>Feature sequence001 1305 184 gene locus_tag LOCUS_00010 gene rodA 1305 184 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919421.1 protein_id gnl|my_center|LOCUS_00010 1937 1314 gene locus_tag LOCUS_00020 1937 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2545 1934 gene locus_tag LOCUS_00030 2545 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3267 2557 gene locus_tag LOCUS_00040 3267 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4010 3264 gene locus_tag LOCUS_00050 4010 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5142 4015 gene locus_tag LOCUS_00060 5142 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5278 6000 gene locus_tag LOCUS_00070 5278 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6074 7744 gene locus_tag LOCUS_00080 6074 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7741 9441 gene locus_tag LOCUS_00090 7741 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9935 9438 gene locus_tag LOCUS_00100 9935 9438 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_00100 11151 10057 gene locus_tag LOCUS_00110 11151 10057 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081430802.1 protein_id gnl|my_center|LOCUS_00110 12051 11203 gene locus_tag LOCUS_00120 12051 11203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14588 12165 gene locus_tag LOCUS_00130 14588 12165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14588 15208 gene locus_tag LOCUS_00140 14588 15208 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_00140 16656 15166 gene locus_tag LOCUS_00150 16656 15166 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107896.1 protein_id gnl|my_center|LOCUS_00150 16704 17813 gene locus_tag LOCUS_00160 16704 17813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18544 17810 gene locus_tag LOCUS_00170 18544 17810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_00170 19998 18541 gene locus_tag LOCUS_00180 19998 18541 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098999755.1 protein_id gnl|my_center|LOCUS_00180 21055 20153 gene locus_tag LOCUS_00190 21055 20153 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258733.1 protein_id gnl|my_center|LOCUS_00190 22121 21066 gene locus_tag LOCUS_00200 22121 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23593 22166 gene locus_tag LOCUS_00210 23593 22166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23689 24789 gene locus_tag LOCUS_00220 23689 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25436 24807 gene locus_tag LOCUS_00230 25436 24807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 26517 25462 gene locus_tag LOCUS_00240 26517 25462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 27818 26517 gene locus_tag LOCUS_00250 gene nuoF 27818 26517 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_00250 28709 27867 gene locus_tag LOCUS_00260 28709 27867 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_00260 29574 28696 gene locus_tag LOCUS_00270 29574 28696 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225105.1 protein_id gnl|my_center|LOCUS_00270 30866 29571 gene locus_tag LOCUS_00280 30866 29571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31096 32652 gene locus_tag LOCUS_00290 31096 32652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 32729 33799 gene locus_tag LOCUS_00300 32729 33799 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942836.1 protein_id gnl|my_center|LOCUS_00300 33976 34401 gene locus_tag LOCUS_00310 gene rplK 33976 34401 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640942.1 protein_id gnl|my_center|LOCUS_00310 34451 37579 gene locus_tag LOCUS_00320 34451 37579 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_00320 37714 38733 gene locus_tag LOCUS_00330 37714 38733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38755 39432 gene locus_tag LOCUS_00340 gene queC 38755 39432 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038130.1 protein_id gnl|my_center|LOCUS_00340 39890 39477 gene locus_tag LOCUS_00350 39890 39477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 40567 39887 gene locus_tag LOCUS_00360 40567 39887 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258009.1 protein_id gnl|my_center|LOCUS_00360 42243 40567 gene locus_tag LOCUS_00370 gene ctaD 42243 40567 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_00370 43279 42245 gene locus_tag LOCUS_00380 gene coxB 43279 42245 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258007.1 protein_id gnl|my_center|LOCUS_00380 44122 43292 gene locus_tag LOCUS_00390 44122 43292 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_00390 44622 44119 gene locus_tag LOCUS_00400 44622 44119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258005.1 protein_id gnl|my_center|LOCUS_00400 45835 44612 gene locus_tag LOCUS_00410 45835 44612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_00410 46547 45837 gene locus_tag LOCUS_00420 46547 45837 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258003.1 protein_id gnl|my_center|LOCUS_00420 47088 46534 gene locus_tag LOCUS_00430 47088 46534 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_00430 48511 47081 gene locus_tag LOCUS_00440 gene nrfD 48511 47081 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_00440 51531 48511 gene locus_tag LOCUS_00450 51531 48511 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256518.1 protein_id gnl|my_center|LOCUS_00450 52290 51544 gene locus_tag LOCUS_00460 52290 51544 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 protein_id gnl|my_center|LOCUS_00460 54295 52451 gene locus_tag LOCUS_00470 54295 52451 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227849.1 protein_id gnl|my_center|LOCUS_00470 55219 54575 gene locus_tag LOCUS_00480 55219 54575 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_00480 55713 55216 gene locus_tag LOCUS_00490 55713 55216 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_00490 55835 56389 gene locus_tag LOCUS_00500 55835 56389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56386 56655 gene locus_tag LOCUS_00510 56386 56655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 56652 57935 gene locus_tag LOCUS_00520 56652 57935 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728106.1 protein_id gnl|my_center|LOCUS_00520 58333 58067 gene locus_tag LOCUS_00530 58333 58067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 59224 58334 gene locus_tag LOCUS_00540 59224 58334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 60844 59306 gene locus_tag LOCUS_00550 60844 59306 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_00550 61469 60837 gene locus_tag LOCUS_00560 61469 60837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 63202 61466 gene locus_tag LOCUS_00570 63202 61466 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_00570 65460 63199 gene locus_tag LOCUS_00580 65460 63199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65804 65463 gene locus_tag LOCUS_00590 gene nuoK 65804 65463 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_00590 66292 65801 gene locus_tag LOCUS_00600 66292 65801 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_00600 67590 66289 gene locus_tag LOCUS_00610 gene nuoH 67590 66289 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005114281.1 protein_id gnl|my_center|LOCUS_00610 67688 68452 gene locus_tag LOCUS_00620 67688 68452 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_00620 68483 68956 gene locus_tag LOCUS_00630 gene rimI 68483 68956 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925883.1 protein_id gnl|my_center|LOCUS_00630 68953 69981 gene locus_tag LOCUS_00640 gene tsaD 68953 69981 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_00640 73159 69959 gene locus_tag LOCUS_00650 73159 69959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 74006 73236 gene locus_tag LOCUS_00660 74006 73236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 74086 75300 gene locus_tag LOCUS_00670 74086 75300 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_00670 75410 75916 gene locus_tag LOCUS_00680 75410 75916 CDS product CHRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088650.1 protein_id gnl|my_center|LOCUS_00680 76014 77207 gene locus_tag LOCUS_00690 76014 77207 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_00690 78317 77214 gene locus_tag LOCUS_00700 78317 77214 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311004.1 protein_id gnl|my_center|LOCUS_00700 78447 79091 gene locus_tag LOCUS_00710 78447 79091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 81483 79108 gene locus_tag LOCUS_00720 81483 79108 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_00720 81537 82532 gene locus_tag LOCUS_00730 81537 82532 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_00730 82917 82567 gene locus_tag LOCUS_00740 82917 82567 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265541.1 protein_id gnl|my_center|LOCUS_00740 83991 82921 gene locus_tag LOCUS_00750 83991 82921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 84103 84642 gene locus_tag LOCUS_00760 gene pyrR 84103 84642 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_00760 84639 85574 gene locus_tag LOCUS_00770 84639 85574 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_00770 85571 86902 gene locus_tag LOCUS_00780 85571 86902 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_00780 86899 87657 gene locus_tag LOCUS_00790 86899 87657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 88016 87654 gene locus_tag LOCUS_00800 88016 87654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 88078 88941 gene locus_tag LOCUS_00810 88078 88941 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_00810 88941 89357 gene locus_tag LOCUS_00820 88941 89357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 89354 89926 gene locus_tag LOCUS_00830 gene pdxT 89354 89926 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977305.1 protein_id gnl|my_center|LOCUS_00830 90517 89933 gene locus_tag LOCUS_00840 90517 89933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 90670 91005 gene locus_tag LOCUS_00850 90670 91005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 91194 92681 gene locus_tag LOCUS_00860 91194 92681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 94304 93771 gene locus_tag LOCUS_00870 94304 93771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 95632 94334 gene locus_tag LOCUS_00880 95632 94334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 96350 95826 gene locus_tag LOCUS_00890 96350 95826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 96525 96722 gene locus_tag LOCUS_00900 gene infA 96525 96722 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948620.1 protein_id gnl|my_center|LOCUS_00900 97542 96781 gene locus_tag LOCUS_00910 97542 96781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 98547 97714 gene locus_tag LOCUS_00920 gene speE 98547 97714 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389381.1 protein_id gnl|my_center|LOCUS_00920 99037 98612 gene locus_tag LOCUS_00930 99037 98612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 99308 99030 gene locus_tag LOCUS_00940 99308 99030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 99334 99831 gene locus_tag LOCUS_00950 99334 99831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 99828 102179 gene locus_tag LOCUS_00960 gene ccsA 99828 102179 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_00960 102179 102541 gene locus_tag LOCUS_00970 102179 102541 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887363.1 protein_id gnl|my_center|LOCUS_00970 104878 102686 gene locus_tag LOCUS_00980 104878 102686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 106349 105693 gene locus_tag LOCUS_00990 gene fsa 106349 105693 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_00990 106810 106379 gene locus_tag LOCUS_01000 106810 106379 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227147.1 protein_id gnl|my_center|LOCUS_01000 106966 107889 gene locus_tag LOCUS_01010 106966 107889 CDS product lactate/malate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118931.1 protein_id gnl|my_center|LOCUS_01010 107960 108562 gene locus_tag LOCUS_01020 107960 108562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 108577 109887 gene locus_tag LOCUS_01030 gene mnmE 108577 109887 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393996.1 protein_id gnl|my_center|LOCUS_01030 109892 110524 gene locus_tag LOCUS_01040 109892 110524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105994.1 protein_id gnl|my_center|LOCUS_01040 110588 113737 gene locus_tag LOCUS_01050 110588 113737 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839665.1 protein_id gnl|my_center|LOCUS_01050 113745 114725 gene locus_tag LOCUS_01060 113745 114725 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143073.1 protein_id gnl|my_center|LOCUS_01060 115280 114741 gene locus_tag LOCUS_01070 115280 114741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 116222 115284 gene locus_tag LOCUS_01080 116222 115284 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080744.1 protein_id gnl|my_center|LOCUS_01080 116311 117516 gene locus_tag LOCUS_01090 116311 117516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 117513 118379 gene locus_tag LOCUS_01100 117513 118379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 119243 118455 gene locus_tag LOCUS_01110 119243 118455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 119414 120637 gene locus_tag LOCUS_01120 gene hisS 119414 120637 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057735.1 protein_id gnl|my_center|LOCUS_01120 120616 121491 gene locus_tag LOCUS_01130 120616 121491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 121495 122127 gene locus_tag LOCUS_01140 121495 122127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 122160 122585 gene locus_tag LOCUS_01150 122160 122585 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992381.1 protein_id gnl|my_center|LOCUS_01150 122641 122859 gene locus_tag LOCUS_01160 gene tatA 122641 122859 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785095.1 protein_id gnl|my_center|LOCUS_01160 122907 123647 gene locus_tag LOCUS_01170 122907 123647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 123635 124039 gene locus_tag LOCUS_01180 123635 124039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 124008 124595 gene locus_tag LOCUS_01190 124008 124595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 124595 125287 gene locus_tag LOCUS_01200 124595 125287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_01200 125324 127255 gene locus_tag LOCUS_01210 125324 127255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 128033 127434 gene locus_tag LOCUS_01220 128033 127434 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392708.1 protein_id gnl|my_center|LOCUS_01220 128368 128033 gene locus_tag LOCUS_01230 128368 128033 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404634.1 protein_id gnl|my_center|LOCUS_01230 131306 128388 gene locus_tag LOCUS_01240 131306 128388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 131403 131828 gene locus_tag LOCUS_01250 131403 131828 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_01250 133058 131835 gene locus_tag LOCUS_01260 133058 131835 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_01260 134067 133078 gene locus_tag LOCUS_01270 134067 133078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 134234 136126 gene locus_tag LOCUS_01280 gene dxs 134234 136126 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_01280 136123 137136 gene locus_tag LOCUS_01290 136123 137136 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_01290 137599 137144 gene locus_tag LOCUS_01300 gene nuoI 137599 137144 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888136.1 protein_id gnl|my_center|LOCUS_01300 138180 137596 gene locus_tag LOCUS_01310 138180 137596 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888144.1 protein_id gnl|my_center|LOCUS_01310 139220 138225 gene locus_tag LOCUS_01320 139220 138225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 139837 140595 gene locus_tag LOCUS_01330 139837 140595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 140662 140991 gene locus_tag LOCUS_01340 140662 140991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 141058 144126 gene locus_tag LOCUS_01350 gene secA 141058 144126 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228548.1 protein_id gnl|my_center|LOCUS_01350 144542 144213 gene locus_tag LOCUS_01360 144542 144213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 144782 145558 gene locus_tag LOCUS_01370 144782 145558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 145571 145747 gene locus_tag LOCUS_01380 145571 145747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 146401 145784 gene locus_tag LOCUS_01390 146401 145784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 146682 146398 gene locus_tag LOCUS_01400 146682 146398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 148105 146672 gene locus_tag LOCUS_01410 gene pyk 148105 146672 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393367.1 protein_id gnl|my_center|LOCUS_01410 150080 148092 gene locus_tag LOCUS_01420 150080 148092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 150217 151245 gene locus_tag LOCUS_01430 150217 151245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 151242 151994 gene locus_tag LOCUS_01440 151242 151994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 152760 151996 gene locus_tag LOCUS_01450 152760 151996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 153460 153032 gene locus_tag LOCUS_01460 153460 153032 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940812.1 protein_id gnl|my_center|LOCUS_01460 154741 153509 gene locus_tag LOCUS_01470 154741 153509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 154855 156489 gene locus_tag LOCUS_01480 154855 156489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 156493 157143 gene locus_tag LOCUS_01490 156493 157143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 157146 158156 gene locus_tag LOCUS_01500 157146 158156 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104159.1 protein_id gnl|my_center|LOCUS_01500 158179 158264 gene locus_tag LOCUS_t00010 158179 158264 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 159370 158267 gene locus_tag LOCUS_01510 gene hisC 159370 158267 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_01510 159852 159367 gene locus_tag LOCUS_01520 159852 159367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 162421 159857 gene locus_tag LOCUS_01530 162421 159857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 163162 162437 gene locus_tag LOCUS_01540 163162 162437 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878743.1 protein_id gnl|my_center|LOCUS_01540 164116 163211 gene locus_tag LOCUS_01550 164116 163211 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919898.1 protein_id gnl|my_center|LOCUS_01550 164323 164799 gene locus_tag LOCUS_01560 164323 164799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 165610 164801 gene locus_tag LOCUS_01570 165610 164801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 166746 165607 gene locus_tag LOCUS_01580 gene metK 166746 165607 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082170.1 protein_id gnl|my_center|LOCUS_01580 167808 166897 gene locus_tag LOCUS_01590 167808 166897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 168974 167829 gene locus_tag LOCUS_01600 168974 167829 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_01600 169140 171341 gene locus_tag LOCUS_01610 169140 171341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 171370 172236 gene locus_tag LOCUS_01620 171370 172236 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_01620 173784 172375 gene locus_tag LOCUS_01630 173784 172375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 174793 173828 gene locus_tag LOCUS_01640 174793 173828 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317694.1 protein_id gnl|my_center|LOCUS_01640 176271 174790 gene locus_tag LOCUS_01650 176271 174790 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922314.1 protein_id gnl|my_center|LOCUS_01650 176297 177931 gene locus_tag LOCUS_01660 176297 177931 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256992.1 protein_id gnl|my_center|LOCUS_01660 179759 177933 gene locus_tag LOCUS_01670 179759 177933 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_01670 181747 179798 gene locus_tag LOCUS_01680 181747 179798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 182103 181771 gene locus_tag LOCUS_01690 182103 181771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 183065 182118 gene locus_tag LOCUS_01700 gene glpX 183065 182118 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_01700 184565 183237 gene locus_tag LOCUS_01710 184565 183237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 185489 184914 gene locus_tag LOCUS_01720 gene scpB 185489 184914 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_01720 185987 185526 gene locus_tag LOCUS_01730 185987 185526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 186561 186142 gene locus_tag LOCUS_01740 186561 186142 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262221.1 protein_id gnl|my_center|LOCUS_01740 187430 186696 gene locus_tag LOCUS_01750 187430 186696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 187711 188667 gene locus_tag LOCUS_01760 187711 188667 CDS product GSU2203 family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942843.1 protein_id gnl|my_center|LOCUS_01760 188679 190331 gene locus_tag LOCUS_01770 188679 190331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 190392 191840 gene locus_tag LOCUS_01780 190392 191840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 192014 194425 gene locus_tag LOCUS_01790 gene ccsA 192014 194425 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256826.1 protein_id gnl|my_center|LOCUS_01790 196071 194422 gene locus_tag LOCUS_01800 196071 194422 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_01800 196202 196468 gene locus_tag LOCUS_01810 196202 196468 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938198.1 protein_id gnl|my_center|LOCUS_01810 196458 197522 gene locus_tag LOCUS_01820 196458 197522 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_01820 197561 198325 gene locus_tag LOCUS_01830 197561 198325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 198322 198792 gene locus_tag LOCUS_01840 198322 198792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 198809 200062 gene locus_tag LOCUS_01850 gene gdhA 198809 200062 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_01850 200173 200976 gene locus_tag LOCUS_01860 200173 200976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 201756 200986 gene locus_tag LOCUS_01870 gene map 201756 200986 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_01870 202379 201753 gene locus_tag LOCUS_01880 202379 201753 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879988.1 protein_id gnl|my_center|LOCUS_01880 203755 202388 gene locus_tag LOCUS_01890 gene secY 203755 202388 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810127.1 protein_id gnl|my_center|LOCUS_01890 204195 203752 gene locus_tag LOCUS_01900 gene rplO 204195 203752 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701328.1 protein_id gnl|my_center|LOCUS_01900 204481 204200 gene locus_tag LOCUS_01910 204481 204200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 205034 204465 gene locus_tag LOCUS_01920 205034 204465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 205389 205039 gene locus_tag LOCUS_01930 gene rplR 205389 205039 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288679.1 protein_id gnl|my_center|LOCUS_01930 205963 205403 gene locus_tag LOCUS_01940 gene rplF 205963 205403 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860588.1 protein_id gnl|my_center|LOCUS_01940 206366 205971 gene locus_tag LOCUS_01950 gene rpsH 206366 205971 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_01950 206571 206386 gene locus_tag LOCUS_01960 206571 206386 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_01960 206942 207619 gene locus_tag LOCUS_01970 206942 207619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 208703 207690 gene locus_tag LOCUS_01980 208703 207690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 208756 209628 gene locus_tag LOCUS_01990 gene hisG 208756 209628 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933644.1 protein_id gnl|my_center|LOCUS_01990 210398 209622 gene locus_tag LOCUS_02000 gene surE 210398 209622 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_02000 210446 212677 gene locus_tag LOCUS_02010 210446 212677 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_02010 213619 212684 gene locus_tag LOCUS_02020 gene speE 213619 212684 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172918.1 protein_id gnl|my_center|LOCUS_02020 214352 213744 gene locus_tag LOCUS_02030 214352 213744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 214817 216307 gene locus_tag LOCUS_02040 214817 216307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 216322 217146 gene locus_tag LOCUS_02050 gene tatC 216322 217146 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227900.1 protein_id gnl|my_center|LOCUS_02050 217160 219346 gene locus_tag LOCUS_02060 217160 219346 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113919.1 protein_id gnl|my_center|LOCUS_02060 219426 221456 gene locus_tag LOCUS_02070 gene pheT 219426 221456 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393251.1 protein_id gnl|my_center|LOCUS_02070 222774 221380 gene locus_tag LOCUS_02080 222774 221380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 222835 223080 gene locus_tag LOCUS_02090 222835 223080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 223544 223077 gene locus_tag LOCUS_02100 223544 223077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 225178 223568 gene locus_tag LOCUS_02110 225178 223568 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462257.1 protein_id gnl|my_center|LOCUS_02110 225429 225920 gene locus_tag LOCUS_02120 225429 225920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 227027 226023 gene locus_tag LOCUS_02130 227027 226023 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704684.1 protein_id gnl|my_center|LOCUS_02130 227842 227078 gene locus_tag LOCUS_02140 227842 227078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 230429 227844 gene locus_tag LOCUS_02150 230429 227844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 230530 231402 gene locus_tag LOCUS_02160 gene ftsY 230530 231402 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_02160 231972 231463 gene locus_tag LOCUS_02170 231972 231463 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404756.1 protein_id gnl|my_center|LOCUS_02170 232279 231962 gene locus_tag LOCUS_02180 232279 231962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 233689 232301 gene locus_tag LOCUS_02190 233689 232301 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_02190 234840 233809 gene locus_tag LOCUS_02200 234840 233809 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_02200 236203 234854 gene locus_tag LOCUS_02210 236203 234854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 236260 236567 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttcacgattcacgattcacattcac 237299 236802 gene locus_tag LOCUS_02220 237299 236802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530068.1 protein_id gnl|my_center|LOCUS_02220 238508 237300 gene locus_tag LOCUS_02230 238508 237300 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929488.1 protein_id gnl|my_center|LOCUS_02230 238725 239573 gene locus_tag LOCUS_02240 gene argB 238725 239573 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_02240 239582 240337 gene locus_tag LOCUS_02250 239582 240337 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289098.1 protein_id gnl|my_center|LOCUS_02250 241364 240306 gene locus_tag LOCUS_02260 gene ribD 241364 240306 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228414.1 protein_id gnl|my_center|LOCUS_02260 241669 241361 gene locus_tag LOCUS_02270 241669 241361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 242307 241651 gene locus_tag LOCUS_02280 gene rpe 242307 241651 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975644.1 protein_id gnl|my_center|LOCUS_02280 244019 242304 gene locus_tag LOCUS_02290 gene pknB 244019 242304 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_02290 244209 244024 gene locus_tag LOCUS_02300 244209 244024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 245237 244233 gene locus_tag LOCUS_02310 gene aroB 245237 244233 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037967.1 protein_id gnl|my_center|LOCUS_02310 245758 245225 gene locus_tag LOCUS_02320 245758 245225 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037966.1 protein_id gnl|my_center|LOCUS_02320 247450 245819 gene locus_tag LOCUS_02330 247450 245819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 248209 247556 gene locus_tag LOCUS_02340 248209 247556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 248990 248259 gene locus_tag LOCUS_02350 248990 248259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 249804 249001 gene locus_tag LOCUS_02360 249804 249001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 250831 249809 gene locus_tag LOCUS_02370 250831 249809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 252049 250841 gene locus_tag LOCUS_02380 252049 250841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 258714 252214 gene locus_tag LOCUS_02390 258714 252214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 263241 258739 gene locus_tag LOCUS_02400 263241 258739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 266315 263238 gene locus_tag LOCUS_02410 266315 263238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 268378 266312 gene locus_tag LOCUS_02420 268378 266312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 270234 268375 gene locus_tag LOCUS_02430 270234 268375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 271137 270238 gene locus_tag LOCUS_02440 271137 270238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 272171 271155 gene locus_tag LOCUS_02450 272171 271155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 273051 272227 gene locus_tag LOCUS_02460 273051 272227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 273865 273089 gene locus_tag LOCUS_02470 273865 273089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 273843 275165 gene locus_tag LOCUS_02480 273843 275165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 275558 275361 gene locus_tag LOCUS_02490 275558 275361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 275540 276193 gene locus_tag LOCUS_02500 275540 276193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 276112 276741 gene locus_tag LOCUS_02510 276112 276741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 276871 277404 gene locus_tag LOCUS_02520 276871 277404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 277534 278028 gene locus_tag LOCUS_02530 277534 278028 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_02530 278276 279133 gene locus_tag LOCUS_02540 gene motA 278276 279133 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_02540 279574 279146 gene locus_tag LOCUS_02550 279574 279146 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 protein_id gnl|my_center|LOCUS_02550 279810 279571 gene locus_tag LOCUS_02560 279810 279571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 281236 279821 gene locus_tag LOCUS_02570 281236 279821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 282360 281269 gene locus_tag LOCUS_02580 gene pheA 282360 281269 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_02580 282455 283912 gene locus_tag LOCUS_02590 282455 283912 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_02590 283932 284714 gene locus_tag LOCUS_02600 283932 284714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 >Feature sequence002 944 708 gene locus_tag LOCUS_02610 944 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 1419 1697 gene locus_tag LOCUS_02620 1419 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 2224 2922 gene locus_tag LOCUS_02630 gene ppaX 2224 2922 CDS product pyrophosphatase PpaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242685.1 protein_id gnl|my_center|LOCUS_02630 2909 6214 gene locus_tag LOCUS_02640 2909 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 6218 7126 gene locus_tag LOCUS_02650 gene era 6218 7126 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_02650 7822 7184 gene locus_tag LOCUS_02660 7822 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 9321 7819 gene locus_tag LOCUS_02670 9321 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 9979 9404 gene locus_tag LOCUS_02680 9979 9404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 10347 9976 gene locus_tag LOCUS_02690 10347 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 11930 10347 gene locus_tag LOCUS_02700 11930 10347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 12006 12923 gene locus_tag LOCUS_02710 12006 12923 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118181.1 protein_id gnl|my_center|LOCUS_02710 13082 13615 gene locus_tag LOCUS_02720 gene raiA 13082 13615 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671190.1 protein_id gnl|my_center|LOCUS_02720 14978 13674 gene locus_tag LOCUS_02730 gene rho 14978 13674 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724107.1 protein_id gnl|my_center|LOCUS_02730 15631 15122 gene locus_tag LOCUS_02740 gene hpt 15631 15122 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567626.1 protein_id gnl|my_center|LOCUS_02740 15690 17231 gene locus_tag LOCUS_02750 gene guaA 15690 17231 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_02750 17529 17308 gene locus_tag LOCUS_02760 17529 17308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 17628 18155 gene locus_tag LOCUS_02770 17628 18155 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083756.1 protein_id gnl|my_center|LOCUS_02770 18429 18160 gene locus_tag LOCUS_02780 18429 18160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 18793 18440 gene locus_tag LOCUS_02790 18793 18440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 19136 20692 gene locus_tag LOCUS_02800 gene lpdA 19136 20692 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_02800 23199 20698 gene locus_tag LOCUS_02810 23199 20698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 25779 23239 gene locus_tag LOCUS_02820 25779 23239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 25871 26341 gene locus_tag LOCUS_02830 25871 26341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 26325 26675 gene locus_tag LOCUS_02840 26325 26675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 26710 27210 gene locus_tag LOCUS_02850 26710 27210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 27272 27844 gene locus_tag LOCUS_02860 27272 27844 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208128.1 protein_id gnl|my_center|LOCUS_02860 27855 28751 gene locus_tag LOCUS_02870 27855 28751 CDS product Fpg/Nei family DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027460.1 protein_id gnl|my_center|LOCUS_02870 29630 28755 gene locus_tag LOCUS_02880 29630 28755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 30370 29627 gene locus_tag LOCUS_02890 gene mtnP 30370 29627 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392226.1 protein_id gnl|my_center|LOCUS_02890 30530 30982 gene locus_tag LOCUS_02900 30530 30982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 31021 32310 gene locus_tag LOCUS_02910 31021 32310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 32312 33778 gene locus_tag LOCUS_02920 32312 33778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 33778 34404 gene locus_tag LOCUS_02930 33778 34404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 34442 35593 gene locus_tag LOCUS_02940 gene sucC 34442 35593 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228010.1 protein_id gnl|my_center|LOCUS_02940 36646 35669 gene locus_tag LOCUS_02950 36646 35669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 37106 36639 gene locus_tag LOCUS_02960 37106 36639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 38445 37291 gene locus_tag LOCUS_02970 38445 37291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 39242 38430 gene locus_tag LOCUS_02980 gene rsmA 39242 38430 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618805.1 protein_id gnl|my_center|LOCUS_02980 39886 39239 gene locus_tag LOCUS_02990 39886 39239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 40082 42247 gene locus_tag LOCUS_03000 40082 42247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 42267 42971 gene locus_tag LOCUS_03010 42267 42971 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166475.1 protein_id gnl|my_center|LOCUS_03010 43006 43950 gene locus_tag LOCUS_03020 43006 43950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 44533 43955 gene locus_tag LOCUS_03030 44533 43955 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894930.1 protein_id gnl|my_center|LOCUS_03030 44620 45888 gene locus_tag LOCUS_03040 44620 45888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 47044 45848 gene locus_tag LOCUS_03050 gene hemW 47044 45848 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338802.1 protein_id gnl|my_center|LOCUS_03050 47055 48221 gene locus_tag LOCUS_03060 47055 48221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 49973 48225 gene locus_tag LOCUS_03070 49973 48225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 50373 50047 gene locus_tag LOCUS_03080 50373 50047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 51615 50479 gene locus_tag LOCUS_03090 gene wecB 51615 50479 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930853.1 protein_id gnl|my_center|LOCUS_03090 51747 52598 gene locus_tag LOCUS_03100 51747 52598 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776877.1 protein_id gnl|my_center|LOCUS_03100 52660 53673 gene locus_tag LOCUS_03110 52660 53673 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_03110 53678 54574 gene locus_tag LOCUS_03120 gene pstC 53678 54574 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_03120 54571 55449 gene locus_tag LOCUS_03130 gene pstA 54571 55449 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405019.1 protein_id gnl|my_center|LOCUS_03130 56383 55451 gene locus_tag LOCUS_03140 gene phhA 56383 55451 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 protein_id gnl|my_center|LOCUS_03140 56598 56960 gene locus_tag LOCUS_03150 56598 56960 CDS product zf-TFIIB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533011.1 protein_id gnl|my_center|LOCUS_03150 57389 56964 gene locus_tag LOCUS_03160 57389 56964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 57658 57386 gene locus_tag LOCUS_03170 57658 57386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 58647 57712 gene locus_tag LOCUS_03180 58647 57712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 59095 58658 gene locus_tag LOCUS_03190 59095 58658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 59956 59099 gene locus_tag LOCUS_03200 59956 59099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 60215 61306 gene locus_tag LOCUS_03210 60215 61306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 61311 62372 gene locus_tag LOCUS_03220 gene rtcA 61311 62372 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250566.1 protein_id gnl|my_center|LOCUS_03220 62419 63201 gene locus_tag LOCUS_03230 gene panB 62419 63201 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_03230 63198 64013 gene locus_tag LOCUS_03240 gene panC 63198 64013 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173797.1 protein_id gnl|my_center|LOCUS_03240 64099 64515 gene locus_tag LOCUS_03250 64099 64515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 64605 65690 gene locus_tag LOCUS_03260 64605 65690 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257578.1 protein_id gnl|my_center|LOCUS_03260 67792 65687 gene locus_tag LOCUS_03270 67792 65687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 68155 67973 gene locus_tag LOCUS_03280 68155 67973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 69002 68241 gene locus_tag LOCUS_03290 69002 68241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 69176 70453 gene locus_tag LOCUS_03300 69176 70453 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919839.1 protein_id gnl|my_center|LOCUS_03300 70450 73185 gene locus_tag LOCUS_03310 70450 73185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 75009 73240 gene locus_tag LOCUS_03320 75009 73240 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922207.1 protein_id gnl|my_center|LOCUS_03320 76135 75056 gene locus_tag LOCUS_03330 76135 75056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 78410 76206 gene locus_tag LOCUS_03340 78410 76206 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392586.1 protein_id gnl|my_center|LOCUS_03340 78539 78964 gene locus_tag LOCUS_03350 78539 78964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 78975 79580 gene locus_tag LOCUS_03360 gene ruvA 78975 79580 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887917.1 protein_id gnl|my_center|LOCUS_03360 79577 80602 gene locus_tag LOCUS_03370 gene ruvB 79577 80602 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_03370 80788 81669 gene locus_tag LOCUS_03380 80788 81669 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256274.1 protein_id gnl|my_center|LOCUS_03380 81813 82538 gene locus_tag LOCUS_03390 81813 82538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 83414 82605 gene locus_tag LOCUS_03400 83414 82605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 83819 83577 gene locus_tag LOCUS_03410 83819 83577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 85030 83822 gene locus_tag LOCUS_03420 gene tyrS 85030 83822 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_03420 85578 85066 gene locus_tag LOCUS_03430 85578 85066 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228194.1 protein_id gnl|my_center|LOCUS_03430 87596 85701 gene locus_tag LOCUS_03440 gene sdhA 87596 85701 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808703.1 protein_id gnl|my_center|LOCUS_03440 89236 87644 gene locus_tag LOCUS_03450 89236 87644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 90867 89242 gene locus_tag LOCUS_03460 90867 89242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 91283 90963 gene locus_tag LOCUS_03470 91283 90963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 91182 91760 gene locus_tag LOCUS_03480 91182 91760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 91820 92110 gene locus_tag LOCUS_03490 91820 92110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 92152 92601 gene locus_tag LOCUS_03500 92152 92601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 92949 93431 gene locus_tag LOCUS_03510 92949 93431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 93433 93714 gene locus_tag LOCUS_03520 93433 93714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 94181 93789 gene locus_tag LOCUS_03530 94181 93789 CDS product iron chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721468.1 protein_id gnl|my_center|LOCUS_03530 95810 94215 gene locus_tag LOCUS_03540 95810 94215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 96798 95830 gene locus_tag LOCUS_03550 96798 95830 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258013.1 protein_id gnl|my_center|LOCUS_03550 97118 98893 gene locus_tag LOCUS_03560 97118 98893 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_03560 98965 100215 gene locus_tag LOCUS_03570 98965 100215 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173990.1 protein_id gnl|my_center|LOCUS_03570 100251 101486 gene locus_tag LOCUS_03580 100251 101486 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_03580 101534 102103 gene locus_tag LOCUS_03590 101534 102103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 102100 102798 gene locus_tag LOCUS_03600 102100 102798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 102939 102808 gene locus_tag LOCUS_03610 102939 102808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 102988 103947 gene locus_tag LOCUS_03620 102988 103947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 104048 105649 gene locus_tag LOCUS_03630 104048 105649 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583152.1 protein_id gnl|my_center|LOCUS_03630 105755 105922 gene locus_tag LOCUS_03640 gene rpmG 105755 105922 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556991.1 protein_id gnl|my_center|LOCUS_03640 105948 106139 gene locus_tag LOCUS_03650 105948 106139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 106139 106375 gene locus_tag LOCUS_03660 106139 106375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 106380 107099 gene locus_tag LOCUS_03670 106380 107099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 107118 107582 gene locus_tag LOCUS_03680 107118 107582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 108601 107567 gene locus_tag LOCUS_03690 108601 107567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 109340 108684 gene locus_tag LOCUS_03700 109340 108684 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172947.1 protein_id gnl|my_center|LOCUS_03700 109421 109855 gene locus_tag LOCUS_03710 gene tsaE 109421 109855 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041669924.1 protein_id gnl|my_center|LOCUS_03710 109876 111240 gene locus_tag LOCUS_03720 109876 111240 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_03720 111237 111785 gene locus_tag LOCUS_03730 111237 111785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 111782 112582 gene locus_tag LOCUS_03740 gene prmC 111782 112582 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388509.1 protein_id gnl|my_center|LOCUS_03740 112607 112903 gene locus_tag LOCUS_03750 112607 112903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 112900 113526 gene locus_tag LOCUS_03760 112900 113526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 113523 114029 gene locus_tag LOCUS_03770 113523 114029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 114433 114026 gene locus_tag LOCUS_03780 114433 114026 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_03780 115915 114437 gene locus_tag LOCUS_03790 gene atpD 115915 114437 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_03790 117204 116041 gene locus_tag LOCUS_03800 117204 116041 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_03800 117443 118318 gene locus_tag LOCUS_03810 117443 118318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 118315 118980 gene locus_tag LOCUS_03820 118315 118980 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_03820 119078 120901 gene locus_tag LOCUS_03830 119078 120901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 122388 120979 gene locus_tag LOCUS_03840 122388 120979 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259726.1 protein_id gnl|my_center|LOCUS_03840 123026 122385 gene locus_tag LOCUS_03850 123026 122385 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920907.1 protein_id gnl|my_center|LOCUS_03850 123088 123678 gene locus_tag LOCUS_03860 123088 123678 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_03860 123675 124187 gene locus_tag LOCUS_03870 123675 124187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 124611 124192 gene locus_tag LOCUS_03880 124611 124192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 124682 126253 gene locus_tag LOCUS_03890 124682 126253 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259149.1 protein_id gnl|my_center|LOCUS_03890 126256 127503 gene locus_tag LOCUS_03900 126256 127503 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_03900 127584 128882 gene locus_tag LOCUS_03910 127584 128882 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_03910 128901 129242 gene locus_tag LOCUS_03920 128901 129242 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389838.1 protein_id gnl|my_center|LOCUS_03920 129336 129842 gene locus_tag LOCUS_03930 129336 129842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 129955 132681 gene locus_tag LOCUS_03940 129955 132681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 132678 133805 gene locus_tag LOCUS_03950 132678 133805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 134876 133818 gene locus_tag LOCUS_03960 134876 133818 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119268.1 protein_id gnl|my_center|LOCUS_03960 135288 134905 gene locus_tag LOCUS_03970 135288 134905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 136224 135301 gene locus_tag LOCUS_03980 136224 135301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 137522 136245 gene locus_tag LOCUS_03990 gene fahA 137522 136245 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405078.1 protein_id gnl|my_center|LOCUS_03990 138373 137519 gene locus_tag LOCUS_04000 138373 137519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113317.1 protein_id gnl|my_center|LOCUS_04000 138467 139069 gene locus_tag LOCUS_04010 138467 139069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 139987 139256 gene locus_tag LOCUS_04020 139987 139256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 140383 140063 gene locus_tag LOCUS_04030 140383 140063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 141008 140502 gene locus_tag LOCUS_04040 141008 140502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 141007 141312 gene locus_tag LOCUS_04050 141007 141312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 142887 141511 gene locus_tag LOCUS_04060 gene xylB 142887 141511 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_04060 142951 143415 gene locus_tag LOCUS_04070 gene dut 142951 143415 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_04070 143423 144355 gene locus_tag LOCUS_04080 143423 144355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 144392 145534 gene locus_tag LOCUS_04090 144392 145534 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026981.1 protein_id gnl|my_center|LOCUS_04090 145639 146241 gene locus_tag LOCUS_04100 145639 146241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 146246 146641 gene locus_tag LOCUS_04110 146246 146641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 147535 146693 gene locus_tag LOCUS_04120 147535 146693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 148148 147528 gene locus_tag LOCUS_04130 148148 147528 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086475.1 protein_id gnl|my_center|LOCUS_04130 149892 148192 gene locus_tag LOCUS_04140 149892 148192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 149934 150434 gene locus_tag LOCUS_04150 gene coaD 149934 150434 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000681221.1 protein_id gnl|my_center|LOCUS_04150 150474 151013 gene locus_tag LOCUS_04160 150474 151013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 151137 151811 gene locus_tag LOCUS_04170 151137 151811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 151821 152351 gene locus_tag LOCUS_04180 gene def 151821 152351 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_04180 152348 153277 gene locus_tag LOCUS_04190 gene fmt 152348 153277 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_04190 153274 154563 gene locus_tag LOCUS_04200 153274 154563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 154641 155729 gene locus_tag LOCUS_04210 154641 155729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 155768 156214 gene locus_tag LOCUS_04220 155768 156214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 156232 156720 gene locus_tag LOCUS_04230 156232 156720 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_04230 156747 157139 gene locus_tag LOCUS_04240 156747 157139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 157149 157604 gene locus_tag LOCUS_04250 157149 157604 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392966.1 protein_id gnl|my_center|LOCUS_04250 158093 157608 gene locus_tag LOCUS_04260 158093 157608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 158154 158702 gene locus_tag LOCUS_04270 158154 158702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 158717 159244 gene locus_tag LOCUS_04280 158717 159244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 159749 159198 gene locus_tag LOCUS_04290 159749 159198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 159813 160364 gene locus_tag LOCUS_04300 gene coaE 159813 160364 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172233.1 protein_id gnl|my_center|LOCUS_04300 160620 162668 gene locus_tag LOCUS_04310 160620 162668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 162750 165545 gene locus_tag LOCUS_04320 162750 165545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 165657 166721 gene locus_tag LOCUS_04330 gene rfbB 165657 166721 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522250.1 protein_id gnl|my_center|LOCUS_04330 166718 167614 gene locus_tag LOCUS_04340 gene rfbA 166718 167614 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105518.1 protein_id gnl|my_center|LOCUS_04340 167611 168435 gene locus_tag LOCUS_04350 167611 168435 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173545.1 protein_id gnl|my_center|LOCUS_04350 168634 169431 gene locus_tag LOCUS_04360 168634 169431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 169583 171454 gene locus_tag LOCUS_04370 169583 171454 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_04370 171599 174679 gene locus_tag LOCUS_04380 171599 174679 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389909.1 protein_id gnl|my_center|LOCUS_04380 175500 174745 gene locus_tag LOCUS_04390 175500 174745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 175972 175493 gene locus_tag LOCUS_04400 175972 175493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 176939 175986 gene locus_tag LOCUS_04410 176939 175986 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707642.1 protein_id gnl|my_center|LOCUS_04410 177121 180399 gene locus_tag LOCUS_04420 177121 180399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 180673 181284 gene locus_tag LOCUS_04430 180673 181284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 182135 181281 gene locus_tag LOCUS_04440 182135 181281 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704225.1 protein_id gnl|my_center|LOCUS_04440 183208 182132 gene locus_tag LOCUS_04450 183208 182132 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_04450 184707 183205 gene locus_tag LOCUS_04460 184707 183205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_04460 185573 184704 gene locus_tag LOCUS_04470 185573 184704 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008032.1 protein_id gnl|my_center|LOCUS_04470 185655 186185 gene locus_tag LOCUS_04480 185655 186185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 187319 186189 gene locus_tag LOCUS_04490 187319 186189 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104341.1 protein_id gnl|my_center|LOCUS_04490 187546 187470 gene locus_tag LOCUS_t00020 187546 187470 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 187597 188358 gene locus_tag LOCUS_04500 187597 188358 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404513.1 protein_id gnl|my_center|LOCUS_04500 189041 188355 gene locus_tag LOCUS_04510 189041 188355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 190000 189038 gene locus_tag LOCUS_04520 190000 189038 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_04520 190054 190926 gene locus_tag LOCUS_04530 gene thyX 190054 190926 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_04530 190931 191641 gene locus_tag LOCUS_04540 190931 191641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 191638 191976 gene locus_tag LOCUS_04550 gene glnB 191638 191976 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_04550 192034 193704 gene locus_tag LOCUS_04560 192034 193704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 193710 194453 gene locus_tag LOCUS_04570 193710 194453 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259482.1 protein_id gnl|my_center|LOCUS_04570 195895 194450 gene locus_tag LOCUS_04580 195895 194450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 196387 195929 gene locus_tag LOCUS_04590 196387 195929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 198901 196472 gene locus_tag LOCUS_04600 gene lon 198901 196472 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583909.1 protein_id gnl|my_center|LOCUS_04600 199443 198994 gene locus_tag LOCUS_04610 199443 198994 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_04610 200043 199456 gene locus_tag LOCUS_04620 200043 199456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 202096 200066 gene locus_tag LOCUS_04630 202096 200066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 202365 202102 gene locus_tag LOCUS_04640 202365 202102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 203933 203070 gene locus_tag LOCUS_04650 203933 203070 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_04650 204005 205207 gene locus_tag LOCUS_04660 204005 205207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 206149 205211 gene locus_tag LOCUS_04670 206149 205211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 207183 206203 gene locus_tag LOCUS_04680 207183 206203 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_04680 208546 207242 gene locus_tag LOCUS_04690 208546 207242 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_04690 209339 208656 gene locus_tag LOCUS_04700 209339 208656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 210318 209353 gene locus_tag LOCUS_04710 210318 209353 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144109.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence003 1295 213 gene locus_tag LOCUS_04720 1295 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 4006 1379 gene locus_tag LOCUS_04730 gene ligD 4006 1379 CDS product DNA ligase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_04730 5067 4012 gene locus_tag LOCUS_04740 5067 4012 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661212.1 protein_id gnl|my_center|LOCUS_04740 5216 5962 gene locus_tag LOCUS_04750 5216 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 5969 7594 gene locus_tag LOCUS_04760 5969 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 9723 7606 gene locus_tag LOCUS_04770 gene feoB 9723 7606 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_04770 10042 9788 gene locus_tag LOCUS_04780 10042 9788 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_04780 10961 10143 gene locus_tag LOCUS_04790 10961 10143 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030593.1 protein_id gnl|my_center|LOCUS_04790 11842 10958 gene locus_tag LOCUS_04800 11842 10958 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969646.1 protein_id gnl|my_center|LOCUS_04800 13194 11857 gene locus_tag LOCUS_04810 gene ngcE 13194 11857 CDS product N-acetylglucosamine/diacetylchitobiose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776381.1 protein_id gnl|my_center|LOCUS_04810 13754 13350 gene locus_tag LOCUS_04820 13754 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 14414 13794 gene locus_tag LOCUS_04830 14414 13794 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479827.1 protein_id gnl|my_center|LOCUS_04830 15419 14424 gene locus_tag LOCUS_04840 15419 14424 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697738.1 protein_id gnl|my_center|LOCUS_04840 15567 16583 gene locus_tag LOCUS_04850 gene pdhA 15567 16583 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919594.1 protein_id gnl|my_center|LOCUS_04850 16583 17596 gene locus_tag LOCUS_04860 16583 17596 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_04860 18074 18850 gene locus_tag LOCUS_04870 18074 18850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 19509 18841 gene locus_tag LOCUS_04880 19509 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 19548 20429 gene locus_tag LOCUS_04890 gene ubiA 19548 20429 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228063.1 protein_id gnl|my_center|LOCUS_04890 20440 21450 gene locus_tag LOCUS_04900 20440 21450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 21906 21427 gene locus_tag LOCUS_04910 21906 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 22520 21903 gene locus_tag LOCUS_04920 22520 21903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 22939 22520 gene locus_tag LOCUS_04930 22939 22520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 24257 22932 gene locus_tag LOCUS_04940 gene fliI 24257 22932 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_04940 24937 24254 gene locus_tag LOCUS_04950 24937 24254 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392294.1 protein_id gnl|my_center|LOCUS_04950 25966 24953 gene locus_tag LOCUS_04960 gene fliG 25966 24953 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_04960 27624 25963 gene locus_tag LOCUS_04970 27624 25963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 27977 27672 gene locus_tag LOCUS_04980 27977 27672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 28371 27982 gene locus_tag LOCUS_04990 gene flgC 28371 27982 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965463.1 protein_id gnl|my_center|LOCUS_04990 28736 28368 gene locus_tag LOCUS_05000 gene flgB 28736 28368 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245656.1 protein_id gnl|my_center|LOCUS_05000 29627 28854 gene locus_tag LOCUS_05010 29627 28854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 30585 29587 gene locus_tag LOCUS_05020 30585 29587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 31433 30582 gene locus_tag LOCUS_05030 gene cdaA 31433 30582 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003223651.1 protein_id gnl|my_center|LOCUS_05030 32836 31511 gene locus_tag LOCUS_05040 32836 31511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 33075 34400 gene locus_tag LOCUS_05050 33075 34400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 34369 35124 gene locus_tag LOCUS_05060 34369 35124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 35121 35891 gene locus_tag LOCUS_05070 35121 35891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 35896 36291 gene locus_tag LOCUS_05080 35896 36291 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811377.1 protein_id gnl|my_center|LOCUS_05080 36288 37517 gene locus_tag LOCUS_05090 gene ftsA 36288 37517 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228430.1 protein_id gnl|my_center|LOCUS_05090 37558 38769 gene locus_tag LOCUS_05100 gene ftsZ 37558 38769 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_05100 40768 38828 gene locus_tag LOCUS_05110 40768 38828 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228000.1 protein_id gnl|my_center|LOCUS_05110 41682 40765 gene locus_tag LOCUS_05120 41682 40765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 41708 42283 gene locus_tag LOCUS_05130 41708 42283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 42363 43439 gene locus_tag LOCUS_05140 42363 43439 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812176.1 protein_id gnl|my_center|LOCUS_05140 43436 43924 gene locus_tag LOCUS_05150 gene rimM 43436 43924 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_05150 43927 44021 gene locus_tag LOCUS_t00030 43927 44021 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 44638 44111 gene locus_tag LOCUS_05160 gene nusG 44638 44111 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_05160 44891 44646 gene locus_tag LOCUS_05170 44891 44646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 45480 44974 gene locus_tag LOCUS_05180 gene greA 45480 44974 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933113.1 protein_id gnl|my_center|LOCUS_05180 45698 46321 gene locus_tag LOCUS_05190 45698 46321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 46368 47450 gene locus_tag LOCUS_05200 46368 47450 