>Feature sequence01 1431 2159 gene locus_tag LOCUS_00010 1431 2159 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_00010 2184 3542 gene locus_tag LOCUS_00020 gene rlmD 2184 3542 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_00020 3596 3718 gene locus_tag LOCUS_00030 3596 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3775 4785 gene locus_tag LOCUS_00040 3775 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4816 5703 gene locus_tag LOCUS_00050 4816 5703 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_00050 5792 6697 gene locus_tag LOCUS_00060 gene era 5792 6697 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_00060 6786 6953 gene locus_tag LOCUS_00070 6786 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7130 7702 gene locus_tag LOCUS_00080 7130 7702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00080 7806 8342 gene locus_tag LOCUS_00090 gene raiA 7806 8342 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_00090 8710 8513 gene locus_tag LOCUS_00100 8710 8513 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_00100 8991 9875 gene locus_tag LOCUS_00110 8991 9875 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966316.1 protein_id gnl|my_center|LOCUS_00110 9985 11109 gene locus_tag LOCUS_00120 9985 11109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11134 11832 gene locus_tag LOCUS_00130 11134 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11835 12674 gene locus_tag LOCUS_00140 11835 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12691 14658 gene locus_tag LOCUS_00150 12691 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14692 16773 gene locus_tag LOCUS_00160 14692 16773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16789 17541 gene locus_tag LOCUS_00170 16789 17541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17560 18072 gene locus_tag LOCUS_00180 17560 18072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18093 18524 gene locus_tag LOCUS_00190 18093 18524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 18609 19010 gene locus_tag LOCUS_00200 18609 19010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19038 19430 gene locus_tag LOCUS_00210 19038 19430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19460 20080 gene locus_tag LOCUS_00220 19460 20080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 20116 20655 gene locus_tag LOCUS_00230 20116 20655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 20723 22348 gene locus_tag LOCUS_00240 20723 22348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 22432 23643 gene locus_tag LOCUS_00250 gene spoIVB 22432 23643 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_00250 23798 24112 gene locus_tag LOCUS_00260 23798 24112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 25555 24173 gene locus_tag LOCUS_00270 gene murC 25555 24173 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_00270 25719 26069 gene locus_tag LOCUS_00280 gene spoVG 25719 26069 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359319.1 protein_id gnl|my_center|LOCUS_00280 26265 27005 gene locus_tag LOCUS_00290 26265 27005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27132 27689 gene locus_tag LOCUS_00300 gene pth 27132 27689 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_00300 27729 28916 gene locus_tag LOCUS_00310 27729 28916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 28962 30320 gene locus_tag LOCUS_00320 gene rimO 28962 30320 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_00320 30348 31604 gene locus_tag LOCUS_00330 30348 31604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31634 31969 gene locus_tag LOCUS_00340 31634 31969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 32601 32065 gene locus_tag LOCUS_00350 32601 32065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 32805 34070 gene locus_tag LOCUS_00360 32805 34070 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386376.1 protein_id gnl|my_center|LOCUS_00360 34247 35722 gene locus_tag LOCUS_00370 34247 35722 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_00370 35870 37162 gene locus_tag LOCUS_00380 35870 37162 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_00380 37392 37467 gene locus_tag LOCUS_t00010 37392 37467 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 37478 37554 gene locus_tag LOCUS_t00020 37478 37554 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 37563 37638 gene locus_tag LOCUS_t00030 37563 37638 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 37965 39668 gene locus_tag LOCUS_00390 37965 39668 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_00390 39772 40503 gene locus_tag LOCUS_00400 39772 40503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 42266 40545 gene locus_tag LOCUS_00410 42266 40545 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_00410 43153 42287 gene locus_tag LOCUS_00420 43153 42287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43253 44554 gene locus_tag LOCUS_00430 43253 44554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44650 45060 gene locus_tag LOCUS_00440 44650 45060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45064 47412 gene locus_tag LOCUS_00450 45064 47412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 47435 48586 gene locus_tag LOCUS_00460 47435 48586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 48608 48862 gene locus_tag LOCUS_00470 48608 48862 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549189.1 protein_id gnl|my_center|LOCUS_00470 48865 49296 gene locus_tag LOCUS_00480 gene ruvX 48865 49296 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964987.1 protein_id gnl|my_center|LOCUS_00480 49356 49655 gene locus_tag LOCUS_00490 49356 49655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 49732 50217 gene locus_tag LOCUS_00500 49732 50217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 50279 51310 gene locus_tag LOCUS_00510 50279 51310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 51333 51932 gene locus_tag LOCUS_00520 51333 51932 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476167.1 protein_id gnl|my_center|LOCUS_00520 52064 52372 gene locus_tag LOCUS_00530 52064 52372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 52373 52549 gene locus_tag LOCUS_00540 52373 52549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 52565 52984 gene locus_tag LOCUS_00550 52565 52984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 52977 53291 gene locus_tag LOCUS_00560 gene cutA 52977 53291 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250982.1 protein_id gnl|my_center|LOCUS_00560 53416 54279 gene locus_tag LOCUS_00570 53416 54279 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_194812347.1 protein_id gnl|my_center|LOCUS_00570 54281 54961 gene locus_tag LOCUS_00580 54281 54961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 54966 55337 gene locus_tag LOCUS_00590 54966 55337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 55348 55917 gene locus_tag LOCUS_00600 55348 55917 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946184.1 protein_id gnl|my_center|LOCUS_00600 55921 56853 gene locus_tag LOCUS_00610 gene ylqF 55921 56853 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967235.1 protein_id gnl|my_center|LOCUS_00610 56895 57299 gene locus_tag LOCUS_00620 56895 57299 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860630.1 protein_id gnl|my_center|LOCUS_00620 57296 57475 gene locus_tag LOCUS_00630 57296 57475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 57393 57968 gene locus_tag LOCUS_00640 57393 57968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 58115 58189 gene locus_tag LOCUS_t00040 58115 58189 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 58410 61136 gene locus_tag LOCUS_00650 58410 61136 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546265.1 protein_id gnl|my_center|LOCUS_00650 61470 63044 gene locus_tag LOCUS_00660 gene metG 61470 63044 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226758.1 protein_id gnl|my_center|LOCUS_00660 63077 64006 gene locus_tag LOCUS_00670 63077 64006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 64030 66363 gene locus_tag LOCUS_00680 64030 66363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 66446 66528 gene locus_tag LOCUS_t00050 66446 66528 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 66778 67083 gene locus_tag LOCUS_00690 66778 67083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 67105 67371 gene locus_tag LOCUS_00700 67105 67371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 67558 68622 gene locus_tag LOCUS_00710 67558 68622 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_00710 68642 69751 gene locus_tag LOCUS_00720 68642 69751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 69779 71578 gene locus_tag LOCUS_00730 gene ftsH 69779 71578 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_00730 71738 72583 gene locus_tag LOCUS_00740 gene prmC 71738 72583 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_00740 72699 72905 gene locus_tag LOCUS_00750 72699 72905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 72923 75121 gene locus_tag LOCUS_00760 72923 75121 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 protein_id gnl|my_center|LOCUS_00760 75251 76129 gene locus_tag LOCUS_00770 gene whiA 75251 76129 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_00770 76122 76331 gene locus_tag LOCUS_00780 76122 76331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 76300 77274 gene locus_tag LOCUS_00790 gene hemW 76300 77274 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00790 77364 78995 gene locus_tag LOCUS_00800 gene recN 77364 78995 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_00800 79066 80334 gene locus_tag LOCUS_00810 gene eno 79066 80334 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_00810 81820 80462 gene locus_tag LOCUS_00820 81820 80462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 82022 82222 gene locus_tag LOCUS_00830 82022 82222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 82238 82555 gene locus_tag LOCUS_00840 82238 82555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 82603 83622 gene locus_tag LOCUS_00850 gene pheS 82603 83622 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965654.1 protein_id gnl|my_center|LOCUS_00850 83696 84028 gene locus_tag LOCUS_00860 83696 84028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 84057 86477 gene locus_tag LOCUS_00870 gene pheT 84057 86477 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_00870 86606 86806 gene locus_tag LOCUS_00880 86606 86806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 87784 88341 gene locus_tag LOCUS_00890 87784 88341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986441.1 protein_id gnl|my_center|LOCUS_00890 88495 88761 gene locus_tag LOCUS_00900 gene rpsO 88495 88761 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_00900 88983 91085 gene locus_tag LOCUS_00910 gene pnp 88983 91085 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_00910 91169 92026 gene locus_tag LOCUS_00920 91169 92026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 92077 92511 gene locus_tag LOCUS_00930 92077 92511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 92554 93576 gene locus_tag LOCUS_00940 gene queA 92554 93576 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048087.1 protein_id gnl|my_center|LOCUS_00940 93706 94833 gene locus_tag LOCUS_00950 gene tgt 93706 94833 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_00950 94846 96372 gene locus_tag LOCUS_00960 94846 96372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 96522 96980 gene locus_tag LOCUS_00970 gene rimP 96522 96980 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439519.1 protein_id gnl|my_center|LOCUS_00970 96996 98141 gene locus_tag LOCUS_00980 gene nusA 96996 98141 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_00980 98180 98440 gene locus_tag LOCUS_00990 98180 98440 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965106.1 protein_id gnl|my_center|LOCUS_00990 98430 98750 gene locus_tag LOCUS_01000 98430 98750 CDS product ribosomal L7Ae/L30e/S12e/Gadd45 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547810.1 protein_id gnl|my_center|LOCUS_01000 98743 101709 gene locus_tag LOCUS_01010 98743 101709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 101902 102267 gene locus_tag LOCUS_01020 gene rbfA 101902 102267 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_01020 102269 103225 gene locus_tag LOCUS_01030 102269 103225 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986790.1 protein_id gnl|my_center|LOCUS_01030 103364 104221 gene locus_tag LOCUS_01040 gene truB 103364 104221 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_01040 104267 105118 gene locus_tag LOCUS_01050 104267 105118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 105421 108021 gene locus_tag LOCUS_01060 105421 108021 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_01060 108074 109471 gene locus_tag LOCUS_01070 gene cysS 108074 109471 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_01070 109579 110589 gene locus_tag LOCUS_01080 gene galE 109579 110589 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_01080 110728 112437 gene locus_tag LOCUS_01090 gene argS 110728 112437 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948742.1 protein_id gnl|my_center|LOCUS_01090 112450 113451 gene locus_tag LOCUS_01100 112450 113451 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986984.1 protein_id gnl|my_center|LOCUS_01100 113529 114041 gene locus_tag LOCUS_01110 113529 114041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 114125 114274 gene locus_tag LOCUS_01120 114125 114274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 114387 114929 gene locus_tag LOCUS_01130 114387 114929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 114999 116876 gene locus_tag LOCUS_01140 114999 116876 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_01140 116949 118076 gene locus_tag LOCUS_01150 116949 118076 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968194.1 protein_id gnl|my_center|LOCUS_01150 118091 118756 gene locus_tag LOCUS_01160 118091 118756 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_01160 118758 119531 gene locus_tag LOCUS_01170 118758 119531 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964562.1 protein_id gnl|my_center|LOCUS_01170 119550 120449 gene locus_tag LOCUS_01180 119550 120449 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_01180 120472 121563 gene locus_tag LOCUS_01190 120472 121563 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878121.1 protein_id gnl|my_center|LOCUS_01190 121565 122698 gene locus_tag LOCUS_01200 121565 122698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 122711 123592 gene locus_tag LOCUS_01210 122711 123592 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107724.1 protein_id gnl|my_center|LOCUS_01210 123582 125093 gene locus_tag LOCUS_01220 123582 125093 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_01220 125098 126123 gene locus_tag LOCUS_01230 125098 126123 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288210.1 protein_id gnl|my_center|LOCUS_01230 126149 127315 gene locus_tag LOCUS_01240 126149 127315 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706681.1 protein_id gnl|my_center|LOCUS_01240 127496 128206 gene locus_tag LOCUS_01250 127496 128206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 128206 129240 gene locus_tag LOCUS_01260 128206 129240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 129268 130101 gene locus_tag LOCUS_01270 129268 130101 CDS product tyrosine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966326.1 protein_id gnl|my_center|LOCUS_01270 130184 131548 gene locus_tag LOCUS_01280 gene glmM 130184 131548 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_01280 131666 132004 gene locus_tag LOCUS_01290 131666 132004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 132200 133348 gene locus_tag LOCUS_01300 132200 133348 CDS product stage II sporulation protein P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897656.1 protein_id gnl|my_center|LOCUS_01300 133491 134798 gene locus_tag LOCUS_01310 133491 134798 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016003.1 protein_id gnl|my_center|LOCUS_01310 134919 135641 gene locus_tag LOCUS_01320 134919 135641 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567089.1 protein_id gnl|my_center|LOCUS_01320 135807 137249 gene locus_tag LOCUS_01330 gene pyk 135807 137249 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_01330 137537 138880 gene locus_tag LOCUS_01340 gene der 137537 138880 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_01340 138882 139529 gene locus_tag LOCUS_01350 gene plsY 138882 139529 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_01350 139661 140647 gene locus_tag LOCUS_01360 139661 140647 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_01360 140776 141450 gene locus_tag LOCUS_01370 140776 141450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 141450 141887 gene locus_tag LOCUS_01380 gene dtd 141450 141887 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373094.1 protein_id gnl|my_center|LOCUS_01380 142169 141888 gene locus_tag LOCUS_01390 142169 141888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 142343 143311 gene locus_tag LOCUS_01400 142343 143311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 143922 144812 gene locus_tag LOCUS_01410 143922 144812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 144910 145974 gene locus_tag LOCUS_01420 144910 145974 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_01420 146235 148010 gene locus_tag LOCUS_01430 146235 148010 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262036.1 protein_id gnl|my_center|LOCUS_01430 149130 148261 gene locus_tag LOCUS_01440 149130 148261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 150867 149281 gene locus_tag LOCUS_01450 150867 149281 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965710.1 protein_id gnl|my_center|LOCUS_01450 151827 150961 gene locus_tag LOCUS_01460 151827 150961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 152047 153738 gene locus_tag LOCUS_01470 152047 153738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 153760 155955 gene locus_tag LOCUS_01480 153760 155955 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_01480 156026 156673 gene locus_tag LOCUS_01490 156026 156673 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_01490 156752 158044 gene locus_tag LOCUS_01500 gene hisS 156752 158044 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_01500 158116 158481 gene locus_tag LOCUS_01510 158116 158481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 159205 158573 gene locus_tag LOCUS_01520 159205 158573 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_01520 159516 161642 gene locus_tag LOCUS_01530 gene nrdD 159516 161642 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187775.1 protein_id gnl|my_center|LOCUS_01530 162512 161769 gene locus_tag LOCUS_01540 162512 161769 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582439.1 protein_id gnl|my_center|LOCUS_01540 163857 162535 gene locus_tag LOCUS_01550 163857 162535 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_01550 164013 164810 gene locus_tag LOCUS_01560 164013 164810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 165541 164819 gene locus_tag LOCUS_01570 165541 164819 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460408.1 protein_id gnl|my_center|LOCUS_01570 166855 165557 gene locus_tag LOCUS_01580 166855 165557 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_01580 167444 166974 gene locus_tag LOCUS_01590 167444 166974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 167595 167969 gene locus_tag LOCUS_01600 167595 167969 CDS product cell wall hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047979.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01600 167999 168325 gene locus_tag LOCUS_01610 167999 168325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 168458 169312 gene locus_tag LOCUS_01620 168458 169312 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_01620 169431 170081 gene locus_tag LOCUS_01630 gene lexA 169431 170081 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_01630 170182 172449 gene locus_tag LOCUS_01640 170182 172449 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_01640 172451 174271 gene locus_tag LOCUS_01650 172451 174271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_01650 174363 175292 gene locus_tag LOCUS_01660 gene fba 174363 175292 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_01660 175884 175432 gene locus_tag LOCUS_01670 gene smpB 175884 175432 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815658.1 protein_id gnl|my_center|LOCUS_01670 176419 175988 gene locus_tag LOCUS_01680 176419 175988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 177001 176564 gene locus_tag LOCUS_01690 177001 176564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 177168 178082 gene locus_tag LOCUS_01700 177168 178082 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831939.1 protein_id gnl|my_center|LOCUS_01700 178272 179027 gene locus_tag LOCUS_01710 178272 179027 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_01710 179083 179346 gene locus_tag LOCUS_01720 179083 179346 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_01720 179367 179849 gene locus_tag LOCUS_01730 179367 179849 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_01730 180206 181447 gene locus_tag LOCUS_01740 180206 181447 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259695.1 protein_id gnl|my_center|LOCUS_01740 181713 183671 gene locus_tag LOCUS_01750 gene uvrB 181713 183671 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891935.1 protein_id gnl|my_center|LOCUS_01750 183741 184280 gene locus_tag LOCUS_01760 gene cysE 183741 184280 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 protein_id gnl|my_center|LOCUS_01760 184813 184322 gene locus_tag LOCUS_01770 184813 184322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 184993 186393 gene locus_tag LOCUS_01780 gene murD 184993 186393 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_01780 186444 187076 gene locus_tag LOCUS_01790 186444 187076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 187183 187683 gene locus_tag LOCUS_01800 187183 187683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 187699 188544 gene locus_tag LOCUS_01810 187699 188544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 188641 189084 gene locus_tag LOCUS_01820 188641 189084 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_01820 189143 190240 gene locus_tag LOCUS_01830 gene ytvI 189143 190240 CDS product sporulation integral membrane protein YtvI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198961.1 protein_id gnl|my_center|LOCUS_01830 191726 190293 gene locus_tag LOCUS_01840 191726 190293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 192340 191798 gene locus_tag LOCUS_01850 192340 191798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 192523 195279 gene locus_tag LOCUS_01860 gene secA 192523 195279 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_01860 196539 196114 gene locus_tag LOCUS_01870 196539 196114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 196739 197287 gene locus_tag LOCUS_01880 196739 197287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 197353 198531 gene locus_tag LOCUS_01890 197353 198531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 198555 199613 gene locus_tag LOCUS_01900 198555 199613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 199624 200211 gene locus_tag LOCUS_01910 199624 200211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 200454 200591 gene locus_tag LOCUS_01920 200454 200591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 201574 200645 gene locus_tag LOCUS_01930 201574 200645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 201733 202245 gene locus_tag LOCUS_01940 201733 202245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 202266 202889 gene locus_tag LOCUS_01950 202266 202889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 202916 203440 gene locus_tag LOCUS_01960 202916 203440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 203460 204029 gene locus_tag LOCUS_01970 203460 204029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 204045 204968 gene locus_tag LOCUS_01980 204045 204968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 204989 205984 gene locus_tag LOCUS_01990 204989 205984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 205998 207521 gene locus_tag LOCUS_02000 205998 207521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 207536 208690 gene locus_tag LOCUS_02010 207536 208690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 208687 209256 gene locus_tag LOCUS_02020 208687 209256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 209259 209855 gene locus_tag LOCUS_02030 209259 209855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 210449 209859 gene locus_tag LOCUS_02040 210449 209859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 210537 211265 gene locus_tag LOCUS_02050 210537 211265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 211420 212409 gene locus_tag LOCUS_02060 211420 212409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 212631 214205 gene locus_tag LOCUS_02070 212631 214205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 214231 222057 gene locus_tag LOCUS_02080 214231 222057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 222071 222652 gene locus_tag LOCUS_02090 222071 222652 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246088.1 protein_id gnl|my_center|LOCUS_02090 222630 223184 gene locus_tag LOCUS_02100 222630 223184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 223264 223578 gene locus_tag LOCUS_02110 223264 223578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 223657 223866 gene locus_tag LOCUS_02120 223657 223866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 224148 224618 gene locus_tag LOCUS_02130 224148 224618 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906378.1 protein_id gnl|my_center|LOCUS_02130 224759 225085 gene locus_tag LOCUS_02140 224759 225085 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906360.1 protein_id gnl|my_center|LOCUS_02140 225122 225523 gene locus_tag LOCUS_02150 225122 225523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 225590 226132 gene locus_tag LOCUS_02160 225590 226132 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052021.1 protein_id gnl|my_center|LOCUS_02160 226181 226699 gene locus_tag LOCUS_02170 226181 226699 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_02170 226702 227061 gene locus_tag LOCUS_02180 226702 