8651 8361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 9192 9031 gene locus_tag LOCUS_08090 9192 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 9533 9189 gene locus_tag LOCUS_08100 9533 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584159.1 protein_id gnl|my_center|LOCUS_08100 10806 9511 gene locus_tag LOCUS_08110 10806 9511 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065904166.1 protein_id gnl|my_center|LOCUS_08110 12144 11212 gene locus_tag LOCUS_08120 12144 11212 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700854.1 protein_id gnl|my_center|LOCUS_08120 12396 12920 gene locus_tag LOCUS_08130 12396 12920 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613286.1 protein_id gnl|my_center|LOCUS_08130 12938 13606 gene locus_tag LOCUS_08140 12938 13606 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036317.1 protein_id gnl|my_center|LOCUS_08140 13730 13927 gene locus_tag LOCUS_08150 13730 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 14148 15119 gene locus_tag LOCUS_08160 gene ilvA 14148 15119 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_08160 15217 16389 gene locus_tag LOCUS_08170 15217 16389 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355262.1 protein_id gnl|my_center|LOCUS_08170 17469 16567 gene locus_tag LOCUS_08180 17469 16567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 17700 18329 gene locus_tag LOCUS_08190 17700 18329 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703661.1 protein_id gnl|my_center|LOCUS_08190 18364 19506 gene locus_tag LOCUS_08200 18364 19506 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674376.1 protein_id gnl|my_center|LOCUS_08200 19563 20084 gene locus_tag LOCUS_08210 19563 20084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 20255 20722 gene locus_tag LOCUS_08220 20255 20722 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964044.1 protein_id gnl|my_center|LOCUS_08220 20977 21300 gene locus_tag LOCUS_08230 20977 21300 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705442.1 protein_id gnl|my_center|LOCUS_08230 21322 22398 gene locus_tag LOCUS_08240 21322 22398 CDS product M42 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546357.1 protein_id gnl|my_center|LOCUS_08240 22707 23516 gene locus_tag LOCUS_08250 gene thiD 22707 23516 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289472.1 protein_id gnl|my_center|LOCUS_08250 24481 23618 gene locus_tag LOCUS_08260 24481 23618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 24586 25575 gene locus_tag LOCUS_08270 gene galE 24586 25575 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002293897.1 protein_id gnl|my_center|LOCUS_08270 25627 26370 gene locus_tag LOCUS_08280 25627 26370 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674428.1 protein_id gnl|my_center|LOCUS_08280 26469 26891 gene locus_tag LOCUS_08290 gene ndk 26469 26891 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699392.1 protein_id gnl|my_center|LOCUS_08290 27194 28282 gene locus_tag LOCUS_08300 27194 28282 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101277.1 protein_id gnl|my_center|LOCUS_08300 28538 28783 gene locus_tag LOCUS_08310 28538 28783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 29703 30287 gene locus_tag LOCUS_08320 29703 30287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 31250 30411 gene locus_tag LOCUS_08330 gene dat 31250 30411 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931211.1 protein_id gnl|my_center|LOCUS_08330 31516 31755 gene locus_tag LOCUS_08340 31516 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475499.1 protein_id gnl|my_center|LOCUS_08340 32109 34070 gene locus_tag LOCUS_08350 32109 34070 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748873.1 protein_id gnl|my_center|LOCUS_08350 34245 35741 gene locus_tag LOCUS_08360 34245 35741 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902452.1 protein_id gnl|my_center|LOCUS_08360 35797 36729 gene locus_tag LOCUS_08370 35797 36729 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893621.1 protein_id gnl|my_center|LOCUS_08370 36759 37811 gene locus_tag LOCUS_08380 36759 37811 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902455.1 protein_id gnl|my_center|LOCUS_08380 37833 38771 gene locus_tag LOCUS_08390 37833 38771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986000.1 protein_id gnl|my_center|LOCUS_08390 38956 39693 gene locus_tag LOCUS_08400 38956 39693 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262716.1 protein_id gnl|my_center|LOCUS_08400 39805 41214 gene locus_tag LOCUS_08410 39805 41214 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641197.1 protein_id gnl|my_center|LOCUS_08410 41316 41816 gene locus_tag LOCUS_08420 41316 41816 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002329068.1 protein_id gnl|my_center|LOCUS_08420 41892 42716 gene locus_tag LOCUS_08430 gene msrA 41892 42716 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287588.1 protein_id gnl|my_center|LOCUS_08430 42742 43143 gene locus_tag LOCUS_08440 42742 43143 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565456.1 protein_id gnl|my_center|LOCUS_08440 43169 43630 gene locus_tag LOCUS_08450 43169 43630 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674531.1 protein_id gnl|my_center|LOCUS_08450 46047 43678 gene locus_tag LOCUS_08460 46047 43678 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476383.1 protein_id gnl|my_center|LOCUS_08460 46253 46480 gene locus_tag LOCUS_08470 46253 46480 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301182.1 protein_id gnl|my_center|LOCUS_08470 46464 46877 gene locus_tag LOCUS_08480 46464 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 46925 47443 gene locus_tag LOCUS_08490 46925 47443 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675026.1 protein_id gnl|my_center|LOCUS_08490 47617 48486 gene locus_tag LOCUS_08500 47617 48486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241762.1 protein_id gnl|my_center|LOCUS_08500 48488 49351 gene locus_tag LOCUS_08510 48488 49351 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007122532.1 protein_id gnl|my_center|LOCUS_08510 49358 49810 gene locus_tag LOCUS_08520 49358 49810 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241763.1 protein_id gnl|my_center|LOCUS_08520 49829 50236 gene locus_tag LOCUS_08530 49829 50236 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241764.1 protein_id gnl|my_center|LOCUS_08530 50330 50986 gene locus_tag LOCUS_08540 50330 50986 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294730.1 protein_id gnl|my_center|LOCUS_08540 52347 51172 gene locus_tag LOCUS_08550 52347 51172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476397.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence012 211 1365 gene locus_tag LOCUS_08560 211 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2371 1445 gene locus_tag LOCUS_08570 2371 1445 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101570.1 protein_id gnl|my_center|LOCUS_08570 2493 3656 gene locus_tag LOCUS_08580 2493 3656 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263061.1 protein_id gnl|my_center|LOCUS_08580 3787 4311 gene locus_tag LOCUS_08590 3787 4311 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289037.1 protein_id gnl|my_center|LOCUS_08590 5287 4505 gene locus_tag LOCUS_08600 5287 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642372.1 protein_id gnl|my_center|LOCUS_08600 5589 5894 gene locus_tag LOCUS_08610 5589 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 5938 6588 gene locus_tag LOCUS_08620 5938 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08620 6585 6902 gene locus_tag LOCUS_08630 6585 6902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08630 8190 7033 gene locus_tag LOCUS_08640 8190 7033 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642293.1 protein_id gnl|my_center|LOCUS_08640 8425 8306 gene locus_tag LOCUS_08650 8425 8306 CDS product putative metal homeostasis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818733.1 protein_id gnl|my_center|LOCUS_08650 8589 8437 gene locus_tag LOCUS_08660 gene rpmG 8589 8437 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358586.1 protein_id gnl|my_center|LOCUS_08660 10462 8831 gene locus_tag LOCUS_08670 10462 8831 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703014.1 protein_id gnl|my_center|LOCUS_08670 11162 11572 gene locus_tag LOCUS_08680 11162 11572 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723377.1 protein_id gnl|my_center|LOCUS_08680 11965 13335 gene locus_tag LOCUS_08690 11965 13335 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 protein_id gnl|my_center|LOCUS_08690 13364 14695 gene locus_tag LOCUS_08700 13364 14695 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674117.1 protein_id gnl|my_center|LOCUS_08700 14722 15411 gene locus_tag LOCUS_08710 14722 15411 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974505.1 protein_id gnl|my_center|LOCUS_08710 15603 16043 gene locus_tag LOCUS_08720 15603 16043 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643512.1 protein_id gnl|my_center|LOCUS_08720 16076 18256 gene locus_tag LOCUS_08730 16076 18256 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674593.1 protein_id gnl|my_center|LOCUS_08730 18256 20502 gene locus_tag LOCUS_08740 18256 20502 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714164.1 protein_id gnl|my_center|LOCUS_08740 20541 20738 gene locus_tag LOCUS_08750 20541 20738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 21310 22635 gene locus_tag LOCUS_08760 21310 22635 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674934.1 protein_id gnl|my_center|LOCUS_08760 22648 24267 gene locus_tag LOCUS_08770 22648 24267 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 protein_id gnl|my_center|LOCUS_08770 25774 24614 gene locus_tag LOCUS_08780 25774 24614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 25847 27217 gene locus_tag LOCUS_08790 gene gabT 25847 27217 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093019.1 protein_id gnl|my_center|LOCUS_08790 27236 27970 gene locus_tag LOCUS_08800 27236 27970 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_08800 27987 28685 gene locus_tag LOCUS_08810 27987 28685 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084339.1 protein_id gnl|my_center|LOCUS_08810 28702 29574 gene locus_tag LOCUS_08820 28702 29574 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963702.1 protein_id gnl|my_center|LOCUS_08820 30291 29776 gene locus_tag LOCUS_08830 30291 29776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 30788 30432 gene locus_tag LOCUS_08840 30788 30432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 31074 32081 gene locus_tag LOCUS_08850 31074 32081 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703057.1 protein_id gnl|my_center|LOCUS_08850 32172 33443 gene locus_tag LOCUS_08860 32172 33443 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476253.1 protein_id gnl|my_center|LOCUS_08860 33749 33823 gene locus_tag LOCUS_t00060 33749 33823 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34051 35190 gene locus_tag LOCUS_08870 gene wecB 34051 35190 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824465.1 protein_id gnl|my_center|LOCUS_08870 35221 35613 gene locus_tag LOCUS_08880 35221 35613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 35688 36824 gene locus_tag LOCUS_08890 35688 36824 CDS product ArgE/DapE family deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475542.1 protein_id gnl|my_center|LOCUS_08890 36929 37579 gene locus_tag LOCUS_08900 36929 37579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 37825 38343 gene locus_tag LOCUS_08910 37825 38343 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583259.1 protein_id gnl|my_center|LOCUS_08910 38347 39411 gene locus_tag LOCUS_08920 38347 39411 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476312.1 protein_id gnl|my_center|LOCUS_08920 39415 40086 gene locus_tag LOCUS_08930 39415 40086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476313.1 protein_id gnl|my_center|LOCUS_08930 40926 40228 gene locus_tag LOCUS_08940 40926 40228 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641877.1 protein_id gnl|my_center|LOCUS_08940 42233 41325 gene locus_tag LOCUS_08950 42233 41325 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475999.1 protein_id gnl|my_center|LOCUS_08950 42377 43558 gene locus_tag LOCUS_08960 42377 43558 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641803.1 protein_id gnl|my_center|LOCUS_08960 43823 44944 gene locus_tag LOCUS_08970 43823 44944 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476309.1 protein_id gnl|my_center|LOCUS_08970 44941 48060 gene locus_tag LOCUS_08980 44941 48060 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476308.1 protein_id gnl|my_center|LOCUS_08980 48134 48598 gene locus_tag LOCUS_08990 48134 48598 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701366.1 protein_id gnl|my_center|LOCUS_08990 48873 50123 gene locus_tag LOCUS_09000 gene tyrS 48873 50123 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701368.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence013 377 96 gene locus_tag LOCUS_09010 377 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09010 1560 382 gene locus_tag LOCUS_09020 1560 382 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102204.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09020 2997 1561 gene locus_tag LOCUS_09030 2997 1561 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732174.1 protein_id gnl|my_center|LOCUS_09030 4973 3018 gene locus_tag LOCUS_09040 4973 3018 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645674.1 protein_id gnl|my_center|LOCUS_09040 5948 5100 gene locus_tag LOCUS_09050 5948 5100 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645673.1 protein_id gnl|my_center|LOCUS_09050 6912 6109 gene locus_tag LOCUS_09060 gene trpA 6912 6109 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673965.1 protein_id gnl|my_center|LOCUS_09060 8110 6905 gene locus_tag LOCUS_09070 gene trpB 8110 6905 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562635.1 protein_id gnl|my_center|LOCUS_09070 8681 8088 gene locus_tag LOCUS_09080 8681 8088 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169895.1 protein_id gnl|my_center|LOCUS_09080 9467 8685 gene locus_tag LOCUS_09090 gene trpC 9467 8685 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592589.1 protein_id gnl|my_center|LOCUS_09090 10489 9464 gene locus_tag LOCUS_09100 gene trpD 10489 9464 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673966.1 protein_id gnl|my_center|LOCUS_09100 11483 10911 gene locus_tag LOCUS_09110 11483 10911 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640393.1 protein_id gnl|my_center|LOCUS_09110 12948 11467 gene locus_tag LOCUS_09120 12948 11467 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101488.1 protein_id gnl|my_center|LOCUS_09120 14640 13306 gene locus_tag LOCUS_09130 14640 13306 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158904.1 protein_id gnl|my_center|LOCUS_09130 15510 14659 gene locus_tag LOCUS_09140 15510 14659 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640478.1 protein_id gnl|my_center|LOCUS_09140 16580 15639 gene locus_tag LOCUS_09150 gene mmuM 16580 15639 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081352.1 protein_id gnl|my_center|LOCUS_09150 17973 16582 gene locus_tag LOCUS_09160 17973 16582 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101342.1 protein_id gnl|my_center|LOCUS_09160 20345 19068 gene locus_tag LOCUS_09170 gene icd 20345 19068 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 protein_id gnl|my_center|LOCUS_09170 21445 20363 gene locus_tag LOCUS_09180 gene citZ 21445 20363 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723251.1 protein_id gnl|my_center|LOCUS_09180 24082 21473 gene locus_tag LOCUS_09190 gene acnA 24082 21473 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238573.1 protein_id gnl|my_center|LOCUS_09190 25072 24410 gene locus_tag LOCUS_09200 gene fepC 25072 24410 CDS product iron-enterobactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097639.1 protein_id gnl|my_center|LOCUS_09200 25979 25062 gene locus_tag LOCUS_09210 25979 25062 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832732.1 protein_id gnl|my_center|LOCUS_09210 26775 25969 gene locus_tag LOCUS_09220 gene isdE 26775 25969 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989920.1 protein_id gnl|my_center|LOCUS_09220 27700 26837 gene locus_tag LOCUS_09230 27700 26837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 29082 27697 gene locus_tag LOCUS_09240 29082 27697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 29369 29992 gene locus_tag LOCUS_09250 29369 29992 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569939.1 protein_id gnl|my_center|LOCUS_09250 30016 31743 gene locus_tag LOCUS_09260 30016 31743 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475588.1 protein_id gnl|my_center|LOCUS_09260 31743 33587 gene locus_tag LOCUS_09270 31743 33587 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641422.1 protein_id gnl|my_center|LOCUS_09270 34042 33713 gene locus_tag LOCUS_09280 34042 33713 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476484.1 protein_id gnl|my_center|LOCUS_09280 34736 34029 gene locus_tag LOCUS_09290 34736 34029 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287482.1 protein_id gnl|my_center|LOCUS_09290 36044 34764 gene locus_tag LOCUS_09300 36044 34764 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101818.1 protein_id gnl|my_center|LOCUS_09300 37270 36140 gene locus_tag LOCUS_09310 37270 36140 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547400.1 protein_id gnl|my_center|LOCUS_09310 39166 37670 gene locus_tag LOCUS_09320 gene yjeM 39166 37670 CDS product glutamate/gamma-aminobutyrate family transporter YjeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476411.1 protein_id gnl|my_center|LOCUS_09320 39590 40966 gene locus_tag LOCUS_09330 39590 40966 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476526.1 protein_id gnl|my_center|LOCUS_09330 41769 41053 gene locus_tag LOCUS_09340 41769 41053 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702269.1 protein_id gnl|my_center|LOCUS_09340 42164 42772 gene locus_tag LOCUS_09350 42164 42772 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188367817.1 protein_id gnl|my_center|LOCUS_09350 44031 42784 gene locus_tag LOCUS_09360 44031 42784 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922165.1 protein_id gnl|my_center|LOCUS_09360 44714 44028 gene locus_tag LOCUS_09370 44714 44028 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548121.1 protein_id gnl|my_center|LOCUS_09370 45337 44726 gene locus_tag LOCUS_09380 45337 44726 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837368.1 protein_id gnl|my_center|LOCUS_09380 46418 45525 gene locus_tag LOCUS_09390 46418 45525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 47187 46462 gene locus_tag LOCUS_09400 47187 46462 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254611.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence014 382 197 gene locus_tag LOCUS_09410 gene rpmB 382 197 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694225.1 protein_id gnl|my_center|LOCUS_09410 616 978 gene locus_tag LOCUS_09420 616 978 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701710.1 protein_id gnl|my_center|LOCUS_09420 1014 2705 gene locus_tag LOCUS_09430 1014 2705 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475843.1 protein_id gnl|my_center|LOCUS_09430 2928 4967 gene locus_tag LOCUS_09440 gene recG 2928 4967 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824485.1 protein_id gnl|my_center|LOCUS_09440 4983 6005 gene locus_tag LOCUS_09450 gene plsX 4983 6005 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475845.1 protein_id gnl|my_center|LOCUS_09450 6009 6251 gene locus_tag LOCUS_09460 gene acpP 6009 6251 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699980.1 protein_id gnl|my_center|LOCUS_09460 6408 7097 gene locus_tag LOCUS_09470 gene rnc 6408 7097 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701755.1 protein_id gnl|my_center|LOCUS_09470 7137 10703 gene locus_tag LOCUS_09480 gene smc 7137 10703 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475846.1 protein_id gnl|my_center|LOCUS_09480 10706 11716 gene locus_tag LOCUS_09490 gene ftsY 10706 11716 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475847.1 protein_id gnl|my_center|LOCUS_09490 11741 12079 gene locus_tag LOCUS_09500 11741 12079 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699985.1 protein_id gnl|my_center|LOCUS_09500 12095 13528 gene locus_tag LOCUS_09510 gene ffh 12095 13528 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824486.1 protein_id gnl|my_center|LOCUS_09510 13622 13894 gene locus_tag LOCUS_09520 gene rpsP 13622 13894 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699989.1 protein_id gnl|my_center|LOCUS_09520 14080 14589 gene locus_tag LOCUS_09530 gene rimM 14080 14589 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 protein_id gnl|my_center|LOCUS_09530 14589 15326 gene locus_tag LOCUS_09540 gene trmD 14589 15326 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699993.1 protein_id gnl|my_center|LOCUS_09540 15435 15782 gene locus_tag LOCUS_09550 gene rplS 15435 15782 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701743.1 protein_id gnl|my_center|LOCUS_09550 16424 16032 gene locus_tag LOCUS_09560 16424 16032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 16762 16442 gene locus_tag LOCUS_09570 16762 16442 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385633.1 protein_id gnl|my_center|LOCUS_09570 16981 17190 gene locus_tag LOCUS_09580 16981 17190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 17831 19030 gene locus_tag LOCUS_09590 gene dapG 17831 19030 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700460.1 protein_id gnl|my_center|LOCUS_09590 19160 19390 gene locus_tag LOCUS_09600 19160 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 19626 20057 gene locus_tag LOCUS_09610 gene mraZ 19626 20057 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700457.1 protein_id gnl|my_center|LOCUS_09610 20073 21023 gene locus_tag LOCUS_09620 gene rsmH 20073 21023 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476142.1 protein_id gnl|my_center|LOCUS_09620 21044 21415 gene locus_tag LOCUS_09630 gene ftsL 21044 21415 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700455.1 protein_id gnl|my_center|LOCUS_09630 21412 23559 gene locus_tag LOCUS_09640 21412 23559 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476141.1 protein_id gnl|my_center|LOCUS_09640 23587 25074 gene locus_tag LOCUS_09650 23587 25074 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101237.1 protein_id gnl|my_center|LOCUS_09650 25075 26037 gene locus_tag LOCUS_09660 gene mraY 25075 26037 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025021648.1 protein_id gnl|my_center|LOCUS_09660 26065 27432 gene locus_tag LOCUS_09670 gene murD 26065 27432 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476140.1 protein_id gnl|my_center|LOCUS_09670 27437 28528 gene locus_tag LOCUS_09680 gene murG 27437 28528 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476139.1 protein_id gnl|my_center|LOCUS_09680 28551 29399 gene locus_tag LOCUS_09690 28551 29399 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476138.1 protein_id gnl|my_center|LOCUS_09690 29538 30857 gene locus_tag LOCUS_09700 gene ftsA 29538 30857 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034990383.1 protein_id gnl|my_center|LOCUS_09700 30879 32126 gene locus_tag LOCUS_09710 gene ftsZ 30879 32126 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476137.1 protein_id gnl|my_center|LOCUS_09710 32163 32585 gene locus_tag LOCUS_09720 gene sepF 32163 32585 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640853.1 protein_id gnl|my_center|LOCUS_09720 32607 32885 gene locus_tag LOCUS_09730 32607 32885 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644609.1 protein_id gnl|my_center|LOCUS_09730 32895 33680 gene locus_tag LOCUS_09740 32895 33680 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640851.1 protein_id gnl|my_center|LOCUS_09740 33705 34418 gene locus_tag LOCUS_09750 33705 34418 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476134.1 protein_id gnl|my_center|LOCUS_09750 34687 37485 gene locus_tag LOCUS_09760 gene ileS 34687 37485 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476133.1 protein_id gnl|my_center|LOCUS_09760 37763 38740 gene locus_tag LOCUS_09770 gene dapF 37763 38740 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704372.1 protein_id gnl|my_center|LOCUS_09770 38742 39293 gene locus_tag LOCUS_09780 38742 39293 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704380.1 protein_id gnl|my_center|LOCUS_09780 39295 39564 gene locus_tag LOCUS_09790 39295 39564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 39587 40273 gene locus_tag LOCUS_09800 39587 40273 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476002.1 protein_id gnl|my_center|LOCUS_09800 40285 41442 gene locus_tag LOCUS_09810 40285 41442 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476003.1 protein_id gnl|my_center|LOCUS_09810 41442 41783 gene locus_tag LOCUS_09820 41442 41783 CDS product DUF1831 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700201.1 protein_id gnl|my_center|LOCUS_09820 41897 43024 gene locus_tag LOCUS_09830 gene mnmA 41897 43024 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476004.1 protein_id gnl|my_center|LOCUS_09830 43248 43901 gene locus_tag LOCUS_09840 43248 43901 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475891.1 protein_id gnl|my_center|LOCUS_09840 43919 44584 gene locus_tag LOCUS_09850 43919 44584 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475892.1 protein_id gnl|my_center|LOCUS_09850 44603 47026 gene locus_tag LOCUS_09860 44603 47026 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101675.