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_05200 47463 48563 gene locus_tag LOCUS_05210 47463 48563 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_05210 48550 49734 gene locus_tag LOCUS_05220 48550 49734 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_05220 49755 50678 gene locus_tag LOCUS_05230 49755 50678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 52280 50814 gene locus_tag LOCUS_05240 gene proS 52280 50814 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933157.1 protein_id gnl|my_center|LOCUS_05240 55288 52385 gene locus_tag LOCUS_05250 55288 52385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 58898 55404 gene locus_tag LOCUS_05260 gene smc 58898 55404 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361019.1 protein_id gnl|my_center|LOCUS_05260 59306 60286 gene locus_tag LOCUS_05270 59306 60286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 60365 60592 gene locus_tag LOCUS_05280 60365 60592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 60852 61190 gene locus_tag LOCUS_05290 60852 61190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 63185 61386 gene locus_tag LOCUS_05300 gene thrS 63185 61386 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228977.1 protein_id gnl|my_center|LOCUS_05300 63440 65329 gene locus_tag LOCUS_05310 gene dnaK 63440 65329 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_05310 66503 65391 gene locus_tag LOCUS_05320 66503 65391 CDS product S-(hydroxymethyl)mycothiol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729747.1 protein_id gnl|my_center|LOCUS_05320 66749 70243 gene locus_tag LOCUS_05330 66749 70243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 70265 70864 gene locus_tag LOCUS_05340 70265 70864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 70950 71993 gene locus_tag LOCUS_05350 70950 71993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 71981 72160 gene locus_tag LOCUS_05360 71981 72160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 72221 74146 gene locus_tag LOCUS_05370 72221 74146 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170118038.1 protein_id gnl|my_center|LOCUS_05370 74645 74154 gene locus_tag LOCUS_05380 74645 74154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 75198 74671 gene locus_tag LOCUS_05390 75198 74671 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_05390 75697 75203 gene locus_tag LOCUS_05400 75697 75203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 77985 75730 gene locus_tag LOCUS_05410 gene tkt 77985 75730 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227715.1 protein_id gnl|my_center|LOCUS_05410 78265 78077 gene locus_tag LOCUS_05420 78265 78077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 78167 78388 gene locus_tag LOCUS_05430 78167 78388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 78511 79104 gene locus_tag LOCUS_05440 78511 79104 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_05440 79503 81080 gene locus_tag LOCUS_05450 79503 81080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 81074 82216 gene locus_tag LOCUS_05460 81074 82216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 83538 82240 gene locus_tag LOCUS_05470 gene eno 83538 82240 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_05470 83547 85172 gene locus_tag LOCUS_05480 83547 85172 CDS product aspartate:alanine exchanger family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941681.1 protein_id gnl|my_center|LOCUS_05480 89665 85169 gene locus_tag LOCUS_05490 89665 85169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 89784 90269 gene locus_tag LOCUS_05500 89784 90269 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038968086.1 protein_id gnl|my_center|LOCUS_05500 91534 90338 gene locus_tag LOCUS_05510 gene coaBC 91534 90338 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_05510 92079 91531 gene locus_tag LOCUS_05520 gene gmk 92079 91531 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_05520 93389 92076 gene locus_tag LOCUS_05530 93389 92076 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391803.1 protein_id gnl|my_center|LOCUS_05530 93765 93382 gene locus_tag LOCUS_05540 93765 93382 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057146.1 protein_id gnl|my_center|LOCUS_05540 93830 94921 gene locus_tag LOCUS_05550 93830 94921 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_05550 95352 96383 gene locus_tag LOCUS_05560 95352 96383 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_05560 96380 97240 gene locus_tag LOCUS_05570 96380 97240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 97305 97553 gene locus_tag LOCUS_05580 97305 97553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 98258 97566 gene locus_tag LOCUS_05590 98258 97566 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172835.1 protein_id gnl|my_center|LOCUS_05590 99073 98255 gene locus_tag LOCUS_05600 99073 98255 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258499.1 protein_id gnl|my_center|LOCUS_05600 99933 99070 gene locus_tag LOCUS_05610 99933 99070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969640.1 protein_id gnl|my_center|LOCUS_05610 100961 99930 gene locus_tag LOCUS_05620 100961 99930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968224.1 protein_id gnl|my_center|LOCUS_05620 102454 100958 gene locus_tag LOCUS_05630 102454 100958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970667.1 protein_id gnl|my_center|LOCUS_05630 103427 102420 gene locus_tag LOCUS_05640 103427 102420 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969638.1 protein_id gnl|my_center|LOCUS_05640 104812 103490 gene locus_tag LOCUS_05650 104812 103490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 105971 104832 gene locus_tag LOCUS_05660 gene argJ 105971 104832 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082329.1 protein_id gnl|my_center|LOCUS_05660 106996 105974 gene locus_tag LOCUS_05670 gene argC 106996 105974 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225637.1 protein_id gnl|my_center|LOCUS_05670 107876 107034 gene locus_tag LOCUS_05680 107876 107034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 108610 107873 gene locus_tag LOCUS_05690 108610 107873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 109524 108700 gene locus_tag LOCUS_05700 109524 108700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 109992 109540 gene locus_tag LOCUS_05710 109992 109540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 111172 109994 gene locus_tag LOCUS_05720 111172 109994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 111356 112720 gene locus_tag LOCUS_05730 111356 112720 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893539.1 protein_id gnl|my_center|LOCUS_05730 112713 113270 gene locus_tag LOCUS_05740 112713 113270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 114439 113426 gene locus_tag LOCUS_05750 114439 113426 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227794.1 protein_id gnl|my_center|LOCUS_05750 115569 114442 gene locus_tag LOCUS_05760 gene bfmBAA 115569 114442 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398565.1 protein_id gnl|my_center|LOCUS_05760 117339 115669 gene locus_tag LOCUS_05770 117339 115669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 117484 118650 gene locus_tag LOCUS_05780 gene aar 117484 118650 CDS product bifunctional L-alanine/L-glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079973.1 protein_id gnl|my_center|LOCUS_05780 118689 120140 gene locus_tag LOCUS_05790 118689 120140 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_05790 120153 120653 gene locus_tag LOCUS_05800 gene hisI 120153 120653 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088269.1 protein_id gnl|my_center|LOCUS_05800 120650 121306 gene locus_tag LOCUS_05810 120650 121306 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_05810 121269 121748 gene locus_tag LOCUS_05820 121269 121748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 123321 121831 gene locus_tag LOCUS_05830 123321 121831 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_05830 123320 124159 gene locus_tag LOCUS_05840 123320 124159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 124636 124163 gene locus_tag LOCUS_05850 124636 124163 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_05850 124684 125817 gene locus_tag LOCUS_05860 124684 125817 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_05860 125807 126976 gene locus_tag LOCUS_05870 125807 126976 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_05870 127059 128180 gene locus_tag LOCUS_05880 127059 128180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 128168 128878 gene locus_tag LOCUS_05890 128168 128878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 128886 129449 gene locus_tag LOCUS_05900 128886 129449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 130211 129480 gene locus_tag LOCUS_05910 130211 129480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 130868 130371 gene locus_tag LOCUS_05920 130868 130371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 130955 131488 gene locus_tag LOCUS_05930 130955 131488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 132365 131469 gene locus_tag LOCUS_05940 132365 131469 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388147.1 protein_id gnl|my_center|LOCUS_05940 133831 132371 gene locus_tag LOCUS_05950 133831 132371 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_05950 136921 133862 gene locus_tag LOCUS_05960 136921 133862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 138120 137020 gene locus_tag LOCUS_05970 138120 137020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 138878 138171 gene locus_tag LOCUS_05980 gene sdhC 138878 138171 CDS product succinate dehydrogenase cytochrome B558 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678351.1 protein_id gnl|my_center|LOCUS_05980 138939 140498 gene locus_tag LOCUS_05990 138939 140498 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172981.1 protein_id gnl|my_center|LOCUS_05990 140978 140502 gene locus_tag LOCUS_06000 140978 140502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 142149 140998 gene locus_tag LOCUS_06010 142149 140998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 143897 142266 gene locus_tag LOCUS_06020 gene groL 143897 142266 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_06020 144317 143901 gene locus_tag LOCUS_06030 144317 143901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 144757 144422 gene locus_tag LOCUS_06040 gene groES 144757 144422 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003155970.1 protein_id gnl|my_center|LOCUS_06040 145141 145902 gene locus_tag LOCUS_06050 145141 145902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 145990 146436 gene locus_tag LOCUS_06060 145990 146436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 146472 147626 gene locus_tag LOCUS_06070 146472 147626 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031011.1 protein_id gnl|my_center|LOCUS_06070 148331 151099 gene locus_tag LOCUS_06080 gene ileS 148331 151099 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460677.1 protein_id gnl|my_center|LOCUS_06080 151168 151629 gene locus_tag LOCUS_06090 151168 151629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 152693 151701 gene locus_tag LOCUS_06100 152693 151701 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563288.1 protein_id gnl|my_center|LOCUS_06100 152832 154010 gene locus_tag LOCUS_06110 152832 154010 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272149.1 protein_id gnl|my_center|LOCUS_06110 155023 154043 gene locus_tag LOCUS_06120 155023 154043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 155214 155032 gene locus_tag LOCUS_06130 155214 155032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 156208 155219 gene locus_tag LOCUS_06140 156208 155219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 156660 156205 gene locus_tag LOCUS_06150 156660 156205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 157162 156674 gene locus_tag LOCUS_06160 157162 156674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 159854 157287 gene locus_tag LOCUS_06170 159854 157287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 160136 159870 gene locus_tag LOCUS_06180 160136 159870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 160262 161722 gene locus_tag LOCUS_06190 160262 161722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 161722 162588 gene locus_tag LOCUS_06200 161722 162588 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_06200 162585 163514 gene locus_tag LOCUS_06210 162585 163514 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065037.1 protein_id gnl|my_center|LOCUS_06210 163525 164238 gene locus_tag LOCUS_06220 gene phoU 163525 164238 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986850.1 protein_id gnl|my_center|LOCUS_06220 165235 164324 gene locus_tag LOCUS_06230 165235 164324 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_06230 166113 165235 gene locus_tag LOCUS_06240 166113 165235 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_06240 167396 166110 gene locus_tag LOCUS_06250 167396 166110 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774915.1 protein_id gnl|my_center|LOCUS_06250 167990 167415 gene locus_tag LOCUS_06260 167990 167415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 169639 167993 gene locus_tag LOCUS_06270 169639 167993 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_06270 170361 169636 gene locus_tag LOCUS_06280 gene phoU 170361 169636 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530180.1 protein_id gnl|my_center|LOCUS_06280 170564 170379 gene locus_tag LOCUS_06290 170564 170379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 170545 171219 gene locus_tag LOCUS_06300 170545 171219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06300 172044 171229 gene locus_tag LOCUS_06310 172044 171229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 172193 173278 gene locus_tag LOCUS_06320 172193 173278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 173266 176043 gene locus_tag LOCUS_06330 173266 176043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 176045 177004 gene locus_tag LOCUS_06340 176045 177004 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032807985.1 protein_id gnl|my_center|LOCUS_06340 179505 177001 gene locus_tag LOCUS_06350 179505 177001 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_06350 180679 179606 gene locus_tag LOCUS_06360 180679 179606 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061833.1 protein_id gnl|my_center|LOCUS_06360 180837 184364 gene locus_tag LOCUS_06370 180837 184364 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_06370 184364 184783 gene locus_tag LOCUS_06380 184364 184783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 185729 184788 gene locus_tag LOCUS_06390 gene dprA 185729 184788 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_06390 187281 185689 gene locus_tag LOCUS_06400 187281 185689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 187416 188138 gene locus_tag LOCUS_06410 187416 188138 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976090.1 protein_id gnl|my_center|LOCUS_06410 188270 189334 gene locus_tag LOCUS_06420 188270 189334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 189373 190572 gene locus_tag LOCUS_06430 189373 190572 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259268.1 protein_id gnl|my_center|LOCUS_06430 190569 191900 gene locus_tag LOCUS_06440 190569 191900 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390686.1 protein_id gnl|my_center|LOCUS_06440 191938 193080 gene locus_tag LOCUS_06450 191938 193080 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_06450 193277 193044 gene locus_tag LOCUS_06460 193277 193044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 193209 194180 gene locus_tag LOCUS_06470 193209 194180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence004 173 775 gene locus_tag LOCUS_06480 173 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 886 2733 gene locus_tag LOCUS_06490 886 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 2718 5045 gene locus_tag LOCUS_06500 2718 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 6391 5063 gene locus_tag LOCUS_06510 gene gcvPA 6391 5063 CDS product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903221.1 protein_id gnl|my_center|LOCUS_06510 6782 6402 gene locus_tag LOCUS_06520 gene gcvH 6782 6402 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765165.1 protein_id gnl|my_center|LOCUS_06520 9785 6885 gene locus_tag LOCUS_06530 9785 6885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 9977 11440 gene locus_tag LOCUS_06540 9977 11440 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223586.1 protein_id gnl|my_center|LOCUS_06540 11676 12434 gene locus_tag LOCUS_06550 11676 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 12424 12846 gene locus_tag LOCUS_06560 12424 12846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 12867 13316 gene locus_tag LOCUS_06570 12867 13316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 13520 14563 gene locus_tag LOCUS_06580 13520 14563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 14627 15178 gene locus_tag LOCUS_06590 14627 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 16373 15555 gene locus_tag LOCUS_06600 gene rplA 16373 15555 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_06600 16446 17486 gene locus_tag LOCUS_06610 16446 17486 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_06610 17109 17025 gene locus_tag LOCUS_t00040 17109 17025 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 17483 17794 gene locus_tag LOCUS_06620 17483 17794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 17885 18697 gene locus_tag LOCUS_06630 17885 18697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 18765 20045 gene locus_tag LOCUS_06640 18765 20045 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259695.1 protein_id gnl|my_center|LOCUS_06640 20042 22426 gene locus_tag LOCUS_06650 20042 22426 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259686.1 protein_id gnl|my_center|LOCUS_06650 23238 22423 gene locus_tag LOCUS_06660 23238 22423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 24746 23319 gene locus_tag LOCUS_06670 24746 23319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06670 25378 24869 gene locus_tag LOCUS_06680 25378 24869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06680 25789 25442 gene locus_tag LOCUS_06690 25789 25442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 27269 25806 gene locus_tag LOCUS_06700 gene hisD 27269 25806 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338373.1 protein_id gnl|my_center|LOCUS_06700 28403 27291 gene locus_tag LOCUS_06710 28403 27291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 28925 28446 gene locus_tag LOCUS_06720 28925 28446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 29220 28996 gene locus_tag LOCUS_06730 29220 28996 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_06730 29311 30399 gene locus_tag LOCUS_06740 29311 30399 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073564.1 protein_id gnl|my_center|LOCUS_06740 30470 32356 gene locus_tag LOCUS_06750 gene argS 30470 32356 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080362.1 protein_id gnl|my_center|LOCUS_06750 32359 33390 gene locus_tag LOCUS_06760 32359 33390 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212337777.1 protein_id gnl|my_center|LOCUS_06760 33442 34008 gene locus_tag LOCUS_06770 33442 34008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 34341 34018 gene locus_tag LOCUS_06780 gene trxA 34341 34018 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_06780 34691 35446 gene locus_tag LOCUS_06790 34691 35446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 35459 37183 gene locus_tag LOCUS_06800 gene dnaG 35459 37183 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528223.1 protein_id gnl|my_center|LOCUS_06800 37260 38294 gene locus_tag LOCUS_06810 gene rpoD 37260 38294 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280530.1 protein_id gnl|my_center|LOCUS_06810 38833 38366 gene locus_tag LOCUS_06820 38833 38366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 38973 39947 gene locus_tag LOCUS_06830 38973 39947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 40224 42251 gene locus_tag LOCUS_06840 40224 42251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 43239 42310 gene locus_tag LOCUS_06850 gene pfkB 43239 42310 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391561.1 protein_id gnl|my_center|LOCUS_06850 45881 43284 gene locus_tag LOCUS_06860 gene polA 45881 43284 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_06860 46635 46907 gene locus_tag LOCUS_06870 46635 46907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 48318 46996 gene locus_tag LOCUS_06880 48318 46996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 49906 48323 gene locus_tag LOCUS_06890 49906 48323 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_06890 50907 49903 gene locus_tag LOCUS_06900 50907 49903 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268709.1 protein_id gnl|my_center|LOCUS_06900 52320 50917 gene locus_tag LOCUS_06910 52320 50917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 53185 52304 gene locus_tag LOCUS_06920 53185 52304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 55908 53185 gene locus_tag LOCUS_06930 55908 53185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 56466 56038 gene locus_tag LOCUS_06940 56466 56038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 56964 56470 gene locus_tag LOCUS_06950 56964 56470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 57701 56943 gene locus_tag LOCUS_06960 57701 56943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 57935 59095 gene locus_tag LOCUS_06970 57935 59095 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_06970 59127 61370 gene locus_tag LOCUS_06980 59127 61370 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256758.1 protein_id gnl|my_center|LOCUS_06980 61640 61464 gene locus_tag LOCUS_06990 61640 61464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 61831 61655 gene locus_tag LOCUS_07000 61831 61655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 62857 61901 gene locus_tag LOCUS_07010 62857 61901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 63031 65358 gene locus_tag LOCUS_07020 63031 65358 CDS product PSD1 and planctomycete cytochrome C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120839.1 protein_id gnl|my_center|LOCUS_07020 65361 66812 gene locus_tag LOCUS_07030 65361 66812 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922492.1 protein_id gnl|my_center|LOCUS_07030 66817 67950 gene locus_tag LOCUS_07040 66817 67950 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_07040 69872 68067 gene locus_tag LOCUS_07050 69872 68067 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393628.1 protein_id gnl|my_center|LOCUS_07050 70845 69874 gene locus_tag LOCUS_07060 gene corA 70845 69874 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_07060 70726 71352 gene locus_tag LOCUS_07070 70726 71352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 71510 72598 gene locus_tag LOCUS_07080 71510 72598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 72716 73417 gene locus_tag LOCUS_07090 72716 73417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 73505 75106 gene locus_tag LOCUS_07100 gene ggtA 73505 75106 CDS product gamma-glutamyltranspeptidase GgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403933.1 protein_id gnl|my_center|LOCUS_07100 76943 75114 gene locus_tag LOCUS_07110 gene glmS 76943 75114 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_07110 77422 77039 gene locus_tag LOCUS_07120 77422 77039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 77874 77425 gene locus_tag LOCUS_07130 77874 77425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 79003 77957 gene locus_tag LOCUS_07140 79003 77957 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930034.1 protein_id gnl|my_center|LOCUS_07140 79124 79411 gene locus_tag LOCUS_07150 79124 79411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 79431 79964 gene locus_tag LOCUS_07160 79431 79964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 80123 80983 gene locus_tag LOCUS_07170 80123 80983 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173912.1 protein_id gnl|my_center|LOCUS_07170 81833 80988 gene locus_tag LOCUS_07180 81833 80988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 82459 81869 gene locus_tag LOCUS_07190 82459 81869 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224545.1 protein_id gnl|my_center|LOCUS_07190 82962 82462 gene locus_tag LOCUS_07200 82962 82462 CDS product DUF4446 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393987.1 protein_id gnl|my_center|LOCUS_07200 83872 83024 gene locus_tag LOCUS_07210 83872 83024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 85330 84878 gene locus_tag LOCUS_07220 85330 84878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 85604 85335 gene locus_tag LOCUS_07230 85604 85335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 85693 86169 gene locus_tag LOCUS_07240 gene ribH 85693 86169 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403828.1 protein_id gnl|my_center|LOCUS_07240 86323 88383 gene locus_tag LOCUS_07250 86323 88383 CDS product bifunctional rhamnulose-1-phosphate aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327307.1 protein_id gnl|my_center|LOCUS_07250 88821 88621 gene locus_tag LOCUS_07260 88821 88621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 89009 88854 gene locus_tag LOCUS_07270 89009 88854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 89095 90258 gene locus_tag LOCUS_07280 89095 90258 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_07280 91454 90255 gene locus_tag LOCUS_07290 91454 90255 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811750.1 protein_id gnl|my_center|LOCUS_07290 91602 92630 gene locus_tag LOCUS_07300 gene recA 91602 92630 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_07300 92627 93562 gene locus_tag LOCUS_07310 92627 93562 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404286.1 protein_id gnl|my_center|LOCUS_07310 93559 94791 gene locus_tag LOCUS_07320 93559 94791 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_07320 94817 97087 gene locus_tag LOCUS_07330 94817 97087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 98226 97054 gene locus_tag LOCUS_07340 98226 97054 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_07340 98956 98213 gene locus_tag LOCUS_07350 98956 98213 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142748.1 protein_id gnl|my_center|LOCUS_07350 99038 100300 gene locus_tag LOCUS_07360 99038 100300 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256882.1 protein_id gnl|my_center|LOCUS_07360 100815 100297 gene locus_tag LOCUS_07370 100815 100297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328133.1 protein_id gnl|my_center|LOCUS_07370 100966 101565 gene locus_tag LOCUS_07380 100966 101565 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933911.1 protein_id gnl|my_center|LOCUS_07380 101544 101885 gene locus_tag LOCUS_07390 101544 101885 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083496.1 protein_id gnl|my_center|LOCUS_07390 103229 101892 gene locus_tag LOCUS_07400 103229 101892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 103337 105259 gene locus_tag LOCUS_07410 103337 105259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 106156 105476 gene locus_tag LOCUS_07420 106156 105476 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355842.1 protein_id gnl|my_center|LOCUS_07420 107120 106161 gene locus_tag LOCUS_07430 107120 106161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 112980 107455 gene locus_tag LOCUS_07440 112980 107455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 114276 113071 gene locus_tag LOCUS_07450 114276 113071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 114759 114322 gene locus_tag LOCUS_07460 114759 114322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 115034 114756 gene locus_tag LOCUS_07470 115034 114756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 115263 115964 gene locus_tag LOCUS_07480 115263 115964 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918095.1 protein_id gnl|my_center|LOCUS_07480 115968 116582 gene locus_tag LOCUS_07490 115968 116582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 116579 117181 gene locus_tag LOCUS_07500 116579 117181 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086030.1 protein_id gnl|my_center|LOCUS_07500 117334 117921 gene locus_tag LOCUS_07510 117334 117921 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969898.1 protein_id gnl|my_center|LOCUS_07510 118864 117974 gene locus_tag LOCUS_07520 gene dapA 118864 117974 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392582.1 protein_id gnl|my_center|LOCUS_07520 119818 118883 gene locus_tag LOCUS_07530 119818 118883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 119974 122964 gene locus_tag LOCUS_07540 119974 122964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 123341 122973 gene locus_tag LOCUS_07550 123341 122973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 123426 126890 gene locus_tag LOCUS_07560 123426 126890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 128682 127219 gene locus_tag LOCUS_07570 128682 127219 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_07570 129206 128838 gene locus_tag LOCUS_07580 129206 128838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 129451 130482 gene locus_tag LOCUS_07590 gene trpD 129451 130482 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_07590 130479 131264 gene locus_tag LOCUS_07600 gene trpC 130479 131264 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531739.1 protein_id gnl|my_center|LOCUS_07600 131258 131851 gene locus_tag LOCUS_07610 131258 131851 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_07610 134552 132042 gene locus_tag LOCUS_07620 134552 132042 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258812.1 protein_id gnl|my_center|LOCUS_07620 135520 134807 gene locus_tag LOCUS_07630 gene rph 135520 134807 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241574.1 protein_id gnl|my_center|LOCUS_07630 136245 135535 gene locus_tag LOCUS_07640 136245 135535 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038010.1 protein_id gnl|my_center|LOCUS_07640 137313 136255 gene locus_tag LOCUS_07650 137313 136255 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230820.1 protein_id gnl|my_center|LOCUS_07650 137846 137385 gene locus_tag LOCUS_07660 137846 137385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 138847 137918 gene locus_tag LOCUS_07670 138847 137918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 139197 138856 gene locus_tag LOCUS_07680 139197 138856 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720289.1 protein_id gnl|my_center|LOCUS_07680 139766 139194 gene locus_tag LOCUS_07690 gene hslV 139766 139194 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_07690 139672 141027 gene locus_tag LOCUS_07700 139672 141027 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545208.1 protein_id gnl|my_center|LOCUS_07700 142551 141004 gene locus_tag LOCUS_07710 142551 141004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 142802 142548 gene locus_tag LOCUS_07720 142802 142548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 143362 142799 gene locus_tag LOCUS_07730 143362 142799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 146444 143349 gene locus_tag LOCUS_07740 146444 143349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_07740 146510 147634 gene locus_tag LOCUS_07750 146510 147634 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_07750 148958 147696 gene locus_tag LOCUS_07760 gene flgE 148958 147696 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986372.1 protein_id gnl|my_center|LOCUS_07760 149465 149097 gene locus_tag LOCUS_07770 149465 149097 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392299.1 protein_id gnl|my_center|LOCUS_07770 149892 149470 gene locus_tag LOCUS_07780 149892 149470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 151102 149906 gene locus_tag LOCUS_07790 151102 149906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 151192 152346 gene locus_tag LOCUS_07800 151192 152346 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162177656.