227061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 227235 228089 gene locus_tag LOCUS_02190 227235 228089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 228395 228598 gene locus_tag LOCUS_02200 228395 228598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 229914 230714 gene locus_tag LOCUS_02210 229914 230714 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546810.1 protein_id gnl|my_center|LOCUS_02210 230695 231630 gene locus_tag LOCUS_02220 230695 231630 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262903.1 protein_id gnl|my_center|LOCUS_02220 231741 232487 gene locus_tag LOCUS_02230 231741 232487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 232572 232730 gene locus_tag LOCUS_02240 232572 232730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 232891 233148 gene locus_tag LOCUS_02250 232891 233148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 233102 233302 gene locus_tag LOCUS_02260 233102 233302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 233349 233597 gene locus_tag LOCUS_02270 233349 233597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 233605 234321 gene locus_tag LOCUS_02280 233605 234321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 234290 236167 gene locus_tag LOCUS_02290 234290 236167 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965347.1 protein_id gnl|my_center|LOCUS_02290 236185 236391 gene locus_tag LOCUS_02300 236185 236391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 236504 237676 gene locus_tag LOCUS_02310 236504 237676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 237669 237977 gene locus_tag LOCUS_02320 237669 237977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 238084 238353 gene locus_tag LOCUS_02330 238084 238353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 238412 238843 gene locus_tag LOCUS_02340 238412 238843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 238855 239013 gene locus_tag LOCUS_02350 238855 239013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 239081 239803 gene locus_tag LOCUS_02360 gene srtB 239081 239803 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242427.1 protein_id gnl|my_center|LOCUS_02360 239917 240876 gene locus_tag LOCUS_02370 239917 240876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 240948 245144 gene locus_tag LOCUS_02380 240948 245144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 245212 245475 gene locus_tag LOCUS_02390 245212 245475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 245554 246159 gene locus_tag LOCUS_02400 245554 246159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 246499 247296 gene locus_tag LOCUS_02410 246499 247296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 247274 248746 gene locus_tag LOCUS_02420 247274 248746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02420 248793 249053 gene locus_tag LOCUS_02430 248793 249053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02430 249109 249924 gene locus_tag LOCUS_02440 249109 249924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 249917 250396 gene locus_tag LOCUS_02450 249917 250396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 250519 250776 gene locus_tag LOCUS_02460 250519 250776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 251339 251064 gene locus_tag LOCUS_02470 251339 251064 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905402.1 protein_id gnl|my_center|LOCUS_02470 251522 252154 gene locus_tag LOCUS_02480 251522 252154 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_02480 252172 252390 gene locus_tag LOCUS_02490 252172 252390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 252395 252727 gene locus_tag LOCUS_02500 252395 252727 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244448.1 protein_id gnl|my_center|LOCUS_02500 252731 252901 gene locus_tag LOCUS_02510 252731 252901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 252953 253207 gene locus_tag LOCUS_02520 252953 253207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 253224 253553 gene locus_tag LOCUS_02530 253224 253553 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015678.1 protein_id gnl|my_center|LOCUS_02530 253578 254492 gene locus_tag LOCUS_02540 253578 254492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 254832 254981 gene locus_tag LOCUS_02550 254832 254981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 254942 255181 gene locus_tag LOCUS_02560 254942 255181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 255194 255721 gene locus_tag LOCUS_02570 255194 255721 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860885.1 protein_id gnl|my_center|LOCUS_02570 255771 257693 gene locus_tag LOCUS_02580 gene tet(O) 255771 257693 CDS product tetracycline resistance ribosomal protection protein Tet(O) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775603.1 protein_id gnl|my_center|LOCUS_02580 258008 258865 gene locus_tag LOCUS_02590 gene ant(6) 258008 258865 CDS product aminoglycoside nucleotidyltransferase ANT(6)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255864.1 protein_id gnl|my_center|LOCUS_02590 258955 259386 gene locus_tag LOCUS_02600 258955 259386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 259413 260045 gene locus_tag LOCUS_02610 259413 260045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 260088 260510 gene locus_tag LOCUS_02620 260088 260510 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476578.1 protein_id gnl|my_center|LOCUS_02620 260762 261391 gene locus_tag LOCUS_02630 260762 261391 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208265.1 protein_id gnl|my_center|LOCUS_02630 261555 262667 gene locus_tag LOCUS_02640 gene mftC 261555 262667 CDS product mycofactocin radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727659.1 protein_id gnl|my_center|LOCUS_02640 262680 264467 gene locus_tag LOCUS_02650 262680 264467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 264563 265357 gene locus_tag LOCUS_02660 264563 265357 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000566050.1 protein_id gnl|my_center|LOCUS_02660 265379 266038 gene locus_tag LOCUS_02670 265379 266038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 266047 266670 gene locus_tag LOCUS_02680 266047 266670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 266691 267299 gene locus_tag LOCUS_02690 266691 267299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 268092 267322 gene locus_tag LOCUS_02700 268092 267322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 268578 268240 gene locus_tag LOCUS_02710 268578 268240 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016138.1 protein_id gnl|my_center|LOCUS_02710 268749 270905 gene locus_tag LOCUS_02720 gene helD 268749 270905 CDS product RNA polymerase recycling motor HelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964344.1 protein_id gnl|my_center|LOCUS_02720 271032 271229 gene locus_tag LOCUS_02730 271032 271229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 271505 272056 gene locus_tag LOCUS_02740 271505 272056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 272046 273239 gene locus_tag LOCUS_02750 272046 273239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 273429 275333 gene locus_tag LOCUS_02760 273429 275333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 275598 275945 gene locus_tag LOCUS_02770 275598 275945 CDS product YxeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289464.1 protein_id gnl|my_center|LOCUS_02770 276032 276703 gene locus_tag LOCUS_02780 276032 276703 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_02780 276700 277719 gene locus_tag LOCUS_02790 276700 277719 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_02790 278520 277759 gene locus_tag LOCUS_02800 278520 277759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 278678 279361 gene locus_tag LOCUS_02810 gene vanR 278678 279361 CDS product vancomycin resistance response regulator transcriptoin factor VanR-G-Cd inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436401.1 protein_id gnl|my_center|LOCUS_02810 279354 280454 gene locus_tag LOCUS_02820 279354 280454 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510927.1 protein_id gnl|my_center|LOCUS_02820 280582 280785 gene locus_tag LOCUS_02830 280582 280785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02830 281132 281350 gene locus_tag LOCUS_02840 281132 281350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 281340 283427 gene locus_tag LOCUS_02850 281340 283427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986644.1 protein_id gnl|my_center|LOCUS_02850 283530 284219 gene locus_tag LOCUS_02860 283530 284219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 284369 284569 gene locus_tag LOCUS_02870 284369 284569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 284593 284856 gene locus_tag LOCUS_02880 284593 284856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 285154 284909 gene locus_tag LOCUS_02890 285154 284909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 285557 285294 gene locus_tag LOCUS_02900 285557 285294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 285683 286303 gene locus_tag LOCUS_02910 285683 286303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 286352 286540 gene locus_tag LOCUS_02920 286352 286540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 287021 287380 gene locus_tag LOCUS_02930 287021 287380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 287370 287609 gene locus_tag LOCUS_02940 287370 287609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 287631 288698 gene locus_tag LOCUS_02950 287631 288698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 288753 288920 gene locus_tag LOCUS_02960 288753 288920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 288933 289505 gene locus_tag LOCUS_02970 288933 289505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 289535 290086 gene locus_tag LOCUS_02980 289535 290086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 290101 291768 gene locus_tag LOCUS_02990 290101 291768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 291822 292112 gene locus_tag LOCUS_03000 gene rpsF 291822 292112 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391676.1 protein_id gnl|my_center|LOCUS_03000 292128 292412 gene locus_tag LOCUS_03010 292128 292412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 292425 292604 gene locus_tag LOCUS_03020 292425 292604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 292597 293013 gene locus_tag LOCUS_03030 292597 293013 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_03030 293090 293737 gene locus_tag LOCUS_03040 293090 293737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 293754 294269 gene locus_tag LOCUS_03050 293754 294269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 294291 295373 gene locus_tag LOCUS_03060 294291 295373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 295389 295787 gene locus_tag LOCUS_03070 295389 295787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 295849 296277 gene locus_tag LOCUS_03080 295849 296277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 296301 298433 gene locus_tag LOCUS_03090 296301 298433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 298408 300867 gene locus_tag LOCUS_03100 298408 300867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 300936 301613 gene locus_tag LOCUS_03110 300936 301613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 301649 302077 gene locus_tag LOCUS_03120 301649 302077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 302094 303536 gene locus_tag LOCUS_03130 302094 303536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 303561 304991 gene locus_tag LOCUS_03140 303561 304991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 305209 305511 gene locus_tag LOCUS_03150 305209 305511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 305625 306215 gene locus_tag LOCUS_03160 305625 306215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 306217 307095 gene locus_tag LOCUS_03170 306217 307095 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207887.1 protein_id gnl|my_center|LOCUS_03170 307218 308408 gene locus_tag LOCUS_03180 307218 308408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 309175 308441 gene locus_tag LOCUS_03190 309175 308441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 309514 309699 gene locus_tag LOCUS_03200 309514 309699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 309721 310176 gene locus_tag LOCUS_03210 309721 310176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 310500 310315 gene locus_tag LOCUS_03220 310500 310315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 310566 310727 gene locus_tag LOCUS_03230 310566 310727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 310754 310981 gene locus_tag LOCUS_03240 310754 310981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 311228 312250 gene locus_tag LOCUS_03250 311228 312250 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_03250 312257 313243 gene locus_tag LOCUS_03260 312257 313243 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_03260 313268 313597 gene locus_tag LOCUS_03270 313268 313597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 315110 314634 gene locus_tag LOCUS_03280 315110 314634 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_03280 315981 315136 gene locus_tag LOCUS_03290 315981 315136 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906177.1 protein_id gnl|my_center|LOCUS_03290 316546 316007 gene locus_tag LOCUS_03300 316546 316007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 316727 316560 gene locus_tag LOCUS_03310 316727 316560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 317450 316749 gene locus_tag LOCUS_03320 317450 316749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 318013 317477 gene locus_tag LOCUS_03330 318013 317477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 318156 318034 gene locus_tag LOCUS_03340 318156 318034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 318321 318722 gene locus_tag LOCUS_03350 318321 318722 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688937.1 protein_id gnl|my_center|LOCUS_03350 319868 318966 gene locus_tag LOCUS_03360 319868 318966 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_03360 320609 320133 gene locus_tag LOCUS_03370 320609 320133 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020461.1 protein_id gnl|my_center|LOCUS_03370 321370 320636 gene locus_tag LOCUS_03380 321370 320636 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_03380 323184 321418 gene locus_tag LOCUS_03390 323184 321418 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017171.1 protein_id gnl|my_center|LOCUS_03390 323367 323837 gene locus_tag LOCUS_03400 323367 323837 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890791.1 protein_id gnl|my_center|LOCUS_03400 324086 323877 gene locus_tag LOCUS_03410 324086 323877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 325552 324047 gene locus_tag LOCUS_03420 gene cls 325552 324047 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_03420 326591 325617 gene locus_tag LOCUS_03430 gene bsh 326591 325617 CDS product choloylglycine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723950.1 protein_id gnl|my_center|LOCUS_03430 327390 326881 gene locus_tag LOCUS_03440 327390 326881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 328432 327410 gene locus_tag LOCUS_03450 328432 327410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 329260 328616 gene locus_tag LOCUS_03460 329260 328616 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_03460 330357 329929 gene locus_tag LOCUS_03470 330357 329929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 331874 330513 gene locus_tag LOCUS_03480 gene rho 331874 330513 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947979.1 protein_id gnl|my_center|LOCUS_03480 332280 332005 gene locus_tag LOCUS_03490 332280 332005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 332869 332363 gene locus_tag LOCUS_03500 332869 332363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 333201 332893 gene locus_tag LOCUS_03510 333201 332893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 334254 333265 gene locus_tag LOCUS_03520 334254 333265 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229564.1 protein_id gnl|my_center|LOCUS_03520 335508 334459 gene locus_tag LOCUS_03530 gene prfB 335508 334459 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197551829.1 protein_id gnl|my_center|LOCUS_03530 336394 335633 gene locus_tag LOCUS_03540 336394 335633 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242850.1 protein_id gnl|my_center|LOCUS_03540 339003 336394 gene locus_tag LOCUS_03550 gene adhE 339003 336394 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_03550 339198 339392 gene locus_tag LOCUS_03560 339198 339392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 341422 339425 gene locus_tag LOCUS_03570 341422 339425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 344079 341596 gene locus_tag LOCUS_03580 344079 341596 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048098.1 protein_id gnl|my_center|LOCUS_03580 344240 344932 gene locus_tag LOCUS_03590 344240 344932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03590 345090 345233 gene locus_tag LOCUS_03600 345090 345233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03600 346142 345342 gene locus_tag LOCUS_03610 346142 345342 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_03610 346793 346215 gene locus_tag LOCUS_03620 346793 346215 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_03620 346987 347262 gene locus_tag LOCUS_03630 346987 347262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 347291 348232 gene locus_tag LOCUS_03640 347291 348232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 348951 348343 gene locus_tag LOCUS_03650 348951 348343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 349122 349556 gene locus_tag LOCUS_03660 349122 349556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 350940 349630 gene locus_tag LOCUS_03670 350940 349630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 351041 351664 gene locus_tag LOCUS_03680 351041 351664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 352128 351745 gene locus_tag LOCUS_03690 352128 351745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 353452 352361 gene locus_tag LOCUS_03700 gene ychF 353452 352361 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965433.1 protein_id gnl|my_center|LOCUS_03700 355399 353471 gene locus_tag LOCUS_03710 gene thrS 355399 353471 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989741.1 protein_id gnl|my_center|LOCUS_03710 355784 355859 gene locus_tag LOCUS_t00060 355784 355859 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 356369 355878 gene locus_tag LOCUS_03720 356369 355878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 357095 356445 gene locus_tag LOCUS_03730 357095 356445 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_03730 358976 357240 gene locus_tag LOCUS_03740 358976 357240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 359823 358978 gene locus_tag LOCUS_03750 359823 358978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 360345 359965 gene locus_tag LOCUS_03760 360345 359965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 360556 360347 gene locus_tag LOCUS_03770 360556 360347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03770 362205 360607 gene locus_tag LOCUS_03780 362205 360607 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_03780 362380 362243 gene locus_tag LOCUS_03790 362380 362243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 363177 362647 gene locus_tag LOCUS_03800 363177 362647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 363601 364179 gene locus_tag LOCUS_03810 363601 364179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 364828 364478 gene locus_tag LOCUS_03820 364828 364478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 365181 364828 gene locus_tag LOCUS_03830 365181 364828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 365833 365300 gene locus_tag LOCUS_03840 365833 365300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 366514 365909 gene locus_tag LOCUS_03850 366514 365909 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475587.1 protein_id gnl|my_center|LOCUS_03850 366766 366575 gene locus_tag LOCUS_03860 gene rpmF 366766 366575 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_03860 367439 366900 gene locus_tag LOCUS_03870 367439 366900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 367590 367769 gene locus_tag LOCUS_03880 367590 367769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03880 367777 369438 gene locus_tag LOCUS_03890 gene asnB 367777 369438 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000333979.1 protein_id gnl|my_center|LOCUS_03890 369949 369488 gene locus_tag LOCUS_03900 369949 369488 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948908.1 protein_id gnl|my_center|LOCUS_03900 371433 369976 gene locus_tag LOCUS_03910 371433 369976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 374065 371450 gene locus_tag LOCUS_03920 gene mutS 374065 371450 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_03920 374940 374089 gene locus_tag LOCUS_03930 374940 374089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 376427 375006 gene locus_tag LOCUS_03940 gene miaB 376427 375006 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965143.1 protein_id gnl|my_center|LOCUS_03940 376781 376581 gene locus_tag LOCUS_03950 gene rpmE 376781 376581 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462249.1 protein_id gnl|my_center|LOCUS_03950 377097 376888 gene locus_tag LOCUS_03960 377097 376888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 377282 377950 gene locus_tag LOCUS_03970 377282 377950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03970 378119 378829 gene locus_tag LOCUS_03980 378119 378829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03980 378804 379358 gene locus_tag LOCUS_03990 378804 379358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 380190 379588 gene locus_tag LOCUS_04000 380190 379588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 380773 380141 gene locus_tag LOCUS_04010 380773 380141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 381312 380845 gene locus_tag LOCUS_04020 381312 380845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 385098 381421 gene locus_tag LOCUS_04030 gene addA 385098 381421 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948198.1 protein_id gnl|my_center|LOCUS_04030 385307 385969 gene locus_tag LOCUS_04040 385307 385969 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301793.1 protein_id gnl|my_center|LOCUS_04040 386313 386050 gene locus_tag LOCUS_04050 386313 386050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 387254 386424 gene locus_tag LOCUS_04060 387254 386424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 387801 387286 gene locus_tag LOCUS_04070 387801 387286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04070 387967 387767 gene locus_tag LOCUS_04080 387967 387767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04080 389763 388024 gene locus_tag LOCUS_04090 389763 388024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 389885 391582 gene locus_tag LOCUS_04100 389885 391582 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965410.1 protein_id gnl|my_center|LOCUS_04100 392341 391589 gene locus_tag LOCUS_04110 392341 391589 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_04110 392800 392354 gene locus_tag LOCUS_04120 392800 392354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 394009 392957 gene locus_tag LOCUS_04130 gene recA 394009 392957 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_04130 395683 394100 gene locus_tag LOCUS_04140 395683 394100 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_04140 396084 395821 gene locus_tag LOCUS_04150 gene spoVS 396084 395821 CDS product stage V sporulation protein SpoVS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154135.1 protein_id gnl|my_center|LOCUS_04150 397055 396285 gene locus_tag LOCUS_04160 397055 396285 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944383.1 protein_id gnl|my_center|LOCUS_04160 398722 397181 gene locus_tag LOCUS_04170 gene rny 398722 397181 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_04170 399189 398899 gene locus_tag LOCUS_04180 399189 398899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 400198 399239 gene locus_tag LOCUS_04190 400198 399239 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964264.1 protein_id gnl|my_center|LOCUS_04190 400701 400354 gene locus_tag LOCUS_04200 400701 400354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 404261 401115 gene locus_tag LOCUS_04210 gene ileS 404261 401115 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986028.1 protein_id gnl|my_center|LOCUS_04210 404586 404332 gene locus_tag LOCUS_04220 404586 404332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 405648 404980 gene locus_tag LOCUS_04230 405648 404980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 407073 405880 gene locus_tag LOCUS_04240 407073 405880 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_04240 408281 407073 gene locus_tag LOCUS_04250 408281 407073 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965050.1 protein_id gnl|my_center|LOCUS_04250 409341 408331 gene locus_tag LOCUS_04260 gene pta 409341 408331 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_04260 409942 409430 gene locus_tag LOCUS_04270 409942 409430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 410647 409985 gene locus_tag LOCUS_04280 gene trmB 410647 409985 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965915.1 protein_id gnl|my_center|LOCUS_04280 410832 411704 gene locus_tag LOCUS_04290 410832 411704 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048019.1 protein_id gnl|my_center|LOCUS_04290 412158 411886 gene locus_tag LOCUS_04300 412158 411886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04300 412967 412434 gene locus_tag LOCUS_04310 412967 412434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence02 779 546 gene locus_tag LOCUS_04320 779 546 CDS product YlmC/YmxH family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392374.1 protein_id gnl|my_center|LOCUS_04320 1617 841 gene locus_tag LOCUS_04330 gene sigG 1617 841 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_04330 2475 1759 gene locus_tag LOCUS_04340 gene sigE 2475 1759 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811355.1 protein_id gnl|my_center|LOCUS_04340 3390 2503 gene locus_tag LOCUS_04350 gene spoIIGA 3390 2503 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_04350 