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence015 41 292 gene locus_tag LOCUS_09870 41 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 270 1904 gene locus_tag LOCUS_09880 270 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1910 3154 gene locus_tag LOCUS_09890 1910 3154 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702271.1 protein_id gnl|my_center|LOCUS_09890 3156 5243 gene locus_tag LOCUS_09900 3156 5243 CDS product cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476116.1 protein_id gnl|my_center|LOCUS_09900 5230 6081 gene locus_tag LOCUS_09910 5230 6081 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476115.1 protein_id gnl|my_center|LOCUS_09910 6381 8210 gene locus_tag LOCUS_09920 6381 8210 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700646.1 protein_id gnl|my_center|LOCUS_09920 8334 9437 gene locus_tag LOCUS_09930 8334 9437 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700645.1 protein_id gnl|my_center|LOCUS_09930 10180 9500 gene locus_tag LOCUS_09940 10180 9500 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357285.1 protein_id gnl|my_center|LOCUS_09940 10180 11535 gene locus_tag LOCUS_09950 10180 11535 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476220.1 protein_id gnl|my_center|LOCUS_09950 11669 12199 gene locus_tag LOCUS_09960 11669 12199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 12316 12858 gene locus_tag LOCUS_09970 gene raiA 12316 12858 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476202.1 protein_id gnl|my_center|LOCUS_09970 13033 15396 gene locus_tag LOCUS_09980 gene secA 13033 15396 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700639.1 protein_id gnl|my_center|LOCUS_09980 15530 16606 gene locus_tag LOCUS_09990 gene prfB 15530 16606 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191976281.1 protein_id gnl|my_center|LOCUS_09990 16704 17393 gene locus_tag LOCUS_10000 gene ftsE 16704 17393 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_10000 17383 18270 gene locus_tag LOCUS_10010 gene ftsX 17383 18270 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564193.1 protein_id gnl|my_center|LOCUS_10010 18643 19791 gene locus_tag LOCUS_10020 18643 19791 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476200.1 protein_id gnl|my_center|LOCUS_10020 19810 20541 gene locus_tag LOCUS_10030 19810 20541 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700635.1 protein_id gnl|my_center|LOCUS_10030 20510 21946 gene locus_tag LOCUS_10040 20510 21946 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476199.1 protein_id gnl|my_center|LOCUS_10040 22131 22802 gene locus_tag LOCUS_10050 gene phoU 22131 22802 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569545.1 protein_id gnl|my_center|LOCUS_10050 22917 23222 gene locus_tag LOCUS_10060 22917 23222 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476198.1 protein_id gnl|my_center|LOCUS_10060 23248 23592 gene locus_tag LOCUS_10070 23248 23592 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700632.1 protein_id gnl|my_center|LOCUS_10070 23641 24576 gene locus_tag LOCUS_10080 gene hprK 23641 24576 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700631.1 protein_id gnl|my_center|LOCUS_10080 24600 25433 gene locus_tag LOCUS_10090 gene lgt 24600 25433 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700630.1 protein_id gnl|my_center|LOCUS_10090 25445 26467 gene locus_tag LOCUS_10100 25445 26467 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646081.1 protein_id gnl|my_center|LOCUS_10100 26531 27460 gene locus_tag LOCUS_10110 gene trxB 26531 27460 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476540.1 protein_id gnl|my_center|LOCUS_10110 27668 29395 gene locus_tag LOCUS_10120 27668 29395 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700629.1 protein_id gnl|my_center|LOCUS_10120 29484 29999 gene locus_tag LOCUS_10130 29484 29999 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294232.1 protein_id gnl|my_center|LOCUS_10130 30223 31665 gene locus_tag LOCUS_10140 30223 31665 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_10140 31772 33778 gene locus_tag LOCUS_10150 gene uvrB 31772 33778 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641029.1 protein_id gnl|my_center|LOCUS_10150 33795 36629 gene locus_tag LOCUS_10160 gene uvrA 33795 36629 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476196.1 protein_id gnl|my_center|LOCUS_10160 36697 37167 gene locus_tag LOCUS_10170 36697 37167 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700626.1 protein_id gnl|my_center|LOCUS_10170 37334 38218 gene locus_tag LOCUS_10180 gene rapZ 37334 38218 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920236.1 protein_id gnl|my_center|LOCUS_10180 38215 39234 gene locus_tag LOCUS_10190 38215 39234 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710476.1 protein_id gnl|my_center|LOCUS_10190 39258 40202 gene locus_tag LOCUS_10200 gene whiA 39258 40202 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700622.1 protein_id gnl|my_center|LOCUS_10200 40949 40356 gene locus_tag LOCUS_10210 gene clpP 40949 40356 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700621.1 protein_id gnl|my_center|LOCUS_10210 42612 41482 gene locus_tag LOCUS_10220 42612 41482 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475894.1 protein_id gnl|my_center|LOCUS_10220 43684 42734 gene locus_tag LOCUS_10230 43684 42734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 44560 43883 gene locus_tag LOCUS_10240 44560 43883 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110319.1 protein_id gnl|my_center|LOCUS_10240 44754 44972 gene locus_tag LOCUS_10250 44754 44972 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702380.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence016 731 883 gene locus_tag LOCUS_10260 731 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1511 1104 gene locus_tag LOCUS_10270 1511 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2525 2052 gene locus_tag LOCUS_10280 2525 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3807 2998 gene locus_tag LOCUS_10290 gene pnuC 3807 2998 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640894.1 protein_id gnl|my_center|LOCUS_10290 4006 4272 gene locus_tag LOCUS_10300 4006 4272 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680497.1 protein_id gnl|my_center|LOCUS_10300 5136 4708 gene locus_tag LOCUS_10310 5136 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5874 5293 gene locus_tag LOCUS_10320 5874 5293 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139327955.1 protein_id gnl|my_center|LOCUS_10320 6576 5899 gene locus_tag LOCUS_10330 6576 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 7079 6633 gene locus_tag LOCUS_10340 7079 6633 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837587.1 protein_id gnl|my_center|LOCUS_10340 7199 8083 gene locus_tag LOCUS_10350 7199 8083 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966910.1 protein_id gnl|my_center|LOCUS_10350 9333 8191 gene locus_tag LOCUS_10360 9333 8191 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053275.1 protein_id gnl|my_center|LOCUS_10360 10468 9347 gene locus_tag LOCUS_10370 10468 9347 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101860.1 protein_id gnl|my_center|LOCUS_10370 11282 10470 gene locus_tag LOCUS_10380 gene metA 11282 10470 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254910.1 protein_id gnl|my_center|LOCUS_10380 12060 12506 gene locus_tag LOCUS_10390 gene lspA 12060 12506 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640508.1 protein_id gnl|my_center|LOCUS_10390 12499 13404 gene locus_tag LOCUS_10400 12499 13404 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475978.1 protein_id gnl|my_center|LOCUS_10400 13562 14098 gene locus_tag LOCUS_10410 gene pyrR 13562 14098 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704375.1 protein_id gnl|my_center|LOCUS_10410 14247 15533 gene locus_tag LOCUS_10420 14247 15533 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700158.1 protein_id gnl|my_center|LOCUS_10420 15544 16491 gene locus_tag LOCUS_10430 15544 16491 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701970.1 protein_id gnl|my_center|LOCUS_10430 16495 17778 gene locus_tag LOCUS_10440 16495 17778 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475572.1 protein_id gnl|my_center|LOCUS_10440 17781 18866 gene locus_tag LOCUS_10450 17781 18866 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475573.1 protein_id gnl|my_center|LOCUS_10450 18859 22047 gene locus_tag LOCUS_10460 gene carB 18859 22047 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475574.1 protein_id gnl|my_center|LOCUS_10460 22082 23014 gene locus_tag LOCUS_10470 22082 23014 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475575.1 protein_id gnl|my_center|LOCUS_10470 23014 23730 gene locus_tag LOCUS_10480 gene pyrF 23014 23730 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704381.1 protein_id gnl|my_center|LOCUS_10480 23730 24350 gene locus_tag LOCUS_10490 gene pyrE 23730 24350 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475979.1 protein_id gnl|my_center|LOCUS_10490 24610 25593 gene locus_tag LOCUS_10500 24610 25593 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963750.1 protein_id gnl|my_center|LOCUS_10500 25852 27276 gene locus_tag LOCUS_10510 25852 27276 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549892.1 protein_id gnl|my_center|LOCUS_10510 27316 28314 gene locus_tag LOCUS_10520 27316 28314 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 protein_id gnl|my_center|LOCUS_10520 28331 29200 gene locus_tag LOCUS_10530 gene rfbA 28331 29200 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_10530 29203 29784 gene locus_tag LOCUS_10540 gene rfbC 29203 29784 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644155.1 protein_id gnl|my_center|LOCUS_10540 29796 30824 gene locus_tag LOCUS_10550 gene rfbB 29796 30824 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292882.1 protein_id gnl|my_center|LOCUS_10550 30849 31685 gene locus_tag LOCUS_10560 gene rfbD 30849 31685 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286428.1 protein_id gnl|my_center|LOCUS_10560 31721 32617 gene locus_tag LOCUS_10570 31721 32617 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965609.1 protein_id gnl|my_center|LOCUS_10570 32729 33922 gene locus_tag LOCUS_10580 32729 33922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101557.1 protein_id gnl|my_center|LOCUS_10580 34263 35096 gene locus_tag LOCUS_10590 34263 35096 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922504.1 protein_id gnl|my_center|LOCUS_10590 35145 36113 gene locus_tag LOCUS_10600 35145 36113 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288613.1 protein_id gnl|my_center|LOCUS_10600 36131 36949 gene locus_tag LOCUS_10610 36131 36949 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002400076.1 protein_id gnl|my_center|LOCUS_10610 36975 37688 gene locus_tag LOCUS_10620 36975 37688 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_10620 37990 40248 gene locus_tag LOCUS_10630 gene pflB 37990 40248 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702975.1 protein_id gnl|my_center|LOCUS_10630 40368 41165 gene locus_tag LOCUS_10640 gene pflA 40368 41165 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476647.1 protein_id gnl|my_center|LOCUS_10640 41857 41273 gene locus_tag LOCUS_10650 41857 41273 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966111.1 protein_id gnl|my_center|LOCUS_10650 42323 42805 gene locus_tag LOCUS_10660 gene agaB 42323 42805 CDS product PTS galactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101867.1 protein_id gnl|my_center|LOCUS_10660 42806 43615 gene locus_tag LOCUS_10670 gene agaC 42806 43615 CDS product PTS galactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101866.1 protein_id gnl|my_center|LOCUS_10670 43605 44414 gene locus_tag LOCUS_10680 gene agaD 43605 44414 CDS product PTS galactosamine transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101865.1 protein_id gnl|my_center|LOCUS_10680 44417 44842 gene locus_tag LOCUS_10690 44417 44842 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101864.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence017 1081 122 gene locus_tag LOCUS_10700 1081 122 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_10700 1745 1158 gene locus_tag LOCUS_10710 1745 1158 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_10710 1915 2595 gene locus_tag LOCUS_10720 1915 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475562.1 protein_id gnl|my_center|LOCUS_10720 2833 3540 gene locus_tag LOCUS_10730 2833 3540 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641817.1 protein_id gnl|my_center|LOCUS_10730 4880 3912 gene locus_tag LOCUS_10740 4880 3912 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475686.1 protein_id gnl|my_center|LOCUS_10740 5039 6133 gene locus_tag LOCUS_10750 5039 6133 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824477.1 protein_id gnl|my_center|LOCUS_10750 6135 6902 gene locus_tag LOCUS_10760 6135 6902 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475688.1 protein_id gnl|my_center|LOCUS_10760 6981 7958 gene locus_tag LOCUS_10770 6981 7958 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643831.1 protein_id gnl|my_center|LOCUS_10770 7974 8339 gene locus_tag LOCUS_10780 7974 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 8504 8902 gene locus_tag LOCUS_10790 8504 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8917 9219 gene locus_tag LOCUS_10800 8917 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 10874 9552 gene locus_tag LOCUS_10810 10874 9552 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475699.1 protein_id gnl|my_center|LOCUS_10810 11067 11495 gene locus_tag LOCUS_10820 11067 11495 CDS product DUF1934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475700.1 protein_id gnl|my_center|LOCUS_10820 11539 12114 gene locus_tag LOCUS_10830 gene rpoE 11539 12114 CDS product DNA-directed RNA polymerase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475701.1 protein_id gnl|my_center|LOCUS_10830 12306 13901 gene locus_tag LOCUS_10840 12306 13901 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475702.1 protein_id gnl|my_center|LOCUS_10840 14259 15521 gene locus_tag LOCUS_10850 14259 15521 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699603.1 protein_id gnl|my_center|LOCUS_10850 15663 16841 gene locus_tag LOCUS_10860 gene rho 15663 16841 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290332.1 protein_id gnl|my_center|LOCUS_10860 16944 17201 gene locus_tag LOCUS_10870 16944 17201 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699599.1 protein_id gnl|my_center|LOCUS_10870 17442 18749 gene locus_tag LOCUS_10880 17442 18749 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294686.1 protein_id gnl|my_center|LOCUS_10880 19134 18964 gene locus_tag LOCUS_10890 19134 18964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 19303 19731 gene locus_tag LOCUS_10900 19303 19731 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355539.1 protein_id gnl|my_center|LOCUS_10900 19763 19924 gene locus_tag LOCUS_10910 19763 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 20309 20866 gene locus_tag LOCUS_10920 20309 20866 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704892.1 protein_id gnl|my_center|LOCUS_10920 20891 21775 gene locus_tag LOCUS_10930 gene htpX 20891 21775 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699683.1 protein_id gnl|my_center|LOCUS_10930 21807 22589 gene locus_tag LOCUS_10940 21807 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646517.1 protein_id gnl|my_center|LOCUS_10940 22847 24214 gene locus_tag LOCUS_10950 22847 24214 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475711.1 protein_id gnl|my_center|LOCUS_10950 24251 25759 gene locus_tag LOCUS_10960 24251 25759 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642058.1 protein_id gnl|my_center|LOCUS_10960 26101 26463 gene locus_tag LOCUS_10970 gene acpS 26101 26463 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704211.1 protein_id gnl|my_center|LOCUS_10970 26484 27605 gene locus_tag LOCUS_10980 gene alr 26484 27605 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475712.1 protein_id gnl|my_center|LOCUS_10980 27686 27955 gene locus_tag LOCUS_10990 27686 27955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 27952 28320 gene locus_tag LOCUS_11000 27952 28320 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699581.1 protein_id gnl|my_center|LOCUS_11000 29266 28631 gene locus_tag LOCUS_11010 gene cbpA 29266 28631 CDS product cyclic di-AMP binding protein CbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643849.1 protein_id gnl|my_center|LOCUS_11010 30494 29532 gene locus_tag LOCUS_11020 30494 29532 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703196.1 protein_id gnl|my_center|LOCUS_11020 30754 31317 gene locus_tag LOCUS_11030 gene pth 30754 31317 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476306.1 protein_id gnl|my_center|LOCUS_11030 31344 34901 gene locus_tag LOCUS_11040 gene mfd 31344 34901 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476305.1 protein_id gnl|my_center|LOCUS_11040 34882 36465 gene locus_tag LOCUS_11050 34882 36465 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476304.1 protein_id gnl|my_center|LOCUS_11050 36465 36731 gene locus_tag LOCUS_11060 36465 36731 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642082.1 protein_id gnl|my_center|LOCUS_11060 36809 37198 gene locus_tag LOCUS_11070 36809 37198 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642083.1 protein_id gnl|my_center|LOCUS_11070 37281 37784 gene locus_tag LOCUS_11080 37281 37784 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703194.1 protein_id gnl|my_center|LOCUS_11080 37843 39195 gene locus_tag LOCUS_11090 gene tilS 37843 39195 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476302.1 protein_id gnl|my_center|LOCUS_11090 39210 39752 gene locus_tag LOCUS_11100 gene hpt 39210 39752 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 protein_id gnl|my_center|LOCUS_11100 39837 41894 gene locus_tag LOCUS_11110 gene ftsH 39837 41894 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476301.1 protein_id gnl|my_center|LOCUS_11110 41998 42882 gene locus_tag LOCUS_11120 gene hslO 41998 42882 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296053.1 protein_id gnl|my_center|LOCUS_11120 42969 44468 gene locus_tag LOCUS_11130 gene lysS 42969 44468 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701392.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence018 1206 130 gene locus_tag LOCUS_11140 1206 130 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675055.1 protein_id gnl|my_center|LOCUS_11140 1691 3109 gene locus_tag LOCUS_11150 1691 3109 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356974.1 protein_id gnl|my_center|LOCUS_11150 3109 4125 gene locus_tag LOCUS_11160 gene cydB 3109 4125 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275291.1 protein_id gnl|my_center|LOCUS_11160 4125 5840 gene locus_tag LOCUS_11170 gene cydD 4125 5840 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378477.1 protein_id gnl|my_center|LOCUS_11170 5842 7602 gene locus_tag LOCUS_11180 gene cydC 5842 7602 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383727.1 protein_id gnl|my_center|LOCUS_11180 8783 7803 gene locus_tag LOCUS_11190 8783 7803 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360015.1 protein_id gnl|my_center|LOCUS_11190 8889 9800 gene locus_tag LOCUS_11200 8889 9800 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360016.1 protein_id gnl|my_center|LOCUS_11200 9819 11027 gene locus_tag LOCUS_11210 9819 11027 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360017.1 protein_id gnl|my_center|LOCUS_11210 12276 11335 gene locus_tag LOCUS_11220 12276 11335 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641300.1 protein_id gnl|my_center|LOCUS_11220 12586 13737 gene locus_tag LOCUS_11230 12586 13737 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905808.1 protein_id gnl|my_center|LOCUS_11230 13806 14792 gene locus_tag LOCUS_11240 13806 14792 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476272.1 protein_id gnl|my_center|LOCUS_11240 14811 15866 gene locus_tag LOCUS_11250 gene citC 14811 15866 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092462393.1 protein_id gnl|my_center|LOCUS_11250 15853 16152 gene locus_tag LOCUS_11260 gene citD 15853 16152 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641303.1 protein_id gnl|my_center|LOCUS_11260 16152 17066 gene locus_tag LOCUS_11270 gene citE 16152 17066 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644111.1 protein_id gnl|my_center|LOCUS_11270 17056 18594 gene locus_tag LOCUS_11280 gene citF 17056 18594 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905813.1 protein_id gnl|my_center|LOCUS_11280 18772 20175 gene locus_tag LOCUS_11290 18772 20175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 20175 20972 gene locus_tag LOCUS_11300 20175 20972 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100893.1 protein_id gnl|my_center|LOCUS_11300 21067 21576 gene locus_tag LOCUS_11310 21067 21576 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921584.1 protein_id gnl|my_center|LOCUS_11310 22775 21915 gene locus_tag LOCUS_11320 22775 21915 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642723.1 protein_id gnl|my_center|LOCUS_11320 23742 22807 gene locus_tag LOCUS_11330 23742 22807 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101884.1 protein_id gnl|my_center|LOCUS_11330 25115 23892 gene locus_tag LOCUS_11340 25115 23892 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476517.1 protein_id gnl|my_center|LOCUS_11340 25944 25513 gene locus_tag LOCUS_11350 25944 25513 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643508.1 protein_id gnl|my_center|LOCUS_11350 26240 27859 gene locus_tag LOCUS_11360 26240 27859 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 protein_id gnl|my_center|LOCUS_11360 28159 30999 gene locus_tag LOCUS_11370 28159 30999 CDS product sigma-54-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101067.1 protein_id gnl|my_center|LOCUS_11370 31196 31693 gene locus_tag LOCUS_11380 31196 31693 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385473.1 protein_id gnl|my_center|LOCUS_11380 31787 32758 gene locus_tag LOCUS_11390 31787 32758 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101057.1 protein_id gnl|my_center|LOCUS_11390 32782 33594 gene locus_tag LOCUS_11400 32782 33594 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101058.1 protein_id gnl|my_center|LOCUS_11400 33612 34526 gene locus_tag LOCUS_11410 33612 34526 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101059.1 protein_id gnl|my_center|LOCUS_11410 34795 35166 gene locus_tag LOCUS_11420 34795 35166 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101065.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence019 532 116 gene locus_tag LOCUS_11430 532 116 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476244.1 protein_id gnl|my_center|LOCUS_11430 2427 616 gene locus_tag LOCUS_11440 2427 616 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475500.1 protein_id gnl|my_center|LOCUS_11440 3343 2438 gene locus_tag LOCUS_11450 3343 2438 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287059.1 protein_id gnl|my_center|LOCUS_11450 4885 3563 gene locus_tag LOCUS_11460 4885 3563 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674117.1 protein_id gnl|my_center|LOCUS_11460 6011 4875 gene locus_tag LOCUS_11470 6011 4875 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593063.1 protein_id gnl|my_center|LOCUS_11470 7375 6020 gene locus_tag LOCUS_11480 7375 6020 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674116.1 protein_id gnl|my_center|LOCUS_11480 8129 7386 gene locus_tag LOCUS_11490 8129 7386 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003604400.1 protein_id gnl|my_center|LOCUS_11490 8639 8430 gene locus_tag LOCUS_11500 8639 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 10416 8668 gene locus_tag LOCUS_11510 10416 8668 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102235.1 protein_id gnl|my_center|LOCUS_11510 12586 10796 gene locus_tag LOCUS_11520 12586 10796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644847.1 protein_id gnl|my_center|LOCUS_11520 14079 12586 gene locus_tag LOCUS_11530 14079 12586 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289168.1 protein_id gnl|my_center|LOCUS_11530 14713 14495 gene locus_tag LOCUS_11540 14713 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 16555 14828 gene locus_tag LOCUS_11550 16555 14828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476454.1 protein_id gnl|my_center|LOCUS_11550 16853 17905 gene locus_tag LOCUS_11560 16853 17905 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642208.1 protein_id gnl|my_center|LOCUS_11560 18591 18094 gene locus_tag LOCUS_11570 18591 18094 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476359.1 protein_id gnl|my_center|LOCUS_11570 19337 18636 gene locus_tag LOCUS_11580 gene queC 19337 18636 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_11580 19879 19349 gene locus_tag LOCUS_11590 gene queF 19879 19349 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_11590 20764 20039 gene locus_tag LOCUS_11600 gene pxpB 20764 20039 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_11600 20990 22168 gene locus_tag LOCUS_11610 20990 22168 CDS product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232415.1 protein_id gnl|my_center|LOCUS_11610 22170 23081 gene locus_tag LOCUS_11620 22170 23081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 24599 23274 gene locus_tag LOCUS_11630 24599 23274 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356719.1 protein_id gnl|my_center|LOCUS_11630 25972 24605 gene locus_tag LOCUS_11640 gene guaD 25972 24605 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379675.1 protein_id gnl|my_center|LOCUS_11640 28230 26155 gene locus_tag LOCUS_11650 28230 26155 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057880580.1 protein_id gnl|my_center|LOCUS_11650 28335 28409 gene locus_tag LOCUS_t00070 28335 28409 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 28495 28929 gene locus_tag LOCUS_11660 gene msrB 28495 28929 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354871.1 protein_id gnl|my_center|LOCUS_11660 30524 29130 gene locus_tag LOCUS_11670 30524 29130 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675056.1 protein_id gnl|my_center|LOCUS_11670 31643 30681 gene locus_tag LOCUS_11680 31643 30681 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475798.1 protein_id gnl|my_center|LOCUS_11680 32682 31702 gene locus_tag LOCUS_11690 32682 31702 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_11690 33476 32703 gene locus_tag LOCUS_11700 33476 32703 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475869.1 protein_id gnl|my_center|LOCUS_11700 34501 33488 gene locus_tag LOCUS_11710 34501 33488 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475868.