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence005 280 1569 gene locus_tag LOCUS_07810 280 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1917 2813 gene locus_tag LOCUS_07820 gene hisC 1917 2813 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496679.1 protein_id gnl|my_center|LOCUS_07820 3280 2810 gene locus_tag LOCUS_07830 gene gspG 3280 2810 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_07830 3349 6864 gene locus_tag LOCUS_07840 gene mfd 3349 6864 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_07840 7199 7726 gene locus_tag LOCUS_07850 gene rplJ 7199 7726 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_07850 7748 8134 gene locus_tag LOCUS_07860 gene rplL 7748 8134 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975165.1 protein_id gnl|my_center|LOCUS_07860 8270 9757 gene locus_tag LOCUS_07870 8270 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 10680 9754 gene locus_tag LOCUS_07880 10680 9754 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942409.1 protein_id gnl|my_center|LOCUS_07880 10729 12801 gene locus_tag LOCUS_07890 gene flhA 10729 12801 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392311.1 protein_id gnl|my_center|LOCUS_07890 12847 13884 gene locus_tag LOCUS_07900 12847 13884 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881059.1 protein_id gnl|my_center|LOCUS_07900 13933 14865 gene locus_tag LOCUS_07910 13933 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 15440 14847 gene locus_tag LOCUS_07920 15440 14847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 16413 15481 gene locus_tag LOCUS_07930 16413 15481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 16958 18163 gene locus_tag LOCUS_07940 16958 18163 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_07940 18208 19176 gene locus_tag LOCUS_07950 18208 19176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 19186 19569 gene locus_tag LOCUS_07960 19186 19569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 20291 19566 gene locus_tag LOCUS_07970 gene prcB 20291 19566 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977182.1 protein_id gnl|my_center|LOCUS_07970 20899 20285 gene locus_tag LOCUS_07980 20899 20285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 21214 21026 gene locus_tag LOCUS_07990 21214 21026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 22680 21211 gene locus_tag LOCUS_08000 gene dop 22680 21211 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_08000 24022 22742 gene locus_tag LOCUS_08010 24022 22742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 24920 24165 gene locus_tag LOCUS_08020 24920 24165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 25012 25686 gene locus_tag LOCUS_08030 25012 25686 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102173.1 protein_id gnl|my_center|LOCUS_08030 25741 27576 gene locus_tag LOCUS_08040 25741 27576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 28617 27637 gene locus_tag LOCUS_08050 28617 27637 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227955.1 protein_id gnl|my_center|LOCUS_08050 31280 28815 gene locus_tag LOCUS_08060 gene pnp 31280 28815 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076750.1 protein_id gnl|my_center|LOCUS_08060 31574 31293 gene locus_tag LOCUS_08070 gene rpsO 31574 31293 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084034.1 protein_id gnl|my_center|LOCUS_08070 32699 31743 gene locus_tag LOCUS_08080 32699 31743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 33040 32699 gene locus_tag LOCUS_08090 33040 32699 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_08090 34300 33227 gene locus_tag LOCUS_08100 34300 33227 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153479.1 protein_id gnl|my_center|LOCUS_08100 36088 34607 gene locus_tag LOCUS_08110 36088 34607 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460967.1 protein_id gnl|my_center|LOCUS_08110 36963 36154 gene locus_tag LOCUS_08120 36963 36154 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031344.1 protein_id gnl|my_center|LOCUS_08120 36997 37746 gene locus_tag LOCUS_08130 36997 37746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 37755 38471 gene locus_tag LOCUS_08140 37755 38471 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_08140 38483 39664 gene locus_tag LOCUS_08150 38483 39664 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_08150 39776 40738 gene locus_tag LOCUS_08160 39776 40738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 40738 40905 gene locus_tag LOCUS_08170 40738 40905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 42015 40975 gene locus_tag LOCUS_08180 42015 40975 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_08180 42283 42504 gene locus_tag LOCUS_08190 42283 42504 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_08190 42713 42964 gene locus_tag LOCUS_08200 42713 42964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 42976 44064 gene locus_tag LOCUS_08210 42976 44064 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_08210 44061 44960 gene locus_tag LOCUS_08220 44061 44960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 45959 45099 gene locus_tag LOCUS_08230 45959 45099 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_08230 46071 46325 gene locus_tag LOCUS_08240 46071 46325 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056973.1 protein_id gnl|my_center|LOCUS_08240 46410 46595 gene locus_tag LOCUS_08250 46410 46595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 47713 46592 gene locus_tag LOCUS_08260 47713 46592 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_08260 49273 47762 gene locus_tag LOCUS_08270 49273 47762 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_08270 49675 49358 gene locus_tag LOCUS_08280 49675 49358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 50386 49838 gene locus_tag LOCUS_08290 50386 49838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 52584 50383 gene locus_tag LOCUS_08300 gene pcrA 52584 50383 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_08300 52667 52957 gene locus_tag LOCUS_08310 52667 52957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 52954 53340 gene locus_tag LOCUS_08320 52954 53340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 54323 53319 gene locus_tag LOCUS_08330 54323 53319 CDS product peptidase C39 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889130.1 protein_id gnl|my_center|LOCUS_08330 55643 54348 gene locus_tag LOCUS_08340 55643 54348 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462314.1 protein_id gnl|my_center|LOCUS_08340 56231 55857 gene locus_tag LOCUS_08350 56231 55857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 56332 56871 gene locus_tag LOCUS_08360 56332 56871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 56858 57442 gene locus_tag LOCUS_08370 56858 57442 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480058.1 protein_id gnl|my_center|LOCUS_08370 58321 57518 gene locus_tag LOCUS_08380 58321 57518 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969246.1 protein_id gnl|my_center|LOCUS_08380 58800 58366 gene locus_tag LOCUS_08390 58800 58366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 59477 58797 gene locus_tag LOCUS_08400 59477 58797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 60643 59474 gene locus_tag LOCUS_08410 60643 59474 CDS product 2-oxo acid dehydrogenase subunit E2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141094.1 protein_id gnl|my_center|LOCUS_08410 60827 62116 gene locus_tag LOCUS_08420 gene tolC 60827 62116 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262654.1 protein_id gnl|my_center|LOCUS_08420 62127 63896 gene locus_tag LOCUS_08430 62127 63896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 63893 65104 gene locus_tag LOCUS_08440 63893 65104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_08440 65101 65865 gene locus_tag LOCUS_08450 65101 65865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_08450 68117 65862 gene locus_tag LOCUS_08460 68117 65862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 68187 69029 gene locus_tag LOCUS_08470 68187 69029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 69036 69515 gene locus_tag LOCUS_08480 69036 69515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 69944 69525 gene locus_tag LOCUS_08490 69944 69525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 70885 69941 gene locus_tag LOCUS_08500 70885 69941 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143107.1 protein_id gnl|my_center|LOCUS_08500 72041 70947 gene locus_tag LOCUS_08510 gene lpxB 72041 70947 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089240244.1 protein_id gnl|my_center|LOCUS_08510 72826 72038 gene locus_tag LOCUS_08520 gene lpxA 72826 72038 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_08520 73273 72830 gene locus_tag LOCUS_08530 gene fabZ 73273 72830 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966834.1 protein_id gnl|my_center|LOCUS_08530 74089 73316 gene locus_tag LOCUS_08540 74089 73316 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_08540 74656 74096 gene locus_tag LOCUS_08550 gene frr 74656 74096 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531503.1 protein_id gnl|my_center|LOCUS_08550 75386 74661 gene locus_tag LOCUS_08560 gene pyrH 75386 74661 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_08560 76222 75389 gene locus_tag LOCUS_08570 gene tsf 76222 75389 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880428.1 protein_id gnl|my_center|LOCUS_08570 77158 76226 gene locus_tag LOCUS_08580 77158 76226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 77347 78060 gene locus_tag LOCUS_08590 77347 78060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 78057 79223 gene locus_tag LOCUS_08600 78057 79223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 79220 80158 gene locus_tag LOCUS_08610 79220 80158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 80169 80699 gene locus_tag LOCUS_08620 80169 80699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 80709 81992 gene locus_tag LOCUS_08630 80709 81992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 83372 81996 gene locus_tag LOCUS_08640 83372 81996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 83908 83435 gene locus_tag LOCUS_08650 83908 83435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 85398 83968 gene locus_tag LOCUS_08660 85398 83968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 85805 85398 gene locus_tag LOCUS_08670 85805 85398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 85853 86437 gene locus_tag LOCUS_08680 gene aat 85853 86437 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384521.1 protein_id gnl|my_center|LOCUS_08680 87459 86434 gene locus_tag LOCUS_08690 87459 86434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 87548 89269 gene locus_tag LOCUS_08700 87548 89269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 89315 89388 gene locus_tag LOCUS_t00050 89315 89388 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 90872 89994 gene locus_tag LOCUS_08710 90872 89994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 92979 90847 gene locus_tag LOCUS_08720 92979 90847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 93314 94225 gene locus_tag LOCUS_08730 93314 94225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 94966 94544 gene locus_tag LOCUS_08740 94966 94544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 95630 95034 gene locus_tag LOCUS_08750 95630 95034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 95925 95686 gene locus_tag LOCUS_08760 95925 95686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 99838 98984 gene locus_tag LOCUS_08770 99838 98984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 99853 100077 gene locus_tag LOCUS_08780 99853 100077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 101218 100505 gene locus_tag LOCUS_08790 101218 100505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 101778 101212 gene locus_tag LOCUS_08800 101778 101212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 102137 101916 gene locus_tag LOCUS_08810 102137 101916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08810 103024 102713 gene locus_tag LOCUS_08820 103024 102713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 103115 103618 gene locus_tag LOCUS_08830 103115 103618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 103622 104740 gene locus_tag LOCUS_08840 103622 104740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 105482 105036 gene locus_tag LOCUS_08850 105482 105036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 106037 107632 gene locus_tag LOCUS_08860 106037 107632 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137617.1 protein_id gnl|my_center|LOCUS_08860 107744 111250 gene locus_tag LOCUS_08870 107744 111250 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_08870 111384 113837 gene locus_tag LOCUS_08880 111384 113837 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08880 113860 114333 gene locus_tag LOCUS_08890 113860 114333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08890 114330 114764 gene locus_tag LOCUS_08900 114330 114764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 114772 118071 gene locus_tag LOCUS_08910 114772 118071 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_08910 118236 119147 gene locus_tag LOCUS_08920 gene uvsE 118236 119147 CDS product UV DNA damage repair endonuclease UvsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350019.1 protein_id gnl|my_center|LOCUS_08920 120484 119144 gene locus_tag LOCUS_08930 120484 119144 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_08930 122859 120481 gene locus_tag LOCUS_08940 122859 120481 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_08940 122994 124229 gene locus_tag LOCUS_08950 122994 124229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 124628 126166 gene locus_tag LOCUS_08960 124628 126166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 127473 126178 gene locus_tag LOCUS_08970 gene hflX 127473 126178 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_08970 128125 127502 gene locus_tag LOCUS_08980 128125 127502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 128264 129502 gene locus_tag LOCUS_08990 128264 129502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence006 2920 1493 gene locus_tag LOCUS_09000 gene hslU 2920 1493 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392544.1 protein_id gnl|my_center|LOCUS_09000 5276 2949 gene locus_tag LOCUS_09010 5276 2949 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173615039.1 protein_id gnl|my_center|LOCUS_09010 6328 5273 gene locus_tag LOCUS_09020 gene ltaE 6328 5273 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_09020 7076 6321 gene locus_tag LOCUS_09030 7076 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 7795 7076 gene locus_tag LOCUS_09040 7795 7076 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528860.1 protein_id gnl|my_center|LOCUS_09040 8155 11250 gene locus_tag LOCUS_09050 8155 11250 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108228.1 protein_id gnl|my_center|LOCUS_09050 12062 11334 gene locus_tag LOCUS_09060 12062 11334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 12582 12121 gene locus_tag LOCUS_09070 12582 12121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 13436 12645 gene locus_tag LOCUS_09080 13436 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 13408 14409 gene locus_tag LOCUS_09090 13408 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 15018 14428 gene locus_tag LOCUS_09100 15018 14428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 15171 16349 gene locus_tag LOCUS_09110 15171 16349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 18102 16396 gene locus_tag LOCUS_09120 18102 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 18282 18821 gene locus_tag LOCUS_09130 18282 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 18828 19934 gene locus_tag LOCUS_09140 gene dnaJ 18828 19934 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_09140 19931 20767 gene locus_tag LOCUS_09150 gene prmA 19931 20767 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000451131.1 protein_id gnl|my_center|LOCUS_09150 21717 20764 gene locus_tag LOCUS_09160 gene waaC 21717 20764 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_09160 22726 21689 gene locus_tag LOCUS_09170 22726 21689 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532743.1 protein_id gnl|my_center|LOCUS_09170 23649 22723 gene locus_tag LOCUS_09180 23649 22723 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_09180 24601 23591 gene locus_tag LOCUS_09190 gene lpxK 24601 23591 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561698.1 protein_id gnl|my_center|LOCUS_09190 24948 24601 gene locus_tag LOCUS_09200 24948 24601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 25822 24986 gene locus_tag LOCUS_09210 25822 24986 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815888.1 protein_id gnl|my_center|LOCUS_09210 26657 25827 gene locus_tag LOCUS_09220 26657 25827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 30695 26727 gene locus_tag LOCUS_09230 30695 26727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 30792 31946 gene locus_tag LOCUS_09240 30792 31946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 32728 31934 gene locus_tag LOCUS_09250 32728 31934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 33132 34052 gene locus_tag LOCUS_09260 33132 34052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 34120 34317 gene locus_tag LOCUS_09270 34120 34317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 34331 34996 gene locus_tag LOCUS_09280 34331 34996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 35079 35414 gene locus_tag LOCUS_09290 35079 35414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 35414 35905 gene locus_tag LOCUS_09300 35414 35905 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_09300 35916 37316 gene locus_tag LOCUS_09310 gene tilS 35916 37316 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942455.1 protein_id gnl|my_center|LOCUS_09310 37352 38386 gene locus_tag LOCUS_09320 gene purM 37352 38386 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393542.1 protein_id gnl|my_center|LOCUS_09320 39148 38438 gene locus_tag LOCUS_09330 39148 38438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 39224 40402 gene locus_tag LOCUS_09340 39224 40402 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_09340 40399 41094 gene locus_tag LOCUS_09350 gene rnc 40399 41094 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460498.1 protein_id gnl|my_center|LOCUS_09350 42737 41103 gene locus_tag LOCUS_09360 42737 41103 CDS product DUF885 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_09360 43739 42834 gene locus_tag LOCUS_09370 43739 42834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 45313 43946 gene locus_tag LOCUS_09380 gene mgtE 45313 43946 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922206.1 protein_id gnl|my_center|LOCUS_09380 46638 45451 gene locus_tag LOCUS_09390 46638 45451 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384203.1 protein_id gnl|my_center|LOCUS_09390 46802 47029 gene locus_tag LOCUS_09400 46802 47029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 47026 47715 gene locus_tag LOCUS_09410 47026 47715 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 protein_id gnl|my_center|LOCUS_09410 48781 47702 gene locus_tag LOCUS_09420 48781 47702 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057982.1 protein_id gnl|my_center|LOCUS_09420 48780 49562 gene locus_tag LOCUS_09430 gene fabG 48780 49562 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706106.1 protein_id gnl|my_center|LOCUS_09430 49594 50070 gene locus_tag LOCUS_09440 49594 50070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 50438 50665 gene locus_tag LOCUS_09450 50438 50665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 51111 50719 gene locus_tag LOCUS_09460 51111 50719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 51147 52595 gene locus_tag LOCUS_09470 gene gatB 51147 52595 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_09470 52592 53140 gene locus_tag LOCUS_09480 52592 53140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 53177 53764 gene locus_tag LOCUS_09490 gene pyrE 53177 53764 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460653.1 protein_id gnl|my_center|LOCUS_09490 54861 53761 gene locus_tag LOCUS_09500 54861 53761 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141711.1 protein_id gnl|my_center|LOCUS_09500 55581 54919 gene locus_tag LOCUS_09510 55581 54919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 56796 55618 gene locus_tag LOCUS_09520 56796 55618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 59147 56904 gene locus_tag LOCUS_09530 gene purL 59147 56904 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_09530 59137 59556 gene locus_tag LOCUS_09540 59137 59556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 59556 60047 gene locus_tag LOCUS_09550 59556 60047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 60072 60986 gene locus_tag LOCUS_09560 60072 60986 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_09560 62268 60988 gene locus_tag LOCUS_09570 62268 60988 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265722.1 protein_id gnl|my_center|LOCUS_09570 62361 63464 gene locus_tag LOCUS_09580 62361 63464 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080086.1 protein_id gnl|my_center|LOCUS_09580 63461 64108 gene locus_tag LOCUS_09590 63461 64108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 64105 64911 gene locus_tag LOCUS_09600 gene dapB 64105 64911 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661724.1 protein_id gnl|my_center|LOCUS_09600 66788 64908 gene locus_tag LOCUS_09610 66788 64908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 67397 66969 gene locus_tag LOCUS_09620 67397 66969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 67423 67668 gene locus_tag LOCUS_09630 67423 67668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 67665 68879 gene locus_tag LOCUS_09640 67665 68879 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014221.1 protein_id gnl|my_center|LOCUS_09640 69853 68876 gene locus_tag LOCUS_09650 69853 68876 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405967.1 protein_id gnl|my_center|LOCUS_09650 69934 70584 gene locus_tag LOCUS_09660 69934 70584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 70630 71556 gene locus_tag LOCUS_09670 70630 71556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 72432 71563 gene locus_tag LOCUS_09680 72432 71563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 73421 72477 gene locus_tag LOCUS_09690 73421 72477 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930876.1 protein_id gnl|my_center|LOCUS_09690 73720 75786 gene locus_tag LOCUS_09700 73720 75786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 75804 75891 gene locus_tag LOCUS_t00060 75804 75891 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 76489 75893 gene locus_tag LOCUS_09710 76489 75893 CDS product aminodeoxychorismate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174674.1 protein_id gnl|my_center|LOCUS_09710 76561 78474 gene locus_tag LOCUS_09720 76561 78474 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944051.1 protein_id gnl|my_center|LOCUS_09720 78502 78732 gene locus_tag LOCUS_09730 78502 78732 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_09730 80798 79146 gene locus_tag LOCUS_09740 80798 79146 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201021.1 protein_id gnl|my_center|LOCUS_09740 80813 81733 gene locus_tag LOCUS_09750 80813 81733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 81745 82350 gene locus_tag LOCUS_09760 gene cobC 81745 82350 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_09760 82347 83831 gene locus_tag LOCUS_09770 gene lnt 82347 83831 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003901363.1 protein_id gnl|my_center|LOCUS_09770 83861 84232 gene locus_tag LOCUS_09780 83861 84232 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_09780 84217 84561 gene locus_tag LOCUS_09790 84217 84561 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172720.1 protein_id gnl|my_center|LOCUS_09790 84658 85287 gene locus_tag LOCUS_09800 84658 85287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 85355 86683 gene locus_tag LOCUS_09810 85355 86683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 87390 86677 gene locus_tag LOCUS_09820 87390 86677 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_09820 87275 87604 gene locus_tag LOCUS_09830 87275 87604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 89030 87702 gene locus_tag LOCUS_09840 89030 87702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 89874 89299 gene locus_tag LOCUS_09850 89874 89299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 90383 89895 gene locus_tag LOCUS_09860 90383 89895 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668974.1 protein_id gnl|my_center|LOCUS_09860 91462 90503 gene locus_tag LOCUS_09870 91462 90503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 92309 91641 gene locus_tag LOCUS_09880 92309 91641 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280862.1 protein_id gnl|my_center|LOCUS_09880 92638 92306 gene locus_tag LOCUS_09890 92638 92306 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_09890 92753 94036 gene locus_tag LOCUS_09900 92753 94036 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 protein_id gnl|my_center|LOCUS_09900 94033 95298 gene locus_tag LOCUS_09910 94033 95298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 95315 96619 gene locus_tag LOCUS_09920 gene aroA 95315 96619 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_09920 96612 97274 gene locus_tag LOCUS_09930 gene cmk 96612 97274 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723586.1 protein_id gnl|my_center|LOCUS_09930 97499 98443 gene locus_tag LOCUS_09940 97499 98443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 98703 99635 gene locus_tag LOCUS_09950 98703 99635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 99901 100833 gene locus_tag LOCUS_09960 99901 100833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 100925 101215 gene locus_tag LOCUS_09970 100925 101215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 101218 101499 gene locus_tag LOCUS_09980 101218 101499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 101499 102410 gene locus_tag LOCUS_09990 101499 102410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 104129 102414 gene locus_tag LOCUS_10000 gene rng 104129 102414 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_10000 104268 105743 gene locus_tag LOCUS_10010 gene gcvPB 104268 105743 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_10010 106094 105753 gene locus_tag LOCUS_10020 106094 105753 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940209.1 protein_id gnl|my_center|LOCUS_10020 107530 106154 gene locus_tag LOCUS_10030 107530 106154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 108280 107585 gene locus_tag LOCUS_10040 108280 107585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 108830 108255 gene locus_tag LOCUS_10050 108830 108255 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_10050 108910 109182 gene locus_tag LOCUS_10060 108910 109182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 112728 109198 gene locus_tag LOCUS_10070 112728 109198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 <114837 112861 gene locus_tag LOCUS_10080 <114837 112861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013228744.1:LuxR C-terminal-related transcriptional regulator >Feature sequence007 1657 263 gene locus_tag LOCUS_10090 gene miaB 1657 263 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392626.1 protein_id gnl|my_center|LOCUS_10090 1780 2127 gene locus_tag LOCUS_10100 gene rplT 1780 2127 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393257.1 protein_id gnl|my_center|LOCUS_10100 2162 2455 gene locus_tag LOCUS_10110 2162 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3270 2449 gene locus_tag LOCUS_10120 3270 2449 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_10120 4797 3292 gene locus_tag LOCUS_10130 4797 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5549 4794 gene locus_tag LOCUS_10140 5549 4794 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_10140 5650 6246 gene locus_tag LOCUS_10150 5650 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 7202 6243 gene locus_tag LOCUS_10160 7202 6243 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_10160 8194 7199 gene locus_tag LOCUS_10170 8194 7199 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545565.1 protein_id gnl|my_center|LOCUS_10170 8265 8714 gene locus_tag LOCUS_10180 8265 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 9575 8757 gene locus_tag LOCUS_10190 9575 8757 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_10190 10459 9572 gene locus_tag LOCUS_10200 10459 9572 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_10200 11763 10456 gene locus_tag LOCUS_10210 11763 10456 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582764.1 protein_id gnl|my_center|LOCUS_10210 12284 11811 gene locus_tag LOCUS_10220 12284 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 12359 13570 gene locus_tag LOCUS_10230 12359 13570 CDS product pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337521.1 protein_id gnl|my_center|LOCUS_10230 13601 14626 gene locus_tag LOCUS_10240 13601 14626 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258767.1 protein_id gnl|my_center|LOCUS_10240 15034 14630 gene locus_tag LOCUS_10250 15034 14630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 15559 15038 gene locus_tag LOCUS_10260 15559 15038 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142741.1 protein_id gnl|my_center|LOCUS_10260 15629 16366 gene locus_tag LOCUS_10270 15629 16366 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774684.1 protein_id gnl|my_center|LOCUS_10270 16363 17376 gene locus_tag LOCUS_10280 16363 17376 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532830.1 protein_id gnl|my_center|LOCUS_10280 17373 18173 gene locus_tag LOCUS_10290 17373 18173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 18325 18116 gene locus_tag LOCUS_10300 18325 18116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 19084 18329 gene locus_tag LOCUS_10310 19084 18329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 20428 19136 gene locus_tag LOCUS_10320 gene purB 20428 19136 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140047.1 protein_id gnl|my_center|LOCUS_10320 20488 22113 gene locus_tag LOCUS_10330 20488 22113 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_10330 22110 23291 gene locus_tag LOCUS_10340 22110 23291 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_10340 23288 23923 gene locus_tag LOCUS_10350 23288 23923 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_10350 25945 23930 gene locus_tag LOCUS_10360 gene nuoG 25945 23930 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258754.1 protein_id gnl|my_center|LOCUS_10360 26014 26247 gene locus_tag LOCUS_10370 26014 26247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 26213 26800 gene locus_tag LOCUS_10380 26213 26800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 27061 26867 gene locus_tag LOCUS_10390 gene rpmI 27061 26867 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_10390 27569 26976 gene locus_tag