4641 3517 gene locus_tag LOCUS_04360 gene ftsZ 4641 3517 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_04360 5962 4733 gene locus_tag LOCUS_04370 gene ftsA 5962 4733 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047886.1 protein_id gnl|my_center|LOCUS_04370 6501 6097 gene locus_tag LOCUS_04380 6501 6097 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392367.1 protein_id gnl|my_center|LOCUS_04380 7263 6514 gene locus_tag LOCUS_04390 7263 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 8028 7312 gene locus_tag LOCUS_04400 8028 7312 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861623.1 protein_id gnl|my_center|LOCUS_04400 9051 8044 gene locus_tag LOCUS_04410 9051 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 9756 9109 gene locus_tag LOCUS_04420 9756 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04420 10357 9758 gene locus_tag LOCUS_04430 10357 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04430 11461 10475 gene locus_tag LOCUS_04440 11461 10475 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262593.1 protein_id gnl|my_center|LOCUS_04440 12195 11491 gene locus_tag LOCUS_04450 12195 11491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 12383 13774 gene locus_tag LOCUS_04460 gene asnS 12383 13774 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432177.1 protein_id gnl|my_center|LOCUS_04460 14854 13832 gene locus_tag LOCUS_04470 14854 13832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 15349 15696 gene locus_tag LOCUS_04480 15349 15696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 15905 18142 gene locus_tag LOCUS_04490 gene pflB 15905 18142 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_04490 18176 18907 gene locus_tag LOCUS_04500 gene pflA 18176 18907 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238477.1 protein_id gnl|my_center|LOCUS_04500 20924 19074 gene locus_tag LOCUS_04510 20924 19074 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_04510 21301 20942 gene locus_tag LOCUS_04520 21301 20942 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_04520 22503 21568 gene locus_tag LOCUS_04530 22503 21568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 23338 22523 gene locus_tag LOCUS_04540 23338 22523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 24147 23434 gene locus_tag LOCUS_04550 24147 23434 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435147.1 protein_id gnl|my_center|LOCUS_04550 25110 24190 gene locus_tag LOCUS_04560 25110 24190 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_04560 26885 25152 gene locus_tag LOCUS_04570 26885 25152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 27715 27014 gene locus_tag LOCUS_04580 27715 27014 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_04580 28365 27832 gene locus_tag LOCUS_04590 28365 27832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 29190 28423 gene locus_tag LOCUS_04600 29190 28423 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898387.1 protein_id gnl|my_center|LOCUS_04600 29343 29819 gene locus_tag LOCUS_04610 29343 29819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 30167 29961 gene locus_tag LOCUS_04620 30167 29961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 30599 30459 gene locus_tag LOCUS_04630 30599 30459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 31109 30753 gene locus_tag LOCUS_04640 31109 30753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 31568 31206 gene locus_tag LOCUS_04650 31568 31206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 32282 31656 gene locus_tag LOCUS_04660 32282 31656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04660 32946 32392 gene locus_tag LOCUS_04670 32946 32392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04670 33677 33039 gene locus_tag LOCUS_04680 gene ruvA 33677 33039 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_04680 34244 33690 gene locus_tag LOCUS_04690 34244 33690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 35352 34387 gene locus_tag LOCUS_04700 35352 34387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 36616 35420 gene locus_tag LOCUS_04710 36616 35420 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284165.1 protein_id gnl|my_center|LOCUS_04710 38145 36715 gene locus_tag LOCUS_04720 38145 36715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04720 44911 38120 gene locus_tag LOCUS_04730 44911 38120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04730 45942 44992 gene locus_tag LOCUS_04740 45942 44992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 46792 46064 gene locus_tag LOCUS_04750 gene cwlD 46792 46064 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_04750 47841 46918 gene locus_tag LOCUS_04760 47841 46918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 48753 47914 gene locus_tag LOCUS_04770 48753 47914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 49753 48818 gene locus_tag LOCUS_04780 49753 48818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 50163 49888 gene locus_tag LOCUS_04790 50163 49888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 50612 50184 gene locus_tag LOCUS_04800 50612 50184 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_04800 50958 50674 gene locus_tag LOCUS_04810 gene rpsF 50958 50674 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_04810 52100 51168 gene locus_tag LOCUS_04820 gene pyrF 52100 51168 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052226.1 protein_id gnl|my_center|LOCUS_04820 53358 52231 gene locus_tag LOCUS_04830 53358 52231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04830 54832 53324 gene locus_tag LOCUS_04840 54832 53324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04840 54963 55529 gene locus_tag LOCUS_04850 54963 55529 CDS product manganese efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399399.1 protein_id gnl|my_center|LOCUS_04850 57404 55644 gene locus_tag LOCUS_04860 57404 55644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 57635 57910 gene locus_tag LOCUS_04870 57635 57910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 61494 57943 gene locus_tag LOCUS_04880 gene smc 61494 57943 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861158.1 protein_id gnl|my_center|LOCUS_04880 61895 61551 gene locus_tag LOCUS_04890 61895 61551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 63198 62188 gene locus_tag LOCUS_04900 63198 62188 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_04900 63901 63275 gene locus_tag LOCUS_04910 63901 63275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 64364 63981 gene locus_tag LOCUS_04920 64364 63981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04920 64791 64297 gene locus_tag LOCUS_04930 64791 64297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04930 64949 64788 gene locus_tag LOCUS_04940 64949 64788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 66588 65032 gene locus_tag LOCUS_04950 66588 65032 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_04950 67502 67182 gene locus_tag LOCUS_04960 67502 67182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 68711 67659 gene locus_tag LOCUS_04970 68711 67659 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202293.1 protein_id gnl|my_center|LOCUS_04970 68856 68701 gene locus_tag LOCUS_04980 68856 68701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 69643 68813 gene locus_tag LOCUS_04990 69643 68813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 70739 69666 gene locus_tag LOCUS_05000 70739 69666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 71571 70945 gene locus_tag LOCUS_05010 71571 70945 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_05010 72835 71804 gene locus_tag LOCUS_05020 72835 71804 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393640.1 protein_id gnl|my_center|LOCUS_05020 73650 73150 gene locus_tag LOCUS_05030 gene trmL 73650 73150 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_05030 74514 73723 gene locus_tag LOCUS_05040 74514 73723 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_05040 75754 74579 gene locus_tag LOCUS_05050 75754 74579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 79225 75770 gene locus_tag LOCUS_05060 gene mfd 79225 75770 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048383.1 protein_id gnl|my_center|LOCUS_05060 79676 79299 gene locus_tag LOCUS_05070 79676 79299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 79848 80423 gene locus_tag LOCUS_05080 79848 80423 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583517.1 protein_id gnl|my_center|LOCUS_05080 82687 80678 gene locus_tag LOCUS_05090 82687 80678 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966830.1 protein_id gnl|my_center|LOCUS_05090 83465 82692 gene locus_tag LOCUS_05100 83465 82692 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065531.1 protein_id gnl|my_center|LOCUS_05100 83581 86001 gene locus_tag LOCUS_05110 gene leuS 83581 86001 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_05110 86654 86124 gene locus_tag LOCUS_05120 86654 86124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 86988 88103 gene locus_tag LOCUS_05130 86988 88103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 89562 88300 gene locus_tag LOCUS_05140 gene gltA 89562 88300 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_05140 90264 89713 gene locus_tag LOCUS_05150 90264 89713 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_05150 91203 90280 gene locus_tag LOCUS_05160 91203 90280 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_05160 92108 91251 gene locus_tag LOCUS_05170 92108 91251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 95607 92230 gene locus_tag LOCUS_05180 gene addB 95607 92230 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965561.1 protein_id gnl|my_center|LOCUS_05180 96688 95732 gene locus_tag LOCUS_05190 96688 95732 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809044.1 protein_id gnl|my_center|LOCUS_05190 98094 97228 gene locus_tag LOCUS_05200 98094 97228 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_05200 98989 98117 gene locus_tag LOCUS_05210 98989 98117 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430304.1 protein_id gnl|my_center|LOCUS_05210 100450 99407 gene locus_tag LOCUS_05220 100450 99407 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_05220 101138 100467 gene locus_tag LOCUS_05230 gene rnc 101138 100467 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_05230 101312 102739 gene locus_tag LOCUS_05240 101312 102739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 102762 103598 gene locus_tag LOCUS_05250 102762 103598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 105774 103735 gene locus_tag LOCUS_05260 105774 103735 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676339.1 protein_id gnl|my_center|LOCUS_05260 106024 106587 gene locus_tag LOCUS_05270 106024 106587 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357803.1 protein_id gnl|my_center|LOCUS_05270 106584 106937 gene locus_tag LOCUS_05280 106584 106937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 107603 107178 gene locus_tag LOCUS_05290 107603 107178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 109035 107665 gene locus_tag LOCUS_05300 109035 107665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 109274 109522 gene locus_tag LOCUS_05310 109274 109522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 109756 109683 gene locus_tag LOCUS_t00070 109756 109683 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 109863 109790 gene locus_tag LOCUS_t00080 109863 109790 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 112120 110075 gene locus_tag LOCUS_05320 gene topA 112120 110075 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_05320 112624 112241 gene locus_tag LOCUS_05330 112624 112241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 113729 112803 gene locus_tag LOCUS_05340 113729 112803 CDS product DUF975 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949104.1 protein_id gnl|my_center|LOCUS_05340 115087 113888 gene locus_tag LOCUS_05350 115087 113888 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963608.1 protein_id gnl|my_center|LOCUS_05350 116117 115287 gene locus_tag LOCUS_05360 116117 115287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_05360 117196 116138 gene locus_tag LOCUS_05370 gene mnmA 117196 116138 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_05370 117784 117338 gene locus_tag LOCUS_05380 117784 117338 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_05380 119241 118033 gene locus_tag LOCUS_05390 119241 118033 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_05390 120287 119241 gene locus_tag LOCUS_05400 gene sufD 120287 119241 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_05400 121687 120287 gene locus_tag LOCUS_05410 gene sufB 121687 120287 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_05410 122548 121805 gene locus_tag LOCUS_05420 gene sufC 122548 121805 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_05420 123025 122618 gene locus_tag LOCUS_05430 123025 122618 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_05430 123963 123292 gene locus_tag LOCUS_05440 123963 123292 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_05440 124169 124029 gene locus_tag LOCUS_05450 124169 124029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 124419 125624 gene locus_tag LOCUS_05460 124419 125624 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_05460 126003 125641 gene locus_tag LOCUS_05470 126003 125641 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_05470 126887 125982 gene locus_tag LOCUS_05480 gene dprA 126887 125982 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461424.1 protein_id gnl|my_center|LOCUS_05480 127576 126893 gene locus_tag LOCUS_05490 127576 126893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05490 128435 127506 gene locus_tag LOCUS_05500 128435 127506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05500 128800 128552 gene locus_tag LOCUS_05510 128800 128552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 128861 128995 gene locus_tag LOCUS_05520 128861 128995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 129621 129064 gene locus_tag LOCUS_05530 129621 129064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 131132 129684 gene locus_tag LOCUS_05540 131132 129684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 132200 131412 gene locus_tag LOCUS_05550 132200 131412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 132337 132678 gene locus_tag LOCUS_05560 132337 132678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 133876 132794 gene locus_tag LOCUS_05570 133876 132794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 134512 134201 gene locus_tag LOCUS_05580 gene trxA 134512 134201 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_05580 134727 134802 gene locus_tag LOCUS_t00090 134727 134802 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 135250 134855 gene locus_tag LOCUS_05590 135250 134855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 136027 135335 gene locus_tag LOCUS_05600 136027 135335 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890711.1 protein_id gnl|my_center|LOCUS_05600 136127 137386 gene locus_tag LOCUS_05610 136127 137386 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454794.1 protein_id gnl|my_center|LOCUS_05610 138979 137552 gene locus_tag LOCUS_05620 138979 137552 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048020.1 protein_id gnl|my_center|LOCUS_05620 139729 139109 gene locus_tag LOCUS_05630 139729 139109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 140930 139740 gene locus_tag LOCUS_05640 140930 139740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 142661 141078 gene locus_tag LOCUS_05650 142661 141078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 143354 142674 gene locus_tag LOCUS_05660 143354 142674 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109792089.1 protein_id gnl|my_center|LOCUS_05660 144166 143354 gene locus_tag LOCUS_05670 144166 143354 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05670 144296 144141 gene locus_tag LOCUS_05680 144296 144141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05680 144663 144739 gene locus_tag LOCUS_t00100 144663 144739 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 146170 144809 gene locus_tag LOCUS_05690 146170 144809 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272155.1 protein_id gnl|my_center|LOCUS_05690 146482 146267 gene locus_tag LOCUS_05700 146482 146267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 146693 146475 gene locus_tag LOCUS_05710 146693 146475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 146931 146686 gene locus_tag LOCUS_05720 146931 146686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 147360 146938 gene locus_tag LOCUS_05730 147360 146938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 147596 147426 gene locus_tag LOCUS_05740 147596 147426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 147928 147749 gene locus_tag LOCUS_05750 147928 147749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 148319 147918 gene locus_tag LOCUS_05760 148319 147918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 148767 149117 gene locus_tag LOCUS_05770 148767 149117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 149187 149405 gene locus_tag LOCUS_05780 149187 149405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 149443 149715 gene locus_tag LOCUS_05790 149443 149715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 149748 150293 gene locus_tag LOCUS_05800 149748 150293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 150528 151010 gene locus_tag LOCUS_05810 150528 151010 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944439.1 protein_id gnl|my_center|LOCUS_05810 151003 151989 gene locus_tag LOCUS_05820 151003 151989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 152320 152955 gene locus_tag LOCUS_05830 152320 152955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 153132 153683 gene locus_tag LOCUS_05840 153132 153683 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949156.1 protein_id gnl|my_center|LOCUS_05840 153673 154953 gene locus_tag LOCUS_05850 153673 154953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 155078 155572 gene locus_tag LOCUS_05860 155078 155572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 155562 156206 gene locus_tag LOCUS_05870 155562 156206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 157134 156259 gene locus_tag LOCUS_05880 gene xerC 157134 156259 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357488.1 protein_id gnl|my_center|LOCUS_05880 157605 157309 gene locus_tag LOCUS_05890 157605 157309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 157969 157622 gene locus_tag LOCUS_05900 157969 157622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 158488 158850 gene locus_tag LOCUS_05910 158488 158850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 158865 159950 gene locus_tag LOCUS_05920 158865 159950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 160071 160301 gene locus_tag LOCUS_05930 160071 160301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 160298 162220 gene locus_tag LOCUS_05940 160298 162220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 162276 162896 gene locus_tag LOCUS_05950 162276 162896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 162871 163047 gene locus_tag LOCUS_05960 162871 163047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 163068 163484 gene locus_tag LOCUS_05970 163068 163484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 163504 164151 gene locus_tag LOCUS_05980 163504 164151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 164166 164528 gene locus_tag LOCUS_05990 164166 164528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 164551 164832 gene locus_tag LOCUS_06000 gene rpsF 164551 164832 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_06000 164848 165273 gene locus_tag LOCUS_06010 164848 165273 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966983.1 protein_id gnl|my_center|LOCUS_06010 165294 165713 gene locus_tag LOCUS_06020 165294 165713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 165718 165993 gene locus_tag LOCUS_06030 165718 165993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 165996 166394 gene locus_tag LOCUS_06040 165996 166394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 166394 167071 gene locus_tag LOCUS_06050 166394 167071 CDS product DUF2786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965287.1 protein_id gnl|my_center|LOCUS_06050 167072 167473 gene locus_tag LOCUS_06060 167072 167473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 167466 169013 gene locus_tag LOCUS_06070 167466 169013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 169024 169875 gene locus_tag LOCUS_06080 169024 169875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 169899 170222 gene locus_tag LOCUS_06090 169899 170222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 170235 170501 gene locus_tag LOCUS_06100 170235 170501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 170611 171309 gene locus_tag LOCUS_06110 170611 171309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 171475 172878 gene locus_tag LOCUS_06120 171475 172878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 173203 173054 gene locus_tag LOCUS_06130 173203 173054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 173298 174089 gene locus_tag LOCUS_06140 173298 174089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 174351 177107 gene locus_tag LOCUS_06150 174351 177107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 177186 178010 gene locus_tag LOCUS_06160 177186 178010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 179350 178862 gene locus_tag LOCUS_06170 179350 178862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 179727 179608 gene locus_tag LOCUS_06180 179727 179608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 180647 179853 gene locus_tag LOCUS_06190 180647 179853 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965266.1 protein_id gnl|my_center|LOCUS_06190 180904 180665 gene locus_tag LOCUS_06200 180904 180665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 181736 181137 gene locus_tag LOCUS_06210 181736 181137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06210 182413 181784 gene locus_tag LOCUS_06220 182413 181784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 183320 182406 gene locus_tag LOCUS_06230 183320 182406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 184108 183494 gene locus_tag LOCUS_06240 184108 183494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 184439 184164 gene locus_tag LOCUS_06250 184439 184164 CDS product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879274.1 protein_id gnl|my_center|LOCUS_06250 186270 184495 gene locus_tag LOCUS_06260 186270 184495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 187069 186227 gene locus_tag LOCUS_06270 187069 186227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 187890 187126 gene locus_tag LOCUS_06280 187890 187126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 188538 187960 gene locus_tag LOCUS_06290 188538 187960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 188916 188554 gene locus_tag LOCUS_06300 188916 188554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 189265 189074 gene locus_tag LOCUS_06310 189265 189074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06310 189599 189234 gene locus_tag LOCUS_06320 189599 189234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 190782 189571 gene locus_tag LOCUS_06330 190782 189571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 191074 190865 gene locus_tag LOCUS_06340 191074 190865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 192292 191366 gene locus_tag LOCUS_06350 192292 191366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06350 192911 192270 gene locus_tag LOCUS_06360 192911 192270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 193602 192868 gene locus_tag LOCUS_06370 193602 192868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 193889 193599 gene locus_tag LOCUS_06380 193889 193599 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965349.1 protein_id gnl|my_center|LOCUS_06380 194118 193900 gene locus_tag LOCUS_06390 194118 193900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 194281 194081 gene locus_tag LOCUS_06400 194281 194081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 194581 194333 gene locus_tag LOCUS_06410 194581 194333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 195279 194596 gene locus_tag LOCUS_06420 195279 194596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 196680 195910 gene locus_tag LOCUS_06430 196680 195910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 196798 198312 gene locus_tag LOCUS_06440 196798 198312 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_06440 198465 198389 gene locus_tag LOCUS_t00110 198465 198389 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 198582 198507 gene locus_tag LOCUS_t00120 198582 198507 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 198807 199082 gene locus_tag LOCUS_06450 198807 199082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 200882 199152 gene locus_tag LOCUS_06460 200882 199152 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042338789.