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence020 53 1162 gene locus_tag LOCUS_11720 53 1162 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593047.1 protein_id gnl|my_center|LOCUS_11720 1324 1893 gene locus_tag LOCUS_11730 1324 1893 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643355.1 protein_id gnl|my_center|LOCUS_11730 1978 2928 gene locus_tag LOCUS_11740 1978 2928 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101494.1 protein_id gnl|my_center|LOCUS_11740 3148 3909 gene locus_tag LOCUS_11750 3148 3909 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135178283.1 protein_id gnl|my_center|LOCUS_11750 5199 4168 gene locus_tag LOCUS_11760 5199 4168 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003715873.1 protein_id gnl|my_center|LOCUS_11760 5362 5724 gene locus_tag LOCUS_11770 5362 5724 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644291.1 protein_id gnl|my_center|LOCUS_11770 6961 5789 gene locus_tag LOCUS_11780 6961 5789 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102067.1 protein_id gnl|my_center|LOCUS_11780 8280 7063 gene locus_tag LOCUS_11790 8280 7063 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287243.1 protein_id gnl|my_center|LOCUS_11790 8726 8478 gene locus_tag LOCUS_11800 8726 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563841.1 protein_id gnl|my_center|LOCUS_11800 9246 9806 gene locus_tag LOCUS_11810 9246 9806 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577536.1 protein_id gnl|my_center|LOCUS_11810 9803 11212 gene locus_tag LOCUS_11820 9803 11212 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100922.1 protein_id gnl|my_center|LOCUS_11820 11426 11887 gene locus_tag LOCUS_11830 11426 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 13046 12018 gene locus_tag LOCUS_11840 13046 12018 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547468.1 protein_id gnl|my_center|LOCUS_11840 13158 14045 gene locus_tag LOCUS_11850 13158 14045 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262369.1 protein_id gnl|my_center|LOCUS_11850 14332 15030 gene locus_tag LOCUS_11860 14332 15030 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262269.1 protein_id gnl|my_center|LOCUS_11860 16121 15237 gene locus_tag LOCUS_11870 16121 15237 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358959.1 protein_id gnl|my_center|LOCUS_11870 16698 16114 gene locus_tag LOCUS_11880 16698 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 18004 16736 gene locus_tag LOCUS_11890 gene hutI 18004 16736 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108451.1 protein_id gnl|my_center|LOCUS_11890 20095 18011 gene locus_tag LOCUS_11900 20095 18011 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203600.1 protein_id gnl|my_center|LOCUS_11900 21451 20117 gene locus_tag LOCUS_11910 21451 20117 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147251.1 protein_id gnl|my_center|LOCUS_11910 22731 21451 gene locus_tag LOCUS_11920 22731 21451 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948355.1 protein_id gnl|my_center|LOCUS_11920 23545 22772 gene locus_tag LOCUS_11930 23545 22772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094604.1 protein_id gnl|my_center|LOCUS_11930 24390 23557 gene locus_tag LOCUS_11940 24390 23557 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006309981.1 protein_id gnl|my_center|LOCUS_11940 25435 24419 gene locus_tag LOCUS_11950 25435 24419 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392003.1 protein_id gnl|my_center|LOCUS_11950 26429 25404 gene locus_tag LOCUS_11960 26429 25404 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989339.1 protein_id gnl|my_center|LOCUS_11960 26858 26433 gene locus_tag LOCUS_11970 26858 26433 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870924.1 protein_id gnl|my_center|LOCUS_11970 28077 26833 gene locus_tag LOCUS_11980 28077 26833 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250200.1 protein_id gnl|my_center|LOCUS_11980 30915 28402 gene locus_tag LOCUS_11990 30915 28402 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674176.1 protein_id gnl|my_center|LOCUS_11990 31195 31629 gene locus_tag LOCUS_12000 31195 31629 CDS product PTS fructose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661531.1 protein_id gnl|my_center|LOCUS_12000 31644 32138 gene locus_tag LOCUS_12010 31644 32138 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563323.1 protein_id gnl|my_center|LOCUS_12010 32162 33016 gene locus_tag LOCUS_12020 32162 33016 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674177.1 protein_id gnl|my_center|LOCUS_12020 33019 33864 gene locus_tag LOCUS_12030 33019 33864 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563328.1 protein_id gnl|my_center|LOCUS_12030 33895 34236 gene locus_tag LOCUS_12040 33895 34236 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003661535.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence021 73 849 gene locus_tag LOCUS_12050 73 849 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 protein_id gnl|my_center|LOCUS_12050 881 1207 gene locus_tag LOCUS_12060 881 1207 CDS product DUF771 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475911.1 protein_id gnl|my_center|LOCUS_12060 1473 1652 gene locus_tag LOCUS_12070 1473 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1665 2012 gene locus_tag LOCUS_12080 1665 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 2012 2278 gene locus_tag LOCUS_12090 2012 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2275 2754 gene locus_tag LOCUS_12100 2275 2754 CDS product siphovirus Gp157 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157809.1 protein_id gnl|my_center|LOCUS_12100 2751 3434 gene locus_tag LOCUS_12110 2751 3434 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031367.1 protein_id gnl|my_center|LOCUS_12110 3437 4132 gene locus_tag LOCUS_12120 3437 4132 CDS product putative HNHc nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286553.1 protein_id gnl|my_center|LOCUS_12120 4129 4536 gene locus_tag LOCUS_12130 4129 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 4558 5130 gene locus_tag LOCUS_12140 4558 5130 CDS product NUMOD4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001004505.1 protein_id gnl|my_center|LOCUS_12140 5123 5890 gene locus_tag LOCUS_12150 5123 5890 CDS product phage replisome organizer N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475627.1 protein_id gnl|my_center|LOCUS_12150 5890 6666 gene locus_tag LOCUS_12160 5890 6666 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674673.1 protein_id gnl|my_center|LOCUS_12160 6668 6796 gene locus_tag LOCUS_12170 6668 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6783 7208 gene locus_tag LOCUS_12180 6783 7208 CDS product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722557.1 protein_id gnl|my_center|LOCUS_12180 7205 7360 gene locus_tag LOCUS_12190 7205 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 7357 8121 gene locus_tag LOCUS_12200 7357 8121 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793656.1 protein_id gnl|my_center|LOCUS_12200 8134 8328 gene locus_tag LOCUS_12210 8134 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 8325 8663 gene locus_tag LOCUS_12220 8325 8663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 8656 9105 gene locus_tag LOCUS_12230 8656 9105 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706850.1 protein_id gnl|my_center|LOCUS_12230 9107 9580 gene locus_tag LOCUS_12240 9107 9580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 9585 9905 gene locus_tag LOCUS_12250 9585 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 9902 10159 gene locus_tag LOCUS_12260 9902 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 10176 10613 gene locus_tag LOCUS_12270 10176 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 11040 11123 gene locus_tag LOCUS_t00080 11040 11123 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 11152 12369 gene locus_tag LOCUS_12280 11152 12369 CDS product GcrA family cell cycle regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674656.1 protein_id gnl|my_center|LOCUS_12280 12386 12529 gene locus_tag LOCUS_12290 12386 12529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 12715 12981 gene locus_tag LOCUS_12300 12715 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 12962 13291 gene locus_tag LOCUS_12310 12962 13291 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000988332.1 protein_id gnl|my_center|LOCUS_12310 13282 13530 gene locus_tag LOCUS_12320 13282 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 13643 13948 gene locus_tag LOCUS_12330 13643 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 13945 15630 gene locus_tag LOCUS_12340 13945 15630 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625088.1 protein_id gnl|my_center|LOCUS_12340 15652 16926 gene locus_tag LOCUS_12350 15652 16926 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025274.1 protein_id gnl|my_center|LOCUS_12350 16916 17674 gene locus_tag LOCUS_12360 16916 17674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 17675 18406 gene locus_tag LOCUS_12370 17675 18406 CDS product Clp protease ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642728.1 protein_id gnl|my_center|LOCUS_12370 18428 19585 gene locus_tag LOCUS_12380 18428 19585 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000154559.1 protein_id gnl|my_center|LOCUS_12380 19601 19903 gene locus_tag LOCUS_12390 19601 19903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 19884 20270 gene locus_tag LOCUS_12400 19884 20270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 20267 20683 gene locus_tag LOCUS_12410 20267 20683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 20683 21090 gene locus_tag LOCUS_12420 20683 21090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 21107 21706 gene locus_tag LOCUS_12430 21107 21706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 21783 22082 gene locus_tag LOCUS_12440 21783 22082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 22294 26145 gene locus_tag LOCUS_12450 22294 26145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 26138 26848 gene locus_tag LOCUS_12460 26138 26848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 26849 28756 gene locus_tag LOCUS_12470 26849 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 28771 31044 gene locus_tag LOCUS_12480 28771 31044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 31167 31547 gene locus_tag LOCUS_12490 31167 31547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 31554 31757 gene locus_tag LOCUS_12500 31554 31757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 31760 32224 gene locus_tag LOCUS_12510 31760 32224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 32234 33262 gene locus_tag LOCUS_12520 32234 33262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 33432 33608 gene locus_tag LOCUS_12530 33432 33608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 33605 34192 gene locus_tag LOCUS_12540 33605 34192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence022 28 672 gene locus_tag LOCUS_12550 28 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1081 821 gene locus_tag LOCUS_12560 1081 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 2129 1182 gene locus_tag LOCUS_12570 2129 1182 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732102.1 protein_id gnl|my_center|LOCUS_12570 2209 3021 gene locus_tag LOCUS_12580 2209 3021 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097421.1 protein_id gnl|my_center|LOCUS_12580 6160 3401 gene locus_tag LOCUS_12590 6160 3401 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476565.1 protein_id gnl|my_center|LOCUS_12590 8133 6163 gene locus_tag LOCUS_12600 8133 6163 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034528504.1 protein_id gnl|my_center|LOCUS_12600 8944 8126 gene locus_tag LOCUS_12610 8944 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 9091 9363 gene locus_tag LOCUS_12620 9091 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 9467 9817 gene locus_tag LOCUS_12630 9467 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 10079 11152 gene locus_tag LOCUS_12640 10079 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 11369 12703 gene locus_tag LOCUS_12650 11369 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 12769 13032 gene locus_tag LOCUS_12660 12769 13032 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196077.1 protein_id gnl|my_center|LOCUS_12660 13075 14373 gene locus_tag LOCUS_12670 13075 14373 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219078.1 protein_id gnl|my_center|LOCUS_12670 14785 14393 gene locus_tag LOCUS_12680 gene rpsI 14785 14393 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476332.1 protein_id gnl|my_center|LOCUS_12680 15241 14798 gene locus_tag LOCUS_12690 gene rplM 15241 14798 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476333.1 protein_id gnl|my_center|LOCUS_12690 16135 15368 gene locus_tag LOCUS_12700 gene truA 16135 15368 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563878.1 protein_id gnl|my_center|LOCUS_12700 16957 16160 gene locus_tag LOCUS_12710 16957 16160 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701341.1 protein_id gnl|my_center|LOCUS_12710 17831 16950 gene locus_tag LOCUS_12720 17831 16950 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641276.1 protein_id gnl|my_center|LOCUS_12720 18634 17801 gene locus_tag LOCUS_12730 18634 17801 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641275.1 protein_id gnl|my_center|LOCUS_12730 19481 19098 gene locus_tag LOCUS_12740 gene rplQ 19481 19098 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701337.1 protein_id gnl|my_center|LOCUS_12740 20451 19507 gene locus_tag LOCUS_12750 20451 19507 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701335.1 protein_id gnl|my_center|LOCUS_12750 20926 20537 gene locus_tag LOCUS_12760 gene rpsK 20926 20537 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701334.1 protein_id gnl|my_center|LOCUS_12760 21317 20952 gene locus_tag LOCUS_12770 gene rpsM 21317 20952 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701333.1 protein_id gnl|my_center|LOCUS_12770 21709 21491 gene locus_tag LOCUS_12780 gene infA 21709 21491 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_12780 22554 21892 gene locus_tag LOCUS_12790 22554 21892 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701331.1 protein_id gnl|my_center|LOCUS_12790 23943 22648 gene locus_tag LOCUS_12800 gene secY 23943 22648 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701329.1 protein_id gnl|my_center|LOCUS_12800 24377 23943 gene locus_tag LOCUS_12810 gene rplO 24377 23943 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701328.1 protein_id gnl|my_center|LOCUS_12810 24606 24424 gene locus_tag LOCUS_12820 gene rpmD 24606 24424 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701327.1 protein_id gnl|my_center|LOCUS_12820 25122 24622 gene locus_tag LOCUS_12830 gene rpsE 25122 24622 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701326.1 protein_id gnl|my_center|LOCUS_12830 25500 25144 gene locus_tag LOCUS_12840 gene rplR 25500 25144 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705309.1 protein_id gnl|my_center|LOCUS_12840 26084 25548 gene locus_tag LOCUS_12850 gene rplF 26084 25548 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701323.1 protein_id gnl|my_center|LOCUS_12850 26514 26116 gene locus_tag LOCUS_12860 gene rpsH 26514 26116 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701322.1 protein_id gnl|my_center|LOCUS_12860 26728 26543 gene locus_tag LOCUS_12870 26728 26543 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701320.1 protein_id gnl|my_center|LOCUS_12870 27284 26742 gene locus_tag LOCUS_12880 gene rplE 27284 26742 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701318.1 protein_id gnl|my_center|LOCUS_12880 27623 27312 gene locus_tag LOCUS_12890 gene rplX 27623 27312 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701316.1 protein_id gnl|my_center|LOCUS_12890 28025 27657 gene locus_tag LOCUS_12900 gene rplN 28025 27657 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701315.1 protein_id gnl|my_center|LOCUS_12900 28360 28094 gene locus_tag LOCUS_12910 gene rpsQ 28360 28094 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701314.1 protein_id gnl|my_center|LOCUS_12910 28580 28386 gene locus_tag LOCUS_12920 gene rpmC 28580 28386 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701313.1 protein_id gnl|my_center|LOCUS_12920 29004 28570 gene locus_tag LOCUS_12930 gene rplP 29004 28570 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288661.1 protein_id gnl|my_center|LOCUS_12930 29664 29008 gene locus_tag LOCUS_12940 gene rpsC 29664 29008 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701310.1 protein_id gnl|my_center|LOCUS_12940 30025 29678 gene locus_tag LOCUS_12950 gene rplV 30025 29678 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701308.1 protein_id gnl|my_center|LOCUS_12950 30321 30040 gene locus_tag LOCUS_12960 gene rpsS 30321 30040 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705314.1 protein_id gnl|my_center|LOCUS_12960 31198 30368 gene locus_tag LOCUS_12970 gene rplB 31198 30368 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701306.1 protein_id gnl|my_center|LOCUS_12970 31508 31224 gene locus_tag LOCUS_12980 gene rplW 31508 31224 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701304.1 protein_id gnl|my_center|LOCUS_12980 32133 31510 gene locus_tag LOCUS_12990 gene rplD 32133 31510 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701303.1 protein_id gnl|my_center|LOCUS_12990 32786 32157 gene locus_tag LOCUS_13000 gene rplC 32786 32157 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701302.1 protein_id gnl|my_center|LOCUS_13000 33145 32837 gene locus_tag LOCUS_13010 gene rpsJ 33145 32837 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563872.1 protein_id gnl|my_center|LOCUS_13010 33411 33959 gene locus_tag LOCUS_13020 33411 33959 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254459.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence023 1601 150 gene locus_tag LOCUS_13030 1601 150 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476193.1 protein_id gnl|my_center|LOCUS_13030 2323 1601 gene locus_tag LOCUS_13040 2323 1601 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476194.1 protein_id gnl|my_center|LOCUS_13040 2874 2510 gene locus_tag LOCUS_tm00010 2874 2510 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4311 2917 gene locus_tag LOCUS_13050 4311 2917 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064095.1 protein_id gnl|my_center|LOCUS_13050 4872 4387 gene locus_tag LOCUS_13060 4872 4387 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566853.1 protein_id gnl|my_center|LOCUS_13060 5074 4892 gene locus_tag LOCUS_13070 5074 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5735 5058 gene locus_tag LOCUS_13080 5735 5058 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674243.1 protein_id gnl|my_center|LOCUS_13080 6448 5750 gene locus_tag LOCUS_13090 6448 5750 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702912.1 protein_id gnl|my_center|LOCUS_13090 7145 6513 gene locus_tag LOCUS_13100 7145 6513 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047035336.1 protein_id gnl|my_center|LOCUS_13100 7294 7815 gene locus_tag LOCUS_13110 7294 7815 CDS product DUF1836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708298.1 protein_id gnl|my_center|LOCUS_13110 8826 7963 gene locus_tag LOCUS_13120 gene fba 8826 7963 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702919.1 protein_id gnl|my_center|LOCUS_13120 9121 8966 gene locus_tag LOCUS_13130 9121 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 11241 9118 gene locus_tag LOCUS_13140 gene feoB 11241 9118 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594982.1 protein_id gnl|my_center|LOCUS_13140 11714 11238 gene locus_tag LOCUS_13150 11714 11238 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129762.1 protein_id gnl|my_center|LOCUS_13150 12589 11915 gene locus_tag LOCUS_13160 gene phoU 12589 11915 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569545.1 protein_id gnl|my_center|LOCUS_13160 13361 12606 gene locus_tag LOCUS_13170 gene pstB 13361 12606 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475736.1 protein_id gnl|my_center|LOCUS_13170 14182 13373 gene locus_tag LOCUS_13180 gene pstB 14182 13373 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702915.1 protein_id gnl|my_center|LOCUS_13180 15082 14195 gene locus_tag LOCUS_13190 gene pstA 15082 14195 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475735.1 protein_id gnl|my_center|LOCUS_13190 15749 15084 gene locus_tag LOCUS_13200 15749 15084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 15652 15978 gene locus_tag LOCUS_13210 15652 15978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 17031 16135 gene locus_tag LOCUS_13220 17031 16135 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722632.1 protein_id gnl|my_center|LOCUS_13220 17466 17158 gene locus_tag LOCUS_13230 17466 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476265.1 protein_id gnl|my_center|LOCUS_13230 19739 18390 gene locus_tag LOCUS_13240 gene glmM 19739 18390 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700589.1 protein_id gnl|my_center|LOCUS_13240 20884 19778 gene locus_tag LOCUS_13250 20884 19778 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674353.1 protein_id gnl|my_center|LOCUS_13250 21723 20881 gene locus_tag LOCUS_13260 gene cdaA 21723 20881 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476186.1 protein_id gnl|my_center|LOCUS_13260 22237 22578 gene locus_tag LOCUS_13270 22237 22578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 24965 22854 gene locus_tag LOCUS_13280 24965 22854 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101165.1 protein_id gnl|my_center|LOCUS_13280 25960 25055 gene locus_tag LOCUS_13290 gene murB 25960 25055 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476187.1 protein_id gnl|my_center|LOCUS_13290 26215 26745 gene locus_tag LOCUS_13300 26215 26745 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700597.1 protein_id gnl|my_center|LOCUS_13300 28169 26862 gene locus_tag LOCUS_13310 28169 26862 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100972.1 protein_id gnl|my_center|LOCUS_13310 29522 29208 gene locus_tag LOCUS_13320 gene tnpA 29522 29208 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377988.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13320 29674 29528 gene locus_tag LOCUS_13330 29674 29528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13330 29936 29850 gene locus_tag LOCUS_t00090 29936 29850 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 30064 29994 gene locus_tag LOCUS_t00100 30064 29994 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 30158 30085 gene locus_tag LOCUS_t00110 30158 30085 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 30239 30165 gene locus_tag LOCUS_t00120 30239 30165 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 30318 30245 gene locus_tag LOCUS_t00130 30318 30245 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 30413 30329 gene locus_tag LOCUS_t00140 30413 30329 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 30489 30414 gene locus_tag LOCUS_t00150 30489 30414 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 30585 30510 gene locus_tag LOCUS_t00160 30585 30510 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 30667 30593 gene locus_tag LOCUS_t00170 30667 30593 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30743 30670 gene locus_tag LOCUS_t00180 30743 30670 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 30845 30752 gene locus_tag LOCUS_t00190 30845 30752 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30932 30858 gene locus_tag LOCUS_t00200 30932 30858 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 1105 167 gene locus_tag LOCUS_13340 1105 167 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_13340 2601 1126 gene locus_tag LOCUS_13350 2601 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13350 2954 3103 gene locus_tag LOCUS_13360 2954 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 3203 3322 gene locus_tag LOCUS_13370 3203 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 4490 4038 gene locus_tag LOCUS_13380 4490 4038 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476243.1 protein_id gnl|my_center|LOCUS_13380 4625 5413 gene locus_tag LOCUS_13390 gene map 4625 5413 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705135.1 protein_id gnl|my_center|LOCUS_13390 5534 6406 gene locus_tag LOCUS_13400 gene galU 5534 6406 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702763.1 protein_id gnl|my_center|LOCUS_13400 6532 7083 gene locus_tag LOCUS_13410 6532 7083 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225357223.1 protein_id gnl|my_center|LOCUS_13410 7508 7299 gene locus_tag LOCUS_13420 7508 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 7480 8088 gene locus_tag LOCUS_13430 7480 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 8922 8131 gene locus_tag LOCUS_13440 gene recX 8922 8131 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475719.1 protein_id gnl|my_center|LOCUS_13440 9035 10429 gene locus_tag LOCUS_13450 gene rlmD 9035 10429 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475720.1 protein_id gnl|my_center|LOCUS_13450 10601 11146 gene locus_tag LOCUS_13460 10601 11146 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710725.1 protein_id gnl|my_center|LOCUS_13460 11360 12493 gene locus_tag LOCUS_13470 11360 12493 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704251.1 protein_id gnl|my_center|LOCUS_13470 12580 14067 gene locus_tag LOCUS_13480 12580 14067 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704227.1 protein_id gnl|my_center|LOCUS_13480 14148 15428 gene locus_tag LOCUS_13490 14148 15428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 15458 17035 gene locus_tag LOCUS_13500 15458 17035 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704258.1 protein_id gnl|my_center|LOCUS_13500 18375 17314 gene locus_tag LOCUS_13510 18375 17314 CDS product MucBP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704215.1 protein_id gnl|my_center|LOCUS_13510 18697 18422 gene locus_tag LOCUS_13520 18697 18422 CDS product DUF1827 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824480.1 protein_id gnl|my_center|LOCUS_13520 21034 18827 gene locus_tag LOCUS_13530 21034 18827 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475728.1 protein_id gnl|my_center|LOCUS_13530 21208 21387 gene locus_tag LOCUS_13540 21208 21387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 21586 21852 gene locus_tag LOCUS_13550 21586 21852 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699522.1 protein_id gnl|my_center|LOCUS_13550 21852 23573 gene locus_tag LOCUS_13560 gene ptsP 21852 23573 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475729.1 protein_id gnl|my_center|LOCUS_13560 23755 24939 gene locus_tag LOCUS_13570 23755 24939 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475730.1 protein_id gnl|my_center|LOCUS_13570 24956 25978 gene locus_tag LOCUS_13580 24956 25978 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475731.1 protein_id gnl|my_center|LOCUS_13580 25981 26994 gene locus_tag LOCUS_13590 25981 26994 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704264.1 protein_id gnl|my_center|LOCUS_13590 27453 27686 gene locus_tag LOCUS_13600 27453 27686 CDS product YkuJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699512.1 protein_id gnl|my_center|LOCUS_13600 27785 29839 gene locus_tag LOCUS_13610 27785 29839 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704241.