LOCUS_10400 gene infC 27569 26976 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051498574.1 protein_id gnl|my_center|LOCUS_10400 28215 27664 gene locus_tag LOCUS_10410 28215 27664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 29201 28212 gene locus_tag LOCUS_10420 29201 28212 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_10420 29691 29383 gene locus_tag LOCUS_10430 29691 29383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 29796 31313 gene locus_tag LOCUS_10440 29796 31313 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174141.1 protein_id gnl|my_center|LOCUS_10440 31389 35156 gene locus_tag LOCUS_10450 31389 35156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 35800 35153 gene locus_tag LOCUS_10460 35800 35153 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_10460 36256 35804 gene locus_tag LOCUS_10470 gene dtd 36256 35804 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941193.1 protein_id gnl|my_center|LOCUS_10470 38493 36253 gene locus_tag LOCUS_10480 38493 36253 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_10480 39215 38490 gene locus_tag LOCUS_10490 gene kdsB 39215 38490 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_10490 39366 39441 gene locus_tag LOCUS_t00070 39366 39441 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 40887 39928 gene locus_tag LOCUS_10500 40887 39928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 41682 40891 gene locus_tag LOCUS_10510 41682 40891 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_10510 42828 41947 gene locus_tag LOCUS_10520 42828 41947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 43930 42929 gene locus_tag LOCUS_10530 43930 42929 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970438.1 protein_id gnl|my_center|LOCUS_10530 44011 44970 gene locus_tag LOCUS_10540 44011 44970 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103129516.1 protein_id gnl|my_center|LOCUS_10540 44975 46225 gene locus_tag LOCUS_10550 44975 46225 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002321046.1 protein_id gnl|my_center|LOCUS_10550 46222 47082 gene locus_tag LOCUS_10560 46222 47082 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721883.1 protein_id gnl|my_center|LOCUS_10560 48238 47135 gene locus_tag LOCUS_10570 48238 47135 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_10570 49866 48436 gene locus_tag LOCUS_10580 49866 48436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 52641 51589 gene locus_tag LOCUS_10590 gene dcm 52641 51589 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690264.1 protein_id gnl|my_center|LOCUS_10590 53687 52638 gene locus_tag LOCUS_10600 53687 52638 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939034.1 protein_id gnl|my_center|LOCUS_10600 54682 53984 gene locus_tag LOCUS_10610 54682 53984 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122175.1 protein_id gnl|my_center|LOCUS_10610 54896 55051 gene locus_tag LOCUS_10620 54896 55051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 55048 56658 gene locus_tag LOCUS_10630 55048 56658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 56655 57128 gene locus_tag LOCUS_10640 56655 57128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 57115 58446 gene locus_tag LOCUS_10650 57115 58446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 58443 59540 gene locus_tag LOCUS_10660 gene metK 58443 59540 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388672.1 protein_id gnl|my_center|LOCUS_10660 63055 59537 gene locus_tag LOCUS_10670 gene nifJ 63055 59537 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705395.1 protein_id gnl|my_center|LOCUS_10670 64695 63052 gene locus_tag LOCUS_10680 64695 63052 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705394.1 protein_id gnl|my_center|LOCUS_10680 65049 64732 gene locus_tag LOCUS_10690 65049 64732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 65119 67368 gene locus_tag LOCUS_10700 65119 67368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 69176 67380 gene locus_tag LOCUS_10710 gene lepA 69176 67380 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_10710 69823 69224 gene locus_tag LOCUS_10720 69823 69224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 70700 69846 gene locus_tag LOCUS_10730 gene folD 70700 69846 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_10730 71257 70697 gene locus_tag LOCUS_10740 71257 70697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 72609 71254 gene locus_tag LOCUS_10750 gene accC 72609 71254 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_10750 72971 72609 gene locus_tag LOCUS_10760 72971 72609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 73372 72968 gene locus_tag LOCUS_10770 73372 72968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 73506 74594 gene locus_tag LOCUS_10780 73506 74594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 74631 77027 gene locus_tag LOCUS_10790 74631 77027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 77024 77914 gene locus_tag LOCUS_10800 77024 77914 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532486.1 protein_id gnl|my_center|LOCUS_10800 77954 79810 gene locus_tag LOCUS_10810 77954 79810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 79892 80296 gene locus_tag LOCUS_10820 79892 80296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 80339 81442 gene locus_tag LOCUS_10830 80339 81442 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_10830 81447 82124 gene locus_tag LOCUS_10840 81447 82124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 82226 83209 gene locus_tag LOCUS_10850 82226 83209 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942235.1 protein_id gnl|my_center|LOCUS_10850 83191 84045 gene locus_tag LOCUS_10860 gene truB 83191 84045 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203915.1 protein_id gnl|my_center|LOCUS_10860 84049 84699 gene locus_tag LOCUS_10870 84049 84699 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257775.1 protein_id gnl|my_center|LOCUS_10870 85178 84696 gene locus_tag LOCUS_10880 85178 84696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 85237 87729 gene locus_tag LOCUS_10890 85237 87729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 88494 87736 gene locus_tag LOCUS_10900 88494 87736 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762836.1 protein_id gnl|my_center|LOCUS_10900 88991 88527 gene locus_tag LOCUS_10910 88991 88527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 89549 89031 gene locus_tag LOCUS_10920 89549 89031 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228273.1 protein_id gnl|my_center|LOCUS_10920 90385 89546 gene locus_tag LOCUS_10930 90385 89546 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_10930 91393 90389 gene locus_tag LOCUS_10940 91393 90389 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_10940 92259 92462 gene locus_tag LOCUS_10950 92259 92462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 92535 93791 gene locus_tag LOCUS_10960 92535 93791 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257562.1 protein_id gnl|my_center|LOCUS_10960 93978 94499 gene locus_tag LOCUS_10970 gene nrdR 93978 94499 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203687.1 protein_id gnl|my_center|LOCUS_10970 94496 98047 gene locus_tag LOCUS_10980 94496 98047 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_10980 98103 101066 gene locus_tag LOCUS_10990 98103 101066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 101157 101636 gene locus_tag LOCUS_11000 101157 101636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 102458 101673 gene locus_tag LOCUS_11010 102458 101673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 102763 102548 gene locus_tag LOCUS_11020 102763 102548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 103607 102756 gene locus_tag LOCUS_11030 103607 102756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 104006 103782 gene locus_tag LOCUS_11040 104006 103782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 103899 105065 gene locus_tag LOCUS_11050 103899 105065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 105098 105184 gene locus_tag LOCUS_t00080 105098 105184 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 106721 105237 gene locus_tag LOCUS_11060 gene guaB 106721 105237 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965988.1 protein_id gnl|my_center|LOCUS_11060 108236 106779 gene locus_tag LOCUS_11070 108236 106779 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530690.1 protein_id gnl|my_center|LOCUS_11070 108339 111014 gene locus_tag LOCUS_11080 gene fdhF 108339 111014 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_11080 >Feature sequence008 1808 609 gene locus_tag LOCUS_11090 gene nuoD 1808 609 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258751.1 protein_id gnl|my_center|LOCUS_11090 1978 2448 gene locus_tag LOCUS_11100 1978 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2449 2730 gene locus_tag LOCUS_11110 2449 2730 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_11110 2727 3434 gene locus_tag LOCUS_11120 gene ric 2727 3434 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073961.1 protein_id gnl|my_center|LOCUS_11120 4223 3492 gene locus_tag LOCUS_11130 4223 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4495 5088 gene locus_tag LOCUS_11140 4495 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 7784 5118 gene locus_tag LOCUS_11150 7784 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 9635 7806 gene locus_tag LOCUS_11160 9635 7806 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_11160 10559 9654 gene locus_tag LOCUS_11170 gene ilvE 10559 9654 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870345.1 protein_id gnl|my_center|LOCUS_11170 10926 10588 gene locus_tag LOCUS_11180 10926 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 11029 11649 gene locus_tag LOCUS_11190 gene pdxH 11029 11649 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112518.1 protein_id gnl|my_center|LOCUS_11190 12073 11651 gene locus_tag LOCUS_11200 12073 11651 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706237.1 protein_id gnl|my_center|LOCUS_11200 12784 12122 gene locus_tag LOCUS_11210 12784 12122 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943050.1 protein_id gnl|my_center|LOCUS_11210 13962 12781 gene locus_tag LOCUS_11220 13962 12781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 13410 13484 gene locus_tag LOCUS_t00090 13410 13484 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15005 14256 gene locus_tag LOCUS_11230 15005 14256 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403421.1 protein_id gnl|my_center|LOCUS_11230 15722 15021 gene locus_tag LOCUS_11240 15722 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 15844 16626 gene locus_tag LOCUS_11250 gene sdhB 15844 16626 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808702.1 protein_id gnl|my_center|LOCUS_11250 16758 18116 gene locus_tag LOCUS_11260 16758 18116 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_11260 18113 19135 gene locus_tag LOCUS_11270 gene cydB 18113 19135 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_11270 22340 19140 gene locus_tag LOCUS_11280 22340 19140 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_11280 22469 23917 gene locus_tag LOCUS_11290 22469 23917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 23944 26172 gene locus_tag LOCUS_11300 23944 26172 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784059.1 protein_id gnl|my_center|LOCUS_11300 26250 26519 gene locus_tag LOCUS_11310 26250 26519 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227983.1 protein_id gnl|my_center|LOCUS_11310 26500 26931 gene locus_tag LOCUS_11320 26500 26931 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209605909.1 protein_id gnl|my_center|LOCUS_11320 27452 26937 gene locus_tag LOCUS_11330 27452 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 27485 28702 gene locus_tag LOCUS_11340 27485 28702 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_11340 28814 29389 gene locus_tag LOCUS_11350 gene nrfH 28814 29389 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107765.1 protein_id gnl|my_center|LOCUS_11350 29386 30849 gene locus_tag LOCUS_11360 gene nrfA 29386 30849 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201986.1 protein_id gnl|my_center|LOCUS_11360 30830 32014 gene locus_tag LOCUS_11370 30830 32014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 32011 32793 gene locus_tag LOCUS_11380 gene ccsA 32011 32793 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933223.1 protein_id gnl|my_center|LOCUS_11380 33378 32800 gene locus_tag LOCUS_11390 33378 32800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 33504 33746 gene locus_tag LOCUS_11400 33504 33746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 36215 33771 gene locus_tag LOCUS_11410 36215 33771 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921186.1 protein_id gnl|my_center|LOCUS_11410 38951 36306 gene locus_tag LOCUS_11420 38951 36306 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839992.1 protein_id gnl|my_center|LOCUS_11420 39018 40106 gene locus_tag LOCUS_11430 39018 40106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 40981 40115 gene locus_tag LOCUS_11440 40981 40115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 41272 45744 gene locus_tag LOCUS_11450 41272 45744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 46181 45741 gene locus_tag LOCUS_11460 46181 45741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 46181 46711 gene locus_tag LOCUS_11470 46181 46711 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962510.1 protein_id gnl|my_center|LOCUS_11470 47603 46803 gene locus_tag LOCUS_11480 47603 46803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 47702 48676 gene locus_tag LOCUS_11490 47702 48676 CDS product glycine cleavage T C-terminal barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141472.1 protein_id gnl|my_center|LOCUS_11490 48801 51494 gene locus_tag LOCUS_11500 gene ppdK 48801 51494 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460835.1 protein_id gnl|my_center|LOCUS_11500 51555 51764 gene locus_tag LOCUS_11510 51555 51764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 52524 51784 gene locus_tag LOCUS_11520 52524 51784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 57158 52521 gene locus_tag LOCUS_11530 57158 52521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 58504 57155 gene locus_tag LOCUS_11540 58504 57155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 60819 58774 gene locus_tag LOCUS_11550 gene ppk1 60819 58774 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_11550 61709 60816 gene locus_tag LOCUS_11560 61709 60816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 62822 61713 gene locus_tag LOCUS_11570 62822 61713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 63792 62839 gene locus_tag LOCUS_11580 gene trxB 63792 62839 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510039.1 protein_id gnl|my_center|LOCUS_11580 64530 63838 gene locus_tag LOCUS_11590 64530 63838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 65364 64618 gene locus_tag LOCUS_11600 65364 64618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 66626 65532 gene locus_tag LOCUS_11610 66626 65532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 66839 67726 gene locus_tag LOCUS_11620 66839 67726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 67816 68652 gene locus_tag LOCUS_11630 67816 68652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 68659 68883 gene locus_tag LOCUS_11640 68659 68883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 69138 68953 gene locus_tag LOCUS_11650 69138 68953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 69318 70910 gene locus_tag LOCUS_11660 69318 70910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 70920 72188 gene locus_tag LOCUS_11670 70920 72188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 72233 72967 gene locus_tag LOCUS_11680 72233 72967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 73309 72953 gene locus_tag LOCUS_11690 gene acpS 73309 72953 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882961.1 protein_id gnl|my_center|LOCUS_11690 75288 73306 gene locus_tag LOCUS_11700 75288 73306 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257680.1 protein_id gnl|my_center|LOCUS_11700 76003 75362 gene locus_tag LOCUS_11710 76003 75362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 77796 76099 gene locus_tag LOCUS_11720 77796 76099 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869365.1 protein_id gnl|my_center|LOCUS_11720 78065 78907 gene locus_tag LOCUS_11730 78065 78907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 78912 79103 gene locus_tag LOCUS_11740 78912 79103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 79288 79881 gene locus_tag LOCUS_11750 gene leuD 79288 79881 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930380.1 protein_id gnl|my_center|LOCUS_11750 79898 80509 gene locus_tag LOCUS_11760 79898 80509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 80527 81906 gene locus_tag LOCUS_11770 80527 81906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 82009 85710 gene locus_tag LOCUS_11780 82009 85710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 85710 86216 gene locus_tag LOCUS_11790 85710 86216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 86376 87731 gene locus_tag LOCUS_11800 86376 87731 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_11800 88132 87728 gene locus_tag LOCUS_11810 88132 87728 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_11810 88210 89871 gene locus_tag LOCUS_11820 88210 89871 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257054.1 protein_id gnl|my_center|LOCUS_11820 89875 91104 gene locus_tag LOCUS_11830 89875 91104 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_11830 91449 91667 gene locus_tag LOCUS_11840 91449 91667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 92269 92754 gene locus_tag LOCUS_11850 gene dps 92269 92754 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312098.1 protein_id gnl|my_center|LOCUS_11850 92819 93964 gene locus_tag LOCUS_11860 92819 93964 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_11860 93961 94683 gene locus_tag LOCUS_11870 93961 94683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 96139 94688 gene locus_tag LOCUS_11880 96139 94688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 96256 96894 gene locus_tag LOCUS_11890 96256 96894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 97195 96863 gene locus_tag LOCUS_11900 97195 96863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 97226 97414 gene locus_tag LOCUS_11910 97226 97414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 97516 98718 gene locus_tag LOCUS_11920 gene wecC 97516 98718 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099275.1 protein_id gnl|my_center|LOCUS_11920 99833 98715 gene locus_tag LOCUS_11930 99833 98715 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037024.1 protein_id gnl|my_center|LOCUS_11930 101024 99936 gene locus_tag LOCUS_11940 101024 99936 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405064.1 protein_id gnl|my_center|LOCUS_11940 101156 101031 gene locus_tag LOCUS_11950 101156 101031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 102169 101144 gene locus_tag LOCUS_11960 102169 101144 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence009 3240 1816 gene locus_tag LOCUS_11970 3240 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 3384 3309 gene locus_tag LOCUS_t00100 3384 3309 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5728 3431 gene locus_tag LOCUS_11980 5728 3431 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090811.1 protein_id gnl|my_center|LOCUS_11980 8522 5721 gene locus_tag LOCUS_11990 8522 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 8625 9176 gene locus_tag LOCUS_12000 8625 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 9242 10891 gene locus_tag LOCUS_12010 9242 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 10905 12107 gene locus_tag LOCUS_12020 10905 12107 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142595.1 protein_id gnl|my_center|LOCUS_12020 14903 12114 gene locus_tag LOCUS_12030 14903 12114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 15350 14964 gene locus_tag LOCUS_12040 15350 14964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 15234 17240 gene locus_tag LOCUS_12050 15234 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 18398 17286 gene locus_tag LOCUS_12060 18398 17286 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295249.1 protein_id gnl|my_center|LOCUS_12060 20610 18415 gene locus_tag LOCUS_12070 20610 18415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_12070 20766 21356 gene locus_tag LOCUS_12080 gene ccmA 20766 21356 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_12080 21353 22042 gene locus_tag LOCUS_12090 21353 22042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 22056 22790 gene locus_tag LOCUS_12100 22056 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 22897 23964 gene locus_tag LOCUS_12110 gene prfA 22897 23964 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_12110 24737 23961 gene locus_tag LOCUS_12120 24737 23961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 24736 25020 gene locus_tag LOCUS_12130 24736 25020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 25050 25733 gene locus_tag LOCUS_12140 25050 25733 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_12140 25717 27570 gene locus_tag LOCUS_12150 25717 27570 CDS product DUF5693 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391758.1 protein_id gnl|my_center|LOCUS_12150 27571 28650 gene locus_tag LOCUS_12160 gene csaB 27571 28650 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_12160 28637 31198 gene locus_tag LOCUS_12170 28637 31198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 33252 31195 gene locus_tag LOCUS_12180 33252 31195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 33305 34120 gene locus_tag LOCUS_12190 33305 34120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 34637 35677 gene locus_tag LOCUS_12200 34637 35677 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142542.1 protein_id gnl|my_center|LOCUS_12200 35700 37736 gene locus_tag LOCUS_12210 35700 37736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 37821 38621 gene locus_tag LOCUS_12220 37821 38621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 38683 38985 gene locus_tag LOCUS_12230 38683 38985 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963273.1 protein_id gnl|my_center|LOCUS_12230 39543 38989 gene locus_tag LOCUS_12240 39543 38989 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072775378.1 protein_id gnl|my_center|LOCUS_12240 39666 40577 gene locus_tag LOCUS_12250 39666 40577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 41479 40574 gene locus_tag LOCUS_12260 41479 40574 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_12260 42369 41476 gene locus_tag LOCUS_12270 42369 41476 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084196.1 protein_id gnl|my_center|LOCUS_12270 43106 42366 gene locus_tag LOCUS_12280 43106 42366 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064854.1 protein_id gnl|my_center|LOCUS_12280 45242 43116 gene locus_tag LOCUS_12290 45242 43116 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228275.1 protein_id gnl|my_center|LOCUS_12290 47336 45360 gene locus_tag LOCUS_12300 47336 45360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 47718 47341 gene locus_tag LOCUS_12310 47718 47341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 48839 47706 gene locus_tag LOCUS_12320 48839 47706 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583824.1 protein_id gnl|my_center|LOCUS_12320 49788 48847 gene locus_tag LOCUS_12330 49788 48847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 52749 49795 gene locus_tag LOCUS_12340 52749 49795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 52974 54389 gene locus_tag LOCUS_12350 52974 54389 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_12350 54939 54864 gene locus_tag LOCUS_t00110 54939 54864 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 55070 55930 gene locus_tag LOCUS_12360 55070 55930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 56025 57026 gene locus_tag LOCUS_12370 56025 57026 CDS product glycoside hydrolase family 130 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786056.1 protein_id gnl|my_center|LOCUS_12370 57934 57101 gene locus_tag LOCUS_12380 gene dapF 57934 57101 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_12380 58191 57931 gene locus_tag LOCUS_12390 gene hfq 58191 57931 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813896.1 protein_id gnl|my_center|LOCUS_12390 59085 58207 gene locus_tag LOCUS_12400 gene miaA 59085 58207 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052636.1 protein_id gnl|my_center|LOCUS_12400 60389 59082 gene locus_tag LOCUS_12410 60389 59082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 60471 61040 gene locus_tag LOCUS_12420 60471 61040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 62860 61037 gene locus_tag LOCUS_12430 62860 61037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 63597 62869 gene locus_tag LOCUS_12440 63597 62869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 64817 63594 gene locus_tag LOCUS_12450 gene purD 64817 63594 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393539.1 protein_id gnl|my_center|LOCUS_12450 66152 64842 gene locus_tag LOCUS_12460 66152 64842 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941684.1 protein_id gnl|my_center|LOCUS_12460 66217 67092 gene locus_tag LOCUS_12470 66217 67092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 67094 67588 gene locus_tag LOCUS_12480 67094 67588 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704154.1 protein_id gnl|my_center|LOCUS_12480 67600 68604 gene locus_tag LOCUS_12490 67600 68604 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029972.1 protein_id gnl|my_center|LOCUS_12490 68642 69139 gene locus_tag LOCUS_12500 68642 69139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 69088 69672 gene locus_tag LOCUS_12510 69088 69672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 70195 69686 gene locus_tag LOCUS_12520 70195 69686 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228194.1 protein_id gnl|my_center|LOCUS_12520 70229 70417 gene locus_tag LOCUS_12530 70229 70417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 70359 70814 gene locus_tag LOCUS_12540 70359 70814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 70818 72380 gene locus_tag LOCUS_12550 70818 72380 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391643.1 protein_id gnl|my_center|LOCUS_12550 72946 72587 gene locus_tag LOCUS_12560 72946 72587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 73848 73772 gene locus_tag LOCUS_t00120 73848 73772 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 73891 74832 gene locus_tag LOCUS_12570 73891 74832 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230308.1 protein_id gnl|my_center|LOCUS_12570 74848 76497 gene locus_tag LOCUS_12580 74848 76497 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088981.1 protein_id gnl|my_center|LOCUS_12580 77227 76529 gene locus_tag LOCUS_12590 77227 76529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 78341 77241 gene locus_tag LOCUS_12600 gene dnaN 78341 77241 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831813.1 protein_id gnl|my_center|LOCUS_12600 78652 78362 gene locus_tag LOCUS_12610 78652 78362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 79188 78649 gene locus_tag LOCUS_12620 gene sigW 79188 78649 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_12620 80014 79259 gene locus_tag LOCUS_12630 80014 79259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 81102 80038 gene locus_tag LOCUS_12640 gene nifS 81102 80038 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065651.1 protein_id gnl|my_center|LOCUS_12640 81987 81142 gene locus_tag LOCUS_12650 gene sucD 81987 81142 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_12650 82195 82824 gene locus_tag LOCUS_12660 gene lexA 82195 82824 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_12660 84134 82821 gene locus_tag LOCUS_12670 84134 82821 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143713.1 protein_id gnl|my_center|LOCUS_12670 85216 84179 gene locus_tag LOCUS_12680 85216 84179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 85337 85246 gene locus_tag LOCUS_t00130 85337 85246 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 86056 85373 gene locus_tag LOCUS_12690 86056 85373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 86892 86092 gene locus_tag LOCUS_12700 86892 86092 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109951.1 protein_id gnl|my_center|LOCUS_12700 87177 86938 gene locus_tag LOCUS_12710 87177 86938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 87557 87174 gene locus_tag LOCUS_12720 87557 87174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 89335 87722 gene locus_tag LOCUS_12730 gene groL 89335 87722 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392083.1 protein_id gnl|my_center|LOCUS_12730 89645 89340 gene locus_tag LOCUS_12740 gene groES 89645 89340 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence010 125 1768 gene locus_tag LOCUS_12750 gene dnaX 125 1768 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121572.1 protein_id gnl|my_center|LOCUS_12750 1765 2100 gene locus_tag LOCUS_12760 1765 2100 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815036.1 protein_id gnl|my_center|LOCUS_12760 2107 2703 gene locus_tag LOCUS_12770 gene recR 2107 2703 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143488.1 protein_id gnl|my_center|LOCUS_12770 2731 4437 gene locus_tag LOCUS_12780 2731 4437 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140819.1 protein_id gnl|my_center|LOCUS_12780 4480 6927 gene locus_tag LOCUS_12790 4480 6927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 6924 7751 gene locus_tag LOCUS_12800 6924 7751 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_12800 8135 8596 gene locus_tag LOCUS_12810 gene mraZ 8135 8596 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 protein_id gnl|my_center|LOCUS_12810 8593 9570 gene locus_tag LOCUS_12820 gene rsmH 8593 9570 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392354.1 protein_id gnl|my_center|LOCUS_12820 9552 9992 gene locus_tag LOCUS_12830 9552 9992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 9973 11952 gene locus_tag LOCUS_12840 9973 11952 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_12840 11949 13427 gene locus_tag LOCUS_12850 11949 13427 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939779.1 protein_id gnl|my_center|LOCUS_12850 13424 14779 gene locus_tag LOCUS_12860 13424 14779 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392358.1 protein_id gnl|my_center|LOCUS_12860 14776 15747 gene locus_tag LOCUS_12870 gene mraY 14776 15747 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310449.1 protein_id gnl|my_center|LOCUS_12870 15806 17011 gene locus_tag LOCUS_12880 15806 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 17008 18063 gene locus_tag LOCUS_12890 gene murG 17008 18063 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130746.1 protein_id gnl|my_center|LOCUS_12890 18071 19135 gene locus_tag LOCUS_12900 gene leuB 18071 19135 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038427.1 protein_id gnl|my_center|LOCUS_12900 19132 20745 gene locus_tag LOCUS_12910 gene trmFO 19132 20745 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 protein_id gnl|my_center|LOCUS_12910 20794 23019 gene locus_tag LOCUS_12920 gene yicI 20794 23019 CDS product alpha-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027547.1 protein_id gnl|my_center|LOCUS_12920 23016 24380 gene locus_tag LOCUS_12930 23016 24380 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_12930 