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence03 <1 687 gene locus_tag LOCUS_06470 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001217618.1:AAA family ATPase 871 1932 gene locus_tag LOCUS_06480 gene prfA 871 1932 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_06480 1932 2474 gene locus_tag LOCUS_06490 gene yfcE 1932 2474 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_06490 2624 3367 gene locus_tag LOCUS_06500 2624 3367 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388218.1 protein_id gnl|my_center|LOCUS_06500 3462 5804 gene locus_tag LOCUS_06510 gene pcrA 3462 5804 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_06510 6122 5877 gene locus_tag LOCUS_06520 6122 5877 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815105.1 protein_id gnl|my_center|LOCUS_06520 6439 6248 gene locus_tag LOCUS_06530 6439 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815107.1 protein_id gnl|my_center|LOCUS_06530 6667 7689 gene locus_tag LOCUS_06540 6667 7689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 8392 7772 gene locus_tag LOCUS_06550 8392 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 8637 8894 gene locus_tag LOCUS_06560 8637 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 8938 9648 gene locus_tag LOCUS_06570 gene radC 8938 9648 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 protein_id gnl|my_center|LOCUS_06570 9687 10721 gene locus_tag LOCUS_06580 9687 10721 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403487.1 protein_id gnl|my_center|LOCUS_06580 10862 11677 gene locus_tag LOCUS_06590 gene mreC 10862 11677 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_06590 11696 12229 gene locus_tag LOCUS_06600 11696 12229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 12290 14413 gene locus_tag LOCUS_06610 gene mrdA 12290 14413 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_06610 14472 15086 gene locus_tag LOCUS_06620 14472 15086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 15526 15140 gene locus_tag LOCUS_06630 15526 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 16001 15528 gene locus_tag LOCUS_06640 16001 15528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 16201 21015 gene locus_tag LOCUS_06650 16201 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 21037 24951 gene locus_tag LOCUS_06660 21037 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 25056 25499 gene locus_tag LOCUS_06670 25056 25499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 25952 26515 gene locus_tag LOCUS_06680 25952 26515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 26463 26609 gene locus_tag LOCUS_06690 26463 26609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 26790 31652 gene locus_tag LOCUS_06700 26790 31652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 31677 35921 gene locus_tag LOCUS_06710 31677 35921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 36567 35980 gene locus_tag LOCUS_06720 36567 35980 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048232.1 protein_id gnl|my_center|LOCUS_06720 36757 38826 gene locus_tag LOCUS_06730 36757 38826 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_06730 39015 41009 gene locus_tag LOCUS_06740 39015 41009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 41266 43704 gene locus_tag LOCUS_06750 gene spoIIE 41266 43704 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898719.1 protein_id gnl|my_center|LOCUS_06750 44012 45529 gene locus_tag LOCUS_06760 44012 45529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 45584 46822 gene locus_tag LOCUS_06770 45584 46822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 47097 47474 gene locus_tag LOCUS_06780 gene acpS 47097 47474 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861979.1 protein_id gnl|my_center|LOCUS_06780 47553 48335 gene locus_tag LOCUS_06790 47553 48335 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_06790 48750 48544 gene locus_tag LOCUS_06800 48750 48544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 50232 49327 gene locus_tag LOCUS_06810 gene htpX 50232 49327 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583272.1 protein_id gnl|my_center|LOCUS_06810 50867 50310 gene locus_tag LOCUS_06820 50867 50310 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_06820 51120 52151 gene locus_tag LOCUS_06830 51120 52151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 52335 53090 gene locus_tag LOCUS_06840 52335 53090 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_06840 53120 54247 gene locus_tag LOCUS_06850 53120 54247 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386882.1 protein_id gnl|my_center|LOCUS_06850 54538 58263 gene locus_tag LOCUS_06860 gene rpoB 54538 58263 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_06860 58390 62016 gene locus_tag LOCUS_06870 gene rpoC 58390 62016 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_06870 62381 64408 gene locus_tag LOCUS_06880 62381 64408 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_06880 64455 64901 gene locus_tag LOCUS_06890 gene rplI 64455 64901 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_06890 64929 66260 gene locus_tag LOCUS_06900 gene dnaB 64929 66260 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_06900 66495 67538 gene locus_tag LOCUS_06910 66495 67538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 67672 69480 gene locus_tag LOCUS_06920 gene ftsH 67672 69480 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_06920 69661 70209 gene locus_tag LOCUS_06930 69661 70209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 70288 70809 gene locus_tag LOCUS_06940 gene nrdG 70288 70809 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_06940 70905 71078 gene locus_tag LOCUS_06950 gene rpsU 70905 71078 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_06950 72208 71132 gene locus_tag LOCUS_06960 72208 71132 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068167.1 protein_id gnl|my_center|LOCUS_06960 72432 73700 gene locus_tag LOCUS_06970 72432 73700 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886510.1 protein_id gnl|my_center|LOCUS_06970 73760 75037 gene locus_tag LOCUS_06980 73760 75037 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_06980 75257 75427 gene locus_tag LOCUS_06990 75257 75427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 75596 76792 gene locus_tag LOCUS_07000 75596 76792 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732778.1 protein_id gnl|my_center|LOCUS_07000 76798 77682 gene locus_tag LOCUS_07010 gene dapA 76798 77682 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048149.1 protein_id gnl|my_center|LOCUS_07010 77856 78599 gene locus_tag LOCUS_07020 gene dapB 77856 78599 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_07020 78869 79387 gene locus_tag LOCUS_07030 78869 79387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 80457 79462 gene locus_tag LOCUS_07040 80457 79462 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422061.1 protein_id gnl|my_center|LOCUS_07040 80642 81952 gene locus_tag LOCUS_07050 80642 81952 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576225.1 protein_id gnl|my_center|LOCUS_07050 82148 85489 gene locus_tag LOCUS_07060 82148 85489 CDS product SNF2 helicase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986302.1 protein_id gnl|my_center|LOCUS_07060 85616 87058 gene locus_tag LOCUS_07070 gene trmFO 85616 87058 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_07070 87264 87437 gene locus_tag LOCUS_07080 87264 87437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 87460 88926 gene locus_tag LOCUS_07090 87460 88926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 89127 89540 gene locus_tag LOCUS_07100 gene rpsL 89127 89540 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641249.1 protein_id gnl|my_center|LOCUS_07100 89859 90329 gene locus_tag LOCUS_07110 gene rpsG 89859 90329 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357613.1 protein_id gnl|my_center|LOCUS_07110 90522 92603 gene locus_tag LOCUS_07120 gene fusA 90522 92603 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966416.1 protein_id gnl|my_center|LOCUS_07120 92774 93976 gene locus_tag LOCUS_07130 gene tuf 92774 93976 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_07130 95203 94052 gene locus_tag LOCUS_07140 95203 94052 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_07140 95607 95359 gene locus_tag LOCUS_07150 95607 95359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 96261 95635 gene locus_tag LOCUS_07160 96261 95635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 96444 96647 gene locus_tag LOCUS_07170 96444 96647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 96738 96986 gene locus_tag LOCUS_07180 96738 96986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 96991 97230 gene locus_tag LOCUS_07190 96991 97230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 97233 97397 gene locus_tag LOCUS_07200 97233 97397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 97412 97693 gene locus_tag LOCUS_07210 97412 97693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 97826 98596 gene locus_tag LOCUS_07220 97826 98596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 98596 98880 gene locus_tag LOCUS_07230 98596 98880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 98881 99144 gene locus_tag LOCUS_07240 98881 99144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 99131 99421 gene locus_tag LOCUS_07250 99131 99421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 99426 99602 gene locus_tag LOCUS_07260 99426 99602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 99627 100034 gene locus_tag LOCUS_07270 99627 100034 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047623.1 protein_id gnl|my_center|LOCUS_07270 100045 100185 gene locus_tag LOCUS_07280 100045 100185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 100172 100594 gene locus_tag LOCUS_07290 100172 100594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 100680 101135 gene locus_tag LOCUS_07300 100680 101135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07300 101128 101373 gene locus_tag LOCUS_07310 101128 101373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 101392 101691 gene locus_tag LOCUS_07320 101392 101691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 101820 102464 gene locus_tag LOCUS_07330 101820 102464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 102479 102661 gene locus_tag LOCUS_07340 102479 102661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 102686 103489 gene locus_tag LOCUS_07350 102686 103489 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793656.1 protein_id gnl|my_center|LOCUS_07350 103476 103910 gene locus_tag LOCUS_07360 103476 103910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 104072 104497 gene locus_tag LOCUS_07370 104072 104497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 104644 104717 gene locus_tag LOCUS_t00130 104644 104717 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 104819 106018 gene locus_tag LOCUS_07380 104819 106018 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399577.1 protein_id gnl|my_center|LOCUS_07380 106038 106664 gene locus_tag LOCUS_07390 106038 106664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 106651 107346 gene locus_tag LOCUS_07400 106651 107346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 107472 107786 gene locus_tag LOCUS_07410 107472 107786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 107776 109440 gene locus_tag LOCUS_07420 107776 109440 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965199.1 protein_id gnl|my_center|LOCUS_07420 109454 109612 gene locus_tag LOCUS_07430 109454 109612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 109599 110843 gene locus_tag LOCUS_07440 109599 110843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 110824 111462 gene locus_tag LOCUS_07450 110824 111462 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905713.1 protein_id gnl|my_center|LOCUS_07450 111464 112852 gene locus_tag LOCUS_07460 111464 112852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 112909 113331 gene locus_tag LOCUS_07470 112909 113331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 113347 113598 gene locus_tag LOCUS_07480 113347 113598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 113595 113981 gene locus_tag LOCUS_07490 113595 113981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 113983 114441 gene locus_tag LOCUS_07500 113983 114441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 114442 114786 gene locus_tag LOCUS_07510 114442 114786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 114802 115422 gene locus_tag LOCUS_07520 114802 115422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 115438 115773 gene locus_tag LOCUS_07530 115438 115773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 115824 116000 gene locus_tag LOCUS_07540 115824 116000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 116027 119071 gene locus_tag LOCUS_07550 116027 119071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 119086 119946 gene locus_tag LOCUS_07560 119086 119946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 119953 121113 gene locus_tag LOCUS_07570 119953 121113 CDS product siphovirus ReqiPepy6 Gp37-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714199.1 protein_id gnl|my_center|LOCUS_07570 121123 121989 gene locus_tag LOCUS_07580 121123 121989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 122014 122874 gene locus_tag LOCUS_07590 122014 122874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 123004 123516 gene locus_tag LOCUS_07600 123004 123516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 123782 124900 gene locus_tag LOCUS_07610 123782 124900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 124846 125166 gene locus_tag LOCUS_07620 124846 125166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 125170 125313 gene locus_tag LOCUS_07630 125170 125313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 125363 125680 gene locus_tag LOCUS_07640 125363 125680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 125704 125958 gene locus_tag LOCUS_07650 125704 125958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 126051 126200 gene locus_tag LOCUS_07660 126051 126200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 126200 127393 gene locus_tag LOCUS_07670 126200 127393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 127872 127489 gene locus_tag LOCUS_07680 127872 127489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 128107 127865 gene locus_tag LOCUS_07690 128107 127865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 128256 128423 gene locus_tag LOCUS_07700 128256 128423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 128974 130002 gene locus_tag LOCUS_07710 gene plsX 128974 130002 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_07710 130124 130381 gene locus_tag LOCUS_07720 gene acpP 130124 130381 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362599.1 protein_id gnl|my_center|LOCUS_07720 131690 130485 gene locus_tag LOCUS_07730 131690 130485 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965357.1 protein_id gnl|my_center|LOCUS_07730 131992 135903 gene locus_tag LOCUS_07740 131992 135903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 136263 137504 gene locus_tag LOCUS_07750 136263 137504 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_07750 137568 138425 gene locus_tag LOCUS_07760 137568 138425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 138449 139786 gene locus_tag LOCUS_07770 138449 139786 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_07770 139882 140526 gene locus_tag LOCUS_07780 139882 140526 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546537.1 protein_id gnl|my_center|LOCUS_07780 140644 141462 gene locus_tag LOCUS_07790 gene spo0A 140644 141462 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424711.1 protein_id gnl|my_center|LOCUS_07790 141578 142384 gene locus_tag LOCUS_07800 141578 142384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 142436 144250 gene locus_tag LOCUS_07810 gene cas8a1 142436 144250 CDS product type I-B CRISPR-associated protein Cas8b1/Cst1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861771.1 protein_id gnl|my_center|LOCUS_07810 144238 145146 gene locus_tag LOCUS_07820 gene cas7i 144238 145146 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_07820 145165 145836 gene locus_tag LOCUS_07830 gene cas5b 145165 145836 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_07830 145826 148018 gene locus_tag LOCUS_07840 145826 148018 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861769.1 protein_id gnl|my_center|LOCUS_07840 148066 148554 gene locus_tag LOCUS_07850 gene cas4 148066 148554 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_07850 148582 149574 gene locus_tag LOCUS_07860 gene cas1b 148582 149574 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896423.1 protein_id gnl|my_center|LOCUS_07860 149576 149860 gene locus_tag LOCUS_07870 gene cas2 149576 149860 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903132.1 protein_id gnl|my_center|LOCUS_07870 150048 151146 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtattaatttaaatataatagaatgtaaat 151283 151666 gene locus_tag LOCUS_07880 151283 151666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 153693 152032 gene locus_tag LOCUS_07890 153693 152032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 153930 154772 gene locus_tag LOCUS_07900 153930 154772 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_07900 156323 155124 gene locus_tag LOCUS_07910 156323 155124 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073167773.1 protein_id gnl|my_center|LOCUS_07910 156528 157475 gene locus_tag LOCUS_07920 156528 157475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393170.1 protein_id gnl|my_center|LOCUS_07920 157485 158012 gene locus_tag LOCUS_07930 157485 158012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 159131 158073 gene locus_tag LOCUS_07940 159131 158073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 159798 160001 gene locus_tag LOCUS_07950 159798 160001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 160014 160529 gene locus_tag LOCUS_07960 160014 160529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 160498 161010 gene locus_tag LOCUS_07970 160498 161010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07970 161004 161366 gene locus_tag LOCUS_07980 161004 161366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07980 161569 161880 gene locus_tag LOCUS_07990 161569 161880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 162011 163144 gene locus_tag LOCUS_08000 162011 163144 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071540979.1 protein_id gnl|my_center|LOCUS_08000 163157 164929 gene locus_tag LOCUS_08010 163157 164929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 165099 165575 gene locus_tag LOCUS_08020 165099 165575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 165588 166682 gene locus_tag LOCUS_08030 165588 166682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 166792 168309 gene locus_tag LOCUS_08040 166792 168309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 168618 168322 gene locus_tag LOCUS_08050 168618 168322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 169373 169720 gene locus_tag LOCUS_08060 169373 169720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 169890 170732 gene locus_tag LOCUS_08070 169890 170732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 170798 171463 gene locus_tag LOCUS_08080 170798 171463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 171504 173576 gene locus_tag LOCUS_08090 171504 173576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 173814 174608 gene locus_tag LOCUS_08100 gene minD 173814 174608 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_08100 174632 175180 gene locus_tag LOCUS_08110 174632 175180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 175220 176326 gene locus_tag LOCUS_08120 gene rodA 175220 176326 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_08120 176336 177313 gene locus_tag LOCUS_08130 gene dusB 176336 177313 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_08130 177396 177992 gene locus_tag LOCUS_08140 177396 177992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 178059 178403 gene locus_tag LOCUS_08150 178059 178403 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_08150 179432 178506 gene locus_tag LOCUS_08160 179432 178506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 179567 181303 gene locus_tag LOCUS_08170 gene aspS 179567 181303 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029239.1 protein_id gnl|my_center|LOCUS_08170 181409 182149 gene locus_tag LOCUS_08180 gene yycF 181409 182149 CDS product response regulator YycF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003658889.1 protein_id gnl|my_center|LOCUS_08180 182423 183481 gene locus_tag LOCUS_08190 gene ispG 182423 183481 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194540.1 protein_id gnl|my_center|LOCUS_08190 183512 184369 gene locus_tag LOCUS_08200 183512 184369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 184609 185109 gene locus_tag LOCUS_08210 gene tnpA 184609 185109 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966797.1 protein_id gnl|my_center|LOCUS_08210 187524 185224 gene locus_tag LOCUS_08220 187524 185224 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_08220 187669 188538 gene locus_tag LOCUS_08230 gene rsmA 187669 188538 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_08230 188589 189332 gene locus_tag LOCUS_08240 188589 189332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 189487 189738 gene locus_tag LOCUS_08250 189487 189738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 189695 190168 gene locus_tag LOCUS_08260 189695 190168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 190617 190237 gene locus_tag LOCUS_08270 190617 190237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence04 1974 1117 gene locus_tag LOCUS_08280 1974 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3085 2060 gene locus_tag LOCUS_08290 gene spoIID 3085 2060 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432452.1 protein_id gnl|my_center|LOCUS_08290 3605 3111 gene locus_tag LOCUS_08300 3605 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 4439 3951 gene locus_tag LOCUS_08310 gene spoIIAB 4439 3951 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965604.1 protein_id gnl|my_center|LOCUS_08310 4798 4487 gene locus_tag LOCUS_08320 gene spoIIAA 4798 4487 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965605.1 protein_id gnl|my_center|LOCUS_08320 7781 5112 gene locus_tag LOCUS_08330 7781 5112 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048157.1 protein_id gnl|my_center|LOCUS_08330 9059 7899 gene locus_tag LOCUS_08340 gene fucO 9059 7899 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766959.1 protein_id gnl|my_center|LOCUS_08340 9764 9114 gene locus_tag LOCUS_08350 9764 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 11007 9862 gene locus_tag LOCUS_08360 11007 9862 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393239.1 protein_id gnl|my_center|LOCUS_08360 11737 11135 gene locus_tag LOCUS_08370 11737 11135 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767065.1 protein_id gnl|my_center|LOCUS_08370 13437 11752 gene locus_tag LOCUS_08380 13437 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 14569 13442 gene locus_tag LOCUS_08390 14569 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 15459 14641 gene locus_tag LOCUS_08400 15459 14641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 16282 15626 gene locus_tag LOCUS_08410 16282 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 16959 16333 gene locus_tag LOCUS_08420 16959 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 17600 16941 gene locus_tag LOCUS_08430 17600 16941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18765 17611 gene locus_tag LOCUS_08440 gene spoIIIAE 18765 17611 CDS product stage III sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358911.1 protein_id gnl|my_center|LOCUS_08440 19166 18780 gene locus_tag LOCUS_08450 19166 18780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 19411 19217 gene locus_tag LOCUS_08460 gene spoIIIAC 19411 19217 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_08460 19943 19434 gene locus_tag LOCUS_08470 gene spoIIIAB 19943 19434 CDS product stage III sporulation protein SpoIIIAB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965392.1 protein_id gnl|my_center|LOCUS_08470 20424 20035 gene locus_tag LOCUS_08480 20424 20035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08480 20912 20586 gene locus_tag LOCUS_08490 20912 20586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08490 22712 21015 gene locus_tag LOCUS_08500 22712 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 23518 22799 gene locus_tag LOCUS_08510 23518 22799 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_08510 24628 23867 gene locus_tag LOCUS_08520 24628 23867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 25827 24892 gene locus_tag LOCUS_08530 gene gpr 25827 24892 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048007.1 protein_id gnl|my_center|LOCUS_08530 28820 25986 gene locus_tag LOCUS_08540 gene uvrA 28820 25986 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_08540 30713 29043 gene locus_tag LOCUS_08550 30713 29043 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_08550 31177 30737 gene locus_tag LOCUS_08560 31177 30737 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_08560 31420 31199 gene locus_tag LOCUS_08570 31420 31199 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551852.1 protein_id gnl|my_center|LOCUS_08570 32684 31491 gene locus_tag LOCUS_08580 gene xseA 32684 31491 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_08580 33116 32709 gene locus_tag LOCUS_08590 gene nusB 33116 32709 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965384.1 protein_id gnl|my_center|LOCUS_08590 33337 33134 gene locus_tag LOCUS_08600 33337 33134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 33911 33363 gene locus_tag LOCUS_08610 33911 33363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 34435 33992 gene locus_tag LOCUS_08620 34435 33992 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_08620 34988 34626 gene locus_tag LOCUS_08630 34988 34626 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715480.1 protein_id gnl|my_center|LOCUS_08630 35910 34999 gene locus_tag LOCUS_08640 35910 34999 CDS product NOL1/NOP2/sun family putative RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496367.1 protein_id gnl|my_center|LOCUS_08640 36028 36378 gene locus_tag LOCUS_08650 36028 36378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 37562 36453 gene locus_tag LOCUS_08660 gene metK 37562 36453 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_08660 39224 37584 gene locus_tag LOCUS_08670 39224 37584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963592.1 protein_id gnl|my_center|LOCUS_08670 39942 39217 gene locus_tag LOCUS_08680 39942 39217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000570206.1 protein_id gnl|my_center|LOCUS_08680 41645 39963 gene locus_tag LOCUS_08690 41645 39963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 42665 41724 gene locus_tag LOCUS_08700 gene fmt 42665 41724 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_08700 43198 42731 gene locus_tag LOCUS_08710 gene def 43198 42731 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_08710 45471 43213 gene locus_tag LOCUS_08720 gene priA 45471 43213 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_08720 46047 45487 gene locus_tag LOCUS_08730 46047 45487 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870161.1 protein_id gnl|my_center|LOCUS_08730 46243 46052 gene locus_tag LOCUS_08740 46243 46052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 46559 46245 gene locus_tag LOCUS_08750 46559 46245 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_08750 47082 46573 gene locus_tag LOCUS_08760 47082 