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence025 544 71 gene locus_tag LOCUS_13620 544 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 813 592 gene locus_tag LOCUS_13630 813 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1174 1101 gene locus_tag LOCUS_t00210 1174 1101 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1239 2555 gene locus_tag LOCUS_13640 gene rpoN 1239 2555 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641042.1 protein_id gnl|my_center|LOCUS_13640 2880 3908 gene locus_tag LOCUS_13650 2880 3908 CDS product central glycolytic genes regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700620.1 protein_id gnl|my_center|LOCUS_13650 3969 4982 gene locus_tag LOCUS_13660 gene gap 3969 4982 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700619.1 protein_id gnl|my_center|LOCUS_13660 5085 6275 gene locus_tag LOCUS_13670 5085 6275 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700618.1 protein_id gnl|my_center|LOCUS_13670 6309 7064 gene locus_tag LOCUS_13680 gene tpiA 6309 7064 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700616.1 protein_id gnl|my_center|LOCUS_13680 7168 8493 gene locus_tag LOCUS_13690 gene eno 7168 8493 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700615.1 protein_id gnl|my_center|LOCUS_13690 8832 9074 gene locus_tag LOCUS_13700 gene secG 8832 9074 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700607.1 protein_id gnl|my_center|LOCUS_13700 9180 11525 gene locus_tag LOCUS_13710 gene rnr 9180 11525 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476190.1 protein_id gnl|my_center|LOCUS_13710 11551 12018 gene locus_tag LOCUS_13720 gene smpB 11551 12018 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700605.1 protein_id gnl|my_center|LOCUS_13720 12507 13652 gene locus_tag LOCUS_13730 12507 13652 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355830.1 protein_id gnl|my_center|LOCUS_13730 14122 15288 gene locus_tag LOCUS_13740 14122 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 16015 15443 gene locus_tag LOCUS_13750 16015 15443 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355832.1 protein_id gnl|my_center|LOCUS_13750 16549 16034 gene locus_tag LOCUS_13760 16549 16034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101162.1 protein_id gnl|my_center|LOCUS_13760 17449 16583 gene locus_tag LOCUS_13770 17449 16583 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700602.1 protein_id gnl|my_center|LOCUS_13770 17616 18299 gene locus_tag LOCUS_13780 17616 18299 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706565.1 protein_id gnl|my_center|LOCUS_13780 18318 19292 gene locus_tag LOCUS_13790 gene pta 18318 19292 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710455.1 protein_id gnl|my_center|LOCUS_13790 19318 19785 gene locus_tag LOCUS_13800 gene tsaE 19318 19785 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476188.1 protein_id gnl|my_center|LOCUS_13800 20122 22281 gene locus_tag LOCUS_13810 gene nrdD 20122 22281 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476286.1 protein_id gnl|my_center|LOCUS_13810 22274 22864 gene locus_tag LOCUS_13820 gene nrdG 22274 22864 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476285.1 protein_id gnl|my_center|LOCUS_13820 23694 23137 gene locus_tag LOCUS_13830 23694 23137 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476311.1 protein_id gnl|my_center|LOCUS_13830 24203 23742 gene locus_tag LOCUS_13840 24203 23742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 24267 25007 gene locus_tag LOCUS_13850 24267 25007 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644623.1 protein_id gnl|my_center|LOCUS_13850 25372 25770 gene locus_tag LOCUS_13860 gene spxA 25372 25770 CDS product transcriptional regulator SpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703607.1 protein_id gnl|my_center|LOCUS_13860 26012 26821 gene locus_tag LOCUS_13870 26012 26821 CDS product adaptor protein MecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563829.1 protein_id gnl|my_center|LOCUS_13870 26880 27887 gene locus_tag LOCUS_13880 26880 27887 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475733.1 protein_id gnl|my_center|LOCUS_13880 27981 29792 gene locus_tag LOCUS_13890 gene pepF 27981 29792 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475734.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence026 485 1549 gene locus_tag LOCUS_13900 485 1549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674342.1 protein_id gnl|my_center|LOCUS_13900 1563 2459 gene locus_tag LOCUS_13910 1563 2459 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564323.1 protein_id gnl|my_center|LOCUS_13910 2472 3296 gene locus_tag LOCUS_13920 2472 3296 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_13920 3379 4686 gene locus_tag LOCUS_13930 3379 4686 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564318.1 protein_id gnl|my_center|LOCUS_13930 4722 5987 gene locus_tag LOCUS_13940 4722 5987 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674341.1 protein_id gnl|my_center|LOCUS_13940 6002 7549 gene locus_tag LOCUS_13950 6002 7549 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378886.1 protein_id gnl|my_center|LOCUS_13950 7782 7710 gene locus_tag LOCUS_t00220 7782 7710 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 8868 8029 gene locus_tag LOCUS_13960 8868 8029 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131024.1 protein_id gnl|my_center|LOCUS_13960 9277 10143 gene locus_tag LOCUS_13970 9277 10143 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287653.1 protein_id gnl|my_center|LOCUS_13970 10388 10870 gene locus_tag LOCUS_13980 10388 10870 CDS product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898809.1 protein_id gnl|my_center|LOCUS_13980 10900 11823 gene locus_tag LOCUS_13990 10900 11823 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357253.1 protein_id gnl|my_center|LOCUS_13990 11807 12622 gene locus_tag LOCUS_14000 11807 12622 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357254.1 protein_id gnl|my_center|LOCUS_14000 12655 13062 gene locus_tag LOCUS_14010 12655 13062 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860837.1 protein_id gnl|my_center|LOCUS_14010 13268 14158 gene locus_tag LOCUS_14020 gene murQ 13268 14158 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254545.1 protein_id gnl|my_center|LOCUS_14020 14170 15174 gene locus_tag LOCUS_14030 14170 15174 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642835.1 protein_id gnl|my_center|LOCUS_14030 15194 16267 gene locus_tag LOCUS_14040 15194 16267 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003585932.1 protein_id gnl|my_center|LOCUS_14040 16657 18147 gene locus_tag LOCUS_14050 16657 18147 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254617.1 protein_id gnl|my_center|LOCUS_14050 18293 18472 gene locus_tag LOCUS_14060 18293 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 18735 18660 gene locus_tag LOCUS_t00230 18735 18660 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19375 18824 gene locus_tag LOCUS_14070 19375 18824 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547188.1 protein_id gnl|my_center|LOCUS_14070 20227 19388 gene locus_tag LOCUS_14080 20227 19388 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254313.1 protein_id gnl|my_center|LOCUS_14080 20440 21150 gene locus_tag LOCUS_14090 gene yycF 20440 21150 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701473.1 protein_id gnl|my_center|LOCUS_14090 21174 23033 gene locus_tag LOCUS_14100 gene walK 21174 23033 CDS product cell wall metabolism sensor histidine kinase WalK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475473.1 protein_id gnl|my_center|LOCUS_14100 23023 24375 gene locus_tag LOCUS_14110 23023 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702718.1 protein_id gnl|my_center|LOCUS_14110 24395 25204 gene locus_tag LOCUS_14120 24395 25204 CDS product two-component system regulatory protein YycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475474.1 protein_id gnl|my_center|LOCUS_14120 25240 26058 gene locus_tag LOCUS_14130 25240 26058 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641659.1 protein_id gnl|my_center|LOCUS_14130 26171 27523 gene locus_tag LOCUS_14140 26171 27523 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475476.1 protein_id gnl|my_center|LOCUS_14140 27966 28445 gene locus_tag LOCUS_14150 gene rlmH 27966 28445 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643636.1 protein_id gnl|my_center|LOCUS_14150 29502 29720 gene locus_tag LOCUS_14160 29502 29720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence027 1039 80 gene locus_tag LOCUS_14170 gene nrdF 1039 80 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703371.1 protein_id gnl|my_center|LOCUS_14170 3240 1063 gene locus_tag LOCUS_14180 gene nrdE 3240 1063 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476229.1 protein_id gnl|my_center|LOCUS_14180 3592 3212 gene locus_tag LOCUS_14190 gene nrdI 3592 3212 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355359.1 protein_id gnl|my_center|LOCUS_14190 3819 3589 gene locus_tag LOCUS_14200 gene nrdH 3819 3589 CDS product glutaredoxin-like protein NrdH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700670.1 protein_id gnl|my_center|LOCUS_14200 4014 4622 gene locus_tag LOCUS_14210 4014 4622 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640953.1 protein_id gnl|my_center|LOCUS_14210 4637 5128 gene locus_tag LOCUS_14220 gene tadA 4637 5128 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703380.1 protein_id gnl|my_center|LOCUS_14220 5325 7058 gene locus_tag LOCUS_14230 gene dnaX 5325 7058 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476228.1 protein_id gnl|my_center|LOCUS_14230 7073 7387 gene locus_tag LOCUS_14240 7073 7387 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700666.1 protein_id gnl|my_center|LOCUS_14240 7418 8017 gene locus_tag LOCUS_14250 gene recR 7418 8017 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700665.1 protein_id gnl|my_center|LOCUS_14250 8032 8271 gene locus_tag LOCUS_14260 8032 8271 CDS product YaaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476227.1 protein_id gnl|my_center|LOCUS_14260 8351 8989 gene locus_tag LOCUS_14270 gene tmk 8351 8989 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700663.1 protein_id gnl|my_center|LOCUS_14270 9015 9344 gene locus_tag LOCUS_14280 9015 9344 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640965.1 protein_id gnl|my_center|LOCUS_14280 9356 10351 gene locus_tag LOCUS_14290 gene holB 9356 10351 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700662.1 protein_id gnl|my_center|LOCUS_14290 10366 10710 gene locus_tag LOCUS_14300 10366 10710 CDS product DNA replication initiation control protein YabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700660.1 protein_id gnl|my_center|LOCUS_14300 10707 11600 gene locus_tag LOCUS_14310 gene rsmI 10707 11600 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700659.1 protein_id gnl|my_center|LOCUS_14310 11618 12361 gene locus_tag LOCUS_14320 11618 12361 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700658.1 protein_id gnl|my_center|LOCUS_14320 13466 12492 gene locus_tag LOCUS_14330 13466 12492 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476226.1 protein_id gnl|my_center|LOCUS_14330 14374 13718 gene locus_tag LOCUS_14340 14374 13718 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475891.1 protein_id gnl|my_center|LOCUS_14340 15144 14374 gene locus_tag LOCUS_14350 gene comA 15144 14374 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869753.1 protein_id gnl|my_center|LOCUS_14350 16350 15424 gene locus_tag LOCUS_14360 16350 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 16883 17413 gene locus_tag LOCUS_14370 16883 17413 CDS product folate family ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385065.1 protein_id gnl|my_center|LOCUS_14370 17638 18363 gene locus_tag LOCUS_14380 gene tsaB 17638 18363 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476225.1 protein_id gnl|my_center|LOCUS_14380 18338 18925 gene locus_tag LOCUS_14390 gene rimI 18338 18925 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101142.1 protein_id gnl|my_center|LOCUS_14390 18918 19955 gene locus_tag LOCUS_14400 gene tsaD 18918 19955 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706529.1 protein_id gnl|my_center|LOCUS_14400 20570 20142 gene locus_tag LOCUS_14410 20570 20142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 20895 20755 gene locus_tag LOCUS_14420 20895 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 23131 21194 gene locus_tag LOCUS_14430 23131 21194 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476224.1 protein_id gnl|my_center|LOCUS_14430 23368 24021 gene locus_tag LOCUS_14440 23368 24021 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003710514.1 protein_id gnl|my_center|LOCUS_14440 24694 24062 gene locus_tag LOCUS_14450 24694 24062 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824463.1 protein_id gnl|my_center|LOCUS_14450 24870 25154 gene locus_tag LOCUS_14460 gene groES 24870 25154 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706535.1 protein_id gnl|my_center|LOCUS_14460 25192 26817 gene locus_tag LOCUS_14470 gene groL 25192 26817 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476222.1 protein_id gnl|my_center|LOCUS_14470 27184 28287 gene locus_tag LOCUS_14480 27184 28287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476120.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence028 2274 1435 gene locus_tag LOCUS_14490 2274 1435 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476336.1 protein_id gnl|my_center|LOCUS_14490 4230 2329 gene locus_tag LOCUS_14500 4230 2329 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101650.1 protein_id gnl|my_center|LOCUS_14500 4416 5084 gene locus_tag LOCUS_14510 4416 5084 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476337.1 protein_id gnl|my_center|LOCUS_14510 5086 6066 gene locus_tag LOCUS_14520 5086 6066 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674856.1 protein_id gnl|my_center|LOCUS_14520 6197 7576 gene locus_tag LOCUS_14530 6197 7576 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286868.1 protein_id gnl|my_center|LOCUS_14530 8378 7803 gene locus_tag LOCUS_14540 8378 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 9575 8379 gene locus_tag LOCUS_14550 9575 8379 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263552.1 protein_id gnl|my_center|LOCUS_14550 11106 9595 gene locus_tag LOCUS_14560 11106 9595 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352327.1 protein_id gnl|my_center|LOCUS_14560 11229 12134 gene locus_tag LOCUS_14570 11229 12134 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002280228.1 protein_id gnl|my_center|LOCUS_14570 13779 12424 gene locus_tag LOCUS_14580 13779 12424 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101564.1 protein_id gnl|my_center|LOCUS_14580 14252 13794 gene locus_tag LOCUS_14590 14252 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 15174 14419 gene locus_tag LOCUS_14600 15174 14419 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645047.1 protein_id gnl|my_center|LOCUS_14600 16775 17272 gene locus_tag LOCUS_14610 16775 17272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 18828 17386 gene locus_tag LOCUS_14620 18828 17386 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254310.1 protein_id gnl|my_center|LOCUS_14620 20379 19030 gene locus_tag LOCUS_14630 20379 19030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067963.1 protein_id gnl|my_center|LOCUS_14630 20978 20394 gene locus_tag LOCUS_14640 gene leuD 20978 20394 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723155.1 protein_id gnl|my_center|LOCUS_14640 22356 20980 gene locus_tag LOCUS_14650 gene leuC 22356 20980 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989859.1 protein_id gnl|my_center|LOCUS_14650 23411 22362 gene locus_tag LOCUS_14660 gene leuB 23411 22362 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162527.1 protein_id gnl|my_center|LOCUS_14660 24954 23773 gene locus_tag LOCUS_14670 gene trpB 24954 23773 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016308.1 protein_id gnl|my_center|LOCUS_14670 25540 26982 gene locus_tag LOCUS_14680 25540 26982 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475829.1 protein_id gnl|my_center|LOCUS_14680 26982 27722 gene locus_tag LOCUS_14690 26982 27722 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699922.1 protein_id gnl|my_center|LOCUS_14690 29033 29311 gene locus_tag LOCUS_14700 29033 29311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence029 1392 436 gene locus_tag LOCUS_14710 1392 436 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475776.1 protein_id gnl|my_center|LOCUS_14710 3649 1415 gene locus_tag LOCUS_14720 3649 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4832 3630 gene locus_tag LOCUS_14730 4832 3630 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645226.1 protein_id gnl|my_center|LOCUS_14730 5348 5010 gene locus_tag LOCUS_14740 5348 5010 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699755.1 protein_id gnl|my_center|LOCUS_14740 7543 5423 gene locus_tag LOCUS_14750 7543 5423 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475775.1 protein_id gnl|my_center|LOCUS_14750 8116 7652 gene locus_tag LOCUS_14760 gene argR 8116 7652 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644266.1 protein_id gnl|my_center|LOCUS_14760 8913 8191 gene locus_tag LOCUS_14770 8913 8191 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288442.1 protein_id gnl|my_center|LOCUS_14770 10118 9078 gene locus_tag LOCUS_14780 gene recA 10118 9078 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641504.1 protein_id gnl|my_center|LOCUS_14780 11457 10219 gene locus_tag LOCUS_14790 11457 10219 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101709.1 protein_id gnl|my_center|LOCUS_14790 12137 11550 gene locus_tag LOCUS_14800 gene pgsA 12137 11550 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706586.1 protein_id gnl|my_center|LOCUS_14800 13072 12185 gene locus_tag LOCUS_14810 13072 12185 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004564371.1 protein_id gnl|my_center|LOCUS_14810 13888 13163 gene locus_tag LOCUS_14820 13888 13163 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476180.1 protein_id gnl|my_center|LOCUS_14820 15189 13888 gene locus_tag LOCUS_14830 15189 13888 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476181.1 protein_id gnl|my_center|LOCUS_14830 16447 15176 gene locus_tag LOCUS_14840 16447 15176 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387388.1 protein_id gnl|my_center|LOCUS_14840 16332 16589 gene locus_tag LOCUS_14850 16332 16589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 18953 16626 gene locus_tag LOCUS_14860 18953 16626 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700578.1 protein_id gnl|my_center|LOCUS_14860 19525 19013 gene locus_tag LOCUS_14870 gene trmL 19525 19013 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700579.1 protein_id gnl|my_center|LOCUS_14870 20590 19733 gene locus_tag LOCUS_14880 20590 19733 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476182.1 protein_id gnl|my_center|LOCUS_14880 21103 20606 gene locus_tag LOCUS_14890 21103 20606 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704674.1 protein_id gnl|my_center|LOCUS_14890 21316 22293 gene locus_tag LOCUS_14900 21316 22293 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700584.1 protein_id gnl|my_center|LOCUS_14900 22792 22436 gene locus_tag LOCUS_14910 22792 22436 CDS product PTS glucitol/sorbitol transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700588.1 protein_id gnl|my_center|LOCUS_14910 22937 23968 gene locus_tag LOCUS_14920 22937 23968 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101686.1 protein_id gnl|my_center|LOCUS_14920 25573 24206 gene locus_tag LOCUS_14930 gene mgtE 25573 24206 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362548.1 protein_id gnl|my_center|LOCUS_14930 26503 25580 gene locus_tag LOCUS_14940 26503 25580 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476266.1 protein_id gnl|my_center|LOCUS_14940 27278 26472 gene locus_tag LOCUS_14950 27278 26472 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476267.1 protein_id gnl|my_center|LOCUS_14950 28005 27373 gene locus_tag LOCUS_14960 28005 27373 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309982.1 protein_id gnl|my_center|LOCUS_14960 28210 28842 gene locus_tag LOCUS_14970 28210 28842 CDS product ClpXP adapter SpxH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162853479.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence030 489 322 gene locus_tag LOCUS_14980 489 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 864 583 gene locus_tag LOCUS_14990 864 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14990 978 1439 gene locus_tag LOCUS_15000 978 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2072 1482 gene locus_tag LOCUS_15010 2072 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 4229 2169 gene locus_tag LOCUS_15020 gene mobQ 4229 2169 CDS product MobQ family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035454417.1 protein_id gnl|my_center|LOCUS_15020 4500 4709 gene locus_tag LOCUS_15030 4500 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241756.1 protein_id gnl|my_center|LOCUS_15030 4732 5010 gene locus_tag LOCUS_15040 4732 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003649842.1 protein_id gnl|my_center|LOCUS_15040 5821 5000 gene locus_tag LOCUS_15050 5821 5000 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241755.1 protein_id gnl|my_center|LOCUS_15050 6519 6226 gene locus_tag LOCUS_15060 6519 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 7111 6839 gene locus_tag LOCUS_15070 7111 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225423878.1 protein_id gnl|my_center|LOCUS_15070 7975 8775 gene locus_tag LOCUS_15080 7975 8775 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222015.1 protein_id gnl|my_center|LOCUS_15080 8777 9127 gene locus_tag LOCUS_15090 8777 9127 CDS product DUF5388 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222016.1 protein_id gnl|my_center|LOCUS_15090 10284 9730 gene locus_tag LOCUS_15100 10284 9730 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222018.1 protein_id gnl|my_center|LOCUS_15100 11627 11986 gene locus_tag LOCUS_15110 11627 11986 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222020.1 protein_id gnl|my_center|LOCUS_15110 11973 12335 gene locus_tag LOCUS_15120 gene arsD 11973 12335 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222021.1 protein_id gnl|my_center|LOCUS_15120 12419 14149 gene locus_tag LOCUS_15130 gene arsA 12419 14149 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222022.1 protein_id gnl|my_center|LOCUS_15130 14208 15503 gene locus_tag LOCUS_15140 14208 15503 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222023.1 protein_id gnl|my_center|LOCUS_15140 15520 15849 gene locus_tag LOCUS_15150 15520 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678453.1 protein_id gnl|my_center|LOCUS_15150 15872 16171 gene locus_tag LOCUS_15160 15872 16171 CDS product arsenic metallochaperone ArsD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678452.1 protein_id gnl|my_center|LOCUS_15160 16195 17595 gene locus_tag LOCUS_15170 16195 17595 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222024.1 protein_id gnl|my_center|LOCUS_15170 17945 18313 gene locus_tag LOCUS_15180 17945 18313 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678450.1 protein_id gnl|my_center|LOCUS_15180 18315 18929 gene locus_tag LOCUS_15190 18315 18929 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222025.1 protein_id gnl|my_center|LOCUS_15190 19508 18954 gene locus_tag LOCUS_15200 19508 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 19942 20355 gene locus_tag LOCUS_15210 19942 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 20267 20668 gene locus_tag LOCUS_15220 20267 20668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 20661 20981 gene locus_tag LOCUS_15230 20661 20981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003584159.1 protein_id gnl|my_center|LOCUS_15230 20974 21360 gene locus_tag LOCUS_15240 20974 21360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566163.1 protein_id gnl|my_center|LOCUS_15240 22437 21478 gene locus_tag LOCUS_15250 22437 21478 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476165.1 protein_id gnl|my_center|LOCUS_15250 23576 22452 gene locus_tag LOCUS_15260 23576 22452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057811338.1 protein_id gnl|my_center|LOCUS_15260 23795 23580 gene locus_tag LOCUS_15270 23795 23580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222028.1 protein_id gnl|my_center|LOCUS_15270 25434 23917 gene locus_tag LOCUS_15280 25434 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 25557 26243 gene locus_tag LOCUS_15290 25557 26243 CDS product IS6 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055307866.1 protein_id gnl|my_center|LOCUS_15290 28135 26309 gene locus_tag LOCUS_15300 28135 26309 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003581516.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence031 1597 44 gene locus_tag LOCUS_15310 gene guaA 1597 44 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824490.1 protein_id gnl|my_center|LOCUS_15310 2640 1720 gene locus_tag LOCUS_15320 gene coaA 2640 1720 CDS product type I pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476408.1 protein_id gnl|my_center|LOCUS_15320 5216 2916 gene locus_tag LOCUS_15330 gene helD 5216 2916 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476315.1 protein_id gnl|my_center|LOCUS_15330 5394 6035 gene locus_tag LOCUS_15340 5394 6035 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162685289.1 protein_id gnl|my_center|LOCUS_15340 6274 6945 gene locus_tag LOCUS_15350 6274 6945 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475535.1 protein_id gnl|my_center|LOCUS_15350 8053 7100 gene locus_tag LOCUS_15360 8053 7100 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643241.1 protein_id gnl|my_center|LOCUS_15360 9118 8069 gene locus_tag LOCUS_15370 9118 8069 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476524.1 protein_id gnl|my_center|LOCUS_15370 10152 9127 gene locus_tag LOCUS_15380 10152 9127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700958.1 protein_id gnl|my_center|LOCUS_15380 11086 10157 gene locus_tag LOCUS_15390 11086 10157 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702695.1 protein_id gnl|my_center|LOCUS_15390 12871 11246 gene locus_tag LOCUS_15400 12871 11246 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476525.1 protein_id gnl|my_center|LOCUS_15400 13259 14512 gene locus_tag LOCUS_15410 gene hflX 13259 14512 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563879.1 protein_id gnl|my_center|LOCUS_15410 15404 14751 gene locus_tag LOCUS_15420 15404 14751 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476340.1 protein_id gnl|my_center|LOCUS_15420 16057 15419 gene locus_tag LOCUS_15430 16057 15419 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701287.1 protein_id gnl|my_center|LOCUS_15430 16881 16054 gene locus_tag LOCUS_15440 16881 16054 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101188.1 protein_id gnl|my_center|LOCUS_15440 17629 16895 gene locus_tag LOCUS_15450 17629 16895 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701689.1 protein_id gnl|my_center|LOCUS_15450 18740 17934 gene locus_tag LOCUS_15460 18740 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476342.1 protein_id gnl|my_center|LOCUS_15460 19219 18752 gene locus_tag LOCUS_15470 19219 18752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 19724 19296 gene locus_tag LOCUS_15480 19724 19296 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563840.1 protein_id gnl|my_center|LOCUS_15480 20268 19828 gene locus_tag LOCUS_15490 20268 19828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 20673 22061 gene locus_tag LOCUS_15500 20673 22061 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 protein_id gnl|my_center|LOCUS_15500 22431 24854 gene locus_tag LOCUS_15510 22431 24854 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476404.1 protein_id gnl|my_center|LOCUS_15510 24919 25833 gene locus_tag LOCUS_15520 24919 25833 CDS product proline-specific peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644004.1 protein_id gnl|my_center|LOCUS_15520 26246 27562 gene locus_tag LOCUS_15530 26246 27562 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476353.1 protein_id gnl|my_center|LOCUS_15530 27592 27954 gene locus_tag LOCUS_15540 27592 27954 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476354.