24493 24417 gene locus_tag LOCUS_t00140 24493 24417 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26227 24551 gene locus_tag LOCUS_12940 26227 24551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 26741 26271 gene locus_tag LOCUS_12950 26741 26271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 27561 26734 gene locus_tag LOCUS_12960 27561 26734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 27641 28297 gene locus_tag LOCUS_12970 27641 28297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 28423 29310 gene locus_tag LOCUS_12980 28423 29310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 29709 30350 gene locus_tag LOCUS_12990 29709 30350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 32017 30671 gene locus_tag LOCUS_13000 gene dapG 32017 30671 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392581.1 protein_id gnl|my_center|LOCUS_13000 32487 32014 gene locus_tag LOCUS_13010 32487 32014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 33448 32480 gene locus_tag LOCUS_13020 33448 32480 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224067.1 protein_id gnl|my_center|LOCUS_13020 35251 33473 gene locus_tag LOCUS_13030 35251 33473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 36166 35480 gene locus_tag LOCUS_13040 36166 35480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 36647 36288 gene locus_tag LOCUS_13050 36647 36288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 37436 36768 gene locus_tag LOCUS_13060 37436 36768 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966354.1 protein_id gnl|my_center|LOCUS_13060 38293 37574 gene locus_tag LOCUS_13070 38293 37574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 38432 39637 gene locus_tag LOCUS_13080 38432 39637 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_13080 39641 40828 gene locus_tag LOCUS_13090 39641 40828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 40825 42018 gene locus_tag LOCUS_13100 40825 42018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 42015 42779 gene locus_tag LOCUS_13110 42015 42779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925352.1 protein_id gnl|my_center|LOCUS_13110 43786 42758 gene locus_tag LOCUS_13120 43786 42758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 45084 43918 gene locus_tag LOCUS_13130 45084 43918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 45230 45742 gene locus_tag LOCUS_13140 45230 45742 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897021.1 protein_id gnl|my_center|LOCUS_13140 46240 46989 gene locus_tag LOCUS_13150 46240 46989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 47032 47640 gene locus_tag LOCUS_13160 gene ubiX 47032 47640 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_13160 47637 48548 gene locus_tag LOCUS_13170 47637 48548 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_13170 48545 49426 gene locus_tag LOCUS_13180 48545 49426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 49440 49916 gene locus_tag LOCUS_13190 49440 49916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 50169 49924 gene locus_tag LOCUS_13200 50169 49924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 52058 50166 gene locus_tag LOCUS_13210 52058 50166 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_13210 53558 52098 gene locus_tag LOCUS_13220 53558 52098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 54606 53788 gene locus_tag LOCUS_13230 54606 53788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 56074 54752 gene locus_tag LOCUS_13240 56074 54752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 57263 56109 gene locus_tag LOCUS_13250 57263 56109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 58270 57290 gene locus_tag LOCUS_13260 58270 57290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 58905 58405 gene locus_tag LOCUS_13270 58905 58405 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675008.1 protein_id gnl|my_center|LOCUS_13270 59092 59988 gene locus_tag LOCUS_13280 59092 59988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 59967 60236 gene locus_tag LOCUS_13290 59967 60236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 60282 60680 gene locus_tag LOCUS_13300 60282 60680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 60733 61995 gene locus_tag LOCUS_13310 gene obgE 60733 61995 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_13310 61992 62585 gene locus_tag LOCUS_13320 61992 62585 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674578.1 protein_id gnl|my_center|LOCUS_13320 62582 62935 gene locus_tag LOCUS_13330 gene rsfS 62582 62935 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763231.1 protein_id gnl|my_center|LOCUS_13330 62932 63723 gene locus_tag LOCUS_13340 62932 63723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 64506 63766 gene locus_tag LOCUS_13350 64506 63766 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009567369.1 protein_id gnl|my_center|LOCUS_13350 65945 64503 gene locus_tag LOCUS_13360 65945 64503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 66195 65950 gene locus_tag LOCUS_13370 66195 65950 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057201.1 protein_id gnl|my_center|LOCUS_13370 67384 66188 gene locus_tag LOCUS_13380 gene moeA 67384 66188 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705495.1 protein_id gnl|my_center|LOCUS_13380 68283 67381 gene locus_tag LOCUS_13390 gene moaCB 68283 67381 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932998.1 protein_id gnl|my_center|LOCUS_13390 69299 68283 gene locus_tag LOCUS_13400 gene moaA 69299 68283 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119704.1 protein_id gnl|my_center|LOCUS_13400 69385 70860 gene locus_tag LOCUS_13410 69385 70860 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113773.1 protein_id gnl|my_center|LOCUS_13410 70870 72192 gene locus_tag LOCUS_13420 70870 72192 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014188.1 protein_id gnl|my_center|LOCUS_13420 72236 72946 gene locus_tag LOCUS_13430 72236 72946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 73021 74103 gene locus_tag LOCUS_13440 73021 74103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 74548 74159 gene locus_tag LOCUS_13450 74548 74159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 74631 75212 gene locus_tag LOCUS_13460 74631 75212 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223264.1 protein_id gnl|my_center|LOCUS_13460 75267 75770 gene locus_tag LOCUS_13470 75267 75770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 75775 78312 gene locus_tag LOCUS_13480 75775 78312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 78309 79514 gene locus_tag LOCUS_13490 78309 79514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 79580 81403 gene locus_tag LOCUS_13500 79580 81403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 82726 81461 gene locus_tag LOCUS_13510 gene clpX 82726 81461 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_13510 83427 82813 gene locus_tag LOCUS_13520 gene clpP 83427 82813 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_13520 84728 83436 gene locus_tag LOCUS_13530 gene tig 84728 83436 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229611.1 protein_id gnl|my_center|LOCUS_13530 84822 85490 gene locus_tag LOCUS_13540 84822 85490 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887197.1 protein_id gnl|my_center|LOCUS_13540 85481 86920 gene locus_tag LOCUS_13550 85481 86920 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_13550 86917 87315 gene locus_tag LOCUS_13560 86917 87315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence011 190 1410 gene locus_tag LOCUS_13570 190 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3094 1514 gene locus_tag LOCUS_13580 gene gltX 3094 1514 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681104.1 protein_id gnl|my_center|LOCUS_13580 3770 3132 gene locus_tag LOCUS_13590 3770 3132 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920979.1 protein_id gnl|my_center|LOCUS_13590 6766 3845 gene locus_tag LOCUS_13600 6766 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 7558 6800 gene locus_tag LOCUS_13610 7558 6800 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776722.1 protein_id gnl|my_center|LOCUS_13610 7649 8938 gene locus_tag LOCUS_13620 7649 8938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 9002 9547 gene locus_tag LOCUS_13630 9002 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 9671 10276 gene locus_tag LOCUS_13640 9671 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 10273 10719 gene locus_tag LOCUS_13650 10273 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 10725 11837 gene locus_tag LOCUS_13660 10725 11837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 11874 13454 gene locus_tag LOCUS_13670 11874 13454 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_13670 13708 16332 gene locus_tag LOCUS_13680 gene acnA 13708 16332 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_13680 16486 17817 gene locus_tag LOCUS_13690 16486 17817 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876185.1 protein_id gnl|my_center|LOCUS_13690 19259 18159 gene locus_tag LOCUS_13700 19259 18159 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141252.1 protein_id gnl|my_center|LOCUS_13700 20139 19246 gene locus_tag LOCUS_13710 gene ftcD 20139 19246 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_13710 20908 20141 gene locus_tag LOCUS_13720 20908 20141 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582796.1 protein_id gnl|my_center|LOCUS_13720 20984 21517 gene locus_tag LOCUS_13730 20984 21517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 22419 21514 gene locus_tag LOCUS_13740 gene axeA 22419 21514 CDS product cephalosporin-C deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082599.1 protein_id gnl|my_center|LOCUS_13740 22655 22416 gene locus_tag LOCUS_13750 22655 22416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 23549 22719 gene locus_tag LOCUS_13760 gene murQ 23549 22719 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254545.1 protein_id gnl|my_center|LOCUS_13760 24398 23556 gene locus_tag LOCUS_13770 24398 23556 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007451.1 protein_id gnl|my_center|LOCUS_13770 25966 24638 gene locus_tag LOCUS_13780 25966 24638 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122554.1 protein_id gnl|my_center|LOCUS_13780 26092 26166 gene locus_tag LOCUS_t00150 26092 26166 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 26212 27306 gene locus_tag LOCUS_13790 26212 27306 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113380.1 protein_id gnl|my_center|LOCUS_13790 27528 28079 gene locus_tag LOCUS_13800 27528 28079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 28076 28507 gene locus_tag LOCUS_13810 28076 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 28518 30482 gene locus_tag LOCUS_13820 28518 30482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 30479 31303 gene locus_tag LOCUS_13830 gene dapF 30479 31303 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546632.1 protein_id gnl|my_center|LOCUS_13830 31403 31966 gene locus_tag LOCUS_13840 31403 31966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119444.1 protein_id gnl|my_center|LOCUS_13840 31963 33273 gene locus_tag LOCUS_13850 31963 33273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 33315 34196 gene locus_tag LOCUS_13860 33315 34196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 34234 35184 gene locus_tag LOCUS_13870 34234 35184 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583497.1 protein_id gnl|my_center|LOCUS_13870 35181 35990 gene locus_tag LOCUS_13880 35181 35990 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723883.1 protein_id gnl|my_center|LOCUS_13880 36017 37117 gene locus_tag LOCUS_13890 gene rlmN 36017 37117 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392423.1 protein_id gnl|my_center|LOCUS_13890 38077 37184 gene locus_tag LOCUS_13900 38077 37184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 38356 38087 gene locus_tag LOCUS_13910 38356 38087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 39208 38372 gene locus_tag LOCUS_13920 39208 38372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 39552 39205 gene locus_tag LOCUS_13930 39552 39205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13930 40029 39553 gene locus_tag LOCUS_13940 40029 39553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13940 42246 40117 gene locus_tag LOCUS_13950 gene recG 42246 40117 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_13950 42311 42670 gene locus_tag LOCUS_13960 42311 42670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 42654 43043 gene locus_tag LOCUS_13970 42654 43043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 43065 43883 gene locus_tag LOCUS_13980 43065 43883 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858390.1 protein_id gnl|my_center|LOCUS_13980 43948 44160 gene locus_tag LOCUS_13990 43948 44160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 44219 44839 gene locus_tag LOCUS_14000 44219 44839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 44843 45391 gene locus_tag LOCUS_14010 gene atpH 44843 45391 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142900.1 protein_id gnl|my_center|LOCUS_14010 45410 46933 gene locus_tag LOCUS_14020 gene atpA 45410 46933 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545369.1 protein_id gnl|my_center|LOCUS_14020 46937 47797 gene locus_tag LOCUS_14030 gene atpG 46937 47797 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_14030 48060 47815 gene locus_tag LOCUS_14040 48060 47815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 49481 48165 gene locus_tag LOCUS_14050 49481 48165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 50865 49579 gene locus_tag LOCUS_14060 gene ahcY 50865 49579 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_14060 50871 51728 gene locus_tag LOCUS_14070 gene metF 50871 51728 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_14070 51830 52840 gene locus_tag LOCUS_14080 51830 52840 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140793.1 protein_id gnl|my_center|LOCUS_14080 52893 53087 gene locus_tag LOCUS_14090 52893 53087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 53839 53117 gene locus_tag LOCUS_14100 53839 53117 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_14100 53845 54819 gene locus_tag LOCUS_14110 53845 54819 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_14110 55142 54816 gene locus_tag LOCUS_14120 55142 54816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 56487 55129 gene locus_tag LOCUS_14130 gene selA 56487 55129 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943980.1 protein_id gnl|my_center|LOCUS_14130 56537 57208 gene locus_tag LOCUS_14140 56537 57208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 57222 57443 gene locus_tag LOCUS_14150 57222 57443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 57440 58483 gene locus_tag LOCUS_14160 57440 58483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 58721 58587 gene locus_tag LOCUS_14170 58721 58587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 58926 59756 gene locus_tag LOCUS_14180 58926 59756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 60823 59753 gene locus_tag LOCUS_14190 60823 59753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 60880 62208 gene locus_tag LOCUS_14200 60880 62208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 63165 62290 gene locus_tag LOCUS_14210 63165 62290 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_14210 63314 64327 gene locus_tag LOCUS_14220 63314 64327 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029024.1 protein_id gnl|my_center|LOCUS_14220 64384 65202 gene locus_tag LOCUS_14230 64384 65202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 65202 65408 gene locus_tag LOCUS_14240 65202 65408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 65481 67334 gene locus_tag LOCUS_14250 65481 67334 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071060.1 protein_id gnl|my_center|LOCUS_14250 67327 69150 gene locus_tag LOCUS_14260 67327 69150 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339026.1 protein_id gnl|my_center|LOCUS_14260 69147 70091 gene locus_tag LOCUS_14270 69147 70091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 70097 72190 gene locus_tag LOCUS_14280 70097 72190 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537441.1 protein_id gnl|my_center|LOCUS_14280 72187 73641 gene locus_tag LOCUS_14290 72187 73641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 73638 74759 gene locus_tag LOCUS_14300 73638 74759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 74756 76306 gene locus_tag LOCUS_14310 gene citF 74756 76306 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_14310 76303 77451 gene locus_tag LOCUS_14320 76303 77451 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967203.1 protein_id gnl|my_center|LOCUS_14320 77471 77878 gene locus_tag LOCUS_14330 gene fliS 77471 77878 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050477.1 protein_id gnl|my_center|LOCUS_14330 77859 78185 gene locus_tag LOCUS_14340 77859 78185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 79202 78195 gene locus_tag LOCUS_14350 79202 78195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 79332 79628 gene locus_tag LOCUS_14360 79332 79628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 79941 80942 gene locus_tag LOCUS_14370 79941 80942 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_14370 81804 81133 gene locus_tag LOCUS_14380 81804 81133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 83275 81806 gene locus_tag LOCUS_14390 gene trpE 83275 81806 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_14390 84371 83280 gene locus_tag LOCUS_14400 gene serC 84371 83280 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083434814.1 protein_id gnl|my_center|LOCUS_14400 84460 85077 gene locus_tag LOCUS_14410 gene nuoE 84460 85077 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967798.1 protein_id gnl|my_center|LOCUS_14410 85203 85418 gene locus_tag LOCUS_14420 85203 85418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence012 548 656 gene locus_tag LOCUS_r00010 548 656 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2100 727 gene locus_tag LOCUS_14430 2100 727 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 protein_id gnl|my_center|LOCUS_14430 2256 4070 gene locus_tag LOCUS_14440 2256 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 4067 6376 gene locus_tag LOCUS_14450 4067 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 6524 7219 gene locus_tag LOCUS_14460 6524 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 7309 8127 gene locus_tag LOCUS_14470 7309 8127 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948031.1 protein_id gnl|my_center|LOCUS_14470 8120 8530 gene locus_tag LOCUS_14480 8120 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162129903.1 protein_id gnl|my_center|LOCUS_14480 8956 8519 gene locus_tag LOCUS_14490 8956 8519 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413460.1 protein_id gnl|my_center|LOCUS_14490 9197 8949 gene locus_tag LOCUS_14500 9197 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 9890 9252 gene locus_tag LOCUS_14510 9890 9252 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_14510 10076 10894 gene locus_tag LOCUS_14520 10076 10894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 11080 11982 gene locus_tag LOCUS_14530 11080 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 12026 14683 gene locus_tag LOCUS_14540 gene leuS 12026 14683 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989774.1 protein_id gnl|my_center|LOCUS_14540 14688 16430 gene locus_tag LOCUS_14550 14688 16430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 18531 16432 gene locus_tag LOCUS_14560 18531 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 19271 18531 gene locus_tag LOCUS_14570 19271 18531 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_14570 20166 19402 gene locus_tag LOCUS_14580 20166 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 21173 20163 gene locus_tag LOCUS_14590 21173 20163 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931013.1 protein_id gnl|my_center|LOCUS_14590 21326 22663 gene locus_tag LOCUS_14600 21326 22663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 24098 22656 gene locus_tag LOCUS_14610 24098 22656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 24823 24140 gene locus_tag LOCUS_14620 24823 24140 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283980.1 protein_id gnl|my_center|LOCUS_14620 24914 25168 gene locus_tag LOCUS_14630 24914 25168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 25194 25394 gene locus_tag LOCUS_14640 25194 25394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 25422 26516 gene locus_tag LOCUS_14650 25422 26516 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640182.1 protein_id gnl|my_center|LOCUS_14650 26925 26713 gene locus_tag LOCUS_14660 26925 26713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 27491 26967 gene locus_tag LOCUS_14670 27491 26967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 28291 27491 gene locus_tag LOCUS_14680 28291 27491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 28868 28350 gene locus_tag LOCUS_14690 28868 28350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 29027 30973 gene locus_tag LOCUS_14700 gene ftsH 29027 30973 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391653.1 protein_id gnl|my_center|LOCUS_14700 31915 30977 gene locus_tag LOCUS_14710 31915 30977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 33190 31955 gene locus_tag LOCUS_14720 33190 31955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 36725 33192 gene locus_tag LOCUS_14730 36725 33192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 39403 36866 gene locus_tag LOCUS_14740 39403 36866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_14740 40195 39443 gene locus_tag LOCUS_14750 40195 39443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 40764 40192 gene locus_tag LOCUS_14760 40764 40192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 40828 41628 gene locus_tag LOCUS_14770 40828 41628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 42358 41579 gene locus_tag LOCUS_14780 42358 41579 CDS product AglZ/HisF2 family acetamidino modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113421.1 protein_id gnl|my_center|LOCUS_14780 42965 42330 gene locus_tag LOCUS_14790 gene hisH 42965 42330 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113422.1 protein_id gnl|my_center|LOCUS_14790 43109 43495 gene locus_tag LOCUS_14800 43109 43495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 43518 44735 gene locus_tag LOCUS_14810 43518 44735 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226524.1 protein_id gnl|my_center|LOCUS_14810 45190 44828 gene locus_tag LOCUS_14820 45190 44828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 47613 45406 gene locus_tag LOCUS_14830 47613 45406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 47793 48398 gene locus_tag LOCUS_14840 47793 48398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 48538 50523 gene locus_tag LOCUS_14850 48538 50523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 50663 52225 gene locus_tag LOCUS_14860 50663 52225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 52506 52718 gene locus_tag LOCUS_14870 52506 52718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 52800 53228 gene locus_tag LOCUS_14880 52800 53228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 53294 53725 gene locus_tag LOCUS_14890 53294 53725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 55124 53919 gene locus_tag LOCUS_14900 55124 53919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 55215 55604 gene locus_tag LOCUS_14910 55215 55604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 57816 55573 gene locus_tag LOCUS_14920 57816 55573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 59489 57813 gene locus_tag LOCUS_14930 59489 57813 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_14930 59633 61123 gene locus_tag LOCUS_14940 59633 61123 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193073.1 protein_id gnl|my_center|LOCUS_14940 61144 61623 gene locus_tag LOCUS_14950 61144 61623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 61691 62116 gene locus_tag LOCUS_14960 61691 62116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 62138 63220 gene locus_tag LOCUS_14970 62138 63220 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203529.1 protein_id gnl|my_center|LOCUS_14970 63292 64698 gene locus_tag LOCUS_14980 63292 64698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 65210 64770 gene locus_tag LOCUS_14990 65210 64770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925185.1 protein_id gnl|my_center|LOCUS_14990 66267 65284 gene locus_tag LOCUS_15000 66267 65284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 66289 66498 gene locus_tag LOCUS_15010 66289 66498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 66507 67196 gene locus_tag LOCUS_15020 66507 67196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 67200 68117 gene locus_tag LOCUS_15030 67200 68117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 68165 69340 gene locus_tag LOCUS_15040 68165 69340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120538.1 protein_id gnl|my_center|LOCUS_15040 69754 69389 gene locus_tag LOCUS_15050 69754 69389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 70510 70355 gene locus_tag LOCUS_15060 70510 70355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 71377 70514 gene locus_tag LOCUS_15070 71377 70514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 72352 71384 gene locus_tag LOCUS_15080 72352 71384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 75616 72353 gene locus_tag LOCUS_15090 75616 72353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 75951 75721 gene locus_tag LOCUS_15100 75951 75721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 76337 75948 gene locus_tag LOCUS_15110 76337 75948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence013 1281 739 gene locus_tag LOCUS_15120 1281 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 2888 1350 gene locus_tag LOCUS_15130 2888 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 3676 2915 gene locus_tag LOCUS_15140 3676 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 4424 3690 gene locus_tag LOCUS_15150 4424 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 8722 4481 gene locus_tag LOCUS_15160 8722 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 10595 8724 gene locus_tag LOCUS_15170 10595 8724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 14951 10650 gene locus_tag LOCUS_15180 14951 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 16894 14960 gene locus_tag LOCUS_15190 16894 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 18510 16897 gene locus_tag LOCUS_15200 18510 16897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 18640 19329 gene locus_tag LOCUS_15210 18640 19329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 19329 19616 gene locus_tag LOCUS_15220 19329 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 19616 19840 gene locus_tag LOCUS_15230 19616 19840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 20847 19948 gene locus_tag LOCUS_15240 20847 19948 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056998.1 protein_id gnl|my_center|LOCUS_15240 21125 20844 gene locus_tag LOCUS_15250 gene groES 21125 20844 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533567.1 protein_id gnl|my_center|LOCUS_15250 22918 21146 gene locus_tag LOCUS_15260 22918 21146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 24652 22934 gene locus_tag LOCUS_15270 24652 22934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 26366 24699 gene locus_tag LOCUS_15280 26366 24699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 27073 26366 gene locus_tag LOCUS_15290 27073 26366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 27297 27070 gene locus_tag LOCUS_15300 27297 27070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 27887 27294 gene locus_tag LOCUS_15310 27887 27294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 29809 27884 gene locus_tag LOCUS_15320 29809 27884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 30267 29809 gene locus_tag LOCUS_15330 30267 29809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 30650 30264 gene locus_tag LOCUS_15340 30650 30264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 31168 30647 gene locus_tag LOCUS_15350 31168 30647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 31760 31257 gene locus_tag LOCUS_15360 31760 31257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 32056 31757 gene locus_tag LOCUS_15370 32056 31757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 33539 32106 gene locus_tag LOCUS_15380 33539 32106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 34351 33536 gene locus_tag LOCUS_15390 34351 33536 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099498.1 protein_id gnl|my_center|LOCUS_15390 35061 34348 gene locus_tag LOCUS_15400 35061 34348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 35611 35063 gene locus_tag LOCUS_15410 35611 35063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 35859 35608 gene locus_tag LOCUS_15420 35859 35608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 36440 35856 gene locus_tag LOCUS_15430 36440 35856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 36946 36437 gene locus_tag LOCUS_15440 36946 36437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 37206 36943 gene locus_tag LOCUS_15450 37206 36943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 37550 37203 gene locus_tag LOCUS_15460 37550 37203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 37956 37543 gene locus_tag LOCUS_15470 37956 37543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 38658 37993 gene locus_tag LOCUS_15480 38658 37993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 39080 38655 gene locus_tag LOCUS_15490 39080 38655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 39790 39077 gene locus_tag LOCUS_15500 39790 39077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 40386 39808 gene locus_tag LOCUS_15510 40386 39808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 40817 40383 gene locus_tag LOCUS_15520 40817 40383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 41071 40814 gene locus_tag LOCUS_15530 41071 40814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 41367 41071 gene locus_tag LOCUS_15540 41367 41071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 41403 41723 gene locus_tag LOCUS_15550 41403 41723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 41734 42474 gene locus_tag LOCUS_15560 41734 42474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 42477 43007 gene locus_tag LOCUS_15570 42477 43007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 43132 43443 gene locus_tag LOCUS_15580 43132 43443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 43565 43843 gene locus_tag LOCUS_15590 43565 43843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 43840 45048 gene locus_tag LOCUS_15600 43840 45048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 45045 46205 gene locus_tag LOCUS_15610 45045 46205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 46195 46602 gene locus_tag LOCUS_15620 46195 46602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 46599 46793 gene locus_tag LOCUS_15630 46599 46793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 46790 49240 gene locus_tag LOCUS_15640 46790 49240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 49244 49558 gene locus_tag LOCUS_15650 49244 49558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 49597 49926 gene locus_tag LOCUS_15660 49597 49926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 49926 51134 gene locus_tag