46573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 47533 47075 gene locus_tag LOCUS_08770 47533 47075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 48297 47530 gene locus_tag LOCUS_08780 48297 47530 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_08780 49100 48561 gene locus_tag LOCUS_08790 49100 48561 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_08790 49668 49342 gene locus_tag LOCUS_08800 49668 49342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 49878 49805 gene locus_tag LOCUS_t00140 49878 49805 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 49994 49921 gene locus_tag LOCUS_t00150 49994 49921 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 51690 50095 gene locus_tag LOCUS_08810 51690 50095 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966175.1 protein_id gnl|my_center|LOCUS_08810 51883 52605 gene locus_tag LOCUS_08820 gene deoD 51883 52605 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020631.1 protein_id gnl|my_center|LOCUS_08820 53202 52726 gene locus_tag LOCUS_08830 gene greA 53202 52726 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_08830 53924 53331 gene locus_tag LOCUS_08840 gene pgsA 53924 53331 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_08840 55224 54001 gene locus_tag LOCUS_08850 55224 54001 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_08850 56597 55377 gene locus_tag LOCUS_08860 56597 55377 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726077.1 protein_id gnl|my_center|LOCUS_08860 57843 56617 gene locus_tag LOCUS_08870 57843 56617 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391790.1 protein_id gnl|my_center|LOCUS_08870 58755 57853 gene locus_tag LOCUS_08880 gene ftsX 58755 57853 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_08880 59431 58745 gene locus_tag LOCUS_08890 gene ftsE 59431 58745 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_08890 60527 59604 gene locus_tag LOCUS_08900 60527 59604 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_08900 61553 60732 gene locus_tag LOCUS_08910 61553 60732 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_08910 62737 62063 gene locus_tag LOCUS_08920 62737 62063 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_08920 63486 62839 gene locus_tag LOCUS_08930 gene sigK 63486 62839 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_08930 63692 64492 gene locus_tag LOCUS_08940 63692 64492 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640533.1 protein_id gnl|my_center|LOCUS_08940 65807 64575 gene locus_tag LOCUS_08950 65807 64575 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_08950 66552 65965 gene locus_tag LOCUS_08960 66552 65965 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964993.1 protein_id gnl|my_center|LOCUS_08960 68455 66635 gene locus_tag LOCUS_08970 gene typA 68455 66635 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_08970 71065 68609 gene locus_tag LOCUS_08980 gene clpC 71065 68609 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235011.1 protein_id gnl|my_center|LOCUS_08980 72131 71130 gene locus_tag LOCUS_08990 72131 71130 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328432.1 protein_id gnl|my_center|LOCUS_08990 72712 72155 gene locus_tag LOCUS_09000 72712 72155 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674811.1 protein_id gnl|my_center|LOCUS_09000 73170 72727 gene locus_tag LOCUS_09010 73170 72727 CDS product CtsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966469.1 protein_id gnl|my_center|LOCUS_09010 73610 73401 gene locus_tag LOCUS_09020 73610 73401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 74804 73872 gene locus_tag LOCUS_09030 74804 73872 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226263.1 protein_id gnl|my_center|LOCUS_09030 75622 74936 gene locus_tag LOCUS_09040 75622 74936 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582682.1 protein_id gnl|my_center|LOCUS_09040 76786 75785 gene locus_tag LOCUS_09050 76786 75785 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_09050 77131 76805 gene locus_tag LOCUS_09060 77131 76805 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965233.1 protein_id gnl|my_center|LOCUS_09060 77850 77161 gene locus_tag LOCUS_09070 77850 77161 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_09070 78666 77962 gene locus_tag LOCUS_09080 78666 77962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 80214 78673 gene locus_tag LOCUS_09090 gene gpmI 80214 78673 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_09090 81101 80355 gene locus_tag LOCUS_09100 gene tpiA 81101 80355 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_09100 82374 81190 gene locus_tag LOCUS_09110 82374 81190 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_09110 83648 82629 gene locus_tag LOCUS_09120 gene gap 83648 82629 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_09120 84390 83866 gene locus_tag LOCUS_09130 84390 83866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 86474 84498 gene locus_tag LOCUS_09140 86474 84498 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978811.1 protein_id gnl|my_center|LOCUS_09140 88185 86536 gene locus_tag LOCUS_09150 88185 86536 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_09150 89861 88248 gene locus_tag LOCUS_09160 89861 88248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 92429 90000 gene locus_tag LOCUS_09170 92429 90000 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438328.1 protein_id gnl|my_center|LOCUS_09170 93017 92514 gene locus_tag LOCUS_09180 93017 92514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 93584 93036 gene locus_tag LOCUS_09190 gene rsmD 93584 93036 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986836.1 protein_id gnl|my_center|LOCUS_09190 94435 93785 gene locus_tag LOCUS_09200 94435 93785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 95028 94570 gene locus_tag LOCUS_09210 95028 94570 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392381.1 protein_id gnl|my_center|LOCUS_09210 95553 95053 gene locus_tag LOCUS_09220 95553 95053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 96936 95680 gene locus_tag LOCUS_09230 96936 95680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 97853 96933 gene locus_tag LOCUS_09240 gene miaA 97853 96933 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_09240 98340 97876 gene locus_tag LOCUS_09250 98340 97876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 100803 98353 gene locus_tag LOCUS_09260 100803 98353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 101106 100900 gene locus_tag LOCUS_09270 101106 100900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 103047 101839 gene locus_tag LOCUS_09280 103047 101839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 103474 103172 gene locus_tag LOCUS_09290 103474 103172 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229490.1 protein_id gnl|my_center|LOCUS_09290 108450 103663 gene locus_tag LOCUS_09300 gene polC 108450 103663 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966712.1 protein_id gnl|my_center|LOCUS_09300 110109 108850 gene locus_tag LOCUS_09310 110109 108850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 110258 112423 gene locus_tag LOCUS_09320 110258 112423 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048131.1 protein_id gnl|my_center|LOCUS_09320 112500 112721 gene locus_tag LOCUS_09330 112500 112721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 113250 112939 gene locus_tag LOCUS_09340 113250 112939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 114908 113268 gene locus_tag LOCUS_09350 114908 113268 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948012.1 protein_id gnl|my_center|LOCUS_09350 116016 115375 gene locus_tag LOCUS_09360 116016 115375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 116500 116021 gene locus_tag LOCUS_09370 116500 116021 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775411.1 protein_id gnl|my_center|LOCUS_09370 117197 116535 gene locus_tag LOCUS_09380 117197 116535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 117921 117286 gene locus_tag LOCUS_09390 117921 117286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 118391 118053 gene locus_tag LOCUS_09400 118391 118053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 118573 118992 gene locus_tag LOCUS_09410 118573 118992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 118994 119377 gene locus_tag LOCUS_09420 118994 119377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 119362 120465 gene locus_tag LOCUS_09430 119362 120465 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_09430 120886 120740 gene locus_tag LOCUS_09440 120886 120740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 122805 121081 gene locus_tag LOCUS_09450 122805 121081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 123047 123394 gene locus_tag LOCUS_09460 123047 123394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 123694 123401 gene locus_tag LOCUS_09470 123694 123401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 125419 124037 gene locus_tag LOCUS_09480 125419 124037 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966472.1 protein_id gnl|my_center|LOCUS_09480 125968 126042 gene locus_tag LOCUS_t00160 125968 126042 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 126274 126074 gene locus_tag LOCUS_09490 126274 126074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 126241 126549 gene locus_tag LOCUS_09500 126241 126549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 127360 126893 gene locus_tag LOCUS_09510 127360 126893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 127946 127380 gene locus_tag LOCUS_09520 gene efp 127946 127380 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_09520 129089 128031 gene locus_tag LOCUS_09530 129089 128031 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391500.1 protein_id gnl|my_center|LOCUS_09530 129864 129112 gene locus_tag LOCUS_09540 129864 129112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 130389 129895 gene locus_tag LOCUS_09550 130389 129895 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000765314.1 protein_id gnl|my_center|LOCUS_09550 131398 130694 gene locus_tag LOCUS_09560 gene sleB 131398 130694 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_09560 132506 131484 gene locus_tag LOCUS_09570 132506 131484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 134550 132514 gene locus_tag LOCUS_09580 134550 132514 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064995.1 protein_id gnl|my_center|LOCUS_09580 136229 134562 gene locus_tag LOCUS_09590 136229 134562 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963834.1 protein_id gnl|my_center|LOCUS_09590 137219 136272 gene locus_tag LOCUS_09600 gene murB 137219 136272 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_09600 137515 137318 gene locus_tag LOCUS_09610 137515 137318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 137526 138389 gene locus_tag LOCUS_09620 137526 138389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 138449 138697 gene locus_tag LOCUS_09630 138449 138697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 139628 138774 gene locus_tag LOCUS_09640 139628 138774 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_09640 140589 139708 gene locus_tag LOCUS_09650 gene dpsA 140589 139708 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439770.1 protein_id gnl|my_center|LOCUS_09650 142035 140782 gene locus_tag LOCUS_09660 142035 140782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 142651 142091 gene locus_tag LOCUS_09670 142651 142091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 145373 142665 gene locus_tag LOCUS_09680 gene polA 145373 142665 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_09680 145589 145834 gene locus_tag LOCUS_09690 145589 145834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 146016 146312 gene locus_tag LOCUS_09700 146016 146312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 147139 146366 gene locus_tag LOCUS_09710 gene fabI 147139 146366 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421886.1 protein_id gnl|my_center|LOCUS_09710 147604 147143 gene locus_tag LOCUS_09720 147604 147143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09720 147959 147552 gene locus_tag LOCUS_09730 147959 147552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09730 148809 147946 gene locus_tag LOCUS_09740 gene accD 148809 147946 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048422.1 protein_id gnl|my_center|LOCUS_09740 150161 148806 gene locus_tag LOCUS_09750 150161 148806 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048423.1 protein_id gnl|my_center|LOCUS_09750 150631 150209 gene locus_tag LOCUS_09760 gene fabZ 150631 150209 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356286.1 protein_id gnl|my_center|LOCUS_09760 151088 150642 gene locus_tag LOCUS_09770 gene accB 151088 150642 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_09770 152329 151088 gene locus_tag LOCUS_09780 gene fabF 152329 151088 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_09780 153078 152344 gene locus_tag LOCUS_09790 gene fabG 153078 152344 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_09790 154024 153080 gene locus_tag LOCUS_09800 gene fabD 154024 153080 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_09800 154608 154021 gene locus_tag LOCUS_09810 154608 154021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 156335 154629 gene locus_tag LOCUS_09820 156335 154629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 157069 156497 gene locus_tag LOCUS_09830 157069 156497 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963361.1 protein_id gnl|my_center|LOCUS_09830 157661 157104 gene locus_tag LOCUS_09840 157661 157104 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_09840 159419 157692 gene locus_tag LOCUS_09850 159419 157692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 160439 159432 gene locus_tag LOCUS_09860 gene ruvB 160439 159432 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965582.1 protein_id gnl|my_center|LOCUS_09860 161013 160525 gene locus_tag LOCUS_09870 161013 160525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 161486 161010 gene locus_tag LOCUS_09880 161486 161010 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_09880 162068 161658 gene locus_tag LOCUS_09890 162068 161658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 163038 162157 gene locus_tag LOCUS_09900 gene xerD 163038 162157 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_09900 163424 163143 gene locus_tag LOCUS_09910 163424 163143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 163779 163453 gene locus_tag LOCUS_09920 163779 163453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 165049 163856 gene locus_tag LOCUS_09930 165049 163856 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246128.1 protein_id gnl|my_center|LOCUS_09930 165897 165103 gene locus_tag LOCUS_09940 165897 165103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 166415 165987 gene locus_tag LOCUS_09950 gene rnhA 166415 165987 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_09950 166508 167740 gene locus_tag LOCUS_09960 166508 167740 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_09960 168237 167872 gene locus_tag LOCUS_09970 168237 167872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 168482 168276 gene locus_tag LOCUS_09980 168482 168276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 168823 168548 gene locus_tag LOCUS_09990 168823 168548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 168957 168883 gene locus_tag LOCUS_t00170 168957 168883 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 169042 168966 gene locus_tag LOCUS_t00180 169042 168966 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 169970 169188 gene locus_tag LOCUS_10000 169970 169188 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_10000 171144 170059 gene locus_tag LOCUS_10010 gene disA 171144 170059 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393302.1 protein_id gnl|my_center|LOCUS_10010 172537 171170 gene locus_tag LOCUS_10020 gene radA 172537 171170 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453976.1 protein_id gnl|my_center|LOCUS_10020 173027 172716 gene locus_tag LOCUS_10030 173027 172716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 174566 173265 gene locus_tag LOCUS_10040 gene mtaB 174566 173265 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048000.1 protein_id gnl|my_center|LOCUS_10040 175659 174640 gene locus_tag LOCUS_10050 175659 174640 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_10050 176143 176586 gene locus_tag LOCUS_10060 gene tsaE 176143 176586 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476188.1 protein_id gnl|my_center|LOCUS_10060 176673 177488 gene locus_tag LOCUS_10070 gene tsaB 176673 177488 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048262.1 protein_id gnl|my_center|LOCUS_10070 177488 178042 gene locus_tag LOCUS_10080 177488 178042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 178720 178223 gene locus_tag LOCUS_10090 178720 178223 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_10090 180065 178791 gene locus_tag LOCUS_10100 gene obgE 180065 178791 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_10100 181215 180199 gene locus_tag LOCUS_10110 gene trpS 181215 180199 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393419.1 protein_id gnl|my_center|LOCUS_10110 183303 181414 gene locus_tag LOCUS_10120 183303 181414 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254225.1 protein_id gnl|my_center|LOCUS_10120 184423 183476 gene locus_tag LOCUS_10130 184423 183476 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 protein_id gnl|my_center|LOCUS_10130 184878 184444 gene locus_tag LOCUS_10140 184878 184444 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_10140 185816 184875 gene locus_tag LOCUS_10150 185816 184875 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218353.1 protein_id gnl|my_center|LOCUS_10150 186670 185882 gene locus_tag LOCUS_10160 186670 185882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_10160 187528 186782 gene locus_tag LOCUS_10170 187528 186782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence05 158 1483 gene locus_tag LOCUS_10180 158 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 1600 4005 gene locus_tag LOCUS_10190 1600 4005 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_10190 4110 4709 gene locus_tag LOCUS_10200 4110 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5504 4902 gene locus_tag LOCUS_10210 gene pgsA 5504 4902 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_10210 7871 5514 gene locus_tag LOCUS_10220 7871 5514 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_10220 8037 8900 gene locus_tag LOCUS_10230 8037 8900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 10846 9536 gene locus_tag LOCUS_10240 10846 9536 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965728.1 protein_id gnl|my_center|LOCUS_10240 11090 11587 gene locus_tag LOCUS_10250 11090 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 11602 12234 gene locus_tag LOCUS_10260 11602 12234 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_10260 12314 13624 gene locus_tag LOCUS_10270 12314 13624 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289207.1 protein_id gnl|my_center|LOCUS_10270 13765 13902 gene locus_tag LOCUS_10280 13765 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 13919 14869 gene locus_tag LOCUS_10290 gene cdaA 13919 14869 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_10290 16333 15146 gene locus_tag LOCUS_10300 16333 15146 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675870.1 protein_id gnl|my_center|LOCUS_10300 16849 16478 gene locus_tag LOCUS_10310 16849 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 17388 16867 gene locus_tag LOCUS_10320 17388 16867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 17543 17764 gene locus_tag LOCUS_10330 17543 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 17827 18018 gene locus_tag LOCUS_10340 17827 18018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 18022 18249 gene locus_tag LOCUS_10350 18022 18249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 18334 18639 gene locus_tag LOCUS_10360 18334 18639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 18723 18878 gene locus_tag LOCUS_10370 18723 18878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 18881 20818 gene locus_tag LOCUS_10380 18881 20818 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700554.1 protein_id gnl|my_center|LOCUS_10380 20818 21162 gene locus_tag LOCUS_10390 20818 21162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 21162 21488 gene locus_tag LOCUS_10400 21162 21488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 21508 21780 gene locus_tag LOCUS_10410 21508 21780 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_10410 21783 22793 gene locus_tag LOCUS_10420 21783 22793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 22793 23536 gene locus_tag LOCUS_10430 22793 23536 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001796827.1 protein_id gnl|my_center|LOCUS_10430 23548 23862 gene locus_tag LOCUS_10440 23548 23862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 23867 23986 gene locus_tag LOCUS_10450 23867 23986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 23967 24812 gene locus_tag LOCUS_10460 23967 24812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 24814 24996 gene locus_tag LOCUS_10470 24814 24996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 25121 25285 gene locus_tag LOCUS_10480 25121 25285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 25341 25751 gene locus_tag LOCUS_10490 25341 25751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272396.1 protein_id gnl|my_center|LOCUS_10490 25758 25985 gene locus_tag LOCUS_10500 25758 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 25915 26274 gene locus_tag LOCUS_10510 25915 26274 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989958.1 protein_id gnl|my_center|LOCUS_10510 26279 26512 gene locus_tag LOCUS_10520 26279 26512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 26530 26751 gene locus_tag LOCUS_10530 26530 26751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 26764 27009 gene locus_tag LOCUS_10540 26764 27009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246457.1 protein_id gnl|my_center|LOCUS_10540 27009 27608 gene locus_tag LOCUS_10550 27009 27608 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680282.1 protein_id gnl|my_center|LOCUS_10550 27610 27822 gene locus_tag LOCUS_10560 27610 27822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 27803 27988 gene locus_tag LOCUS_10570 27803 27988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 27957 28151 gene locus_tag LOCUS_10580 27957 28151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 28162 28404 gene locus_tag LOCUS_10590 28162 28404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 28503 28676 gene locus_tag LOCUS_10600 28503 28676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 28692 29090 gene locus_tag LOCUS_10610 28692 29090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 29095 29280 gene locus_tag LOCUS_10620 29095 29280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 29282 29587 gene locus_tag LOCUS_10630 29282 29587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 29600 29893 gene locus_tag LOCUS_10640 29600 29893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 29883 30089 gene locus_tag LOCUS_10650 29883 30089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 30082 30555 gene locus_tag LOCUS_10660 30082 30555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 30557 30778 gene locus_tag LOCUS_10670 30557 30778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 30757 31248 gene locus_tag LOCUS_10680 30757 31248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 31229 31567 gene locus_tag LOCUS_10690 31229 31567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 31524 31832 gene locus_tag LOCUS_10700 31524 31832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 31798 31953 gene locus_tag LOCUS_10710 31798 31953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 32045 32635 gene locus_tag LOCUS_10720 32045 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 32786 32923 gene locus_tag LOCUS_10730 32786 32923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 33031 33627 gene locus_tag LOCUS_10740 33031 33627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 33630 34160 gene locus_tag LOCUS_10750 33630 34160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 34160 35314 gene locus_tag LOCUS_10760 34160 35314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 35311 35949 gene locus_tag LOCUS_10770 35311 35949 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087445.1 protein_id gnl|my_center|LOCUS_10770 35972 36220 gene locus_tag LOCUS_10780 35972 36220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 36264 36728 gene locus_tag LOCUS_10790 36264 36728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 36772 37164 gene locus_tag LOCUS_10800 36772 37164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 37236 37676 gene locus_tag LOCUS_10810 37236 37676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10810 37744 38112 gene locus_tag LOCUS_10820 37744 38112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10820 38127 39674 gene locus_tag LOCUS_10830 38127 39674 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047637.1 protein_id gnl|my_center|LOCUS_10830 39674 41245 gene locus_tag LOCUS_10840 39674 41245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 41247 41453 gene locus_tag LOCUS_10850 41247 41453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 41741 42352 gene locus_tag LOCUS_10860 41741 42352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 42372 42677 gene locus_tag LOCUS_10870 42372 42677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 42721 43740 gene locus_tag LOCUS_10880 42721 43740 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674646.1 protein_id gnl|my_center|LOCUS_10880 43788 44297 gene locus_tag LOCUS_10890 43788 44297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 44306 44767 gene locus_tag LOCUS_10900 44306 44767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 44770 45135 gene locus_tag LOCUS_10910 44770 45135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429844.1 protein_id gnl|my_center|LOCUS_10910 45137 45688 gene locus_tag LOCUS_10920 45137 45688 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047645.1 protein_id gnl|my_center|LOCUS_10920 45681 46136 gene locus_tag LOCUS_10930 45681 46136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901504.1 protein_id