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence032 787 23 gene locus_tag LOCUS_15550 787 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1281 1108 gene locus_tag LOCUS_15560 1281 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2127 1297 gene locus_tag LOCUS_15570 2127 1297 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815634.1 protein_id gnl|my_center|LOCUS_15570 2954 2142 gene locus_tag LOCUS_15580 2954 2142 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165149.1 protein_id gnl|my_center|LOCUS_15580 3454 2963 gene locus_tag LOCUS_15590 3454 2963 CDS product PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027849.1 protein_id gnl|my_center|LOCUS_15590 3876 3451 gene locus_tag LOCUS_15600 3876 3451 CDS product mannose/fructose/sorbose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815636.1 protein_id gnl|my_center|LOCUS_15600 4689 3892 gene locus_tag LOCUS_15610 4689 3892 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674993.1 protein_id gnl|my_center|LOCUS_15610 4855 5835 gene locus_tag LOCUS_15620 4855 5835 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048331.1 protein_id gnl|my_center|LOCUS_15620 5949 7187 gene locus_tag LOCUS_15630 5949 7187 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815633.1 protein_id gnl|my_center|LOCUS_15630 8232 7660 gene locus_tag LOCUS_15640 gene pdxT 8232 7660 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932189.1 protein_id gnl|my_center|LOCUS_15640 9128 8244 gene locus_tag LOCUS_15650 gene pdxS 9128 8244 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247145.1 protein_id gnl|my_center|LOCUS_15650 9242 10678 gene locus_tag LOCUS_15660 9242 10678 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925710.1 protein_id gnl|my_center|LOCUS_15660 12047 10818 gene locus_tag LOCUS_15670 12047 10818 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263119.1 protein_id gnl|my_center|LOCUS_15670 13092 12061 gene locus_tag LOCUS_15680 13092 12061 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263118.1 protein_id gnl|my_center|LOCUS_15680 14084 13116 gene locus_tag LOCUS_15690 14084 13116 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897599.1 protein_id gnl|my_center|LOCUS_15690 15492 14152 gene locus_tag LOCUS_15700 gene lpdA 15492 14152 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263116.1 protein_id gnl|my_center|LOCUS_15700 17809 16001 gene locus_tag LOCUS_15710 17809 16001 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881436.1 protein_id gnl|my_center|LOCUS_15710 20257 18227 gene locus_tag LOCUS_15720 20257 18227 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643475.1 protein_id gnl|my_center|LOCUS_15720 22131 20674 gene locus_tag LOCUS_15730 22131 20674 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102196.1 protein_id gnl|my_center|LOCUS_15730 23975 22161 gene locus_tag LOCUS_15740 23975 22161 CDS product beta-glucoside-specific PTS transporter subunit IIABC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102197.1 protein_id gnl|my_center|LOCUS_15740 24951 24097 gene locus_tag LOCUS_15750 24951 24097 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643570.1 protein_id gnl|my_center|LOCUS_15750 25762 25130 gene locus_tag LOCUS_15760 25762 25130 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295401.1 protein_id gnl|my_center|LOCUS_15760 26082 26279 gene locus_tag LOCUS_15770 26082 26279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358191.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence033 212 63 gene locus_tag LOCUS_15780 212 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 193 693 gene locus_tag LOCUS_15790 193 693 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034982991.1 protein_id gnl|my_center|LOCUS_15790 829 707 gene locus_tag LOCUS_15800 829 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 2381 1089 gene locus_tag LOCUS_15810 2381 1089 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700902.1 protein_id gnl|my_center|LOCUS_15810 4081 2696 gene locus_tag LOCUS_15820 gene dnaB 4081 2696 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702157.1 protein_id gnl|my_center|LOCUS_15820 4563 4114 gene locus_tag LOCUS_15830 gene rplI 4563 4114 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700898.1 protein_id gnl|my_center|LOCUS_15830 6591 4588 gene locus_tag LOCUS_15840 6591 4588 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476541.1 protein_id gnl|my_center|LOCUS_15840 7602 6835 gene locus_tag LOCUS_15850 gene pnuC 7602 6835 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565044.1 protein_id gnl|my_center|LOCUS_15850 8033 7797 gene locus_tag LOCUS_15860 gene rpsR 8033 7797 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701427.1 protein_id gnl|my_center|LOCUS_15860 8569 8054 gene locus_tag LOCUS_15870 gene ssb 8569 8054 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703384.1 protein_id gnl|my_center|LOCUS_15870 8897 8610 gene locus_tag LOCUS_15880 gene rpsF 8897 8610 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703382.1 protein_id gnl|my_center|LOCUS_15880 11554 9089 gene locus_tag LOCUS_15890 gene gyrA 11554 9089 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703396.1 protein_id gnl|my_center|LOCUS_15890 13546 11597 gene locus_tag LOCUS_15900 gene gyrB 13546 11597 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703395.1 protein_id gnl|my_center|LOCUS_15900 14709 13585 gene locus_tag LOCUS_15910 gene recF 14709 13585 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475454.1 protein_id gnl|my_center|LOCUS_15910 14941 14714 gene locus_tag LOCUS_15920 gene yaaA 14941 14714 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701414.1 protein_id gnl|my_center|LOCUS_15920 16916 15291 gene locus_tag LOCUS_15930 16916 15291 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101261.1 protein_id gnl|my_center|LOCUS_15930 18344 17208 gene locus_tag LOCUS_15940 gene dnaN 18344 17208 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475453.1 protein_id gnl|my_center|LOCUS_15940 19869 18514 gene locus_tag LOCUS_15950 gene dnaA 19869 18514 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701412.1 protein_id gnl|my_center|LOCUS_15950 20381 20515 gene locus_tag LOCUS_15960 20381 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 20580 20921 gene locus_tag LOCUS_15970 gene rnpA 20580 20921 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701410.1 protein_id gnl|my_center|LOCUS_15970 20951 21784 gene locus_tag LOCUS_15980 20951 21784 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705633.1 protein_id gnl|my_center|LOCUS_15980 23909 22002 gene locus_tag LOCUS_15990 23909 22002 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476506.1 protein_id gnl|my_center|LOCUS_15990 24821 23967 gene locus_tag LOCUS_16000 24821 23967 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674020.1 protein_id gnl|my_center|LOCUS_16000 25131 25577 gene locus_tag LOCUS_16010 25131 25577 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701002.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence034 2253 145 gene locus_tag LOCUS_16020 2253 145 CDS product putative ornithine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547166.1 protein_id gnl|my_center|LOCUS_16020 2441 3664 gene locus_tag LOCUS_16030 2441 3664 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102145.1 protein_id gnl|my_center|LOCUS_16030 4428 3706 gene locus_tag LOCUS_16040 4428 3706 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699748.1 protein_id gnl|my_center|LOCUS_16040 5271 4435 gene locus_tag LOCUS_16050 gene larE 5271 4435 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641716.1 protein_id gnl|my_center|LOCUS_16050 6523 5294 gene locus_tag LOCUS_16060 gene larC 6523 5294 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369243.1 protein_id gnl|my_center|LOCUS_16060 7281 6520 gene locus_tag LOCUS_16070 gene larB 7281 6520 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_16070 8566 7283 gene locus_tag LOCUS_16080 gene larA 8566 7283 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100883.1 protein_id gnl|my_center|LOCUS_16080 8766 9479 gene locus_tag LOCUS_16090 8766 9479 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641710.1 protein_id gnl|my_center|LOCUS_16090 9618 10913 gene locus_tag LOCUS_16100 9618 10913 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616720.1 protein_id gnl|my_center|LOCUS_16100 10910 12610 gene locus_tag LOCUS_16110 gene menD 10910 12610 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387681.1 protein_id gnl|my_center|LOCUS_16110 12613 13422 gene locus_tag LOCUS_16120 gene menH 12613 13422 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989779.1 protein_id gnl|my_center|LOCUS_16120 13419 14537 gene locus_tag LOCUS_16130 gene menC 13419 14537 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990009.1 protein_id gnl|my_center|LOCUS_16130 14954 15808 gene locus_tag LOCUS_16140 14954 15808 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704103.1 protein_id gnl|my_center|LOCUS_16140 16086 16586 gene locus_tag LOCUS_16150 16086 16586 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236612.1 protein_id gnl|my_center|LOCUS_16150 17115 16612 gene locus_tag LOCUS_16160 17115 16612 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640717.1 protein_id gnl|my_center|LOCUS_16160 18219 17119 gene locus_tag LOCUS_16170 18219 17119 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644490.1 protein_id gnl|my_center|LOCUS_16170 19528 18224 gene locus_tag LOCUS_16180 gene aroA 19528 18224 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644491.1 protein_id gnl|my_center|LOCUS_16180 20070 19537 gene locus_tag LOCUS_16190 20070 19537 CDS product amino acid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644492.1 protein_id gnl|my_center|LOCUS_16190 21259 20093 gene locus_tag LOCUS_16200 gene aroC 21259 20093 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644493.1 protein_id gnl|my_center|LOCUS_16200 22727 21276 gene locus_tag LOCUS_16210 22727 21276 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644494.1 protein_id gnl|my_center|LOCUS_16210 24358 23159 gene locus_tag LOCUS_16220 24358 23159 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100975.1 protein_id gnl|my_center|LOCUS_16220 25465 24725 gene locus_tag LOCUS_16230 25465 24725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence035 1894 92 gene locus_tag LOCUS_16240 gene pepF 1894 92 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475465.1 protein_id gnl|my_center|LOCUS_16240 2018 2860 gene locus_tag LOCUS_16250 2018 2860 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476536.1 protein_id gnl|my_center|LOCUS_16250 3031 4377 gene locus_tag LOCUS_16260 3031 4377 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476346.1 protein_id gnl|my_center|LOCUS_16260 4415 5209 gene locus_tag LOCUS_16270 gene proB 4415 5209 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476469.1 protein_id gnl|my_center|LOCUS_16270 5230 6477 gene locus_tag LOCUS_16280 5230 6477 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704295.1 protein_id gnl|my_center|LOCUS_16280 6551 7516 gene locus_tag LOCUS_16290 6551 7516 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705524.1 protein_id gnl|my_center|LOCUS_16290 7755 8408 gene locus_tag LOCUS_16300 7755 8408 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642580.1 protein_id gnl|my_center|LOCUS_16300 8439 9764 gene locus_tag LOCUS_16310 8439 9764 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476236.1 protein_id gnl|my_center|LOCUS_16310 9983 13549 gene locus_tag LOCUS_16320 9983 13549 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476467.1 protein_id gnl|my_center|LOCUS_16320 13536 17273 gene locus_tag LOCUS_16330 gene addA 13536 17273 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476466.1 protein_id gnl|my_center|LOCUS_16330 18092 17268 gene locus_tag LOCUS_16340 18092 17268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254053.1 protein_id gnl|my_center|LOCUS_16340 18200 18646 gene locus_tag LOCUS_16350 18200 18646 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701037.1 protein_id gnl|my_center|LOCUS_16350 18731 19456 gene locus_tag LOCUS_16360 18731 19456 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704313.1 protein_id gnl|my_center|LOCUS_16360 19499 20314 gene locus_tag LOCUS_16370 19499 20314 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476364.1 protein_id gnl|my_center|LOCUS_16370 20336 20647 gene locus_tag LOCUS_16380 gene trxA 20336 20647 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476363.1 protein_id gnl|my_center|LOCUS_16380 20689 21687 gene locus_tag LOCUS_16390 20689 21687 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033099007.1 protein_id gnl|my_center|LOCUS_16390 21732 23006 gene locus_tag LOCUS_16400 21732 23006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 23267 23758 gene locus_tag LOCUS_16410 23267 23758 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476359.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence036 66 908 gene locus_tag LOCUS_16420 gene ala 66 908 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023186.1 protein_id gnl|my_center|LOCUS_16420 1076 1897 gene locus_tag LOCUS_16430 1076 1897 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922504.1 protein_id gnl|my_center|LOCUS_16430 2376 4124 gene locus_tag LOCUS_16440 2376 4124 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563398.1 protein_id gnl|my_center|LOCUS_16440 4093 5877 gene locus_tag LOCUS_16450 4093 5877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593025.1 protein_id gnl|my_center|LOCUS_16450 7439 6102 gene locus_tag LOCUS_16460 7439 6102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 7604 8575 gene locus_tag LOCUS_16470 7604 8575 CDS product proline iminopeptidase-family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548604.1 protein_id gnl|my_center|LOCUS_16470 9144 8572 gene locus_tag LOCUS_16480 9144 8572 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563797.1 protein_id gnl|my_center|LOCUS_16480 9207 9794 gene locus_tag LOCUS_16490 9207 9794 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476280.1 protein_id gnl|my_center|LOCUS_16490 9826 10962 gene locus_tag LOCUS_16500 9826 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 11108 11845 gene locus_tag LOCUS_16510 11108 11845 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701006.1 protein_id gnl|my_center|LOCUS_16510 11994 12947 gene locus_tag LOCUS_16520 11994 12947 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836909.1 protein_id gnl|my_center|LOCUS_16520 13050 13508 gene locus_tag LOCUS_16530 13050 13508 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475491.1 protein_id gnl|my_center|LOCUS_16530 14596 13679 gene locus_tag LOCUS_16540 14596 13679 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100973.1 protein_id gnl|my_center|LOCUS_16540 15711 14626 gene locus_tag LOCUS_16550 15711 14626 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642221.1 protein_id gnl|my_center|LOCUS_16550 16798 15752 gene locus_tag LOCUS_16560 16798 15752 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101728.1 protein_id gnl|my_center|LOCUS_16560 17402 18796 gene locus_tag LOCUS_16570 gene mnmE 17402 18796 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700790.1 protein_id gnl|my_center|LOCUS_16570 18826 20730 gene locus_tag LOCUS_16580 gene mnmG 18826 20730 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700792.1 protein_id gnl|my_center|LOCUS_16580 21381 21205 gene locus_tag LOCUS_16590 21381 21205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 22066 22308 gene locus_tag LOCUS_16600 22066 22308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 22665 22489 gene locus_tag LOCUS_16610 22665 22489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 22813 22950 gene locus_tag LOCUS_16620 22813 22950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence037 284 4285 gene locus_tag LOCUS_16630 284 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 5542 6678 gene locus_tag LOCUS_16640 5542 6678 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267197.1 protein_id gnl|my_center|LOCUS_16640 6671 8644 gene locus_tag LOCUS_16650 6671 8644 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964794.1 protein_id gnl|my_center|LOCUS_16650 9030 11090 gene locus_tag LOCUS_16660 9030 11090 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 protein_id gnl|my_center|LOCUS_16660 13989 11926 gene locus_tag LOCUS_16670 13989 11926 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964123.1 protein_id gnl|my_center|LOCUS_16670 14329 14781 gene locus_tag LOCUS_16680 14329 14781 CDS product DUF3290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837296.1 protein_id gnl|my_center|LOCUS_16680 14783 15436 gene locus_tag LOCUS_16690 14783 15436 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641021.1 protein_id gnl|my_center|LOCUS_16690 16405 15491 gene locus_tag LOCUS_16700 16405 15491 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641317.1 protein_id gnl|my_center|LOCUS_16700 16556 18238 gene locus_tag LOCUS_16710 gene dld 16556 18238 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097938.1 protein_id gnl|my_center|LOCUS_16710 18366 19607 gene locus_tag LOCUS_16720 18366 19607 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390064.1 protein_id gnl|my_center|LOCUS_16720 20914 19826 gene locus_tag LOCUS_16730 20914 19826 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102058.1 protein_id gnl|my_center|LOCUS_16730 21257 21796 gene locus_tag LOCUS_16740 21257 21796 CDS product YagU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906096.1 protein_id gnl|my_center|LOCUS_16740 22133 22723 gene locus_tag LOCUS_16750 22133 22723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence038 1403 72 gene locus_tag LOCUS_16760 1403 72 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254512.1 protein_id gnl|my_center|LOCUS_16760 2636 1473 gene locus_tag LOCUS_16770 2636 1473 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475582.1 protein_id gnl|my_center|LOCUS_16770 3341 2652 gene locus_tag LOCUS_16780 3341 2652 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475581.1 protein_id gnl|my_center|LOCUS_16780 3665 4378 gene locus_tag LOCUS_16790 gene budA 3665 4378 CDS product acetolactate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390224.1 protein_id gnl|my_center|LOCUS_16790 6843 4567 gene locus_tag LOCUS_16800 6843 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 8275 6878 gene locus_tag LOCUS_16810 8275 6878 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379356.1 protein_id gnl|my_center|LOCUS_16810 8651 9682 gene locus_tag LOCUS_16820 gene argC 8651 9682 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646527.1 protein_id gnl|my_center|LOCUS_16820 9710 10912 gene locus_tag LOCUS_16830 gene argJ 9710 10912 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101044.1 protein_id gnl|my_center|LOCUS_16830 10936 11700 gene locus_tag LOCUS_16840 gene argB 10936 11700 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642071.1 protein_id gnl|my_center|LOCUS_16840 11684 12835 gene locus_tag LOCUS_16850 11684 12835 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101045.1 protein_id gnl|my_center|LOCUS_16850 12846 13865 gene locus_tag LOCUS_16860 gene argF 12846 13865 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101046.1 protein_id gnl|my_center|LOCUS_16860 15500 14133 gene locus_tag LOCUS_16870 15500 14133 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674855.1 protein_id gnl|my_center|LOCUS_16870 16382 15912 gene locus_tag LOCUS_16880 16382 15912 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100891.1 protein_id gnl|my_center|LOCUS_16880 17667 16411 gene locus_tag LOCUS_16890 17667 16411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_16890 17851 17690 gene locus_tag LOCUS_16900 17851 17690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 18183 18040 gene locus_tag LOCUS_16910 18183 18040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003681696.1 protein_id gnl|my_center|LOCUS_16910 18320 18183 gene locus_tag LOCUS_16920 18320 18183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 19402 18410 gene locus_tag LOCUS_16930 gene hemH 19402 18410 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364185.1 protein_id gnl|my_center|LOCUS_16930 19636 20316 gene locus_tag LOCUS_16940 19636 20316 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642969.1 protein_id gnl|my_center|LOCUS_16940 20323 21069 gene locus_tag LOCUS_16950 20323 21069 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642968.1 protein_id gnl|my_center|LOCUS_16950 21179 21520 gene locus_tag LOCUS_16960 21179 21520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence039 2412 244 gene locus_tag LOCUS_16970 2412 244 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475771.1 protein_id gnl|my_center|LOCUS_16970 2627 3814 gene locus_tag LOCUS_16980 2627 3814 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101808.1 protein_id gnl|my_center|LOCUS_16980 3903 4760 gene locus_tag LOCUS_16990 3903 4760 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642758.1 protein_id gnl|my_center|LOCUS_16990 5011 6360 gene locus_tag LOCUS_17000 5011 6360 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699746.1 protein_id gnl|my_center|LOCUS_17000 6515 7447 gene locus_tag LOCUS_17010 6515 7447 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102098.1 protein_id gnl|my_center|LOCUS_17010 7463 8308 gene locus_tag LOCUS_17020 gene hisJ 7463 8308 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642710.1 protein_id gnl|my_center|LOCUS_17020 8648 9817 gene locus_tag LOCUS_17030 gene hisZ 8648 9817 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644683.1 protein_id gnl|my_center|LOCUS_17030 9792 10433 gene locus_tag LOCUS_17040 gene hisG 9792 10433 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642712.1 protein_id gnl|my_center|LOCUS_17040 10445 11731 gene locus_tag LOCUS_17050 gene hisD 10445 11731 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101827.1 protein_id gnl|my_center|LOCUS_17050 11733 12317 gene locus_tag LOCUS_17060 gene hisB 11733 12317 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644682.1 protein_id gnl|my_center|LOCUS_17060 12318 12932 gene locus_tag LOCUS_17070 gene hisH 12318 12932 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101826.1 protein_id gnl|my_center|LOCUS_17070 12929 13654 gene locus_tag LOCUS_17080 gene hisA 12929 13654 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642716.1 protein_id gnl|my_center|LOCUS_17080 13644 14402 gene locus_tag LOCUS_17090 gene hisF 13644 14402 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646590.1 protein_id gnl|my_center|LOCUS_17090 14399 14722 gene locus_tag LOCUS_17100 gene hisI 14399 14722 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646591.1 protein_id gnl|my_center|LOCUS_17100 14724 15044 gene locus_tag LOCUS_17110 gene hisE 14724 15044 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642719.1 protein_id gnl|my_center|LOCUS_17110 15055 16131 gene locus_tag LOCUS_17120 gene hisC 15055 16131 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101825.1 protein_id gnl|my_center|LOCUS_17120 16211 17185 gene locus_tag LOCUS_17130 16211 17185 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174124611.1 protein_id gnl|my_center|LOCUS_17130 18107 17373 gene locus_tag LOCUS_17140 18107 17373 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674285.1 protein_id gnl|my_center|LOCUS_17140 18256 18741 gene locus_tag LOCUS_17150 18256 18741 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705862.1 protein_id gnl|my_center|LOCUS_17150 18768 19478 gene locus_tag LOCUS_17160 gene dapD 18768 19478 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003708242.1 protein_id gnl|my_center|LOCUS_17160 19652 20800 gene locus_tag LOCUS_17170 19652 20800 CDS product N-acetyldiaminopimelate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475772.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence040 882 127 gene locus_tag LOCUS_17180 882 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 979 2250 gene locus_tag LOCUS_17190 979 2250 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475597.1 protein_id gnl|my_center|LOCUS_17190 2243 3196 gene locus_tag LOCUS_17200 2243 3196 CDS product IpaB/EvcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475598.1 protein_id gnl|my_center|LOCUS_17200 3316 5355 gene locus_tag LOCUS_17210 gene metG 3316 5355 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475599.1 protein_id gnl|my_center|LOCUS_17210 5424 6191 gene locus_tag LOCUS_17220 5424 6191 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475600.1 protein_id gnl|my_center|LOCUS_17220 6188 6751 gene locus_tag LOCUS_17230 gene rnmV 6188 6751 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475601.1 protein_id gnl|my_center|LOCUS_17230 6741 7637 gene locus_tag LOCUS_17240 gene rsmA 6741 7637 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475602.1 protein_id gnl|my_center|LOCUS_17240 7732 7974 gene locus_tag LOCUS_17250 7732 7974 CDS product Veg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567734.1 protein_id gnl|my_center|LOCUS_17250 8106 8966 gene locus_tag LOCUS_17260 gene ispE 8106 8966 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475606.1 protein_id gnl|my_center|LOCUS_17260 10703 9315 gene locus_tag LOCUS_17270 gene argH 10703 9315 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475672.1 protein_id gnl|my_center|LOCUS_17270 11941 10706 gene locus_tag LOCUS_17280 11941 10706 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475673.1 protein_id gnl|my_center|LOCUS_17280 12545 13723 gene locus_tag LOCUS_17290 12545 13723 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475674.1 protein_id gnl|my_center|LOCUS_17290 13727 14713 gene locus_tag LOCUS_17300 13727 14713 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475675.1 protein_id gnl|my_center|LOCUS_17300 14740 15786 gene locus_tag LOCUS_17310 14740 15786 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475676.1 protein_id gnl|my_center|LOCUS_17310 16253 17092 gene locus_tag LOCUS_17320 gene purR 16253 17092 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702595.1 protein_id gnl|my_center|LOCUS_17320 17284 18696 gene locus_tag LOCUS_17330 gene glmU 17284 18696 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475681.1 protein_id gnl|my_center|LOCUS_17330 18778 19752 gene locus_tag LOCUS_17340 18778 19752 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475682.