LOCUS_15670 49926 51134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 51150 51422 gene locus_tag LOCUS_15680 51150 51422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 51422 51784 gene locus_tag LOCUS_15690 51422 51784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 51787 52284 gene locus_tag LOCUS_15700 51787 52284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 52284 52556 gene locus_tag LOCUS_15710 52284 52556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 52774 53055 gene locus_tag LOCUS_15720 gene hupN 52774 53055 CDS product HU-related DNA-binding protein HupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399274.1 protein_id gnl|my_center|LOCUS_15720 53067 54164 gene locus_tag LOCUS_15730 53067 54164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 54345 54707 gene locus_tag LOCUS_15740 54345 54707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 54709 55023 gene locus_tag LOCUS_15750 54709 55023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 55025 55453 gene locus_tag LOCUS_15760 55025 55453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 55453 55686 gene locus_tag LOCUS_15770 55453 55686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 55683 56150 gene locus_tag LOCUS_15780 55683 56150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 56147 56611 gene locus_tag LOCUS_15790 56147 56611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 56608 57069 gene locus_tag LOCUS_15800 56608 57069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 57066 57428 gene locus_tag LOCUS_15810 57066 57428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 57622 58806 gene locus_tag LOCUS_15820 57622 58806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 58887 59105 gene locus_tag LOCUS_15830 58887 59105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 60217 59138 gene locus_tag LOCUS_15840 60217 59138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 60618 60214 gene locus_tag LOCUS_15850 60618 60214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 61059 60622 gene locus_tag LOCUS_15860 61059 60622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 61328 61056 gene locus_tag LOCUS_15870 61328 61056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 61696 61325 gene locus_tag LOCUS_15880 61696 61325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 61914 61693 gene locus_tag LOCUS_15890 61914 61693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 62279 61911 gene locus_tag LOCUS_15900 62279 61911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 62547 62269 gene locus_tag LOCUS_15910 62547 62269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 62924 62544 gene locus_tag LOCUS_15920 62924 62544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 63955 62924 gene locus_tag LOCUS_15930 63955 62924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 64799 63993 gene locus_tag LOCUS_15940 64799 63993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 65458 64799 gene locus_tag LOCUS_15950 65458 64799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 66211 65462 gene locus_tag LOCUS_15960 66211 65462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 66735 66187 gene locus_tag LOCUS_15970 66735 66187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 68252 66735 gene locus_tag LOCUS_15980 68252 66735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 69651 68263 gene locus_tag LOCUS_15990 69651 68263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 69745 69670 gene locus_tag LOCUS_t00160 69745 69670 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 71469 69790 gene locus_tag LOCUS_16000 71469 69790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 71556 72737 gene locus_tag LOCUS_16010 71556 72737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 73519 72734 gene locus_tag LOCUS_16020 73519 72734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 75915 73516 gene locus_tag LOCUS_16030 75915 73516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence014 2379 979 gene locus_tag LOCUS_16040 2379 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2470 2706 gene locus_tag LOCUS_16050 2470 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 4580 2730 gene locus_tag LOCUS_16060 4580 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 4643 4718 gene locus_tag LOCUS_t00170 4643 4718 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5735 5091 gene locus_tag LOCUS_16070 5735 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 6059 5736 gene locus_tag LOCUS_16080 6059 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 6881 6060 gene locus_tag LOCUS_16090 6881 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 8877 7120 gene locus_tag LOCUS_16100 8877 7120 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389868.1 protein_id gnl|my_center|LOCUS_16100 9198 8992 gene locus_tag LOCUS_16110 9198 8992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 10067 9183 gene locus_tag LOCUS_16120 10067 9183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 11847 10054 gene locus_tag LOCUS_16130 gene cysC 11847 10054 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224712.1 protein_id gnl|my_center|LOCUS_16130 12728 11847 gene locus_tag LOCUS_16140 gene cysD 12728 11847 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_16140 12812 13741 gene locus_tag LOCUS_16150 12812 13741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 14144 14059 gene locus_tag LOCUS_t00180 14144 14059 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14246 15271 gene locus_tag LOCUS_16160 gene fbaA 14246 15271 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907650.1 protein_id gnl|my_center|LOCUS_16160 15279 15467 gene locus_tag LOCUS_16170 15279 15467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 17618 15546 gene locus_tag LOCUS_16180 gene glyS 17618 15546 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141645.1 protein_id gnl|my_center|LOCUS_16180 20446 17651 gene locus_tag LOCUS_16190 20446 17651 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_16190 20507 20872 gene locus_tag LOCUS_16200 20507 20872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480251.1 protein_id gnl|my_center|LOCUS_16200 21648 20869 gene locus_tag LOCUS_16210 gene cdsA 21648 20869 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173216.1 protein_id gnl|my_center|LOCUS_16210 22229 21675 gene locus_tag LOCUS_16220 22229 21675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 22866 22231 gene locus_tag LOCUS_16230 gene sigH 22866 22231 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_16230 23522 23004 gene locus_tag LOCUS_16240 23522 23004 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681338.1 protein_id gnl|my_center|LOCUS_16240 24095 23547 gene locus_tag LOCUS_16250 24095 23547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 25484 24237 gene locus_tag LOCUS_16260 25484 24237 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000859148.1 protein_id gnl|my_center|LOCUS_16260 25549 27123 gene locus_tag LOCUS_16270 25549 27123 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479713.1 protein_id gnl|my_center|LOCUS_16270 28581 27130 gene locus_tag LOCUS_16280 28581 27130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 30973 28733 gene locus_tag LOCUS_16290 30973 28733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976148.1 protein_id gnl|my_center|LOCUS_16290 32665 30983 gene locus_tag LOCUS_16300 gene sulP 32665 30983 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926914.1 protein_id gnl|my_center|LOCUS_16300 32820 33659 gene locus_tag LOCUS_16310 32820 33659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 34658 33762 gene locus_tag LOCUS_16320 34658 33762 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087473.1 protein_id gnl|my_center|LOCUS_16320 35553 34675 gene locus_tag LOCUS_16330 35553 34675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 37431 35689 gene locus_tag LOCUS_16340 37431 35689 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_16340 37975 37445 gene locus_tag LOCUS_16350 37975 37445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 38775 38005 gene locus_tag LOCUS_16360 38775 38005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 39512 38772 gene locus_tag LOCUS_16370 39512 38772 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_16370 40293 39514 gene locus_tag LOCUS_16380 40293 39514 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_16380 40335 40661 gene locus_tag LOCUS_16390 40335 40661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 40779 42821 gene locus_tag LOCUS_16400 gene gyrB 40779 42821 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_16400 42832 43281 gene locus_tag LOCUS_16410 42832 43281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 44723 43347 gene locus_tag LOCUS_16420 44723 43347 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258538.1 protein_id gnl|my_center|LOCUS_16420 45732 44770 gene locus_tag LOCUS_16430 45732 44770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 46414 45713 gene locus_tag LOCUS_16440 46414 45713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 47079 46411 gene locus_tag LOCUS_16450 47079 46411 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_16450 47195 48844 gene locus_tag LOCUS_16460 gene recN 47195 48844 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660689.1 protein_id gnl|my_center|LOCUS_16460 50791 48860 gene locus_tag LOCUS_16470 gene mutL 50791 48860 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037442.1 protein_id gnl|my_center|LOCUS_16470 51147 51524 gene locus_tag LOCUS_16480 gene rpsM 51147 51524 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_16480 51537 51929 gene locus_tag LOCUS_16490 gene rpsK 51537 51929 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055956.1 protein_id gnl|my_center|LOCUS_16490 51939 52937 gene locus_tag LOCUS_16500 51939 52937 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_16500 52964 53410 gene locus_tag LOCUS_16510 gene rplQ 52964 53410 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331497.1 protein_id gnl|my_center|LOCUS_16510 53407 54198 gene locus_tag LOCUS_16520 gene truA 53407 54198 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974242.1 protein_id gnl|my_center|LOCUS_16520 54234 54668 gene locus_tag LOCUS_16530 gene rplM 54234 54668 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902658.1 protein_id gnl|my_center|LOCUS_16530 54676 55068 gene locus_tag LOCUS_16540 gene rpsI 54676 55068 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975055.1 protein_id gnl|my_center|LOCUS_16540 55454 55101 gene locus_tag LOCUS_16550 55454 55101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 55479 56171 gene locus_tag LOCUS_16560 55479 56171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 56983 56156 gene locus_tag LOCUS_16570 56983 56156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 58204 57071 gene locus_tag LOCUS_16580 58204 57071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 58384 59412 gene locus_tag LOCUS_16590 58384 59412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 59518 60633 gene locus_tag LOCUS_16600 59518 60633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 60675 60872 gene locus_tag LOCUS_16610 60675 60872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 61252 60869 gene locus_tag LOCUS_16620 61252 60869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 61535 61245 gene locus_tag LOCUS_16630 61535 61245 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759700.1 protein_id gnl|my_center|LOCUS_16630 62790 61540 gene locus_tag LOCUS_16640 62790 61540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121480.1 protein_id gnl|my_center|LOCUS_16640 62789 63340 gene locus_tag LOCUS_16650 62789 63340 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241839.1 protein_id gnl|my_center|LOCUS_16650 64060 63425 gene locus_tag LOCUS_16660 64060 63425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 64420 64157 gene locus_tag LOCUS_16670 64420 64157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 64419 65213 gene locus_tag LOCUS_16680 64419 65213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 65335 65883 gene locus_tag LOCUS_16690 65335 65883 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039237.1 protein_id gnl|my_center|LOCUS_16690 67008 65887 gene locus_tag LOCUS_16700 67008 65887 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168257883.1 protein_id gnl|my_center|LOCUS_16700 68189 67110 gene locus_tag LOCUS_16710 gene gcvT 68189 67110 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228001.1 protein_id gnl|my_center|LOCUS_16710 68231 70057 gene locus_tag LOCUS_16720 68231 70057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 70639 70866 gene locus_tag LOCUS_16730 70639 70866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 72149 73021 gene locus_tag LOCUS_16740 72149 73021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 73023 74690 gene locus_tag LOCUS_16750 73023 74690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence015 77 1813 gene locus_tag LOCUS_16760 77 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1813 3237 gene locus_tag LOCUS_16770 1813 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 3240 4574 gene locus_tag LOCUS_16780 3240 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 5794 4613 gene locus_tag LOCUS_16790 5794 4613 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_16790 5982 6506 gene locus_tag LOCUS_16800 5982 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 6609 7124 gene locus_tag LOCUS_16810 6609 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 7094 7303 gene locus_tag LOCUS_16820 gene yidD 7094 7303 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703903.1 protein_id gnl|my_center|LOCUS_16820 7320 8639 gene locus_tag LOCUS_16830 7320 8639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 8670 9470 gene locus_tag LOCUS_16840 8670 9470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9493 12054 gene locus_tag LOCUS_16850 gene mutS 9493 12054 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_16850 12051 12593 gene locus_tag LOCUS_16860 12051 12593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 12590 13426 gene locus_tag LOCUS_16870 12590 13426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 13423 14181 gene locus_tag LOCUS_16880 gene lptB 13423 14181 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_16880 14181 15293 gene locus_tag LOCUS_16890 14181 15293 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_16890 15302 16846 gene locus_tag LOCUS_16900 15302 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 16846 17265 gene locus_tag LOCUS_16910 16846 17265 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142305.1 protein_id gnl|my_center|LOCUS_16910 17413 18516 gene locus_tag LOCUS_16920 gene nadA 17413 18516 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858544.1 protein_id gnl|my_center|LOCUS_16920 18668 18910 gene locus_tag LOCUS_16930 18668 18910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 18965 19435 gene locus_tag LOCUS_16940 18965 19435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 19485 20972 gene locus_tag LOCUS_16950 19485 20972 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_16950 22612 21785 gene locus_tag LOCUS_16960 22612 21785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 22856 23068 gene locus_tag LOCUS_16970 22856 23068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 23128 24630 gene locus_tag LOCUS_16980 gene cysS 23128 24630 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_237701980.1 protein_id gnl|my_center|LOCUS_16980 24838 25782 gene locus_tag LOCUS_16990 24838 25782 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_16990 25779 26567 gene locus_tag LOCUS_17000 25779 26567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 26572 27957 gene locus_tag LOCUS_17010 26572 27957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 28995 28216 gene locus_tag LOCUS_17020 28995 28216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 29181 29867 gene locus_tag LOCUS_17030 29181 29867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 34467 29872 gene locus_tag LOCUS_17040 34467 29872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 36869 34536 gene locus_tag LOCUS_17050 36869 34536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 37591 37043 gene locus_tag LOCUS_17060 37591 37043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 38338 37595 gene locus_tag LOCUS_17070 38338 37595 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722856.1 protein_id gnl|my_center|LOCUS_17070 38422 38691 gene locus_tag LOCUS_17080 38422 38691 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257713.1 protein_id gnl|my_center|LOCUS_17080 38726 39634 gene locus_tag LOCUS_17090 38726 39634 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_17090 39709 40356 gene locus_tag LOCUS_17100 39709 40356 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364322.1 protein_id gnl|my_center|LOCUS_17100 41596 40361 gene locus_tag LOCUS_17110 41596 40361 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000211475.1 protein_id gnl|my_center|LOCUS_17110 42761 41604 gene locus_tag LOCUS_17120 gene ugpC 42761 41604 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583259.1 protein_id gnl|my_center|LOCUS_17120 43182 44015 gene locus_tag LOCUS_17130 43182 44015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 44167 45129 gene locus_tag LOCUS_17140 44167 45129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 45138 45935 gene locus_tag LOCUS_17150 45138 45935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 46032 48098 gene locus_tag LOCUS_17160 gene fusA 46032 48098 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_17160 49128 48148 gene locus_tag LOCUS_17170 49128 48148 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258703.1 protein_id gnl|my_center|LOCUS_17170 51805 49214 gene locus_tag LOCUS_17180 51805 49214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 52654 51809 gene locus_tag LOCUS_17190 52654 51809 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_17190 53583 52651 gene locus_tag LOCUS_17200 53583 52651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 54661 53669 gene locus_tag LOCUS_17210 54661 53669 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004349090.1 protein_id gnl|my_center|LOCUS_17210 54815 56650 gene locus_tag LOCUS_17220 54815 56650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 56655 58097 gene locus_tag LOCUS_17230 56655 58097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 58094 59065 gene locus_tag LOCUS_17240 58094 59065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 59423 59067 gene locus_tag LOCUS_17250 59423 59067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 60673 59546 gene locus_tag LOCUS_17260 60673 59546 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259192.1 protein_id gnl|my_center|LOCUS_17260 62287 60728 gene locus_tag LOCUS_17270 62287 60728 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027258.1 protein_id gnl|my_center|LOCUS_17270 63598 62393 gene locus_tag LOCUS_17280 63598 62393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 66235 63920 gene locus_tag LOCUS_17290 66235 63920 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763369.1 protein_id gnl|my_center|LOCUS_17290 67508 66282 gene locus_tag LOCUS_17300 67508 66282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 70146 67573 gene locus_tag LOCUS_17310 70146 67573 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_17310 70246 70902 gene locus_tag LOCUS_17320 70246 70902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 71363 71854 gene locus_tag LOCUS_17330 71363 71854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 71912 72121 gene locus_tag LOCUS_17340 71912 72121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence016 2377 845 gene locus_tag LOCUS_17350 2377 845 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228066.1 protein_id gnl|my_center|LOCUS_17350 3978 2374 gene locus_tag LOCUS_17360 3978 2374 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_17360 4445 3996 gene locus_tag LOCUS_17370 4445 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 4535 5218 gene locus_tag LOCUS_17380 4535 5218 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086177.1 protein_id gnl|my_center|LOCUS_17380 5218 6021 gene locus_tag LOCUS_17390 5218 6021 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259018.1 protein_id gnl|my_center|LOCUS_17390 6443 6033 gene locus_tag LOCUS_17400 6443 6033 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140634.1 protein_id gnl|my_center|LOCUS_17400 6685 6440 gene locus_tag LOCUS_17410 6685 6440 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140635.1 protein_id gnl|my_center|LOCUS_17410 9234 6709 gene locus_tag LOCUS_17420 9234 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 9343 9657 gene locus_tag LOCUS_17430 9343 9657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 12105 10237 gene locus_tag LOCUS_17440 12105 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 12886 14688 gene locus_tag LOCUS_17450 12886 14688 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977687.1 protein_id gnl|my_center|LOCUS_17450 14696 15274 gene locus_tag LOCUS_17460 14696 15274 CDS product 4-amino-4-deoxychorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296643.1 protein_id gnl|my_center|LOCUS_17460 16036 15275 gene locus_tag LOCUS_17470 16036 15275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 16557 16039 gene locus_tag LOCUS_17480 16557 16039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 17411 16581 gene locus_tag LOCUS_17490 gene kdsA 17411 16581 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001056080.1 protein_id gnl|my_center|LOCUS_17490 19276 17408 gene locus_tag LOCUS_17500 19276 17408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 19239 19406 gene locus_tag LOCUS_17510 19239 19406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 19455 20456 gene locus_tag LOCUS_17520 19455 20456 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583041.1 protein_id gnl|my_center|LOCUS_17520 20466 21890 gene locus_tag LOCUS_17530 20466 21890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 22501 24042 gene locus_tag LOCUS_17540 22501 24042 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_17540 24080 24673 gene locus_tag LOCUS_17550 24080 24673 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355429.1 protein_id gnl|my_center|LOCUS_17550 24733 25662 gene locus_tag LOCUS_17560 24733 25662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 27135 25741 gene locus_tag LOCUS_17570 27135 25741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442181.1 protein_id gnl|my_center|LOCUS_17570 27233 29689 gene locus_tag LOCUS_17580 27233 29689 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_17580 29686 30597 gene locus_tag LOCUS_17590 29686 30597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 30608 32314 gene locus_tag LOCUS_17600 30608 32314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 32316 33194 gene locus_tag LOCUS_17610 gene xerD 32316 33194 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014350.1 protein_id gnl|my_center|LOCUS_17610 33253 33561 gene locus_tag LOCUS_17620 33253 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 33558 34826 gene locus_tag LOCUS_17630 33558 34826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 35211 34969 gene locus_tag LOCUS_17640 35211 34969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 35814 35443 gene locus_tag LOCUS_17650 35814 35443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 36139 37194 gene locus_tag LOCUS_17660 36139 37194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 37191 38468 gene locus_tag LOCUS_17670 37191 38468 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807098.1 protein_id gnl|my_center|LOCUS_17670 38990 39703 gene locus_tag LOCUS_17680 38990 39703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 39704 40219 gene locus_tag LOCUS_17690 gene lspA 39704 40219 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140076.1 protein_id gnl|my_center|LOCUS_17690 41226 40216 gene locus_tag LOCUS_17700 41226 40216 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087456.1 protein_id gnl|my_center|LOCUS_17700 42107 41256 gene locus_tag LOCUS_17710 42107 41256 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931393.1 protein_id gnl|my_center|LOCUS_17710 43019 42120 gene locus_tag LOCUS_17720 43019 42120 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_17720 43085 43750 gene locus_tag LOCUS_17730 gene hxpB 43085 43750 CDS product hexitol phosphatase HxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705977.1 protein_id gnl|my_center|LOCUS_17730 44375 43893 gene locus_tag LOCUS_17740 44375 43893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 47390 45777 gene locus_tag LOCUS_17750 47390 45777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 48674 47448 gene locus_tag LOCUS_17760 48674 47448 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_17760 49519 48680 gene locus_tag LOCUS_17770 49519 48680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 51168 49549 gene locus_tag LOCUS_17780 51168 49549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 51251 52249 gene locus_tag LOCUS_17790 gene pheS 51251 52249 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037597.1 protein_id gnl|my_center|LOCUS_17790 52249 52608 gene locus_tag LOCUS_17800 52249 52608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 52672 53358 gene locus_tag LOCUS_17810 gene msrA 52672 53358 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_17810 53365 55200 gene locus_tag LOCUS_17820 gene selB 53365 55200 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_17820 55244 56641 gene locus_tag LOCUS_17830 55244 56641 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_17830 57082 56645 gene locus_tag LOCUS_17840 57082 56645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 57575 57123 gene locus_tag LOCUS_17850 57575 57123 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020639190.1 protein_id gnl|my_center|LOCUS_17850 58191 57583 gene locus_tag LOCUS_17860 58191 57583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 59042 58188 gene locus_tag LOCUS_17870 59042 58188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 59805 59050 gene locus_tag LOCUS_17880 59805 59050 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_17880 60797 59871 gene locus_tag LOCUS_17890 gene selD 60797 59871 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_17890 60843 62081 gene locus_tag LOCUS_17900 60843 62081 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_17900 62086 63363 gene locus_tag LOCUS_17910 62086 63363 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_17910 64775 63441 gene locus_tag LOCUS_17920 gene megL 64775 63441 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_17920 64864 65346 gene locus_tag LOCUS_17930 64864 65346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 65557 66498 gene locus_tag LOCUS_17940 65557 66498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 66561 66734 gene locus_tag LOCUS_17950 66561 66734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 66731 67381 gene locus_tag LOCUS_17960 66731 67381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 67428 68255 gene locus_tag LOCUS_17970 67428 68255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 68265 68792 gene locus_tag LOCUS_17980 68265 68792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 68966 69838 gene locus_tag LOCUS_17990 68966 69838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 69835 70509 gene locus_tag LOCUS_18000 69835 70509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 71175 70510 gene locus_tag LOCUS_18010 71175 70510 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_18010 71228 71596 gene locus_tag LOCUS_18020 71228 71596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 71816 71565 gene locus_tag LOCUS_18030 71816 71565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence017 2845 347 gene locus_tag LOCUS_18040 2845 347 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_18040 3671 3237 gene locus_tag LOCUS_18050 3671 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 4900 3752 gene locus_tag LOCUS_18060 4900 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 5595 4909 gene locus_tag LOCUS_18070 5595 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 5959 5612 gene locus_tag LOCUS_18080 5959 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 6787 6125 gene locus_tag LOCUS_18090 6787 6125 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028048.1 protein_id gnl|my_center|LOCUS_18090 6786 7574 gene locus_tag LOCUS_18100 6786 7574 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583963.1 protein_id gnl|my_center|LOCUS_18100 7578 8660 gene locus_tag LOCUS_18110 7578 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 8657 9319 gene locus_tag LOCUS_18120 8657 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 9316 10092 gene locus_tag LOCUS_18130 9316 10092 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_18130 10174 10842 gene locus_tag LOCUS_18140 10174 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 10881 12008 gene locus_tag LOCUS_18150 10881 12008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 12005 12775 gene locus_tag LOCUS_18160 12005 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 12839 14113 gene locus_tag LOCUS_18170 12839 14113 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403883.1 protein_id gnl|my_center|LOCUS_18170 14116 15288 gene locus_tag LOCUS_18180 14116 15288 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838600.1 protein_id gnl|my_center|LOCUS_18180 16620 15538 gene locus_tag LOCUS_18190 16620 15538 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088971.1 protein_id gnl|my_center|LOCUS_18190 17010 16666 gene locus_tag LOCUS_18200 gene queF 17010 16666 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_18200 18958 17015 gene locus_tag LOCUS_18210 gene infB 18958 17015 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231906.1 protein_id gnl|my_center|LOCUS_18210 19125 18943 gene locus_tag LOCUS_18220 19125 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 20302 19223 gene locus_tag LOCUS_18230 gene nusA 20302 19223 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_18230 21018 20443 gene locus_tag LOCUS_18240 21018 20443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 22777 21023 gene locus_tag LOCUS_18250 22777 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 22941 23016 gene locus_tag LOCUS_t00190 22941 23016 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 23070 23921 gene locus_tag LOCUS_18260 23070 23921 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_18260 23939 24535 gene locus_tag LOCUS_18270 23939 24535 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259201.1 protein_id gnl|my_center|LOCUS_18270 24532 25368 gene locus_tag LOCUS_18280 24532 25368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18280 25583 27415 gene locus_tag LOCUS_18290 25583 27415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 27482 29779 gene locus_tag LOCUS_18300 27482 29779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 29814 30575 gene locus_tag LOCUS_18310 29814 30575 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_18310 30572 31111 gene locus_tag LOCUS_18320 30572 31111 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_18320 31117 31833 gene locus_tag LOCUS_18330 31117 31833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 31830 32432 gene locus_tag LOCUS_18340 31830 32432 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887249.1 protein_id gnl|my_center|LOCUS_18340 32429 34891 gene locus_tag LOCUS_18350 32429 34891 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_18350 35469 36101 gene locus_tag LOCUS_18360 35469 36101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 37098 36109 gene locus_tag