gnl|my_center|LOCUS_10930 46123 46320 gene locus_tag LOCUS_10940 46123 46320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 46322 47614 gene locus_tag LOCUS_10950 46322 47614 CDS product phage tail sheath family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861032.1 protein_id gnl|my_center|LOCUS_10950 47665 48138 gene locus_tag LOCUS_10960 47665 48138 CDS product phage tail tube protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429851.1 protein_id gnl|my_center|LOCUS_10960 48178 48585 gene locus_tag LOCUS_10970 48178 48585 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429853.1 protein_id gnl|my_center|LOCUS_10970 48791 51130 gene locus_tag LOCUS_10980 48791 51130 CDS product tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861036.1 protein_id gnl|my_center|LOCUS_10980 51145 51819 gene locus_tag LOCUS_10990 51145 51819 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861037.1 protein_id gnl|my_center|LOCUS_10990 51829 52791 gene locus_tag LOCUS_11000 51829 52791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 52805 53296 gene locus_tag LOCUS_11010 52805 53296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 53315 53719 gene locus_tag LOCUS_11020 53315 53719 CDS product DUF2634 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861039.1 protein_id gnl|my_center|LOCUS_11020 53722 54828 gene locus_tag LOCUS_11030 53722 54828 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047656.1 protein_id gnl|my_center|LOCUS_11030 54825 55616 gene locus_tag LOCUS_11040 54825 55616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 55616 57454 gene locus_tag LOCUS_11050 55616 57454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 57839 58402 gene locus_tag LOCUS_11060 57839 58402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11060 58386 58649 gene locus_tag LOCUS_11070 58386 58649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11070 58865 59398 gene locus_tag LOCUS_11080 58865 59398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 59404 59658 gene locus_tag LOCUS_11090 59404 59658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 59679 60026 gene locus_tag LOCUS_11100 59679 60026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 60043 60294 gene locus_tag LOCUS_11110 60043 60294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 60451 61587 gene locus_tag LOCUS_11120 60451 61587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 62015 61617 gene locus_tag LOCUS_11130 62015 61617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 62233 62012 gene locus_tag LOCUS_11140 62233 62012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 62385 62564 gene locus_tag LOCUS_11150 62385 62564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 62643 62810 gene locus_tag LOCUS_11160 62643 62810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 62889 63077 gene locus_tag LOCUS_11170 62889 63077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 63055 63642 gene locus_tag LOCUS_11180 gene truA 63055 63642 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11180 63705 64154 gene locus_tag LOCUS_11190 63705 64154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 64283 65131 gene locus_tag LOCUS_11200 64283 65131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 67570 65231 gene locus_tag LOCUS_11210 67570 65231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 67720 68001 gene locus_tag LOCUS_11220 67720 68001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 68025 68285 gene locus_tag LOCUS_11230 68025 68285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 70241 68412 gene locus_tag LOCUS_11240 gene glmS 70241 68412 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_11240 70688 71386 gene locus_tag LOCUS_11250 70688 71386 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965416.1 protein_id gnl|my_center|LOCUS_11250 71487 71801 gene locus_tag LOCUS_11260 71487 71801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 71882 71958 gene locus_tag LOCUS_t00190 71882 71958 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 73633 72425 gene locus_tag LOCUS_11270 73633 72425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 73905 73546 gene locus_tag LOCUS_11280 73905 73546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 74303 74458 gene locus_tag LOCUS_11290 74303 74458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 74675 76072 gene locus_tag LOCUS_11300 74675 76072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 76272 76418 gene locus_tag LOCUS_11310 76272 76418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 76461 76631 gene locus_tag LOCUS_11320 76461 76631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 78058 77090 gene locus_tag LOCUS_11330 78058 77090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 78755 78045 gene locus_tag LOCUS_11340 78755 78045 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948826.1 protein_id gnl|my_center|LOCUS_11340 78982 79782 gene locus_tag LOCUS_11350 78982 79782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 79829 80113 gene locus_tag LOCUS_11360 79829 80113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 80125 81309 gene locus_tag LOCUS_11370 gene yqfD 80125 81309 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861554.1 protein_id gnl|my_center|LOCUS_11370 81323 82534 gene locus_tag LOCUS_11380 81323 82534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 82535 83011 gene locus_tag LOCUS_11390 gene ybeY 82535 83011 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_11390 83065 84150 gene locus_tag LOCUS_11400 83065 84150 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_11400 84178 84513 gene locus_tag LOCUS_11410 84178 84513 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460709.1 protein_id gnl|my_center|LOCUS_11410 85224 84667 gene locus_tag LOCUS_11420 85224 84667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 85377 86333 gene locus_tag LOCUS_11430 85377 86333 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715339.1 protein_id gnl|my_center|LOCUS_11430 86818 87138 gene locus_tag LOCUS_11440 gene rpsJ 86818 87138 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_11440 87278 87913 gene locus_tag LOCUS_11450 gene rplC 87278 87913 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_11450 87934 88557 gene locus_tag LOCUS_11460 gene rplD 87934 88557 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_11460 88557 88904 gene locus_tag LOCUS_11470 88557 88904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 88976 89809 gene locus_tag LOCUS_11480 gene rplB 88976 89809 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459099.1 protein_id gnl|my_center|LOCUS_11480 89827 90108 gene locus_tag LOCUS_11490 gene rpsS 89827 90108 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421166.1 protein_id gnl|my_center|LOCUS_11490 90147 90512 gene locus_tag LOCUS_11500 gene rplV 90147 90512 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_11500 90517 91173 gene locus_tag LOCUS_11510 gene rpsC 90517 91173 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_11510 91173 91616 gene locus_tag LOCUS_11520 gene rplP 91173 91616 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_11520 91603 91809 gene locus_tag LOCUS_11530 gene rpmC 91603 91809 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421158.1 protein_id gnl|my_center|LOCUS_11530 91872 92135 gene locus_tag LOCUS_11540 gene rpsQ 91872 92135 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421156.1 protein_id gnl|my_center|LOCUS_11540 92153 92521 gene locus_tag LOCUS_11550 gene rplN 92153 92521 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_11550 92744 93052 gene locus_tag LOCUS_11560 gene rplX 92744 93052 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_11560 93071 93610 gene locus_tag LOCUS_11570 gene rplE 93071 93610 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966400.1 protein_id gnl|my_center|LOCUS_11570 93643 93828 gene locus_tag LOCUS_11580 93643 93828 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393924.1 protein_id gnl|my_center|LOCUS_11580 93881 94279 gene locus_tag LOCUS_11590 gene rpsH 93881 94279 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987748.1 protein_id gnl|my_center|LOCUS_11590 94316 94852 gene locus_tag LOCUS_11600 gene rplF 94316 94852 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_11600 95013 95372 gene locus_tag LOCUS_11610 gene rplR 95013 95372 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966396.1 protein_id gnl|my_center|LOCUS_11610 95403 95885 gene locus_tag LOCUS_11620 gene rpsE 95403 95885 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_11620 95929 96363 gene locus_tag LOCUS_11630 gene rplO 95929 96363 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000766080.1 protein_id gnl|my_center|LOCUS_11630 96364 97683 gene locus_tag LOCUS_11640 gene secY 96364 97683 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_11640 97829 98497 gene locus_tag LOCUS_11650 97829 98497 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_11650 98510 99283 gene locus_tag LOCUS_11660 gene map 98510 99283 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_11660 99371 99589 gene locus_tag LOCUS_11670 gene infA 99371 99589 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_11670 99954 100322 gene locus_tag LOCUS_11680 gene rpsM 99954 100322 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966388.1 protein_id gnl|my_center|LOCUS_11680 100508 100903 gene locus_tag LOCUS_11690 gene rpsK 100508 100903 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_11690 100934 101560 gene locus_tag LOCUS_11700 gene rpsD 100934 101560 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_11700 101665 102612 gene locus_tag LOCUS_11710 101665 102612 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_11710 102637 103164 gene locus_tag LOCUS_11720 gene rplQ 102637 103164 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_11720 103350 103700 gene locus_tag LOCUS_11730 103350 103700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 103809 104282 gene locus_tag LOCUS_11740 103809 104282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 104388 106628 gene locus_tag LOCUS_11750 104388 106628 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_11750 106704 107315 gene locus_tag LOCUS_11760 106704 107315 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357235.1 protein_id gnl|my_center|LOCUS_11760 107345 109345 gene locus_tag LOCUS_11770 107345 109345 CDS product KAP family P-loop domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015265747.1 protein_id gnl|my_center|LOCUS_11770 109368 111323 gene locus_tag LOCUS_11780 109368 111323 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_11780 111458 112012 gene locus_tag LOCUS_11790 gene spoVT 111458 112012 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359411.1 protein_id gnl|my_center|LOCUS_11790 112289 112059 gene locus_tag LOCUS_11800 112289 112059 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459149.1 protein_id gnl|my_center|LOCUS_11800 112561 113796 gene locus_tag LOCUS_11810 112561 113796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 113998 115749 gene locus_tag LOCUS_11820 113998 115749 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_11820 115793 116137 gene locus_tag LOCUS_11830 115793 116137 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 protein_id gnl|my_center|LOCUS_11830 116328 116990 gene locus_tag LOCUS_11840 116328 116990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 117151 119148 gene locus_tag LOCUS_11850 gene ligA 117151 119148 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_11850 119159 119398 gene locus_tag LOCUS_11860 119159 119398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 119500 120147 gene locus_tag LOCUS_11870 119500 120147 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948375.1 protein_id gnl|my_center|LOCUS_11870 120253 121140 gene locus_tag LOCUS_11880 gene folD 120253 121140 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_11880 121180 122139 gene locus_tag LOCUS_11890 gene dprA 121180 122139 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_11890 122328 122681 gene locus_tag LOCUS_11900 122328 122681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence06 771 1274 gene locus_tag LOCUS_11910 771 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1241 1624 gene locus_tag LOCUS_11920 1241 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1872 2165 gene locus_tag LOCUS_11930 1872 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2285 4732 gene locus_tag LOCUS_11940 gene gyrA 2285 4732 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_11940 5235 4888 gene locus_tag LOCUS_11950 5235 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 5896 5288 gene locus_tag LOCUS_11960 5896 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11960 6874 5897 gene locus_tag LOCUS_11970 6874 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 7304 7023 gene locus_tag LOCUS_11980 7304 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 8431 7553 gene locus_tag LOCUS_11990 8431 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 8780 8442 gene locus_tag LOCUS_12000 8780 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 10448 8889 gene locus_tag LOCUS_12010 10448 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11014 11205 gene locus_tag LOCUS_12020 11014 11205 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_12020 11308 11383 gene locus_tag LOCUS_t00200 11308 11383 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11432 11506 gene locus_tag LOCUS_t00210 11432 11506 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11533 11609 gene locus_tag LOCUS_t00220 11533 11609 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 11773 12513 gene locus_tag LOCUS_12030 11773 12513 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_12030 13058 12588 gene locus_tag LOCUS_12040 13058 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 13229 15028 gene locus_tag LOCUS_12050 13229 15028 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948022.1 protein_id gnl|my_center|LOCUS_12050 15379 15454 gene locus_tag LOCUS_t00230 15379 15454 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 17152 15464 gene locus_tag LOCUS_12060 17152 15464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 17680 17459 gene locus_tag LOCUS_12070 17680 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 17918 17673 gene locus_tag LOCUS_12080 17918 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 18342 17926 gene locus_tag LOCUS_12090 18342 17926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 18583 18413 gene locus_tag LOCUS_12100 18583 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 18914 18735 gene locus_tag LOCUS_12110 18914 18735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 19311 18904 gene locus_tag LOCUS_12120 19311 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 19756 20103 gene locus_tag LOCUS_12130 19756 20103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 20178 20396 gene locus_tag LOCUS_12140 20178 20396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 20501 20911 gene locus_tag LOCUS_12150 20501 20911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 20963 21151 gene locus_tag LOCUS_12160 20963 21151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 21506 21198 gene locus_tag LOCUS_12170 21506 21198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 21885 21589 gene locus_tag LOCUS_12180 21885 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 22242 21889 gene locus_tag LOCUS_12190 22242 21889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 22771 23133 gene locus_tag LOCUS_12200 22771 23133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 23284 24354 gene locus_tag LOCUS_12210 23284 24354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 24473 24694 gene locus_tag LOCUS_12220 24473 24694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 24748 26514 gene locus_tag LOCUS_12230 24748 26514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 26577 26993 gene locus_tag LOCUS_12240 26577 26993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 27014 27298 gene locus_tag LOCUS_12250 gene rpsF 27014 27298 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_12250 27318 27749 gene locus_tag LOCUS_12260 gene ssb 27318 27749 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_12260 27770 28198 gene locus_tag LOCUS_12270 27770 28198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 28225 28500 gene locus_tag LOCUS_12280 28225 28500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 28502 28894 gene locus_tag LOCUS_12290 28502 28894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 28912 29328 gene locus_tag LOCUS_12300 28912 29328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 29328 30788 gene locus_tag LOCUS_12310 29328 30788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 30755 30898 gene locus_tag LOCUS_12320 30755 30898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 30903 31103 gene locus_tag LOCUS_12330 30903 31103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 31110 31346 gene locus_tag LOCUS_12340 31110 31346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 31309 32178 gene locus_tag LOCUS_12350 31309 32178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 32465 32214 gene locus_tag LOCUS_12360 32465 32214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 32581 32823 gene locus_tag LOCUS_12370 32581 32823 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966909.1 protein_id gnl|my_center|LOCUS_12370 33015 33584 gene locus_tag LOCUS_12380 33015 33584 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_12380 33578 34549 gene locus_tag LOCUS_12390 33578 34549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 34710 35462 gene locus_tag LOCUS_12400 34710 35462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 36285 35530 gene locus_tag LOCUS_12410 gene spo0A 36285 35530 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226427.1 protein_id gnl|my_center|LOCUS_12410 36479 40807 gene locus_tag LOCUS_12420 36479 40807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 40825 41517 gene locus_tag LOCUS_12430 40825 41517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 41648 42331 gene locus_tag LOCUS_12440 41648 42331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 43022 42525 gene locus_tag LOCUS_12450 43022 42525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 43831 43034 gene locus_tag LOCUS_12460 43831 43034 CDS product S1 RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965266.1 protein_id gnl|my_center|LOCUS_12460 44381 43920 gene locus_tag LOCUS_12470 44381 43920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 44955 44416 gene locus_tag LOCUS_12480 44955 44416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 45523 45113 gene locus_tag LOCUS_12490 45523 45113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 45826 45560 gene locus_tag LOCUS_12500 45826 45560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 46132 45875 gene locus_tag LOCUS_12510 46132 45875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 47614 46355 gene locus_tag LOCUS_12520 47614 46355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12520 48521 47607 gene locus_tag LOCUS_12530 48521 47607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 49319 48696 gene locus_tag LOCUS_12540 49319 48696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 49649 49377 gene locus_tag LOCUS_12550 gene spoVG 49649 49377 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868999.1 protein_id gnl|my_center|LOCUS_12550 50101 49712 gene locus_tag LOCUS_12560 50101 49712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 52293 50929 gene locus_tag LOCUS_12570 52293 50929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 52579 52349 gene locus_tag LOCUS_12580 52579 52349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 53081 52608 gene locus_tag LOCUS_12590 53081 52608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 53744 53163 gene locus_tag LOCUS_12600 53744 53163 CDS product class A sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041726.1 protein_id gnl|my_center|LOCUS_12600 54155 53784 gene locus_tag LOCUS_12610 54155 53784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 54848 54384 gene locus_tag LOCUS_12620 54848 54384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 55839 54832 gene locus_tag LOCUS_12630 55839 54832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 56194 55853 gene locus_tag LOCUS_12640 56194 55853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 56327 56154 gene locus_tag LOCUS_12650 56327 56154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 56838 56371 gene locus_tag LOCUS_12660 56838 56371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 57313 56885 gene locus_tag LOCUS_12670 57313 56885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12670 57899 57558 gene locus_tag LOCUS_12680 57899 57558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 58200 57874 gene locus_tag LOCUS_12690 58200 57874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 58894 58151 gene locus_tag LOCUS_12700 58894 58151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 59181 58885 gene locus_tag LOCUS_12710 59181 58885 CDS product PrgI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965349.1 protein_id gnl|my_center|LOCUS_12710 59575 59195 gene locus_tag LOCUS_12720 59575 59195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 60598 59900 gene locus_tag LOCUS_12730 60598 59900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 60713 60591 gene locus_tag LOCUS_12740 60713 60591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 61296 63932 gene locus_tag LOCUS_12750 gene mgtA 61296 63932 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047937.1 protein_id gnl|my_center|LOCUS_12750 64141 65184 gene locus_tag LOCUS_12760 64141 65184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 65165 65860 gene locus_tag LOCUS_12770 gene srtA 65165 65860 CDS product class A sortase SrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831599.1 protein_id gnl|my_center|LOCUS_12770 65932 68433 gene locus_tag LOCUS_12780 65932 68433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 68625 69575 gene locus_tag LOCUS_12790 68625 69575 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932389.1 protein_id gnl|my_center|LOCUS_12790 71000 69705 gene locus_tag LOCUS_12800 71000 69705 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808454.1 protein_id gnl|my_center|LOCUS_12800 71287 71487 gene locus_tag LOCUS_12810 71287 71487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 71797 71528 gene locus_tag LOCUS_12820 71797 71528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 72170 72826 gene locus_tag LOCUS_12830 72170 72826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 73173 74756 gene locus_tag LOCUS_12840 73173 74756 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_12840 75032 75715 gene locus_tag LOCUS_12850 75032 75715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 75846 78029 gene locus_tag LOCUS_12860 75846 78029 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_12860 79419 78352 gene locus_tag LOCUS_12870 79419 78352 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_12870 81595 79556 gene locus_tag LOCUS_12880 81595 79556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 85895 81600 gene locus_tag LOCUS_12890 85895 81600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 86086 87819 gene locus_tag LOCUS_12900 86086 87819 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_12900 87949 89082 gene locus_tag LOCUS_12910 87949 89082 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963785.1 protein_id gnl|my_center|LOCUS_12910 89150 89767 gene locus_tag LOCUS_12920 89150 89767 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966844.1 protein_id gnl|my_center|LOCUS_12920 90825 89824 gene locus_tag LOCUS_12930 90825 89824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 92648 90894 gene locus_tag LOCUS_12940 gene aspS 92648 90894 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599762.1 protein_id gnl|my_center|LOCUS_12940 93636 92998 gene locus_tag LOCUS_12950 93636 92998 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964964.1 protein_id gnl|my_center|LOCUS_12950 94781 93633 gene locus_tag LOCUS_12960 94781 93633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 95738 94899 gene locus_tag LOCUS_12970 gene dapF 95738 94899 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157609.1 protein_id gnl|my_center|LOCUS_12970 95902 96588 gene locus_tag LOCUS_12980 95902 96588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 96806 96672 gene locus_tag LOCUS_12990 96806 96672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 97033 97377 gene locus_tag LOCUS_13000 97033 97377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 98826 97432 gene locus_tag LOCUS_13010 98826 97432 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence07 6225 3262 gene locus_tag LOCUS_13020 6225 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7191 6292 gene locus_tag LOCUS_13030 7191 6292 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476094.1 protein_id gnl|my_center|LOCUS_13030 8308 7193 gene locus_tag LOCUS_13040 8308 7193 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225909.1 protein_id gnl|my_center|LOCUS_13040 9303 8323 gene locus_tag LOCUS_13050 9303 8323 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 protein_id gnl|my_center|LOCUS_13050 10262 9309 gene locus_tag LOCUS_13060 10262 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 11820 10279 gene locus_tag LOCUS_13070 11820 10279 CDS product glucosyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399465.1 protein_id gnl|my_center|LOCUS_13070 13042 11822 gene locus_tag LOCUS_13080 13042 11822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 14201 13056 gene locus_tag LOCUS_13090 14201 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 15182 14217 gene locus_tag LOCUS_13100 15182 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 17108 15186 gene locus_tag LOCUS_13110 17108 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 17558 17298 gene locus_tag LOCUS_13120 gene rpmA 17558 17298 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357774.1 protein_id gnl|my_center|LOCUS_13120 18020 17634 gene locus_tag LOCUS_13130 gene rplU 18020 17634 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_13130 18717 18139 gene locus_tag LOCUS_13140 18717 18139 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_13140 18949 19698 gene locus_tag LOCUS_13150 18949 19698 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13150 20066 19725 gene locus_tag LOCUS_13160 20066 19725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 