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence041 52 378 gene locus_tag LOCUS_17350 52 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1193 636 gene locus_tag LOCUS_17360 gene efp 1193 636 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700953.1 protein_id gnl|my_center|LOCUS_17360 1472 2110 gene locus_tag LOCUS_17370 1472 2110 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390042.1 protein_id gnl|my_center|LOCUS_17370 2246 3499 gene locus_tag LOCUS_17380 2246 3499 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476014.1 protein_id gnl|my_center|LOCUS_17380 3496 3906 gene locus_tag LOCUS_17390 3496 3906 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705736.1 protein_id gnl|my_center|LOCUS_17390 3890 4042 gene locus_tag LOCUS_17400 3890 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 5043 4195 gene locus_tag LOCUS_17410 5043 4195 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475713.1 protein_id gnl|my_center|LOCUS_17410 5223 6428 gene locus_tag LOCUS_17420 5223 6428 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102228.1 protein_id gnl|my_center|LOCUS_17420 6870 7958 gene locus_tag LOCUS_17430 6870 7958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356508.1 protein_id gnl|my_center|LOCUS_17430 8010 8810 gene locus_tag LOCUS_17440 8010 8810 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356510.1 protein_id gnl|my_center|LOCUS_17440 8810 9637 gene locus_tag LOCUS_17450 8810 9637 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287036.1 protein_id gnl|my_center|LOCUS_17450 9651 10721 gene locus_tag LOCUS_17460 9651 10721 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002376560.1 protein_id gnl|my_center|LOCUS_17460 10765 11652 gene locus_tag LOCUS_17470 gene rarD 10765 11652 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001224293.1 protein_id gnl|my_center|LOCUS_17470 12029 12412 gene locus_tag LOCUS_17480 12029 12412 CDS product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101596.1 protein_id gnl|my_center|LOCUS_17480 12412 12798 gene locus_tag LOCUS_17490 12412 12798 CDS product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674081.1 protein_id gnl|my_center|LOCUS_17490 13940 13143 gene locus_tag LOCUS_17500 13940 13143 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082558.1 protein_id gnl|my_center|LOCUS_17500 14036 14977 gene locus_tag LOCUS_17510 14036 14977 CDS product DUF1177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391755.1 protein_id gnl|my_center|LOCUS_17510 15004 15948 gene locus_tag LOCUS_17520 15004 15948 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391757.1 protein_id gnl|my_center|LOCUS_17520 15965 16630 gene locus_tag LOCUS_17530 15965 16630 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391752.1 protein_id gnl|my_center|LOCUS_17530 16627 18204 gene locus_tag LOCUS_17540 16627 18204 CDS product OPT/YSL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062285060.1 protein_id gnl|my_center|LOCUS_17540 18218 18901 gene locus_tag LOCUS_17550 18218 18901 CDS product AroM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391756.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence042 681 67 gene locus_tag LOCUS_17560 681 67 CDS product DUF1054 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359064.1 protein_id gnl|my_center|LOCUS_17560 2492 711 gene locus_tag LOCUS_17570 2492 711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702733.1 protein_id gnl|my_center|LOCUS_17570 4216 2492 gene locus_tag LOCUS_17580 4216 2492 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475471.1 protein_id gnl|my_center|LOCUS_17580 4945 4244 gene locus_tag LOCUS_17590 4945 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640317.1 protein_id gnl|my_center|LOCUS_17590 5398 4949 gene locus_tag LOCUS_17600 5398 4949 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948329.1 protein_id gnl|my_center|LOCUS_17600 5721 7028 gene locus_tag LOCUS_17610 5721 7028 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379729.1 protein_id gnl|my_center|LOCUS_17610 7044 8189 gene locus_tag LOCUS_17620 7044 8189 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966119.1 protein_id gnl|my_center|LOCUS_17620 8284 9123 gene locus_tag LOCUS_17630 8284 9123 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476132.1 protein_id gnl|my_center|LOCUS_17630 10435 9326 gene locus_tag LOCUS_17640 gene hisC 10435 9326 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897361.1 protein_id gnl|my_center|LOCUS_17640 10571 10392 gene locus_tag LOCUS_17650 10571 10392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 11978 10611 gene locus_tag LOCUS_17660 11978 10611 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704283.1 protein_id gnl|my_center|LOCUS_17660 13275 11995 gene locus_tag LOCUS_17670 13275 11995 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014518834.1 protein_id gnl|my_center|LOCUS_17670 14037 13297 gene locus_tag LOCUS_17680 14037 13297 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565291.1 protein_id gnl|my_center|LOCUS_17680 14736 14050 gene locus_tag LOCUS_17690 14736 14050 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_17690 15593 14763 gene locus_tag LOCUS_17700 15593 14763 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922504.1 protein_id gnl|my_center|LOCUS_17700 16450 15611 gene locus_tag LOCUS_17710 16450 15611 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963698.1 protein_id gnl|my_center|LOCUS_17710 18107 16464 gene locus_tag LOCUS_17720 18107 16464 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227487.1 protein_id gnl|my_center|LOCUS_17720 >Feature sequence043 798 271 gene locus_tag LOCUS_17730 798 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2015 945 gene locus_tag LOCUS_17740 2015 945 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_17740 2686 2012 gene locus_tag LOCUS_17750 2686 2012 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_17750 3047 2766 gene locus_tag LOCUS_17760 3047 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 3638 3153 gene locus_tag LOCUS_17770 3638 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 4688 4302 gene locus_tag LOCUS_17780 4688 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 5885 4938 gene locus_tag LOCUS_17790 5885 4938 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_17790 6826 5903 gene locus_tag LOCUS_17800 6826 5903 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948840.1 protein_id gnl|my_center|LOCUS_17800 8495 6849 gene locus_tag LOCUS_17810 8495 6849 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101336.1 protein_id gnl|my_center|LOCUS_17810 9920 8601 gene locus_tag LOCUS_17820 9920 8601 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386630.1 protein_id gnl|my_center|LOCUS_17820 10260 10505 gene locus_tag LOCUS_17830 10260 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17830 10451 11137 gene locus_tag LOCUS_17840 10451 11137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17840 11215 11421 gene locus_tag LOCUS_17850 11215 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 13689 11890 gene locus_tag LOCUS_17860 gene lmrA 13689 11890 CDS product multidrug efflux ABC transporter LmrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905525.1 protein_id gnl|my_center|LOCUS_17860 14433 13822 gene locus_tag LOCUS_17870 14433 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 16802 14898 gene locus_tag LOCUS_17880 16802 14898 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066516.1 protein_id gnl|my_center|LOCUS_17880 18399 17122 gene locus_tag LOCUS_17890 18399 17122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence044 379 1575 gene locus_tag LOCUS_17900 379 1575 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476299.1 protein_id gnl|my_center|LOCUS_17900 2005 4239 gene locus_tag LOCUS_17910 gene pcrA 2005 4239 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225356248.1 protein_id gnl|my_center|LOCUS_17910 4263 6284 gene locus_tag LOCUS_17920 gene ligA 4263 6284 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476297.1 protein_id gnl|my_center|LOCUS_17920 6281 7438 gene locus_tag LOCUS_17930 6281 7438 CDS product CamS family sex pheromone protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701508.1 protein_id gnl|my_center|LOCUS_17930 7519 7821 gene locus_tag LOCUS_17940 gene gatC 7519 7821 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702422.1 protein_id gnl|my_center|LOCUS_17940 7825 9288 gene locus_tag LOCUS_17950 gene gatA 7825 9288 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476296.1 protein_id gnl|my_center|LOCUS_17950 9288 10718 gene locus_tag LOCUS_17960 gene gatB 9288 10718 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476295.1 protein_id gnl|my_center|LOCUS_17960 10773 11810 gene locus_tag LOCUS_17970 10773 11810 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563760.1 protein_id gnl|my_center|LOCUS_17970 11946 13322 gene locus_tag LOCUS_17980 gene rlmD 11946 13322 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476294.1 protein_id gnl|my_center|LOCUS_17980 13837 14544 gene locus_tag LOCUS_17990 13837 14544 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642440.1 protein_id gnl|my_center|LOCUS_17990 14544 15281 gene locus_tag LOCUS_18000 14544 15281 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701034.1 protein_id gnl|my_center|LOCUS_18000 15307 16116 gene locus_tag LOCUS_18010 15307 16116 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593281.1 protein_id gnl|my_center|LOCUS_18010 17080 16169 gene locus_tag LOCUS_18020 17080 16169 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549598.1 protein_id gnl|my_center|LOCUS_18020 17456 18151 gene locus_tag LOCUS_18030 17456 18151 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369289.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence045 200 640 gene locus_tag LOCUS_18040 gene tnpA 200 640 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377988.1 protein_id gnl|my_center|LOCUS_18040 2250 901 gene locus_tag LOCUS_18050 2250 901 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643171.1 protein_id gnl|my_center|LOCUS_18050 3077 2247 gene locus_tag LOCUS_18060 3077 2247 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643172.1 protein_id gnl|my_center|LOCUS_18060 4027 3077 gene locus_tag LOCUS_18070 4027 3077 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101355.1 protein_id gnl|my_center|LOCUS_18070 5102 3984 gene locus_tag LOCUS_18080 5102 3984 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101354.1 protein_id gnl|my_center|LOCUS_18080 5904 6899 gene locus_tag LOCUS_18090 gene dhaK 5904 6899 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701020.1 protein_id gnl|my_center|LOCUS_18090 6913 7497 gene locus_tag LOCUS_18100 gene dhaL 6913 7497 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704296.1 protein_id gnl|my_center|LOCUS_18100 7494 7868 gene locus_tag LOCUS_18110 gene dhaM 7494 7868 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704317.1 protein_id gnl|my_center|LOCUS_18110 7881 8585 gene locus_tag LOCUS_18120 7881 8585 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548130.1 protein_id gnl|my_center|LOCUS_18120 8850 10136 gene locus_tag LOCUS_18130 8850 10136 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389936.1 protein_id gnl|my_center|LOCUS_18130 10120 11010 gene locus_tag LOCUS_18140 10120 11010 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034565176.1 protein_id gnl|my_center|LOCUS_18140 11003 11821 gene locus_tag LOCUS_18150 11003 11821 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299926.1 protein_id gnl|my_center|LOCUS_18150 11833 12921 gene locus_tag LOCUS_18160 11833 12921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299925.1 protein_id gnl|my_center|LOCUS_18160 12936 13784 gene locus_tag LOCUS_18170 12936 13784 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102094.1 protein_id gnl|my_center|LOCUS_18170 14049 14621 gene locus_tag LOCUS_18180 14049 14621 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648778.1 protein_id gnl|my_center|LOCUS_18180 14652 15662 gene locus_tag LOCUS_18190 14652 15662 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481279.1 protein_id gnl|my_center|LOCUS_18190 15877 17451 gene locus_tag LOCUS_18200 15877 17451 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642253.1 protein_id gnl|my_center|LOCUS_18200 17491 17919 gene locus_tag LOCUS_18210 17491 17919 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642254.1 protein_id gnl|my_center|LOCUS_18210 >Feature sequence046 1454 120 gene locus_tag LOCUS_18220 1454 120 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476236.1 protein_id gnl|my_center|LOCUS_18220 2212 1529 gene locus_tag LOCUS_18230 gene rpiA 2212 1529 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706781.1 protein_id gnl|my_center|LOCUS_18230 2519 2226 gene locus_tag LOCUS_18240 2519 2226 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702618.1 protein_id gnl|my_center|LOCUS_18240 2623 3159 gene locus_tag LOCUS_18250 2623 3159 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476235.1 protein_id gnl|my_center|LOCUS_18250 3243 4613 gene locus_tag LOCUS_18260 gene radA 3243 4613 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476234.1 protein_id gnl|my_center|LOCUS_18260 4635 5762 gene locus_tag LOCUS_18270 4635 5762 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700688.1 protein_id gnl|my_center|LOCUS_18270 5891 7375 gene locus_tag LOCUS_18280 gene gltX 5891 7375 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700687.1 protein_id gnl|my_center|LOCUS_18280 7692 9113 gene locus_tag LOCUS_18290 gene cysS 7692 9113 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476233.1 protein_id gnl|my_center|LOCUS_18290 9106 9510 gene locus_tag LOCUS_18300 9106 9510 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700685.1 protein_id gnl|my_center|LOCUS_18300 9512 10261 gene locus_tag LOCUS_18310 gene rlmB 9512 10261 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702630.1 protein_id gnl|my_center|LOCUS_18310 10264 10800 gene locus_tag LOCUS_18320 10264 10800 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700683.1 protein_id gnl|my_center|LOCUS_18320 10855 11004 gene locus_tag LOCUS_18330 gene rpmG 10855 11004 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003637768.1 protein_id gnl|my_center|LOCUS_18330 11017 11184 gene locus_tag LOCUS_18340 gene secE 11017 11184 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700681.1 protein_id gnl|my_center|LOCUS_18340 11316 11867 gene locus_tag LOCUS_18350 gene nusG 11316 11867 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702631.1 protein_id gnl|my_center|LOCUS_18350 11890 12624 gene locus_tag LOCUS_18360 11890 12624 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101075.1 protein_id gnl|my_center|LOCUS_18360 12739 13164 gene locus_tag LOCUS_18370 gene rplK 12739 13164 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700679.1 protein_id gnl|my_center|LOCUS_18370 13266 13955 gene locus_tag LOCUS_18380 gene rplA 13266 13955 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700678.1 protein_id gnl|my_center|LOCUS_18380 14181 14684 gene locus_tag LOCUS_18390 gene rplJ 14181 14684 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700677.1 protein_id gnl|my_center|LOCUS_18390 14730 15098 gene locus_tag LOCUS_18400 gene rplL 14730 15098 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476232.1 protein_id gnl|my_center|LOCUS_18400 15242 17827 gene locus_tag LOCUS_18410 gene mprF 15242 17827 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476230.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence047 354 2549 gene locus_tag LOCUS_18420 354 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 4168 2873 gene locus_tag LOCUS_18430 4168 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 4946 4146 gene locus_tag LOCUS_18440 4946 4146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 5442 4975 gene locus_tag LOCUS_18450 5442 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 5670 6359 gene locus_tag LOCUS_18460 5670 6359 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003606146.1 protein_id gnl|my_center|LOCUS_18460 6376 7743 gene locus_tag LOCUS_18470 6376 7743 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596410.1 protein_id gnl|my_center|LOCUS_18470 8559 9500 gene locus_tag LOCUS_18480 8559 9500 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674971.1 protein_id gnl|my_center|LOCUS_18480 9559 10221 gene locus_tag LOCUS_18490 9559 10221 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674972.1 protein_id gnl|my_center|LOCUS_18490 10208 10849 gene locus_tag LOCUS_18500 10208 10849 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596406.1 protein_id gnl|my_center|LOCUS_18500 11918 12910 gene locus_tag LOCUS_18510 11918 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 13001 14812 gene locus_tag LOCUS_18520 13001 14812 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642848.1 protein_id gnl|my_center|LOCUS_18520 14837 15241 gene locus_tag LOCUS_18530 gene arsC 14837 15241 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288294.1 protein_id gnl|my_center|LOCUS_18530 15564 16103 gene locus_tag LOCUS_18540 15564 16103 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354975.1 protein_id gnl|my_center|LOCUS_18540 16197 17363 gene locus_tag LOCUS_18550 16197 17363 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475983.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence048 1493 90 gene locus_tag LOCUS_18560 1493 90 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642338.1 protein_id gnl|my_center|LOCUS_18560 2620 1916 gene locus_tag LOCUS_18570 2620 1916 CDS product lactate utilization protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674741.1 protein_id gnl|my_center|LOCUS_18570 4091 2613 gene locus_tag LOCUS_18580 4091 2613 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674742.1 protein_id gnl|my_center|LOCUS_18580 4871 4104 gene locus_tag LOCUS_18590 4871 4104 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570970.1 protein_id gnl|my_center|LOCUS_18590 5545 5069 gene locus_tag LOCUS_18600 5545 5069 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587210.1 protein_id gnl|my_center|LOCUS_18600 6358 5804 gene locus_tag LOCUS_18610 6358 5804 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357432.1 protein_id gnl|my_center|LOCUS_18610 6950 7993 gene locus_tag LOCUS_18620 6950 7993 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003605017.1 protein_id gnl|my_center|LOCUS_18620 7996 8682 gene locus_tag LOCUS_18630 7996 8682 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595940.1 protein_id gnl|my_center|LOCUS_18630 10226 8733 gene locus_tag LOCUS_18640 10226 8733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 10710 10219 gene locus_tag LOCUS_18650 10710 10219 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721449.1 protein_id gnl|my_center|LOCUS_18650 10889 11494 gene locus_tag LOCUS_18660 10889 11494 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003575135.1 protein_id gnl|my_center|LOCUS_18660 12434 11676 gene locus_tag LOCUS_18670 12434 11676 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130282.1 protein_id gnl|my_center|LOCUS_18670 12617 13171 gene locus_tag LOCUS_18680 12617 13171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 13865 13173 gene locus_tag LOCUS_18690 13865 13173 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864370.1 protein_id gnl|my_center|LOCUS_18690 14123 15634 gene locus_tag LOCUS_18700 gene glpK 14123 15634 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700771.1 protein_id gnl|my_center|LOCUS_18700 15649 17328 gene locus_tag LOCUS_18710 15649 17328 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439581.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence049 422 126 gene locus_tag LOCUS_18720 422 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 605 441 gene locus_tag LOCUS_18730 605 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 2901 655 gene locus_tag LOCUS_18740 2901 655 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669015.1 protein_id gnl|my_center|LOCUS_18740 3583 3152 gene locus_tag LOCUS_18750 3583 3152 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816262.1 protein_id gnl|my_center|LOCUS_18750 4279 4938 gene locus_tag LOCUS_18760 4279 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 6314 4989 gene locus_tag LOCUS_18770 6314 4989 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674951.1 protein_id gnl|my_center|LOCUS_18770 7279 6320 gene locus_tag LOCUS_18780 7279 6320 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567800.1 protein_id gnl|my_center|LOCUS_18780 8811 7279 gene locus_tag LOCUS_18790 8811 7279 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003596286.1 protein_id gnl|my_center|LOCUS_18790 9637 9014 gene locus_tag LOCUS_18800 9637 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 10292 9732 gene locus_tag LOCUS_18810 10292 9732 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569255.1 protein_id gnl|my_center|LOCUS_18810 10650 10300 gene locus_tag LOCUS_18820 10650 10300 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563881.1 protein_id gnl|my_center|LOCUS_18820 10860 11237 gene locus_tag LOCUS_18830 10860 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 11526 11179 gene locus_tag LOCUS_18840 11526 11179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222043.1 protein_id gnl|my_center|LOCUS_18840 13674 11611 gene locus_tag LOCUS_18850 gene mobQ 13674 11611 CDS product MobQ family relaxase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035454417.1 protein_id gnl|my_center|LOCUS_18850 13946 14155 gene locus_tag LOCUS_18860 13946 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241756.1 protein_id gnl|my_center|LOCUS_18860 14178 14456 gene locus_tag LOCUS_18870 14178 14456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222046.1 protein_id gnl|my_center|LOCUS_18870 14997 14446 gene locus_tag LOCUS_18880 14997 14446 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18880 15329 15132 gene locus_tag LOCUS_18890 15329 15132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241754.1 protein_id gnl|my_center|LOCUS_18890 16095 15484 gene locus_tag LOCUS_18900 16095 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061777522.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence050 36 110 gene locus_tag LOCUS_t00240 36 110 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 133 217 gene locus_tag LOCUS_t00250 133 217 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 223 298 gene locus_tag LOCUS_t00260 223 298 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 306 377 gene locus_tag LOCUS_t00270 306 377 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 390 477 gene locus_tag LOCUS_t00280 390 477 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 492 567 gene locus_tag LOCUS_t00290 492 567 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 571 646 gene locus_tag LOCUS_t00300 571 646 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 685 759 gene locus_tag LOCUS_t00310 685 759 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 973 1440 gene locus_tag LOCUS_18910 973 1440 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644086.1 protein_id gnl|my_center|LOCUS_18910 1458 3923 gene locus_tag LOCUS_18920 1458 3923 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101242.1 protein_id gnl|my_center|LOCUS_18920 4322 7909 gene locus_tag LOCUS_18930 4322 7909 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699705.1 protein_id gnl|my_center|LOCUS_18930 7972 11640 gene locus_tag LOCUS_18940 gene rpoC 7972 11640 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701972.1 protein_id gnl|my_center|LOCUS_18940 12651 13064 gene locus_tag LOCUS_18950 gene rpsL 12651 13064 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641249.1 protein_id gnl|my_center|LOCUS_18950 13094 13564 gene locus_tag LOCUS_18960 gene rpsG 13094 13564 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699701.1 protein_id gnl|my_center|LOCUS_18960 13675 15768 gene locus_tag LOCUS_18970 gene fusA 13675 15768 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475578.1 protein_id gnl|my_center|LOCUS_18970 >Feature sequence051 1596 424 gene locus_tag LOCUS_18980 1596 424 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640436.1 protein_id gnl|my_center|LOCUS_18980 1965 1819 gene locus_tag LOCUS_18990 1965 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2326 2075 gene locus_tag LOCUS_19000 2326 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2795 3097 gene locus_tag LOCUS_19010 2795 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 3892 3689 gene locus_tag LOCUS_19020 3892 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4703 4470 gene locus_tag LOCUS_19030 4703 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 5047 6147 gene locus_tag LOCUS_19040 gene pdhA 5047 6147 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700825.1 protein_id gnl|my_center|LOCUS_19040 6150 7127 gene locus_tag LOCUS_19050 6150 7127 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700827.1 protein_id gnl|my_center|LOCUS_19050 7139 8470 gene locus_tag LOCUS_19060 7139 8470 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475556.1 protein_id gnl|my_center|LOCUS_19060 8475 9881 gene locus_tag LOCUS_19070 gene lpdA 8475 9881 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700832.1 protein_id gnl|my_center|LOCUS_19070 9894 10907 gene locus_tag LOCUS_19080 9894 10907 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709185.1 protein_id gnl|my_center|LOCUS_19080 11152 12291 gene locus_tag LOCUS_19090 11152 12291 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475558.1 protein_id gnl|my_center|LOCUS_19090 12329 13138 gene locus_tag LOCUS_19100 12329 13138 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476575.1 protein_id gnl|my_center|LOCUS_19100 13176 13334 gene locus_tag LOCUS_19110 13176 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 13315 14295 gene locus_tag LOCUS_19120 13315 14295 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_19120 15004 14279 gene locus_tag LOCUS_19130 15004 14279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence052 468 175 gene locus_tag LOCUS_19140 468 175 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593046.1 protein_id gnl|my_center|LOCUS_19140 1126 572 gene locus_tag LOCUS_19150 1126 572 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003595059.1 protein_id gnl|my_center|LOCUS_19150 1579 2661 gene locus_tag LOCUS_19160 1579 2661 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101250.1 protein_id gnl|my_center|LOCUS_19160 3828 2815 gene locus_tag LOCUS_19170 3828 2815 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101898.1 protein_id gnl|my_center|LOCUS_19170 4262 3825 gene locus_tag LOCUS_19180 4262 3825 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641108.1 protein_id gnl|my_center|LOCUS_19180 5105 4497 gene locus_tag LOCUS_19190 5105 4497 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476278.1 protein_id gnl|my_center|LOCUS_19190 5249 6082 gene locus_tag LOCUS_19200 5249 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050611271.1 protein_id gnl|my_center|LOCUS_19200 6824 6219 gene locus_tag LOCUS_19210 6824 6219 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476385.1 protein_id gnl|my_center|LOCUS_19210 7578 6853 gene locus_tag LOCUS_19220 7578 6853 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703401.1 protein_id gnl|my_center|LOCUS_19220 7815 8810 gene locus_tag LOCUS_19230 gene galE 7815 8810 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476382.1 protein_id gnl|my_center|LOCUS_19230 9215 8913 gene locus_tag LOCUS_19240 9215 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702995.1 protein_id gnl|my_center|LOCUS_19240 9485 11407 gene locus_tag LOCUS_19250 9485 11407 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206540837.1 protein_id gnl|my_center|LOCUS_19250 11639 12697 gene locus_tag LOCUS_19260 11639 12697 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476377.1 protein_id gnl|my_center|LOCUS_19260 12705 13886 gene locus_tag LOCUS_19270 12705 13886 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476376.1 protein_id gnl|my_center|LOCUS_19270 13994 14680 gene locus_tag LOCUS_19280 13994 14680 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703418.1 protein_id gnl|my_center|LOCUS_19280 >Feature sequence053 36 110 gene locus_tag LOCUS_t00320 36 110 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 189 264 gene locus_tag LOCUS_t00330 189 264 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 272 343 gene locus_tag LOCUS_t00340 272 343 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 356 443 gene locus_tag LOCUS_t00350 356 443 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 458 533 gene locus_tag LOCUS_t00360 458 533 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 537 612 gene locus_tag LOCUS_t00370 537 612 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 639 714 gene locus_tag LOCUS_t00380 639 714 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 733 808 gene locus_tag LOCUS_t00390 733 808 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 853 942 gene locus_tag LOCUS_t00400 853 942 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 952 1027 gene locus_tag LOCUS_t00410 952 1027 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1028 1103 gene locus_tag LOCUS_t00420 1028 1103 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1136 1210 gene locus_tag LOCUS_t00430 1136 1210 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1220 1290 gene locus_tag LOCUS_t00440 1220 1290 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1305 1394 gene locus_tag LOCUS_t00450 1305 1394 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1400 1473 gene locus_tag LOCUS_t00460 1400 1473 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1481 1556 gene locus_tag LOCUS_t00470 1481 1556 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1557 1632 gene locus_tag LOCUS_t00480 1557 1632 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1823 3013 gene locus_tag LOCUS_19290 gene metK 1823 3013 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475757.1 protein_id gnl|my_center|LOCUS_19290 3349 5766 gene locus_tag LOCUS_19300 gene leuS 3349 5766 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475758.1 protein_id gnl|my_center|LOCUS_19300 6042 7718 gene locus_tag LOCUS_19310 6042 7718 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699719.1 protein_id gnl|my_center|LOCUS_19310 7715 8437 gene locus_tag LOCUS_19320 7715 8437 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234884.1 protein_id gnl|my_center|LOCUS_19320 9566 8721 gene locus_tag LOCUS_19330 9566 8721 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475761.1 protein_id gnl|my_center|LOCUS_19330 9701 11101 gene locus_tag LOCUS_19340 gene pepV 9701 11101 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475762.1 protein_id gnl|my_center|LOCUS_19340 11260 11505 gene locus_tag LOCUS_19350 11260 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 11588 11869 gene locus_tag LOCUS_19360 11588 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709782.1 protein_id gnl|my_center|LOCUS_19360 12336 11887 gene locus_tag LOCUS_19370 12336 11887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 12965 12666 gene locus_tag LOCUS_19380 12965 12666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 13199 14158 gene locus_tag LOCUS_19390 13199 14158 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800998.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence054 6 1166 gene locus_tag LOCUS_19400 6 1166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081491.1 protein_id gnl|my_center|LOCUS_19400 1881 1255 gene locus_tag LOCUS_19410 1881 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129888.1 protein_id gnl|my_center|LOCUS_19410 2752 2156 gene locus_tag LOCUS_19420 gene lepB 2752 2156 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704639.1 protein_id gnl|my_center|LOCUS_19420 3054 3467 gene locus_tag LOCUS_19430 3054 3467 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003550121.1 protein_id gnl|my_center|LOCUS_19430 3460 6360 gene locus_tag LOCUS_19440 3460 6360 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476344.1 protein_id gnl|my_center|LOCUS_19440 6437 6781 gene locus_tag LOCUS_19450 6437 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 6804 7622 gene locus_tag LOCUS_19460 6804 7622 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548384.1 protein_id gnl|my_center|LOCUS_19460 8593 10365 gene locus_tag LOCUS_19470 8593 10365 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921966.1 protein_id gnl|my_center|LOCUS_19470 10826 12103 gene locus_tag LOCUS_19480 10826 12103 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674099.1 protein_id gnl|my_center|LOCUS_19480 12475 13959 gene locus_tag LOCUS_19490 gene guaB 12475 13959 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476343.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence055 483 64 gene locus_tag LOCUS_19500 483 64 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002315975.1 protein_id gnl|my_center|LOCUS_19500 1216 485 gene locus_tag LOCUS_19510 1216 485 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675715.1 protein_id gnl|my_center|LOCUS_19510 1290 1700 gene locus_tag LOCUS_19520 1290 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 2045 2971 gene locus_tag LOCUS_19530 2045 2971 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_19530 3190 4068 gene locus_tag LOCUS_19540 3190 4068 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 protein_id gnl|my_center|LOCUS_19540 4613 4239 gene locus_tag LOCUS_19550 4613 4239 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721437.1 protein_id gnl|my_center|LOCUS_19550 4764 5951 gene locus_tag LOCUS_19560 4764 5951 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003588846.1 protein_id gnl|my_center|LOCUS_19560 6435 6902 gene locus_tag LOCUS_19570 6435 6902 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549015.1 protein_id gnl|my_center|LOCUS_19570 6922 7395 gene locus_tag LOCUS_19580 6922 7395 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057799316.1 protein_id gnl|my_center|LOCUS_19580 7431 8201 gene locus_tag LOCUS_19590 7431 8201 CDS product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002469307.1 protein_id gnl|my_center|LOCUS_19590 8255 9415 gene locus_tag LOCUS_19600 8255 9415 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765527.1 protein_id gnl|my_center|LOCUS_19600 9444 10496 gene locus_tag LOCUS_19610 9444 10496 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296186.1 protein_id gnl|my_center|LOCUS_19610 10486 11157 gene locus_tag LOCUS_19620 10486 11157 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905283.1 protein_id gnl|my_center|LOCUS_19620 11170 12030 gene locus_tag LOCUS_19630 11170 12030 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569974.1 protein_id gnl|my_center|LOCUS_19630 12043 13137 gene locus_tag LOCUS_19640 12043 13137 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358821.1 protein_id gnl|my_center|LOCUS_19640 13544 13831 gene locus_tag LOCUS_19650 13544 13831 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476589.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence056 986 351 gene locus_tag LOCUS_19660 986 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19660 1141 965 gene locus_tag LOCUS_19670 1141 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 1676 1227 gene locus_tag LOCUS_19680 1676 1227 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234960.1 protein_id gnl|my_center|LOCUS_19680 2868 1858 gene locus_tag LOCUS_19690 2868 1858 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215631.1 protein_id gnl|my_center|LOCUS_19690 3685 3050 gene locus_tag LOCUS_19700 3685 3050 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101466.1 protein_id gnl|my_center|LOCUS_19700 5455 3746 gene locus_tag LOCUS_19710 5455 3746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101509.1 protein_id gnl|my_center|LOCUS_19710 5550 6092 gene locus_tag LOCUS_19720 5550 6092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 6370 7011 gene locus_tag LOCUS_19730 6370 7011 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703424.1 protein_id gnl|my_center|LOCUS_19730 7217 8140 gene locus_tag LOCUS_19740 7217 8140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966871.1 protein_id gnl|my_center|LOCUS_19740 8130 8903 gene locus_tag LOCUS_19750 8130 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 8905 9546 gene locus_tag LOCUS_19760 8905 9546 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003577317.1 protein_id gnl|my_center|LOCUS_19760 10355 9750 gene locus_tag LOCUS_19770 10355 9750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 11185 10616 gene locus_tag LOCUS_19780 11185 10616 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003592593.1 protein_id gnl|my_center|LOCUS_19780 11347 13149 gene locus_tag LOCUS_19790 11347 13149 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673967.1 protein_id gnl|my_center|LOCUS_19790 13192 13455 gene locus_tag LOCUS_19800 13192 13455 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199136.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence057 825 151 gene locus_tag LOCUS_19810 825 151 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706506.1 protein_id gnl|my_center|LOCUS_19810 2356 1157 gene locus_tag LOCUS_19820 2356 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 3678 2725 gene locus_tag LOCUS_19830 3678 2725 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643926.1 protein_id gnl|my_center|LOCUS_19830 4637 3693 gene locus_tag LOCUS_19840 4637 3693 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476237.1 protein_id gnl|my_center|LOCUS_19840 4844 6004 gene locus_tag LOCUS_19850 4844 6004 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101070.1 protein_id gnl|my_center|LOCUS_19850 7142 6159 gene locus_tag LOCUS_19860 7142 6159 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640915.1 protein_id gnl|my_center|LOCUS_19860 7367 7279 gene locus_tag LOCUS_t00490 7367 7279 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7874 7416 gene locus_tag LOCUS_19870 7874 7416 CDS product SprT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640904.1 protein_id gnl|my_center|LOCUS_19870 10058 7881 gene locus_tag LOCUS_19880 10058 7881 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640903.1 protein_id gnl|my_center|LOCUS_19880 10972 10145 gene locus_tag LOCUS_19890 gene nadE 10972 10145 CDS product ammonia-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476239.1 protein_id gnl|my_center|LOCUS_19890 12493 11030 gene locus_tag LOCUS_19900 12493 11030 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476240.1 protein_id gnl|my_center|LOCUS_19900 12674 13420 gene locus_tag LOCUS_19910 12674 13420 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702613.1 protein_id gnl|my_center|LOCUS_19910 >Feature sequence058 356 922 gene locus_tag LOCUS_19920 356 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 3123 919 gene locus_tag LOCUS_19930 3123 919 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070650885.1 protein_id gnl|my_center|LOCUS_19930 5527 3539 gene locus_tag LOCUS_19940 5527 3539 CDS product TraM recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109603.1 protein_id gnl|my_center|LOCUS_19940 6188 5520 gene locus_tag LOCUS_19950 6188 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 7576 8376 gene locus_tag LOCUS_19960 7576 8376 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706882.1 protein_id gnl|my_center|LOCUS_19960 8378 8728 gene locus_tag LOCUS_19970 8378 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 9115 8975 gene locus_tag LOCUS_19980 9115 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 9255 9911 gene locus_tag LOCUS_19990 9255 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19990 10447 9998 gene locus_tag LOCUS_20000 10447 9998 CDS product DUF305 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_20000 10804 10628 gene locus_tag LOCUS_20010 10804 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 11022 10804 gene locus_tag LOCUS_20020 11022 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 12090 11215 gene locus_tag LOCUS_20030 12090 11215 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640865.1 protein_id gnl|my_center|LOCUS_20030 12253 12035 gene locus_tag LOCUS_20040 12253 12035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 12493 12266 gene locus_tag LOCUS_20050 12493 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 >Feature sequence059 628 32 gene locus_tag LOCUS_20060 628 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 951 1220 gene locus_tag LOCUS_20070 951 1220 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703119.1 protein_id gnl|my_center|LOCUS_20070 1239 2582 gene locus_tag LOCUS_20080 1239 2582 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 protein_id gnl|my_center|LOCUS_20080 2833 3588 gene locus_tag LOCUS_20090 2833 3588 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709193.1 protein_id gnl|my_center|LOCUS_20090 3585 4502 gene locus_tag LOCUS_20100 gene pfkB 3585 4502 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003707131.1 protein_id gnl|my_center|LOCUS_20100 4518 6467 gene locus_tag LOCUS_20110 4518 6467 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101650.1 protein_id gnl|my_center|LOCUS_20110 7040 6588 gene locus_tag LOCUS_20120 7040 6588 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642743.1 protein_id gnl|my_center|LOCUS_20120 8713 7214 gene locus_tag LOCUS_20130 gene thrC 8713 7214 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101905.1 protein_id gnl|my_center|LOCUS_20130 8931 10214 gene locus_tag LOCUS_20140 8931 10214 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476391.1 protein_id gnl|my_center|LOCUS_20140 10240 11115 gene locus_tag LOCUS_20150 gene thrB 10240 11115 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692421.1 protein_id gnl|my_center|LOCUS_20150 11330 11977 gene locus_tag LOCUS_20160 11330 11977 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986980.1 protein_id gnl|my_center|LOCUS_20160 11999 12781 gene locus_tag LOCUS_20170 11999 12781 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence060 482 763 gene locus_tag LOCUS_20180 482 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 1426 1339 gene locus_tag LOCUS_t00500 1426 1339 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2234 1485 gene locus_tag LOCUS_20190 2234 1485 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546159.1 protein_id gnl|my_center|LOCUS_20190 2720 2304 gene locus_tag LOCUS_20200 2720 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3460 2984 gene locus_tag LOCUS_20210 gene greA 3460 2984 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475971.1 protein_id gnl|my_center|LOCUS_20210 4142 3486 gene locus_tag LOCUS_20220 gene udk 4142 3486 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700143.1 protein_id gnl|my_center|LOCUS_20220 5299 4166 gene locus_tag LOCUS_20230 gene mltG 5299 4166 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475970.1 protein_id gnl|my_center|LOCUS_20230 7859 5451 gene locus_tag LOCUS_20240 gene pheT 7859 5451 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475969.1 protein_id gnl|my_center|LOCUS_20240 8912 7866 gene locus_tag LOCUS_20250 gene pheS 8912 7866 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700137.1 protein_id gnl|my_center|LOCUS_20250 9744 9403 gene locus_tag LOCUS_20260 9744 9403 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704358.1 protein_id gnl|my_center|LOCUS_20260 10333 9833 gene locus_tag LOCUS_20270 10333 9833 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700135.1 protein_id gnl|my_center|LOCUS_20270 11208 10435 gene locus_tag LOCUS_20280 11208 10435 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475968.1 protein_id gnl|my_center|LOCUS_20280 11306 11578 gene locus_tag LOCUS_20290 11306 11578 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475805.1 protein_id gnl|my_center|LOCUS_20290 11688 12605 gene locus_tag LOCUS_20300 gene yidC 11688 12605 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475804.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence061 1268 465 gene locus_tag LOCUS_20310 1268 465 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131676.1 protein_id gnl|my_center|LOCUS_20310 2509 2018 gene locus_tag LOCUS_20320 2509 2018 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289239.1 protein_id gnl|my_center|LOCUS_20320 2781 3515 gene locus_tag LOCUS_20330 2781 3515 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_20330 3952 3668 gene locus_tag LOCUS_20340 3952 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 4726 3959 gene locus_tag LOCUS_20350 4726 3959 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263145.1 protein_id gnl|my_center|LOCUS_20350 6118 4952 gene locus_tag LOCUS_20360 6118 4952 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100995.1 protein_id gnl|my_center|LOCUS_20360 7669 6434 gene locus_tag LOCUS_20370 7669 6434 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286708.1 protein_id gnl|my_center|LOCUS_20370 8207 9613 gene locus_tag LOCUS_20380 8207 9613 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701275.1 protein_id gnl|my_center|LOCUS_20380 11841 9718 gene locus_tag LOCUS_20390 11841 9718 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387049.1 protein_id gnl|my_center|LOCUS_20390 >Feature sequence062 837 601 gene locus_tag LOCUS_20400 837 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1018 1716 gene locus_tag LOCUS_20410 1018 1716 CDS product LexA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475614.1 protein_id gnl|my_center|LOCUS_20410 1876 2070 gene locus_tag LOCUS_20420 1876 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2134 2835 gene locus_tag LOCUS_20430 2134 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2955 4388 gene locus_tag LOCUS_20440 2955 4388 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_20440 5463 4456 gene locus_tag LOCUS_20450 gene comGB 5463 4456 CDS product competence type IV pilus assembly protein ComGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475746.1 protein_id gnl|my_center|LOCUS_20450 6403 5441 gene locus_tag LOCUS_20460 gene comGA 6403 5441 CDS product competence type IV pilus ATPase ComGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475745.1 protein_id gnl|my_center|LOCUS_20460 7408 6503 gene locus_tag LOCUS_20470 gene rbsK 7408 6503 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702891.1 protein_id gnl|my_center|LOCUS_20470 8242 7514 gene locus_tag LOCUS_20480 8242 7514 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475744.1 protein_id gnl|my_center|LOCUS_20480 8833 8336 gene locus_tag LOCUS_20490 8833 8336 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701534.1 protein_id gnl|my_center|LOCUS_20490 9853 8852 gene locus_tag LOCUS_20500 gene ccpA 9853 8852 CDS product catabolite control protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475743.1 protein_id gnl|my_center|LOCUS_20500 10053 11159 gene locus_tag LOCUS_20510 10053 11159 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709752.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence063 333 548 gene locus_tag LOCUS_20520 333 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1807 812 gene locus_tag LOCUS_20530 1807 812 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000481279.1 protein_id gnl|my_center|LOCUS_20530 1915 2346 gene locus_tag LOCUS_20540 1915 2346 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418035.1 protein_id gnl|my_center|LOCUS_20540 2414 2662 gene locus_tag LOCUS_20550 2414 2662 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816285.1 protein_id gnl|my_center|LOCUS_20550 2926 3279 gene locus_tag LOCUS_20560 gene mobC 2926 3279 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002498952.1 protein_id gnl|my_center|LOCUS_20560 3815 3660 gene locus_tag LOCUS_20570 3815 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 3988 4566 gene locus_tag LOCUS_20580 3988 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 5624 4851 gene locus_tag LOCUS_20590 5624 4851 CDS product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905614.1 protein_id gnl|my_center|LOCUS_20590 6145 5780 gene locus_tag LOCUS_20600 6145 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 6707 7219 gene locus_tag LOCUS_20610 6707 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 7756 7577 gene locus_tag LOCUS_20620 7756 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 8570 8724 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtgattttcacatttccgctcgtaccaagggttt 9751 9921 gene locus_tag LOCUS_20630 9751 9921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 10544 10029 gene locus_tag LOCUS_20640 10544 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 10635 10886 gene locus_tag LOCUS_20650 10635 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence064 1252 134 gene locus_tag LOCUS_20660 1252 134 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675055.1 protein_id gnl|my_center|LOCUS_20660 1586 2242 gene locus_tag LOCUS_20670 1586 2242 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289185.1 protein_id gnl|my_center|LOCUS_20670 2427 3299 gene locus_tag LOCUS_20680 2427 3299 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476452.1 protein_id gnl|my_center|LOCUS_20680 3306 3962 gene locus_tag LOCUS_20690 3306 3962 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476451.1 protein_id gnl|my_center|LOCUS_20690 3962 4774 gene locus_tag LOCUS_20700 3962 4774 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476450.1 protein_id gnl|my_center|LOCUS_20700 6055 4880 gene locus_tag LOCUS_20710 6055 4880 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475515.1 protein_id gnl|my_center|LOCUS_20710 7154 6057 gene locus_tag LOCUS_20720 gene serC 7154 6057 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475514.1 protein_id gnl|my_center|LOCUS_20720 7702 9093 gene locus_tag LOCUS_20730 7702 9093 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101674.1 protein_id gnl|my_center|LOCUS_20730 >Feature sequence065 1526 5050 gene locus_tag LOCUS_20740 1526 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 5255 6160 gene locus_tag LOCUS_20750 gene cas1 5255 6160 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989953.1 protein_id gnl|my_center|LOCUS_20750 6150 6470 gene locus_tag LOCUS_20760 6150 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 6467 7498 gene locus_tag LOCUS_20770 6467 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 7566 8794 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttttgcactctcaacattttcctatcaataaaac >Feature sequence066 1107 19 gene locus_tag LOCUS_20780 1107 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 2156 1248 gene locus_tag LOCUS_20790 2156 1248 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948840.1 protein_id gnl|my_center|LOCUS_20790 3604 2411 gene locus_tag LOCUS_20800 3604 2411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 protein_id gnl|my_center|LOCUS_20800 4516 3626 gene locus_tag LOCUS_20810 4516 3626 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547989.1 protein_id gnl|my_center|LOCUS_20810 5464 4598 gene locus_tag LOCUS_20820 5464 4598 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431317.1 protein_id gnl|my_center|LOCUS_20820 6494 5574 gene locus_tag LOCUS_20830 6494 5574 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475981.1 protein_id gnl|my_center|LOCUS_20830 7506 6538 gene locus_tag LOCUS_20840 7506 6538 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475980.1 protein_id gnl|my_center|LOCUS_20840 8371 7694 gene locus_tag LOCUS_20850 8371 7694 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295463.1 protein_id gnl|my_center|LOCUS_20850 >Feature sequence067 174 28 gene locus_tag LOCUS_20860 174 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 587 219 gene locus_tag LOCUS_20870 gene tnpB 587 219 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921815.1 protein_id gnl|my_center|LOCUS_20870 754 584 gene locus_tag LOCUS_20880 754 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 2031 1060 gene locus_tag LOCUS_20890 2031 1060 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002322451.1 protein_id gnl|my_center|LOCUS_20890 2927 2100 gene locus_tag LOCUS_20900 2927 2100 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002400076.1 protein_id gnl|my_center|LOCUS_20900 3664 2939 gene locus_tag LOCUS_20910 3664 2939 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_20910 4295 3651 gene locus_tag LOCUS_20920 4295 3651 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358158.1 protein_id gnl|my_center|LOCUS_20920 5158 4337 gene locus_tag LOCUS_20930 5158 4337 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047707.1 protein_id gnl|my_center|LOCUS_20930 6689 5418 gene locus_tag LOCUS_20940 6689 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 7661 6957 gene locus_tag LOCUS_20950 7661 6957 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence068 131 700 gene locus_tag LOCUS_20960 131 700 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549286.1 protein_id gnl|my_center|LOCUS_20960 1100 2125 gene locus_tag LOCUS_20970 1100 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20970 2272 2460 gene locus_tag LOCUS_20980 2272 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20980 2587 2901 gene locus_tag LOCUS_20990 2587 2901 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665422.1 protein_id gnl|my_center|LOCUS_20990 2913 3770 gene locus_tag LOCUS_21000 2913 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 4856 3948 gene locus_tag LOCUS_21010 4856 3948 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476460.1 protein_id gnl|my_center|LOCUS_21010 5293 6081 gene locus_tag LOCUS_21020 5293 6081 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262133.1 protein_id gnl|my_center|LOCUS_21020 6118 7293 gene locus_tag LOCUS_21030 6118 7293 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703454.1 protein_id gnl|my_center|LOCUS_21030 7860 8297 gene locus_tag LOCUS_21040 7860 8297 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563791.