22202 20193 gene locus_tag LOCUS_13170 22202 20193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 22959 22192 gene locus_tag LOCUS_13180 22959 22192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 23643 23035 gene locus_tag LOCUS_13190 23643 23035 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544944.1 protein_id gnl|my_center|LOCUS_13190 24038 23951 gene locus_tag LOCUS_t00240 24038 23951 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24748 24185 gene locus_tag LOCUS_13200 24748 24185 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_13200 25434 24973 gene locus_tag LOCUS_13210 25434 24973 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389647.1 protein_id gnl|my_center|LOCUS_13210 25613 25849 gene locus_tag LOCUS_13220 25613 25849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 26217 27872 gene locus_tag LOCUS_13230 gene feoB 26217 27872 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13230 28588 28145 gene locus_tag LOCUS_13240 28588 28145 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000620822.1 protein_id gnl|my_center|LOCUS_13240 28723 31329 gene locus_tag LOCUS_13250 gene mgtA 28723 31329 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047937.1 protein_id gnl|my_center|LOCUS_13250 35149 31580 gene locus_tag LOCUS_13260 35149 31580 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_13260 36614 35172 gene locus_tag LOCUS_13270 gene amyS 36614 35172 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480254.1 protein_id gnl|my_center|LOCUS_13270 36836 37249 gene locus_tag LOCUS_13280 36836 37249 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_13280 37347 37637 gene locus_tag LOCUS_13290 37347 37637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 37653 38867 gene locus_tag LOCUS_13300 gene tyrS 37653 38867 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_13300 41917 39002 gene locus_tag LOCUS_13310 41917 39002 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963339.1 protein_id gnl|my_center|LOCUS_13310 42844 41939 gene locus_tag LOCUS_13320 42844 41939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 43005 43619 gene locus_tag LOCUS_13330 43005 43619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 43716 43791 gene locus_tag LOCUS_t00250 43716 43791 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 43999 44916 gene locus_tag LOCUS_13340 43999 44916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 46648 45011 gene locus_tag LOCUS_13350 gene groL 46648 45011 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_13350 47001 46720 gene locus_tag LOCUS_13360 47001 46720 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_13360 47191 48054 gene locus_tag LOCUS_13370 47191 48054 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166761.1 protein_id gnl|my_center|LOCUS_13370 49298 48432 gene locus_tag LOCUS_13380 49298 48432 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754206.1 protein_id gnl|my_center|LOCUS_13380 49506 50027 gene locus_tag LOCUS_13390 49506 50027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 50421 50122 gene locus_tag LOCUS_13400 50421 50122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 51828 50440 gene locus_tag LOCUS_13410 51828 50440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 52273 53277 gene locus_tag LOCUS_13420 52273 53277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 53280 54215 gene locus_tag LOCUS_13430 53280 54215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 54803 54730 gene locus_tag LOCUS_t00260 54803 54730 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 55249 54821 gene locus_tag LOCUS_13440 55249 54821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 56068 55457 gene locus_tag LOCUS_13450 56068 55457 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254069.1 protein_id gnl|my_center|LOCUS_13450 56953 56599 gene locus_tag LOCUS_tm00010 56953 56599 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 57149 57298 gene locus_tag LOCUS_13460 57149 57298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 57646 58068 gene locus_tag LOCUS_13470 57646 58068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13470 60784 58214 gene locus_tag LOCUS_13480 gene glgP 60784 58214 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_13480 61990 60968 gene locus_tag LOCUS_13490 gene rseP 61990 60968 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_13490 62878 62075 gene locus_tag LOCUS_13500 62878 62075 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384675.1 protein_id gnl|my_center|LOCUS_13500 63613 62900 gene locus_tag LOCUS_13510 63613 62900 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440346.1 protein_id gnl|my_center|LOCUS_13510 64542 63628 gene locus_tag LOCUS_13520 64542 63628 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_13520 65127 64579 gene locus_tag LOCUS_13530 gene frr 65127 64579 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_13530 65922 65215 gene locus_tag LOCUS_13540 gene pyrH 65922 65215 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_13540 67018 66140 gene locus_tag LOCUS_13550 gene tsf 67018 66140 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965094.1 protein_id gnl|my_center|LOCUS_13550 67900 67118 gene locus_tag LOCUS_13560 gene rpsB 67900 67118 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220918.1 protein_id gnl|my_center|LOCUS_13560 68198 69250 gene locus_tag LOCUS_13570 68198 69250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 70210 69308 gene locus_tag LOCUS_13580 70210 69308 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_13580 71679 70330 gene locus_tag LOCUS_13590 71679 70330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 72804 71698 gene locus_tag LOCUS_13600 72804 71698 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461712.1 protein_id gnl|my_center|LOCUS_13600 74461 72827 gene locus_tag LOCUS_13610 gene pilB 74461 72827 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_13610 74901 74485 gene locus_tag LOCUS_13620 74901 74485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 75328 74903 gene locus_tag LOCUS_13630 75328 74903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 76213 75359 gene locus_tag LOCUS_13640 76213 75359 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966069.1 protein_id gnl|my_center|LOCUS_13640 76675 76253 gene locus_tag LOCUS_13650 76675 76253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 77105 76692 gene locus_tag LOCUS_13660 77105 76692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 77663 77181 gene locus_tag LOCUS_13670 77663 77181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 78427 77681 gene locus_tag LOCUS_13680 78427 77681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 80043 78424 gene locus_tag LOCUS_13690 80043 78424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 81614 80241 gene locus_tag LOCUS_13700 gene rsmB 81614 80241 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440956.1 protein_id gnl|my_center|LOCUS_13700 81720 81938 gene locus_tag LOCUS_13710 81720 81938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 81956 82420 gene locus_tag LOCUS_13720 gene spoVAC 81956 82420 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418420.1 protein_id gnl|my_center|LOCUS_13720 82598 83599 gene locus_tag LOCUS_13730 gene spoVAD 82598 83599 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_13730 83710 84102 gene locus_tag LOCUS_13740 gene spoVAE 83710 84102 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_13740 84515 84165 gene locus_tag LOCUS_13750 gene rplT 84515 84165 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_13750 84753 84550 gene locus_tag LOCUS_13760 gene rpmI 84753 84550 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_13760 85134 84784 gene locus_tag LOCUS_13770 85134 84784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 86455 85625 gene locus_tag LOCUS_13780 86455 85625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 86709 88001 gene locus_tag LOCUS_13790 gene serS 86709 88001 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_13790 88065 88646 gene locus_tag LOCUS_13800 gene yihA 88065 88646 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867697.1 protein_id gnl|my_center|LOCUS_13800 88992 88714 gene locus_tag LOCUS_13810 88992 88714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 89318 89133 gene locus_tag LOCUS_13820 89318 89133 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_13820 91069 89423 gene locus_tag LOCUS_13830 91069 89423 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_13830 93095 91155 gene locus_tag LOCUS_13840 93095 91155 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_13840 94373 93507 gene locus_tag LOCUS_13850 94373 93507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 96361 94649 gene locus_tag LOCUS_13860 96361 94649 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_13860 96998 96429 gene locus_tag LOCUS_13870 96998 96429 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963361.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence08 1475 360 gene locus_tag LOCUS_13880 gene dnaN 1475 360 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_13880 3158 1803 gene locus_tag LOCUS_13890 gene dnaA 3158 1803 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_13890 3552 3686 gene locus_tag LOCUS_13900 gene rpmH 3552 3686 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568442.1 protein_id gnl|my_center|LOCUS_13900 3761 4126 gene locus_tag LOCUS_13910 gene rnpA 3761 4126 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_13910 4129 4347 gene locus_tag LOCUS_13920 4129 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4371 5264 gene locus_tag LOCUS_13930 4371 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 5279 5992 gene locus_tag LOCUS_13940 5279 5992 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_13940 6150 7460 gene locus_tag LOCUS_13950 gene mnmE 6150 7460 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_13950 7974 9875 gene locus_tag LOCUS_13960 gene mnmG 7974 9875 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_13960 9936 10655 gene locus_tag LOCUS_13970 gene rsmG 9936 10655 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_13970 11058 11846 gene locus_tag LOCUS_13980 gene soj 11058 11846 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_13980 11934 12782 gene locus_tag LOCUS_13990 11934 12782 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_13990 12845 13348 gene locus_tag LOCUS_14000 12845 13348 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398925.1 protein_id gnl|my_center|LOCUS_14000 13456 13547 gene locus_tag LOCUS_t00270 13456 13547 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13635 13724 gene locus_tag LOCUS_t00280 13635 13724 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13899 14273 gene locus_tag LOCUS_14010 13899 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 14297 14689 gene locus_tag LOCUS_14020 14297 14689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 14707 15054 gene locus_tag LOCUS_14030 14707 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 15150 15515 gene locus_tag LOCUS_14040 15150 15515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 15719 16066 gene locus_tag LOCUS_14050 15719 16066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 16059 17282 gene locus_tag LOCUS_14060 16059 17282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 17230 19179 gene locus_tag LOCUS_14070 17230 19179 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965347.1 protein_id gnl|my_center|LOCUS_14070 19195 21945 gene locus_tag LOCUS_14080 19195 21945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 22021 22917 gene locus_tag LOCUS_14090 22021 22917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 22948 23796 gene locus_tag LOCUS_14100 22948 23796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 23832 26633 gene locus_tag LOCUS_14110 23832 26633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 26647 27783 gene locus_tag LOCUS_14120 26647 27783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 27878 29497 gene locus_tag LOCUS_14130 27878 29497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 30236 29541 gene locus_tag LOCUS_14140 30236 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 30655 30413 gene locus_tag LOCUS_14150 30655 30413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 30876 31724 gene locus_tag LOCUS_14160 30876 31724 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933543.1 protein_id gnl|my_center|LOCUS_14160 36139 31883 gene locus_tag LOCUS_14170 36139 31883 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_14170 36605 36483 gene locus_tag LOCUS_14180 36605 36483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 36890 37435 gene locus_tag LOCUS_14190 36890 37435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 37592 37428 gene locus_tag LOCUS_14200 37592 37428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 37783 37935 gene locus_tag LOCUS_14210 37783 37935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 38053 38736 gene locus_tag LOCUS_14220 38053 38736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 38747 39487 gene locus_tag LOCUS_14230 38747 39487 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_14230 39581 40405 gene locus_tag LOCUS_14240 gene rsmI 39581 40405 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267808.1 protein_id gnl|my_center|LOCUS_14240 40568 41836 gene locus_tag LOCUS_14250 40568 41836 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_14250 41841 42632 gene locus_tag LOCUS_14260 41841 42632 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048403.1 protein_id gnl|my_center|LOCUS_14260 42772 43251 gene locus_tag LOCUS_14270 gene rlmH 42772 43251 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966801.1 protein_id gnl|my_center|LOCUS_14270 44040 43513 gene locus_tag LOCUS_14280 44040 43513 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_14280 44629 44045 gene locus_tag LOCUS_14290 44629 44045 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963791.1 protein_id gnl|my_center|LOCUS_14290 44767 45021 gene locus_tag LOCUS_14300 44767 45021 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_14300 45761 45093 gene locus_tag LOCUS_14310 gene spoIIR 45761 45093 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947973.1 protein_id gnl|my_center|LOCUS_14310 45980 46453 gene locus_tag LOCUS_14320 45980 46453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 46528 47775 gene locus_tag LOCUS_14330 46528 47775 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121186.1 protein_id gnl|my_center|LOCUS_14330 47920 49644 gene locus_tag LOCUS_14340 47920 49644 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396540.1 protein_id gnl|my_center|LOCUS_14340 50560 49856 gene locus_tag LOCUS_14350 50560 49856 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435803.1 protein_id gnl|my_center|LOCUS_14350 50890 50815 gene locus_tag LOCUS_t00290 50890 50815 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 51081 51569 gene locus_tag LOCUS_14360 gene tadA 51081 51569 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703380.1 protein_id gnl|my_center|LOCUS_14360 51616 52371 gene locus_tag LOCUS_14370 51616 52371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 52638 54290 gene locus_tag LOCUS_14380 gene dnaX 52638 54290 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003394606.1 protein_id gnl|my_center|LOCUS_14380 54380 54727 gene locus_tag LOCUS_14390 54380 54727 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_14390 54731 55330 gene locus_tag LOCUS_14400 gene recR 54731 55330 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_14400 56629 55436 gene locus_tag LOCUS_14410 56629 55436 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947974.1 protein_id gnl|my_center|LOCUS_14410 56814 57287 gene locus_tag LOCUS_14420 56814 57287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 57357 58730 gene locus_tag LOCUS_14430 gene ypeB 57357 58730 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947975.1 protein_id gnl|my_center|LOCUS_14430 58987 60330 gene locus_tag LOCUS_14440 58987 60330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 62261 60591 gene locus_tag LOCUS_14450 62261 60591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 62611 64008 gene locus_tag LOCUS_14460 62611 64008 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_14460 63996 65051 gene locus_tag LOCUS_14470 63996 65051 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_14470 65599 66474 gene locus_tag LOCUS_14480 65599 66474 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459679.1 protein_id gnl|my_center|LOCUS_14480 66581 67099 gene locus_tag LOCUS_14490 66581 67099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 67117 67425 gene locus_tag LOCUS_14500 67117 67425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 67448 69535 gene locus_tag LOCUS_14510 67448 69535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 69685 70767 gene locus_tag LOCUS_14520 69685 70767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence09 218 655 gene locus_tag LOCUS_14530 gene rplM 218 655 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_14530 657 1058 gene locus_tag LOCUS_14540 gene rpsI 657 1058 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393901.1 protein_id gnl|my_center|LOCUS_14540 1374 1111 gene locus_tag LOCUS_14550 1374 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1828 1385 gene locus_tag LOCUS_14560 1828 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 3368 1821 gene locus_tag LOCUS_14570 3368 1821 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966186.1 protein_id gnl|my_center|LOCUS_14570 3780 3484 gene locus_tag LOCUS_14580 3780 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4553 3951 gene locus_tag LOCUS_14590 4553 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4900 4619 gene locus_tag LOCUS_14600 gene spoIIID 4900 4619 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420727.1 protein_id gnl|my_center|LOCUS_14600 5765 5121 gene locus_tag LOCUS_14610 5765 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5890 7467 gene locus_tag LOCUS_14620 5890 7467 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_14620 8594 7464 gene locus_tag LOCUS_14630 gene nifS 8594 7464 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_14630 9498 8638 gene locus_tag LOCUS_14640 9498 8638 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207516.1 protein_id gnl|my_center|LOCUS_14640 11419 9689 gene locus_tag LOCUS_14650 11419 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 12794 11475 gene locus_tag LOCUS_14660 12794 11475 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_14660 13961 12888 gene locus_tag LOCUS_14670 13961 12888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 15387 14077 gene locus_tag LOCUS_14680 15387 14077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 16034 15444 gene locus_tag LOCUS_14690 16034 15444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 17959 16457 gene locus_tag LOCUS_14700 17959 16457 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965729.1 protein_id gnl|my_center|LOCUS_14700 18658 17981 gene locus_tag LOCUS_14710 18658 17981 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044683.1 protein_id gnl|my_center|LOCUS_14710 19916 18843 gene locus_tag LOCUS_14720 19916 18843 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_14720 21233 19977 gene locus_tag LOCUS_14730 gene rpoD 21233 19977 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_14730 23041 21248 gene locus_tag LOCUS_14740 gene dnaG 23041 21248 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357766.1 protein_id gnl|my_center|LOCUS_14740 23843 23184 gene locus_tag LOCUS_14750 23843 23184 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_14750 24134 23919 gene locus_tag LOCUS_14760 24134 23919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 25509 24070 gene locus_tag LOCUS_14770 gene proS 25509 24070 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450718.1 protein_id gnl|my_center|LOCUS_14770 26272 25586 gene locus_tag LOCUS_14780 26272 25586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 26454 26615 gene locus_tag LOCUS_14790 26454 26615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 26818 27396 gene locus_tag LOCUS_14800 26818 27396 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_14800 27393 27683 gene locus_tag LOCUS_14810 gene porD 27393 27683 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082458.1 protein_id gnl|my_center|LOCUS_14810 27784 28974 gene locus_tag LOCUS_14820 27784 28974 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_14820 28976 29920 gene locus_tag LOCUS_14830 28976 29920 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_14830 31133 30012 gene locus_tag LOCUS_14840 31133 30012 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966298.1 protein_id gnl|my_center|LOCUS_14840 31381 31211 gene locus_tag LOCUS_14850 31381 31211 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_14850 32313 31402 gene locus_tag LOCUS_14860 32313 31402 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_14860 33197 32310 gene locus_tag LOCUS_14870 33197 32310 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_14870 33869 33237 gene locus_tag LOCUS_14880 gene lepB 33869 33237 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047862.1 protein_id gnl|my_center|LOCUS_14880 35459 33999 gene locus_tag LOCUS_14890 35459 33999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 36587 35472 gene locus_tag LOCUS_14900 gene murG 36587 35472 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893705.1 protein_id gnl|my_center|LOCUS_14900 37757 36675 gene locus_tag LOCUS_14910 gene spoVE 37757 36675 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_14910 38790 37810 gene locus_tag LOCUS_14920 gene mraY 38790 37810 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_14920 40282 38810 gene locus_tag LOCUS_14930 40282 38810 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_14930 40733 40389 gene locus_tag LOCUS_14940 40733 40389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 42384 40831 gene locus_tag LOCUS_14950 42384 40831 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14950 42933 42436 gene locus_tag LOCUS_14960 42933 42436 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358710.1 protein_id gnl|my_center|LOCUS_14960 43519 42956 gene locus_tag LOCUS_14970 43519 42956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 44548 44123 gene locus_tag LOCUS_14980 gene mraZ 44548 44123 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355890.1 protein_id gnl|my_center|LOCUS_14980 44816 45661 gene locus_tag LOCUS_14990 44816 45661 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945539.