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence069 369 5888 gene locus_tag LOCUS_21050 369 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 6534 6364 gene locus_tag LOCUS_21060 6534 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 6724 7224 gene locus_tag LOCUS_21070 6724 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence070 1306 695 gene locus_tag LOCUS_21080 1306 695 CDS product DUF4479 and tRNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475781.1 protein_id gnl|my_center|LOCUS_21080 1689 1369 gene locus_tag LOCUS_21090 1689 1369 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699770.1 protein_id gnl|my_center|LOCUS_21090 1858 2190 gene locus_tag LOCUS_21100 1858 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 2878 2231 gene locus_tag LOCUS_21110 gene trmB 2878 2231 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709822.1 protein_id gnl|my_center|LOCUS_21110 3815 3021 gene locus_tag LOCUS_21120 3815 3021 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699765.1 protein_id gnl|my_center|LOCUS_21120 4412 3888 gene locus_tag LOCUS_21130 4412 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 5826 5086 gene locus_tag LOCUS_21140 5826 5086 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699760.1 protein_id gnl|my_center|LOCUS_21140 5966 6394 gene locus_tag LOCUS_21150 5966 6394 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475778.1 protein_id gnl|my_center|LOCUS_21150 6398 6700 gene locus_tag LOCUS_21160 6398 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 6850 7737 gene locus_tag LOCUS_21170 6850 7737 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699757.1 protein_id gnl|my_center|LOCUS_21170 >Feature sequence071 497 111 gene locus_tag LOCUS_21180 497 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1068 523 gene locus_tag LOCUS_21190 1068 523 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975272.1 protein_id gnl|my_center|LOCUS_21190 2255 1068 gene locus_tag LOCUS_21200 2255 1068 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002392915.1 protein_id gnl|my_center|LOCUS_21200 2457 2239 gene locus_tag LOCUS_21210 2457 2239 CDS product DUF3173 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861908.1 protein_id gnl|my_center|LOCUS_21210 2702 2550 gene locus_tag LOCUS_21220 2702 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3486 2704 gene locus_tag LOCUS_21230 3486 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121259.1 protein_id gnl|my_center|LOCUS_21230 4024 3710 gene locus_tag LOCUS_21240 4024 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772799.1 protein_id gnl|my_center|LOCUS_21240 5469 4132 gene locus_tag LOCUS_21250 5469 4132 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475574.1 protein_id gnl|my_center|LOCUS_21250 5692 5486 gene locus_tag LOCUS_21260 5692 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 6059 5697 gene locus_tag LOCUS_21270 6059 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 6282 6061 gene locus_tag LOCUS_21280 6282 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 6590 6294 gene locus_tag LOCUS_21290 6590 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 6732 6607 gene locus_tag LOCUS_21300 6732 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 7118 6855 gene locus_tag LOCUS_21310 7118 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 >Feature sequence072 97 876 gene locus_tag LOCUS_21320 97 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1972 1424 gene locus_tag LOCUS_21330 1972 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 2700 2197 gene locus_tag LOCUS_21340 2700 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 4884 2731 gene locus_tag LOCUS_21350 4884 2731 CDS product DUF1906 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070650885.1 protein_id gnl|my_center|LOCUS_21350 5724 5137 gene locus_tag LOCUS_21360 5724 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 6045 5803 gene locus_tag LOCUS_21370 6045 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 >Feature sequence073 145 447 gene locus_tag LOCUS_21380 145 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 485 1234 gene locus_tag LOCUS_21390 485 1234 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646470.1 protein_id gnl|my_center|LOCUS_21390 1475 2563 gene locus_tag LOCUS_21400 1475 2563 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479781.1 protein_id gnl|my_center|LOCUS_21400 2567 3391 gene locus_tag LOCUS_21410 2567 3391 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421288.1 protein_id gnl|my_center|LOCUS_21410 3394 4212 gene locus_tag LOCUS_21420 3394 4212 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263896.1 protein_id gnl|my_center|LOCUS_21420 4209 5231 gene locus_tag LOCUS_21430 4209 5231 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564358.1 protein_id gnl|my_center|LOCUS_21430 5233 6105 gene locus_tag LOCUS_21440 gene hisJ 5233 6105 CDS product histidinol-phosphatase HisJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732654.1 protein_id gnl|my_center|LOCUS_21440 6117 6971 gene locus_tag LOCUS_21450 6117 6971 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095006144.1 protein_id gnl|my_center|LOCUS_21450 >Feature sequence074 570 103 gene locus_tag LOCUS_21460 570 103 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587210.1 protein_id gnl|my_center|LOCUS_21460 814 957 gene locus_tag LOCUS_21470 814 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 1323 1508 gene locus_tag LOCUS_21480 1323 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 4010 1713 gene locus_tag LOCUS_21490 4010 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 4648 4364 gene locus_tag LOCUS_21500 4648 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 5001 4648 gene locus_tag LOCUS_21510 5001 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 5096 5683 gene locus_tag LOCUS_21520 5096 5683 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 protein_id gnl|my_center|LOCUS_21520 6119 6313 gene locus_tag LOCUS_21530 6119 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010625611.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence075 1694 303 gene locus_tag LOCUS_21540 1694 303 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643131.1 protein_id gnl|my_center|LOCUS_21540 2725 2309 gene locus_tag LOCUS_21550 gene arsC 2725 2309 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288294.1 protein_id gnl|my_center|LOCUS_21550 3492 3271 gene locus_tag LOCUS_21560 3492 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 3873 5213 gene locus_tag LOCUS_21570 3873 5213 CDS product ISL3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081512349.1 protein_id gnl|my_center|LOCUS_21570 6375 5281 gene locus_tag LOCUS_21580 gene waaB 6375 5281 CDS product lipopolysaccharide 1,6-galactosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704702.1 protein_id gnl|my_center|LOCUS_21580 >Feature sequence076 175 246 gene locus_tag LOCUS_t00510 175 246 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 254 328 gene locus_tag LOCUS_t00520 254 328 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 714 1694 gene locus_tag LOCUS_21590 714 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 1837 2046 gene locus_tag LOCUS_21600 1837 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 2212 3681 gene locus_tag LOCUS_21610 2212 3681 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700706.1 protein_id gnl|my_center|LOCUS_21610 3758 3843 gene locus_tag LOCUS_t00530 3758 3843 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3846 3919 gene locus_tag LOCUS_t00540 3846 3919 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4081 4881 gene locus_tag LOCUS_21620 gene proC 4081 4881 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476242.1 protein_id gnl|my_center|LOCUS_21620 4902 6038 gene locus_tag LOCUS_21630 gene nagA 4902 6038 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476357.1 protein_id gnl|my_center|LOCUS_21630 6061 6762 gene locus_tag LOCUS_21640 6061 6762 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476241.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence077 994 224 gene locus_tag LOCUS_21650 994 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 3423 1819 gene locus_tag LOCUS_21660 3423 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 3731 3405 gene locus_tag LOCUS_21670 3731 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 4394 5599 gene locus_tag LOCUS_21680 4394 5599 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101621619.1 protein_id gnl|my_center|LOCUS_21680 5721 6404 gene locus_tag LOCUS_21690 5721 6404 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021922.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence078 491 147 gene locus_tag LOCUS_21700 491 147 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241744.1 protein_id gnl|my_center|LOCUS_21700 748 485 gene locus_tag LOCUS_21710 748 485 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001748109.1 protein_id gnl|my_center|LOCUS_21710 834 1421 gene locus_tag LOCUS_21720 834 1421 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050340461.1 protein_id gnl|my_center|LOCUS_21720 1519 2784 gene locus_tag LOCUS_21730 1519 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3150 3461 gene locus_tag LOCUS_21740 3150 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3578 5356 gene locus_tag LOCUS_21750 3578 5356 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_21750 5530 5844 gene locus_tag LOCUS_21760 5530 5844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 >Feature sequence079 670 1188 gene locus_tag LOCUS_21770 670 1188 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262616.1 protein_id gnl|my_center|LOCUS_21770 1507 1343 gene locus_tag LOCUS_21780 1507 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 1640 1819 gene locus_tag LOCUS_21790 1640 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1881 2741 gene locus_tag LOCUS_21800 1881 2741 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674020.1 protein_id gnl|my_center|LOCUS_21800 3466 3203 gene locus_tag LOCUS_21810 3466 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 4034 3456 gene locus_tag LOCUS_21820 4034 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 4149 4027 gene locus_tag LOCUS_21830 4149 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 4984 4229 gene locus_tag LOCUS_21840 gene fetB 4984 4229 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643458.1 protein_id gnl|my_center|LOCUS_21840 5631 4981 gene locus_tag LOCUS_21850 5631 4981 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642453.1 protein_id gnl|my_center|LOCUS_21850 6131 5646 gene locus_tag LOCUS_21860 6131 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 >Feature sequence080 63 3938 gene locus_tag LOCUS_21870 63 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 4166 4942 gene locus_tag LOCUS_21880 gene murI 4166 4942 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475984.1 protein_id gnl|my_center|LOCUS_21880 5621 5067 gene locus_tag LOCUS_21890 5621 5067 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476075.1 protein_id gnl|my_center|LOCUS_21890 >Feature sequence081 847 257 gene locus_tag LOCUS_21900 847 257 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000872882.1 protein_id gnl|my_center|LOCUS_21900 1126 1054 gene locus_tag LOCUS_t00550 1126 1054 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3549 1279 gene locus_tag LOCUS_21910 gene helD 3549 1279 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475590.1 protein_id gnl|my_center|LOCUS_21910 3876 4889 gene locus_tag LOCUS_21920 gene trpS 3876 4889 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699680.1 protein_id gnl|my_center|LOCUS_21920 4927 5868 gene locus_tag LOCUS_21930 4927 5868 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475592.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence082 604 41 gene locus_tag LOCUS_21940 604 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1944 904 gene locus_tag LOCUS_21950 1944 904 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020707.1 protein_id gnl|my_center|LOCUS_21950 3263 2082 gene locus_tag LOCUS_21960 3263 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476397.1 protein_id gnl|my_center|LOCUS_21960 4449 3334 gene locus_tag LOCUS_21970 gene glf 4449 3334 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476416.1 protein_id gnl|my_center|LOCUS_21970 4799 6031 gene locus_tag LOCUS_21980 4799 6031 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000685095.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence083 948 64 gene locus_tag LOCUS_21990 948 64 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476274.1 protein_id gnl|my_center|LOCUS_21990 1222 2190 gene locus_tag LOCUS_22000 1222 2190 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476272.1 protein_id gnl|my_center|LOCUS_22000 2572 3129 gene locus_tag LOCUS_22010 2572 3129 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476271.1 protein_id gnl|my_center|LOCUS_22010 3160 3876 gene locus_tag LOCUS_22020 3160 3876 CDS product glycoside hydrolase family 73 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703028.1 protein_id gnl|my_center|LOCUS_22020 4070 4657 gene locus_tag LOCUS_22030 4070 4657 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476270.1 protein_id gnl|my_center|LOCUS_22030 4650 5945 gene locus_tag LOCUS_22040 4650 5945 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476269.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence084 128 868 gene locus_tag LOCUS_22050 128 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 1444 920 gene locus_tag LOCUS_22060 1444 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 2228 1725 gene locus_tag LOCUS_22070 2228 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669028.1 protein_id gnl|my_center|LOCUS_22070 2765 2241 gene locus_tag LOCUS_22080 2765 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 3396 2926 gene locus_tag LOCUS_22090 3396 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22090 3724 3452 gene locus_tag LOCUS_22100 3724 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22100 4023 3763 gene locus_tag LOCUS_22110 4023 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 5302 5481 gene locus_tag LOCUS_22120 5302 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003587040.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence085 127 282 gene locus_tag LOCUS_22130 127 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 342 584 gene locus_tag LOCUS_22140 342 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641122.1 protein_id gnl|my_center|LOCUS_22140 725 1354 gene locus_tag LOCUS_22150 725 1354 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970705.1 protein_id gnl|my_center|LOCUS_22150 2745 1525 gene locus_tag LOCUS_22160 2745 1525 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645437.1 protein_id gnl|my_center|LOCUS_22160 3002 5692 gene locus_tag LOCUS_22170 gene adhE 3002 5692 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476657.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence086 658 1554 gene locus_tag LOCUS_22180 658 1554 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361212.1 protein_id gnl|my_center|LOCUS_22180 2548 1862 gene locus_tag LOCUS_22190 2548 1862 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101847.1 protein_id gnl|my_center|LOCUS_22190 4336 2969 gene locus_tag LOCUS_22200 4336 2969 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642338.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence087 282 1178 gene locus_tag LOCUS_22210 282 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1414 1596 gene locus_tag LOCUS_22220 1414 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 1617 1751 gene locus_tag LOCUS_22230 1617 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 1772 2446 gene locus_tag LOCUS_22240 1772 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22240 3234 4289 gene locus_tag LOCUS_22250 3234 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 4273 5403 gene locus_tag LOCUS_22260 4273 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence088 90 674 gene locus_tag LOCUS_22270 90 674 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241777.1 protein_id gnl|my_center|LOCUS_22270 809 1600 gene locus_tag LOCUS_22280 809 1600 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005717330.1 protein_id gnl|my_center|LOCUS_22280 1672 1911 gene locus_tag LOCUS_22290 1672 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 3241 3395 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aaacccttgctgcgcgcagaactgtaaattctaca 4133 4414 gene locus_tag LOCUS_22300 4133 4414 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222012.1 protein_id gnl|my_center|LOCUS_22300 4461 4646 gene locus_tag LOCUS_22310 4461 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011241754.1 protein_id gnl|my_center|LOCUS_22310 4643 5323 gene locus_tag LOCUS_22320 4643 5323 CDS product zeta toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142413611.1 protein_id gnl|my_center|LOCUS_22320 >Feature sequence089 211 609 gene locus_tag LOCUS_22330 211 609 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640765.1 protein_id gnl|my_center|LOCUS_22330 2488 872 gene locus_tag LOCUS_22340 2488 872 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010709260.1 protein_id gnl|my_center|LOCUS_22340 2880 3596 gene locus_tag LOCUS_22350 gene menG 2880 3596 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726790.1 protein_id gnl|my_center|LOCUS_22350 3946 4818 gene locus_tag LOCUS_22360 3946 4818 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164299.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence090 843 28 gene locus_tag LOCUS_22370 843 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 <4649 1004 gene locus_tag LOCUS_22380 <4649 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002352262.1:glycoside hydrolase family 70 protein >Feature sequence091 216 995 gene locus_tag LOCUS_22390 216 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2028 1060 gene locus_tag LOCUS_22400 2028 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2602 2177 gene locus_tag LOCUS_22410 2602 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3407 3039 gene locus_tag LOCUS_22420 3407 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 3676 3401 gene locus_tag LOCUS_22430 3676 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence092 134 424 gene locus_tag LOCUS_22440 134 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 581 1342 gene locus_tag LOCUS_22450 581 1342 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475982.1 protein_id gnl|my_center|LOCUS_22450 1532 1861 gene locus_tag LOCUS_22460 1532 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 2129 2995 gene locus_tag LOCUS_22470 2129 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254037.1 protein_id gnl|my_center|LOCUS_22470 3093 3356 gene locus_tag LOCUS_22480 3093 3356 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199136.1 protein_id gnl|my_center|LOCUS_22480 3634 4029 gene locus_tag LOCUS_22490 3634 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 <4494 3995 gene locus_tag LOCUS_22500 <4494 3995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003561810.1:IS30-like element ISLpl1 family transposase >Feature sequence093 >Feature sequence094 831 3952 gene locus_tag LOCUS_r00010 831 3952 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence095 580 245 gene locus_tag LOCUS_22510 580 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 917 594 gene locus_tag LOCUS_22520 917 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2621 990 gene locus_tag LOCUS_22530 2621 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2755 3039 gene locus_tag LOCUS_22540 2755 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 3040 3417 gene locus_tag LOCUS_22550 3040 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 <3991 3455 gene locus_tag LOCUS_22560 <3991 3455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050340461.1:site-specific integrase >Feature sequence096 2025 244 gene locus_tag LOCUS_22570 2025 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2227 3084 gene locus_tag LOCUS_22580 2227 3084 CDS product IS982-like element ISEfm1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295743.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence097 209 3448 gene locus_tag LOCUS_22590 209 3448 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674061.1 protein_id gnl|my_center|LOCUS_22590 >Feature sequence098 171 1127 gene locus_tag LOCUS_22600 171 1127 CDS product protein rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011222005.1 protein_id gnl|my_center|LOCUS_22600 1141 1311 gene locus_tag LOCUS_22610 1141 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1325 1531 gene locus_tag LOCUS_22620 1325 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 1862 3001 gene locus_tag LOCUS_22630 1862 3001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence099 3006 2317 gene locus_tag LOCUS_22640 3006 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3074 3295 gene locus_tag LOCUS_22650 3074 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence100 29 505 gene locus_tag LOCUS_22660 29 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 2432 738 gene locus_tag LOCUS_22670 2432 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476454.1 protein_id gnl|my_center|LOCUS_22670 <3391 2445 gene locus_tag LOCUS_22680 <3391 2445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003645220.1:glycosyltransferase family 2 protein >Feature sequence101 61 465 gene locus_tag LOCUS_22690 61 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1456 530 gene locus_tag LOCUS_22700 1456 530 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167582487.1 protein_id gnl|my_center|LOCUS_22700 1658 1527 gene locus_tag LOCUS_22710 1658 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 2277 2864 gene locus_tag LOCUS_22720 2277 2864 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674185.1 protein_id gnl|my_center|LOCUS_22720 2955 3344 gene locus_tag LOCUS_22730 2955 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence102 1307 1190 gene locus_tag LOCUS_r00020 1307 1190 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2577 2759 gene locus_tag LOCUS_22740 2577 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence103 95 592 gene locus_tag LOCUS_22750 95 592 CDS product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101511.1 protein_id gnl|my_center|LOCUS_22750 1070 582 gene locus_tag LOCUS_22760 1070 582 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576872.1 protein_id gnl|my_center|LOCUS_22760 1304 2464 gene locus_tag LOCUS_22770 1304 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 2513 2755 gene locus_tag LOCUS_22780 2513 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence104 102 1313 gene locus_tag LOCUS_22790 102 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 1936 1448 gene locus_tag LOCUS_22800 1936 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 2903 2196 gene locus_tag LOCUS_22810 2903 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence105 97 870 gene locus_tag LOCUS_22820 97 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 985 1767 gene locus_tag LOCUS_22830 985 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence106 193 360 gene locus_tag LOCUS_22840 193 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 801 1775 gene locus_tag LOCUS_22850 801 1775 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288613.1 protein_id gnl|my_center|LOCUS_22850 1804 2505 gene locus_tag LOCUS_22860 1804 2505 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_22860 2526 2723 gene locus_tag LOCUS_22870 2526 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 >Feature sequence107 316 50 gene locus_tag LOCUS_22880 316 50 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_22880 576 313 gene locus_tag LOCUS_22890 576 313 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_22890 1971 1018 gene locus_tag LOCUS_22900 1971 1018 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642346.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence108 >Feature sequence109 1085 171 gene locus_tag LOCUS_22910 1085 171 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824481.1 protein_id gnl|my_center|LOCUS_22910 1216 1617 gene locus_tag LOCUS_22920 1216 1617 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357316.1 protein_id gnl|my_center|LOCUS_22920 1637 2098 gene locus_tag LOCUS_22930 1637 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475742.1 protein_id gnl|my_center|LOCUS_22930 >Feature sequence110 1262 528 gene locus_tag LOCUS_22940 1262 528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002505902.1 protein_id gnl|my_center|LOCUS_22940 1412 1960 gene locus_tag LOCUS_22950 1412 1960 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053025875.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence111 >Feature sequence112 1488 184 gene locus_tag LOCUS_22960 1488 184 CDS product IS1380-like element ISEcp1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608644.1 protein_id gnl|my_center|LOCUS_22960 >Feature sequence113 1430 15 gene locus_tag LOCUS_22970 1430 15 CDS product IS5-like element ISLca2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568911.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence114 57 590 gene locus_tag LOCUS_22980 57 590 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476689.1 protein_id gnl|my_center|LOCUS_22980 605 1486 gene locus_tag LOCUS_22990 605 1486 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476688.1 protein_id gnl|my_center|LOCUS_22990 >Feature sequence115 >Feature sequence116 >Feature sequence117