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence10 1094 1546 gene locus_tag LOCUS_15000 1094 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 1559 1756 gene locus_tag LOCUS_15010 1559 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1743 1997 gene locus_tag LOCUS_15020 1743 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3006 2242 gene locus_tag LOCUS_15030 3006 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 3361 3104 gene locus_tag LOCUS_15040 3361 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3607 3374 gene locus_tag LOCUS_15050 3607 3374 CDS product hemolysin XhlA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358009.1 protein_id gnl|my_center|LOCUS_15050 4018 3791 gene locus_tag LOCUS_15060 4018 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 5395 4085 gene locus_tag LOCUS_15070 5395 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 6450 5470 gene locus_tag LOCUS_15080 6450 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 11112 6466 gene locus_tag LOCUS_15090 11112 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 11834 11124 gene locus_tag LOCUS_15100 11834 11124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 12086 11853 gene locus_tag LOCUS_15110 12086 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 13217 12252 gene locus_tag LOCUS_15120 13217 12252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 13421 13260 gene locus_tag LOCUS_15130 13421 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 16424 13755 gene locus_tag LOCUS_15140 16424 13755 CDS product phage tail tape measure protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286502.1 protein_id gnl|my_center|LOCUS_15140 16987 16634 gene locus_tag LOCUS_15150 16987 16634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 17595 17014 gene locus_tag LOCUS_15160 17595 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286512.1 protein_id gnl|my_center|LOCUS_15160 17988 17596 gene locus_tag LOCUS_15170 17988 17596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 18344 17988 gene locus_tag LOCUS_15180 18344 17988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 18678 18337 gene locus_tag LOCUS_15190 18678 18337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 18943 18665 gene locus_tag LOCUS_15200 18943 18665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 20259 18997 gene locus_tag LOCUS_15210 20259 18997 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286525.1 protein_id gnl|my_center|LOCUS_15210 21062 20271 gene locus_tag LOCUS_15220 21062 20271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 22236 21052 gene locus_tag LOCUS_15230 22236 21052 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002317387.1 protein_id gnl|my_center|LOCUS_15230 23910 22264 gene locus_tag LOCUS_15240 23910 22264 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625088.1 protein_id gnl|my_center|LOCUS_15240 24364 23900 gene locus_tag LOCUS_15250 24364 23900 CDS product phage terminase small subunit P27 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965200.1 protein_id gnl|my_center|LOCUS_15250 24831 24487 gene locus_tag LOCUS_15260 24831 24487 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286540.1 protein_id gnl|my_center|LOCUS_15260 25099 24833 gene locus_tag LOCUS_15270 25099 24833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 25680 25165 gene locus_tag LOCUS_15280 25680 25165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 26039 25743 gene locus_tag LOCUS_15290 26039 25743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426603.1 protein_id gnl|my_center|LOCUS_15290 26738 26304 gene locus_tag LOCUS_15300 26738 26304 CDS product sigma factor-like helix-turn-helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963871.1 protein_id gnl|my_center|LOCUS_15300 26927 26763 gene locus_tag LOCUS_15310 26927 26763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 27553 26927 gene locus_tag LOCUS_15320 27553 26927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 27683 27546 gene locus_tag LOCUS_15330 27683 27546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 28014 27697 gene locus_tag LOCUS_15340 28014 27697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 28420 27992 gene locus_tag LOCUS_15350 gene ssb 28420 27992 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420524.1 protein_id gnl|my_center|LOCUS_15350 28752 28417 gene locus_tag LOCUS_15360 28752 28417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 28952 28764 gene locus_tag LOCUS_15370 28952 28764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 29370 28942 gene locus_tag LOCUS_15380 29370 28942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 30148 29363 gene locus_tag LOCUS_15390 30148 29363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 30721 30164 gene locus_tag LOCUS_15400 30721 30164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 31361 30735 gene locus_tag LOCUS_15410 31361 30735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 32393 31374 gene locus_tag LOCUS_15420 32393 31374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 33209 32394 gene locus_tag LOCUS_15430 33209 32394 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656688.1 protein_id gnl|my_center|LOCUS_15430 33712 33227 gene locus_tag LOCUS_15440 33712 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 34482 33742 gene locus_tag LOCUS_15450 34482 33742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 35471 34989 gene locus_tag LOCUS_15460 35471 34989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 35743 35573 gene locus_tag LOCUS_15470 35743 35573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 36179 35700 gene locus_tag LOCUS_15480 36179 35700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 36425 36291 gene locus_tag LOCUS_15490 36425 36291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 36577 36422 gene locus_tag LOCUS_15500 36577 36422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 36756 36601 gene locus_tag LOCUS_15510 36756 36601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 36891 37277 gene locus_tag LOCUS_15520 36891 37277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 37457 37296 gene locus_tag LOCUS_15530 37457 37296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 37834 37634 gene locus_tag LOCUS_15540 37834 37634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 38029 39393 gene locus_tag LOCUS_15550 38029 39393 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861760.1 protein_id gnl|my_center|LOCUS_15550 40598 39525 gene locus_tag LOCUS_15560 40598 39525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence11 1204 716 gene locus_tag LOCUS_15570 gene dfrA 1204 716 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_15570 2241 1384 gene locus_tag LOCUS_15580 2241 1384 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_15580 2887 2264 gene locus_tag LOCUS_15590 2887 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3275 2889 gene locus_tag LOCUS_15600 3275 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 4407 3265 gene locus_tag LOCUS_15610 4407 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5475 4582 gene locus_tag LOCUS_15620 5475 4582 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_15620 6185 5499 gene locus_tag LOCUS_15630 6185 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 7753 6440 gene locus_tag LOCUS_15640 gene clpX 7753 6440 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816893.1 protein_id gnl|my_center|LOCUS_15640 8426 7821 gene locus_tag LOCUS_15650 gene clpP 8426 7821 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461047.1 protein_id gnl|my_center|LOCUS_15650 9876 8590 gene locus_tag LOCUS_15660 gene tig 9876 8590 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965929.1 protein_id gnl|my_center|LOCUS_15660 10042 10239 gene locus_tag LOCUS_15670 gene rpmB 10042 10239 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_15670 10703 10344 gene locus_tag LOCUS_15680 10703 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 11046 10897 gene locus_tag LOCUS_15690 11046 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 11219 11875 gene locus_tag LOCUS_15700 gene nth 11219 11875 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_15700 11930 13132 gene locus_tag LOCUS_15710 11930 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 13876 13217 gene locus_tag LOCUS_15720 gene rpe 13876 13217 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_15720 14754 13870 gene locus_tag LOCUS_15730 gene rsgA 14754 13870 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_15730 14993 14751 gene locus_tag LOCUS_15740 14993 14751 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809228.1 protein_id gnl|my_center|LOCUS_15740 15266 15000 gene locus_tag LOCUS_15750 15266 15000 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808730.1 protein_id gnl|my_center|LOCUS_15750 17476 15470 gene locus_tag LOCUS_15760 gene pknB 17476 15470 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_15760 18250 17516 gene locus_tag LOCUS_15770 18250 17516 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388610.1 protein_id gnl|my_center|LOCUS_15770 19112 18426 gene locus_tag LOCUS_15780 19112 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 19566 21962 gene locus_tag LOCUS_15790 19566 21962 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_15790 22769 22155 gene locus_tag LOCUS_15800 22769 22155 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459616.1 protein_id gnl|my_center|LOCUS_15800 23678 22875 gene locus_tag LOCUS_15810 23678 22875 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897805.1 protein_id gnl|my_center|LOCUS_15810 25543 23684 gene locus_tag LOCUS_15820 gene dxs 25543 23684 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_15820 26174 25566 gene locus_tag LOCUS_15830 26174 25566 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881346.1 protein_id gnl|my_center|LOCUS_15830 26847 26179 gene locus_tag LOCUS_15840 gene cmk 26847 26179 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358949.1 protein_id gnl|my_center|LOCUS_15840 27727 26849 gene locus_tag LOCUS_15850 27727 26849 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888021.1 protein_id gnl|my_center|LOCUS_15850 28763 27738 gene locus_tag LOCUS_15860 gene rlmN 28763 27738 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_15860 29400 28837 gene locus_tag LOCUS_15870 29400 28837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 30661 29375 gene locus_tag LOCUS_15880 30661 29375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_15880 31672 30785 gene locus_tag LOCUS_15890 31672 30785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 33053 31887 gene locus_tag LOCUS_15900 gene dnaJ 33053 31887 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395180.1 protein_id gnl|my_center|LOCUS_15900 35008 33149 gene locus_tag LOCUS_15910 gene dnaK 35008 33149 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357980.1 protein_id gnl|my_center|LOCUS_15910 35687 35169 gene locus_tag LOCUS_15920 35687 35169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 36709 35687 gene locus_tag LOCUS_15930 gene hrcA 36709 35687 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_15930 37610 36840 gene locus_tag LOCUS_15940 gene murI 37610 36840 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_15940 37783 38211 gene locus_tag LOCUS_15950 37783 38211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 38977 38255 gene locus_tag LOCUS_15960 38977 38255 CDS product putative ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454079.1 protein_id gnl|my_center|LOCUS_15960 39581 39484 gene locus_tag LOCUS_r00010 39581 39484 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence12 1938 514 gene locus_tag LOCUS_15970 1938 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2361 1942 gene locus_tag LOCUS_15980 2361 1942 CDS product holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721755.1 protein_id gnl|my_center|LOCUS_15980 2566 2435 gene locus_tag LOCUS_15990 2566 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 2754 2614 gene locus_tag LOCUS_16000 2754 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 3038 2772 gene locus_tag LOCUS_16010 3038 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4153 3035 gene locus_tag LOCUS_16020 4153 3035 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_16020 6658 4565 gene locus_tag LOCUS_16030 6658 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 6930 6658 gene locus_tag LOCUS_16040 6930 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 7079 6927 gene locus_tag LOCUS_16050 7079 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 9333 7093 gene locus_tag LOCUS_16060 9333 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 10026 9334 gene locus_tag LOCUS_16070 10026 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 12722 10026 gene locus_tag LOCUS_16080 12722 10026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 12960 12730 gene locus_tag LOCUS_16090 12960 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 13442 13047 gene locus_tag LOCUS_16100 13442 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 13630 13442 gene locus_tag LOCUS_16110 13630 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 14240 13653 gene locus_tag LOCUS_16120 14240 13653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 14618 14244 gene locus_tag LOCUS_16130 14618 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 15115 14621 gene locus_tag LOCUS_16140 15115 14621 CDS product HK97 gp10 family phage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002403769.1 protein_id gnl|my_center|LOCUS_16140 15536 15108 gene locus_tag LOCUS_16150 15536 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 16063 15536 gene locus_tag LOCUS_16160 16063 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109440.1 protein_id gnl|my_center|LOCUS_16160 17021 16086 gene locus_tag LOCUS_16170 17021 16086 CDS product N4-gp56 family major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922080.1 protein_id gnl|my_center|LOCUS_16170 17664 17035 gene locus_tag LOCUS_16180 17664 17035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 18051 17833 gene locus_tag LOCUS_16190 18051 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 19690 18035 gene locus_tag LOCUS_16200 19690 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 21143 19683 gene locus_tag LOCUS_16210 21143 19683 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714187.1 protein_id gnl|my_center|LOCUS_16210 22391 21162 gene locus_tag LOCUS_16220 22391 21162 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988380.1 protein_id gnl|my_center|LOCUS_16220 23125 22628 gene locus_tag LOCUS_16230 23125 22628 CDS product terminase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816478.1 protein_id gnl|my_center|LOCUS_16230 23635 23276 gene locus_tag LOCUS_16240 23635 23276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 24632 23946 gene locus_tag LOCUS_16250 24632 23946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021681.1 protein_id gnl|my_center|LOCUS_16250 24766 24644 gene locus_tag LOCUS_16260 24766 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 25158 24766 gene locus_tag LOCUS_16270 25158 24766 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257803.1 protein_id gnl|my_center|LOCUS_16270 27302 25158 gene locus_tag LOCUS_16280 gene nrdD 27302 25158 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288083.1 protein_id gnl|my_center|LOCUS_16280 27795 27289 gene locus_tag LOCUS_16290 gene nrdG 27795 27289 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901774.1 protein_id gnl|my_center|LOCUS_16290 28064 27795 gene locus_tag LOCUS_16300 28064 27795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 29963 28080 gene locus_tag LOCUS_16310 29963 28080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 31808 29991 gene locus_tag LOCUS_16320 31808 29991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475919.1 protein_id gnl|my_center|LOCUS_16320 32301 31828 gene locus_tag LOCUS_16330 32301 31828 CDS product DUF669 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703687.1 protein_id gnl|my_center|LOCUS_16330 32717 32316 gene locus_tag LOCUS_16340 32717 32316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 34555 32720 gene locus_tag LOCUS_16350 34555 32720 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125080931.1 protein_id gnl|my_center|LOCUS_16350 34898 34548 gene locus_tag LOCUS_16360 34898 34548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 35338 34907 gene locus_tag LOCUS_16370 35338 34907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 35567 35325 gene locus_tag LOCUS_16380 35567 35325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 36813 35539 gene locus_tag LOCUS_16390 36813 35539 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087359848.1 protein_id gnl|my_center|LOCUS_16390 37046 36810 gene locus_tag LOCUS_16400 37046 36810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence13 454 591 gene locus_tag LOCUS_16410 454 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 773 1102 gene locus_tag LOCUS_16420 773 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1213 3003 gene locus_tag LOCUS_16430 gene uvrC 1213 3003 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_16430 3598 3822 gene locus_tag LOCUS_16440 3598 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 3907 4770 gene locus_tag LOCUS_16450 3907 4770 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_16450 4819 5490 gene locus_tag LOCUS_16460 4819 5490 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_16460 5638 5886 gene locus_tag LOCUS_16470 5638 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 6010 8127 gene locus_tag LOCUS_16480 gene rnr 6010 8127 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964034.1 protein_id gnl|my_center|LOCUS_16480 8307 8128 gene locus_tag LOCUS_16490 8307 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 9537 8377 gene locus_tag LOCUS_16500 9537 8377 CDS product Ger(x)C family spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890704.1 protein_id gnl|my_center|LOCUS_16500 10628 9534 gene locus_tag LOCUS_16510 10628 9534 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231622.1 protein_id gnl|my_center|LOCUS_16510 11836 10625 gene locus_tag LOCUS_16520 11836 10625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 12344 11820 gene locus_tag LOCUS_16530 12344 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 12514 13659 gene locus_tag LOCUS_16540 12514 13659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 13678 14343 gene locus_tag LOCUS_16550 13678 14343 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_16550 14350 15564 gene locus_tag LOCUS_16560 14350 15564 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861225.1 protein_id gnl|my_center|LOCUS_16560 15866 16549 gene locus_tag LOCUS_16570 15866 16549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963847.1 protein_id gnl|my_center|LOCUS_16570 16549 19119 gene locus_tag LOCUS_16580 16549 19119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861226.1 protein_id gnl|my_center|LOCUS_16580 19190 19819 gene locus_tag LOCUS_16590 19190 19819 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989762.1 protein_id gnl|my_center|LOCUS_16590 21423 19945 gene locus_tag LOCUS_16600 gene spoIVA 21423 19945 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965020.1 protein_id gnl|my_center|LOCUS_16600 21665 22912 gene locus_tag LOCUS_16610 21665 22912 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485391.1 protein_id gnl|my_center|LOCUS_16610 22966 23631 gene locus_tag LOCUS_16620 22966 23631 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_16620 24153 23776 gene locus_tag LOCUS_16630 24153 23776 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391740.1 protein_id gnl|my_center|LOCUS_16630 24312 24989 gene locus_tag LOCUS_16640 24312 24989 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_16640 25065 25451 gene locus_tag LOCUS_16650 25065 25451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 28105 25712 gene locus_tag LOCUS_16660 28105 25712 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence14 688 410 gene locus_tag LOCUS_16670 688 410 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_16670 1225 830 gene locus_tag LOCUS_16680 1225 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2465 1215 gene locus_tag LOCUS_16690 2465 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16690 3513 2590 gene locus_tag LOCUS_16700 3513 2590 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226902.1 protein_id gnl|my_center|LOCUS_16700 4514 3633 gene locus_tag LOCUS_16710 gene hslO 4514 3633 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965667.1 protein_id gnl|my_center|LOCUS_16710 5912 4671 gene locus_tag LOCUS_16720 5912 4671 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_16720 6373 5927 gene locus_tag LOCUS_16730 gene rpiB 6373 5927 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221910.1 protein_id gnl|my_center|LOCUS_16730 6520 6786 gene locus_tag LOCUS_16740 gene rpsT 6520 6786 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_16740 7001 7252 gene locus_tag LOCUS_16750 7001 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 8742 7303 gene locus_tag LOCUS_16760 gene gatB 8742 7303 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048223.1 protein_id gnl|my_center|LOCUS_16760 10297 8825 gene locus_tag LOCUS_16770 gene gatA 10297 8825 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_16770 10717 10430 gene locus_tag LOCUS_16780 gene gatC 10717 10430 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_16780 11228 10863 gene locus_tag LOCUS_16790 gene rplL 11228 10863 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294588.1 protein_id gnl|my_center|LOCUS_16790 11958 11371 gene locus_tag LOCUS_16800 gene rplJ 11958 11371 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003235042.1 protein_id gnl|my_center|LOCUS_16800 12843 12166 gene locus_tag LOCUS_16810 gene rplA 12843 12166 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_16810 13374 12946 gene locus_tag LOCUS_16820 gene rplK 13374 12946 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263607.1 protein_id gnl|my_center|LOCUS_16820 13930 13394 gene locus_tag LOCUS_16830 gene nusG 13930 13394 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_16830 14366 13956 gene locus_tag LOCUS_16840 14366 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 14560 14396 gene locus_tag LOCUS_16850 gene rpmG 14560 14396 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_16850 14862 15569 gene locus_tag LOCUS_16860 14862 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 16175 15609 gene locus_tag LOCUS_16870 16175 15609 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_16870 16459 16362 gene locus_tag LOCUS_r00020 16459 16362 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence15 651 394 gene locus_tag LOCUS_16880 651 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1066 983 gene locus_tag LOCUS_t00300 1066 983 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1315 1121 gene locus_tag LOCUS_16890 1315 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3565 1520 gene locus_tag LOCUS_16900 gene recG 3565 1520 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_16900 4354 3647 gene locus_tag LOCUS_16910 4354 3647 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_16910 5448 4456 gene locus_tag LOCUS_16920 gene tsaD 5448 4456 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_16920 6353 5619 gene locus_tag LOCUS_16930 6353 5619 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_16930 6571 7230 gene locus_tag LOCUS_16940 6571 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 7190 7816 gene locus_tag LOCUS_16950 7190 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 8693 7800 gene locus_tag LOCUS_16960 8693 7800 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_16960 9367 8690 gene locus_tag LOCUS_16970 9367 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 9803 9378 gene locus_tag LOCUS_16980 9803 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 10505 9834 gene locus_tag LOCUS_16990 10505 9834 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682109.1 protein_id gnl|my_center|LOCUS_16990 11176 10502 gene locus_tag LOCUS_17000 11176 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 11902 11297 gene locus_tag LOCUS_17010 11902 11297 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_17010 13461 11959 gene locus_tag LOCUS_17020 gene lysS 13461 11959 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence16 2061 271 gene locus_tag LOCUS_17030 2061 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2914 2066 gene locus_tag LOCUS_17040 gene rlmB 2914 2066 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_17040 4746 2935 gene locus_tag LOCUS_17050 gene lepA 4746 2935 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_17050 5533 4862 gene locus_tag LOCUS_17060 5533 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 7011 5569 gene locus_tag LOCUS_17070 7011 5569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 7702 7043 gene locus_tag LOCUS_17080 7702 7043 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_17080 8077 7775 gene locus_tag LOCUS_17090 8077 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 9116 8070 gene locus_tag LOCUS_17100 9116 8070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 9696 9139 gene locus_tag LOCUS_17110 9696 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 10248 9748 gene locus_tag LOCUS_17120 10248 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 10934 10347 gene locus_tag LOCUS_17130 10934 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 11650 11264 gene locus_tag LOCUS_17140 11650 11264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 12126 11743 gene locus_tag LOCUS_17150 12126 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 12280 12195 gene locus_tag LOCUS_t00310 12280 12195 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 12370 12294 gene locus_tag LOCUS_t00320 12370 12294 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence17 850 158 gene locus_tag LOCUS_17160 850 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2254 1613 gene locus_tag LOCUS_17170 2254 1613 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860653.1 protein_id gnl|my_center|LOCUS_17170 2837 2247 gene locus_tag LOCUS_17180 2837 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 4075 2894 gene locus_tag LOCUS_17190 4075 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5867 4056 gene locus_tag LOCUS_17200 5867 4056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888006.1 protein_id gnl|my_center|LOCUS_17200 8788 5864 gene locus_tag LOCUS_17210 8788 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 9088 8891 gene locus_tag LOCUS_17220 9088 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 9828 9085 gene locus_tag LOCUS_17230 9828 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 11119 9848 gene locus_tag LOCUS_17240 11119 9848 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965307.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence18 946 872 gene locus_tag LOCUS_t00330 946 872 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1604 1083 gene locus_tag LOCUS_17250 1604 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2350 1859 gene locus_tag LOCUS_17260 2350 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3107 2421 gene locus_tag LOCUS_17270 gene trmD 3107 2421 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_17270 3633 3127 gene locus_tag LOCUS_17280 gene rimM 3633 3127 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889030.1 protein_id gnl|my_center|LOCUS_17280 3879 3649 gene locus_tag LOCUS_17290 3879 3649 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_17290 4127 3897 gene locus_tag LOCUS_17300 gene rpsP 4127 3897 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_17300 5559 4207 gene locus_tag LOCUS_17310 gene ffh 5559 4207 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_17310 5919 5572 gene locus_tag LOCUS_17320 5919 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903280.1 protein_id gnl|my_center|LOCUS_17320 6331 6050 gene locus_tag LOCUS_17330 6331 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 6433 6690 gene locus_tag LOCUS_17340 6433 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 6803 7045 gene locus_tag LOCUS_17350 6803 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 7471 7052 gene locus_tag LOCUS_17360 7471 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 7611 8039 gene locus_tag LOCUS_17370 7611 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 8057 9025 gene locus_tag LOCUS_17380 8057 9025 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_17380 9696 9340 gene locus_tag LOCUS_17390 9696 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 10126 9677 gene locus_tag LOCUS_17400 10126 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence19 920 267 gene locus_tag LOCUS_17410 gene rpe 920 267 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721855.1 protein_id gnl|my_center|LOCUS_17410 2287 947 gene locus_tag LOCUS_17420 2287 947 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425390.1 protein_id gnl|my_center|LOCUS_17420 3442 2360 gene locus_tag LOCUS_17430 3442 2360 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432374.1 protein_id gnl|my_center|LOCUS_17430 3585 4304 gene locus_tag LOCUS_17440 3585 4304 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292782.1 protein_id gnl|my_center|LOCUS_17440 4431 5159 gene locus_tag LOCUS_17450 4431 5159 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377923.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence20 1536 544 gene locus_tag LOCUS_17460 1536 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2220 1603 gene locus_tag LOCUS_17470 2220 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 2566 2240 gene locus_tag LOCUS_17480 2566 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3053 2556 gene locus_tag LOCUS_17490 3053 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 3258 3046 gene locus_tag LOCUS_17500 3258 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 5401 4319 gene locus_tag LOCUS_17510 5401 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence21 693 94 gene locus_tag LOCUS_17520 693 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 3707 1779 gene locus_tag LOCUS_17530 gene gyrB 3707 1779 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_17530 4784 3708 gene locus_tag LOCUS_17540 gene recF 4784 3708 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359456.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence22 282 1934 gene locus_tag LOCUS_17550 282 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550