LOCUS_18370 gene ilvC 37098 36109 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125540.1 protein_id gnl|my_center|LOCUS_18370 37146 37721 gene locus_tag LOCUS_18380 37146 37721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 37718 38989 gene locus_tag LOCUS_18390 37718 38989 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459547.1 protein_id gnl|my_center|LOCUS_18390 40154 38946 gene locus_tag LOCUS_18400 40154 38946 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_18400 41372 42733 gene locus_tag LOCUS_18410 41372 42733 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_18410 43864 42746 gene locus_tag LOCUS_18420 43864 42746 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_18420 45315 43948 gene locus_tag LOCUS_18430 45315 43948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 45375 46442 gene locus_tag LOCUS_18440 45375 46442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 46439 46987 gene locus_tag LOCUS_18450 46439 46987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 46984 47940 gene locus_tag LOCUS_18460 gene murB 46984 47940 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598636.1 protein_id gnl|my_center|LOCUS_18460 48013 48663 gene locus_tag LOCUS_18470 48013 48663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 49055 49345 gene locus_tag LOCUS_18480 49055 49345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 50262 49342 gene locus_tag LOCUS_18490 50262 49342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 51349 50249 gene locus_tag LOCUS_18500 gene tgt 51349 50249 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_18500 51572 51369 gene locus_tag LOCUS_18510 51572 51369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 52383 51592 gene locus_tag LOCUS_18520 gene whiG 52383 51592 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973389.1 protein_id gnl|my_center|LOCUS_18520 52675 52418 gene locus_tag LOCUS_18530 52675 52418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 53530 52766 gene locus_tag LOCUS_18540 53530 52766 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_18540 54135 53527 gene locus_tag LOCUS_18550 54135 53527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 55101 54172 gene locus_tag LOCUS_18560 55101 54172 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132585.1 protein_id gnl|my_center|LOCUS_18560 55877 55098 gene locus_tag LOCUS_18570 55877 55098 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902235.1 protein_id gnl|my_center|LOCUS_18570 56428 55907 gene locus_tag LOCUS_18580 56428 55907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 56991 56425 gene locus_tag LOCUS_18590 56991 56425 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393068.1 protein_id gnl|my_center|LOCUS_18590 58007 56988 gene locus_tag LOCUS_18600 gene mltG 58007 56988 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_18600 58401 57994 gene locus_tag LOCUS_18610 gene ruvX 58401 57994 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377205.1 protein_id gnl|my_center|LOCUS_18610 59153 58398 gene locus_tag LOCUS_18620 59153 58398 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_18620 59935 59177 gene locus_tag LOCUS_18630 59935 59177 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_18630 60771 59950 gene locus_tag LOCUS_18640 60771 59950 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891754.1 protein_id gnl|my_center|LOCUS_18640 61463 60765 gene locus_tag LOCUS_18650 gene pxpA 61463 60765 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215593.1 protein_id gnl|my_center|LOCUS_18650 62101 61460 gene locus_tag LOCUS_18660 gene pxpB 62101 61460 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869461.1 protein_id gnl|my_center|LOCUS_18660 62990 62118 gene locus_tag LOCUS_18670 62990 62118 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_18670 63039 64352 gene locus_tag LOCUS_18680 gene xylA 63039 64352 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118969.1 protein_id gnl|my_center|LOCUS_18680 64839 64363 gene locus_tag LOCUS_18690 64839 64363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 64896 66314 gene locus_tag LOCUS_18700 64896 66314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 66589 67617 gene locus_tag LOCUS_18710 66589 67617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 67652 69550 gene locus_tag LOCUS_18720 67652 69550 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530523.1 protein_id gnl|my_center|LOCUS_18720 69713 70960 gene locus_tag LOCUS_18730 69713 70960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 >Feature sequence018 704 261 gene locus_tag LOCUS_18740 704 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 753 2141 gene locus_tag LOCUS_18750 753 2141 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_18750 2483 2172 gene locus_tag LOCUS_18760 gene rpsJ 2483 2172 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_18760 3739 2540 gene locus_tag LOCUS_18770 gene tuf 3739 2540 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_18770 6084 3949 gene locus_tag LOCUS_18780 gene fusA 6084 3949 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_18780 6564 6094 gene locus_tag LOCUS_18790 gene rpsG 6564 6094 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_18790 6968 6564 gene locus_tag LOCUS_18800 gene rpsL 6968 6564 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583340.1 protein_id gnl|my_center|LOCUS_18800 8183 7209 gene locus_tag LOCUS_18810 8183 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 8290 10161 gene locus_tag LOCUS_18820 gene mnmG 8290 10161 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393995.1 protein_id gnl|my_center|LOCUS_18820 11374 10142 gene locus_tag LOCUS_18830 11374 10142 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114957.1 protein_id gnl|my_center|LOCUS_18830 11598 11371 gene locus_tag LOCUS_18840 11598 11371 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037555.1 protein_id gnl|my_center|LOCUS_18840 12686 11595 gene locus_tag LOCUS_18850 gene lhpB 12686 11595 CDS product D-hydroxyproline dehydrogenase subunit beta LhpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114955.1 protein_id gnl|my_center|LOCUS_18850 12892 13824 gene locus_tag LOCUS_18860 12892 13824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 13998 15236 gene locus_tag LOCUS_18870 gene kynU 13998 15236 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257142.1 protein_id gnl|my_center|LOCUS_18870 15352 16647 gene locus_tag LOCUS_18880 15352 16647 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_18880 16644 17285 gene locus_tag LOCUS_18890 16644 17285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 17491 17282 gene locus_tag LOCUS_18900 17491 17282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 17595 18206 gene locus_tag LOCUS_18910 17595 18206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 18232 20241 gene locus_tag LOCUS_18920 18232 20241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 20222 22669 gene locus_tag LOCUS_18930 20222 22669 CDS product ligase-associated DNA damage response DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_18930 23416 22748 gene locus_tag LOCUS_18940 23416 22748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 25161 23533 gene locus_tag LOCUS_18950 25161 23533 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922737.1 protein_id gnl|my_center|LOCUS_18950 26036 25188 gene locus_tag LOCUS_18960 26036 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 27093 26119 gene locus_tag LOCUS_18970 27093 26119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 27935 27261 gene locus_tag LOCUS_18980 27935 27261 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_18980 28026 30332 gene locus_tag LOCUS_18990 28026 30332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 30755 30390 gene locus_tag LOCUS_19000 30755 30390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 31459 30752 gene locus_tag LOCUS_19010 31459 30752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 32251 31571 gene locus_tag LOCUS_19020 32251 31571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 32452 33882 gene locus_tag LOCUS_19030 32452 33882 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928742.1 protein_id gnl|my_center|LOCUS_19030 35548 33872 gene locus_tag LOCUS_19040 35548 33872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 36922 35558 gene locus_tag LOCUS_19050 36922 35558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 38874 36919 gene locus_tag LOCUS_19060 38874 36919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 40305 38917 gene locus_tag LOCUS_19070 gene argH 40305 38917 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_19070 41374 40310 gene locus_tag LOCUS_19080 41374 40310 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_19080 41458 42021 gene locus_tag LOCUS_19090 41458 42021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 42135 43490 gene locus_tag LOCUS_19100 42135 43490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 43570 43941 gene locus_tag LOCUS_19110 43570 43941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 44065 48153 gene locus_tag LOCUS_19120 44065 48153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 48293 50008 gene locus_tag LOCUS_19130 48293 50008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 50414 50136 gene locus_tag LOCUS_19140 50414 50136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 50295 51824 gene locus_tag LOCUS_19150 50295 51824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 51988 56685 gene locus_tag LOCUS_19160 51988 56685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 57320 56766 gene locus_tag LOCUS_19170 57320 56766 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390527.1 protein_id gnl|my_center|LOCUS_19170 58854 57325 gene locus_tag LOCUS_19180 gene pckA 58854 57325 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_19180 58958 59263 gene locus_tag LOCUS_19190 58958 59263 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_19190 59278 59532 gene locus_tag LOCUS_19200 59278 59532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 61308 59599 gene locus_tag LOCUS_19210 61308 59599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 61301 62026 gene locus_tag LOCUS_19220 61301 62026 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401354.1 protein_id gnl|my_center|LOCUS_19220 62058 63275 gene locus_tag LOCUS_19230 62058 63275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 63272 64567 gene locus_tag LOCUS_19240 63272 64567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 64583 65581 gene locus_tag LOCUS_19250 64583 65581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 65578 65865 gene locus_tag LOCUS_19260 65578 65865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 66563 65868 gene locus_tag LOCUS_19270 66563 65868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 67222 66560 gene locus_tag LOCUS_19280 67222 66560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 68094 67303 gene locus_tag LOCUS_19290 68094 67303 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256749.1 protein_id gnl|my_center|LOCUS_19290 68183 69529 gene locus_tag LOCUS_19300 gene rimO 68183 69529 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392588.1 protein_id gnl|my_center|LOCUS_19300 69526 70662 gene locus_tag LOCUS_19310 69526 70662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence019 1562 192 gene locus_tag LOCUS_19320 1562 192 CDS product TROVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727486.1 protein_id gnl|my_center|LOCUS_19320 2072 2599 gene locus_tag LOCUS_19330 2072 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2596 3591 gene locus_tag LOCUS_19340 gene plsX 2596 3591 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_19340 3588 4577 gene locus_tag LOCUS_19350 3588 4577 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_19350 6084 4603 gene locus_tag LOCUS_19360 6084 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 6420 6205 gene locus_tag LOCUS_19370 6420 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 8023 6791 gene locus_tag LOCUS_19380 8023 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 11394 8194 gene locus_tag LOCUS_19390 11394 8194 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_19390 12658 11510 gene locus_tag LOCUS_19400 12658 11510 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_19400 13886 12663 gene locus_tag LOCUS_19410 13886 12663 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_19410 14091 14786 gene locus_tag LOCUS_19420 14091 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 15376 14783 gene locus_tag LOCUS_19430 15376 14783 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_19430 15908 15441 gene locus_tag LOCUS_19440 15908 15441 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_19440 16663 16019 gene locus_tag LOCUS_19450 16663 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 16876 16730 gene locus_tag LOCUS_19460 16876 16730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 16930 17967 gene locus_tag LOCUS_19470 16930 17967 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839930.1 protein_id gnl|my_center|LOCUS_19470 20672 17961 gene locus_tag LOCUS_19480 20672 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 20815 21687 gene locus_tag LOCUS_19490 20815 21687 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030863161.1 protein_id gnl|my_center|LOCUS_19490 21678 23099 gene locus_tag LOCUS_19500 21678 23099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 23459 23112 gene locus_tag LOCUS_19510 23459 23112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 25010 23514 gene locus_tag LOCUS_19520 25010 23514 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_19520 25744 25025 gene locus_tag LOCUS_19530 25744 25025 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416641.1 protein_id gnl|my_center|LOCUS_19530 26202 25741 gene locus_tag LOCUS_19540 26202 25741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 26477 26307 gene locus_tag LOCUS_19550 gene rpsU 26477 26307 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547397.1 protein_id gnl|my_center|LOCUS_19550 27087 26518 gene locus_tag LOCUS_19560 gene efp 27087 26518 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810907.1 protein_id gnl|my_center|LOCUS_19560 28281 27133 gene locus_tag LOCUS_19570 28281 27133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 28363 28725 gene locus_tag LOCUS_19580 28363 28725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 29888 28731 gene locus_tag LOCUS_19590 29888 28731 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_19590 30983 29937 gene locus_tag LOCUS_19600 30983 29937 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356585.1 protein_id gnl|my_center|LOCUS_19600 31051 31389 gene locus_tag LOCUS_19610 31051 31389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 31397 32620 gene locus_tag LOCUS_19620 31397 32620 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704482.1 protein_id gnl|my_center|LOCUS_19620 33345 32617 gene locus_tag LOCUS_19630 33345 32617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 33424 34092 gene locus_tag LOCUS_19640 33424 34092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 35211 34132 gene locus_tag LOCUS_19650 35211 34132 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976918.1 protein_id gnl|my_center|LOCUS_19650 35590 35213 gene locus_tag LOCUS_19660 gene mnhG 35590 35213 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404441.1 protein_id gnl|my_center|LOCUS_19660 35868 35587 gene locus_tag LOCUS_19670 35868 35587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 36344 35865 gene locus_tag LOCUS_19680 36344 35865 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942976.1 protein_id gnl|my_center|LOCUS_19680 37835 36345 gene locus_tag LOCUS_19690 37835 36345 CDS product Na+/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404437.1 protein_id gnl|my_center|LOCUS_19690 38206 37865 gene locus_tag LOCUS_19700 38206 37865 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942978.1 protein_id gnl|my_center|LOCUS_19700 38613 38206 gene locus_tag LOCUS_19710 38613 38206 CDS product Na+/H+ antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942979.1 protein_id gnl|my_center|LOCUS_19710 40886 38610 gene locus_tag LOCUS_19720 40886 38610 CDS product putative monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942980.1 protein_id gnl|my_center|LOCUS_19720 41047 42234 gene locus_tag LOCUS_19730 41047 42234 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_19730 42234 43724 gene locus_tag LOCUS_19740 42234 43724 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_19740 43734 44483 gene locus_tag LOCUS_19750 43734 44483 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_19750 44610 46442 gene locus_tag LOCUS_19760 44610 46442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 46475 46675 gene locus_tag LOCUS_19770 46475 46675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 46677 47087 gene locus_tag LOCUS_19780 46677 47087 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_19780 47093 47515 gene locus_tag LOCUS_19790 47093 47515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19790 47512 48195 gene locus_tag LOCUS_19800 47512 48195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19800 48195 49034 gene locus_tag LOCUS_19810 48195 49034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 49088 50275 gene locus_tag LOCUS_19820 49088 50275 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230945.1 protein_id gnl|my_center|LOCUS_19820 50926 50270 gene locus_tag LOCUS_19830 50926 50270 CDS product CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920264.1 protein_id gnl|my_center|LOCUS_19830 52063 50951 gene locus_tag LOCUS_19840 52063 50951 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966180.1 protein_id gnl|my_center|LOCUS_19840 52944 52060 gene locus_tag LOCUS_19850 52944 52060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 53028 53597 gene locus_tag LOCUS_19860 53028 53597 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_19860 53842 53594 gene locus_tag LOCUS_19870 53842 53594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 54211 53915 gene locus_tag LOCUS_19880 54211 53915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 56977 54239 gene locus_tag LOCUS_19890 gene alaS 56977 54239 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_19890 58394 57003 gene locus_tag LOCUS_19900 gene asnS 58394 57003 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_19900 58826 58548 gene locus_tag LOCUS_19910 58826 58548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 60122 58917 gene locus_tag LOCUS_19920 60122 58917 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_19920 60316 61176 gene locus_tag LOCUS_19930 60316 61176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 61173 61922 gene locus_tag LOCUS_19940 61173 61922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 61919 64213 gene locus_tag LOCUS_19950 61919 64213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 64266 64964 gene locus_tag LOCUS_19960 64266 64964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 65042 65458 gene locus_tag LOCUS_19970 gene ndk 65042 65458 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228487.1 protein_id gnl|my_center|LOCUS_19970 65463 66503 gene locus_tag LOCUS_19980 gene lpxD 65463 66503 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_19980 66500 67303 gene locus_tag LOCUS_19990 gene lpxC 66500 67303 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447207.1 protein_id gnl|my_center|LOCUS_19990 67311 68624 gene locus_tag LOCUS_20000 gene mtaB 67311 68624 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392125.1 protein_id gnl|my_center|LOCUS_20000 68617 68898 gene locus_tag LOCUS_20010 68617 68898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 69653 70093 gene locus_tag LOCUS_20020 69653 70093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence020 1526 423 gene locus_tag LOCUS_20030 gene flhB 1526 423 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_20030 2297 1527 gene locus_tag LOCUS_20040 gene fliR 2297 1527 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_20040 2563 2294 gene locus_tag LOCUS_20050 gene fliQ 2563 2294 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_20050 3305 2565 gene locus_tag LOCUS_20060 gene fliP 3305 2565 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272500.1 protein_id gnl|my_center|LOCUS_20060 3757 3302 gene locus_tag LOCUS_20070 3757 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 4674 3769 gene locus_tag LOCUS_20080 4674 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 5724 4678 gene locus_tag LOCUS_20090 gene fliM 5724 4678 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870065.1 protein_id gnl|my_center|LOCUS_20090 6267 5854 gene locus_tag LOCUS_20100 6267 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 6362 7228 gene locus_tag LOCUS_20110 gene rbsK 6362 7228 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246357.1 protein_id gnl|my_center|LOCUS_20110 7259 8959 gene locus_tag LOCUS_20120 7259 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 8969 10096 gene locus_tag LOCUS_20130 8969 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 11455 10202 gene locus_tag LOCUS_20140 11455 10202 CDS product PhoPQ-activated pathogenicity-related family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921868.1 protein_id gnl|my_center|LOCUS_20140 11597 12973 gene locus_tag LOCUS_20150 11597 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 14270 13026 gene locus_tag LOCUS_20160 gene dinB 14270 13026 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_20160 14350 16554 gene locus_tag LOCUS_20170 14350 16554 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259698.1 protein_id gnl|my_center|LOCUS_20170 16789 17688 gene locus_tag LOCUS_20180 16789 17688 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257482.1 protein_id gnl|my_center|LOCUS_20180 17819 20449 gene locus_tag LOCUS_20190 17819 20449 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_20190 20457 20711 gene locus_tag LOCUS_20200 20457 20711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 20728 21444 gene locus_tag LOCUS_20210 gene trmD 20728 21444 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632436.1 protein_id gnl|my_center|LOCUS_20210 21518 21871 gene locus_tag LOCUS_20220 gene rplS 21518 21871 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_20220 21893 22780 gene locus_tag LOCUS_20230 21893 22780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 23604 22777 gene locus_tag LOCUS_20240 23604 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 23908 25380 gene locus_tag LOCUS_20250 23908 25380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 25398 26639 gene locus_tag LOCUS_20260 25398 26639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 26629 27114 gene locus_tag LOCUS_20270 26629 27114 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931087.1 protein_id gnl|my_center|LOCUS_20270 27167 28696 gene locus_tag LOCUS_20280 27167 28696 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405167.1 protein_id gnl|my_center|LOCUS_20280 28860 29414 gene locus_tag LOCUS_20290 28860 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 30123 29395 gene locus_tag LOCUS_20300 30123 29395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 33050 30135 gene locus_tag LOCUS_20310 33050 30135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 33170 34846 gene locus_tag LOCUS_20320 gene ggt 33170 34846 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000595080.1 protein_id gnl|my_center|LOCUS_20320 35211 34840 gene locus_tag LOCUS_20330 35211 34840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 35686 35219 gene locus_tag LOCUS_20340 35686 35219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 35837 36835 gene locus_tag LOCUS_20350 35837 36835 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963508.1 protein_id gnl|my_center|LOCUS_20350 36862 37692 gene locus_tag LOCUS_20360 36862 37692 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001228669.1 protein_id gnl|my_center|LOCUS_20360 37708 38031 gene locus_tag LOCUS_20370 37708 38031 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_20370 38840 38133 gene locus_tag LOCUS_20380 38840 38133 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880279.1 protein_id gnl|my_center|LOCUS_20380 38960 40123 gene locus_tag LOCUS_20390 38960 40123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 40142 41416 gene locus_tag LOCUS_20400 gene larA 40142 41416 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100883.1 protein_id gnl|my_center|LOCUS_20400 42780 41413 gene locus_tag LOCUS_20410 42780 41413 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106243816.1 protein_id gnl|my_center|LOCUS_20410 43891 42857 gene locus_tag LOCUS_20420 43891 42857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 45021 43888 gene locus_tag LOCUS_20430 45021 43888 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017302733.1 protein_id gnl|my_center|LOCUS_20430 45093 45917 gene locus_tag LOCUS_20440 45093 45917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 46903 45914 gene locus_tag LOCUS_20450 46903 45914 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_20450 47735 46905 gene locus_tag LOCUS_20460 47735 46905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 47713 48663 gene locus_tag LOCUS_20470 47713 48663 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_20470 50228 48846 gene locus_tag LOCUS_20480 50228 48846 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123424.1 protein_id gnl|my_center|LOCUS_20480 50306 53170 gene locus_tag LOCUS_20490 50306 53170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 55223 53178 gene locus_tag LOCUS_20500 55223 53178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 55269 56288 gene locus_tag LOCUS_20510 55269 56288 CDS product DUF3500 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327684.1 protein_id gnl|my_center|LOCUS_20510 57711 57037 gene locus_tag LOCUS_20520 57711 57037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 58347 58165 gene locus_tag LOCUS_20530 58347 58165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 59613 58402 gene locus_tag LOCUS_20540 59613 58402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 61219 59615 gene locus_tag LOCUS_20550 61219 59615 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_20550 61236 62219 gene locus_tag LOCUS_20560 61236 62219 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_20560 63149 62223 gene locus_tag LOCUS_20570 63149 62223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 63210 63644 gene locus_tag LOCUS_20580 gene greA 63210 63644 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016773.1 protein_id gnl|my_center|LOCUS_20580 63652 64533 gene locus_tag LOCUS_20590 63652 64533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 64584 65861 gene locus_tag LOCUS_20600 64584 65861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 66633 67052 gene locus_tag LOCUS_20610 66633 67052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence021 38 412 gene locus_tag LOCUS_20620 38 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 1108 1791 gene locus_tag LOCUS_20630 1108 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2200 2126 gene locus_tag LOCUS_t00200 2200 2126 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2406 3134 gene locus_tag LOCUS_20640 gene flgF 2406 3134 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557363.1 protein_id gnl|my_center|LOCUS_20640 3233 4018 gene locus_tag LOCUS_20650 gene flgG 3233 4018 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_20650 4022 5143 gene locus_tag LOCUS_20660 4022 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 5140 5733 gene locus_tag LOCUS_20670 5140 5733 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869892.1 protein_id gnl|my_center|LOCUS_20670 5744 6928 gene locus_tag LOCUS_20680 5744 6928 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869891.1 protein_id gnl|my_center|LOCUS_20680 6935 7267 gene locus_tag LOCUS_20690 6935 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 7264 7740 gene locus_tag LOCUS_20700 7264 7740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 7751 9118 gene locus_tag LOCUS_20710 gene flgK 7751 9118 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_20710 9179 9541 gene locus_tag LOCUS_20720 9179 9541 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225795.1 protein_id gnl|my_center|LOCUS_20720 9545 9862 gene locus_tag LOCUS_20730 9545 9862 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969960.1 protein_id gnl|my_center|LOCUS_20730 10050 9871 gene locus_tag LOCUS_20740 10050 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 10350 10075 gene locus_tag LOCUS_20750 10350 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 10593 11072 gene locus_tag LOCUS_20760 10593 11072 CDS product DUF1579 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929298.1 protein_id gnl|my_center|LOCUS_20760 11107 12231 gene locus_tag LOCUS_20770 11107 12231 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188776689.1 protein_id gnl|my_center|LOCUS_20770 12224 13486 gene locus_tag LOCUS_20780 gene rseP 12224 13486 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_20780 16642 13493 gene locus_tag LOCUS_20790 16642 13493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 16834 18777 gene locus_tag LOCUS_20800 16834 18777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 18932 18744 gene locus_tag LOCUS_20810 18932 18744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 18882 19418 gene locus_tag LOCUS_20820 gene lipB 18882 19418 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_20820 19915 19415 gene locus_tag LOCUS_20830 19915 19415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 20418 19897 gene locus_tag LOCUS_20840 20418 19897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 20521 22050 gene locus_tag LOCUS_20850 20521 22050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 22073 22148 gene locus_tag LOCUS_t00210 22073 22148 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 22469 22203 gene locus_tag LOCUS_20860 22469 22203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 24054 22528 gene locus_tag LOCUS_20870 gene purH 24054 22528 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817232.1 protein_id gnl|my_center|LOCUS_20870 25646 24051 gene locus_tag LOCUS_20880 25646 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 27968 25680 gene locus_tag LOCUS_20890 27968 25680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 29038 27965 gene locus_tag LOCUS_20900 29038 27965 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930937.1 protein_id gnl|my_center|LOCUS_20900 29817 29035 gene locus_tag LOCUS_20910 29817 29035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 30464 29817 gene locus_tag LOCUS_20920 gene plsY 30464 29817 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_20920 32798 30474 gene locus_tag LOCUS_20930 gene glnE 32798 30474 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038683.1 protein_id gnl|my_center|LOCUS_20930 33848 33138 gene locus_tag LOCUS_20940 33848 33138 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_20940 35236 33845 gene locus_tag LOCUS_20950 35236 33845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 36692 35286 gene locus_tag LOCUS_20960 36692 35286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 39043 36812 gene locus_tag LOCUS_20970 39043 36812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 39145 39513 gene locus_tag LOCUS_20980 39145 39513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 40093 39518 gene locus_tag LOCUS_20990 40093 39518 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_20990 40313 41365 gene locus_tag LOCUS_21000 40313 41365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 41698 41375 gene locus_tag LOCUS_21010 41698 41375 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919817.1 protein_id gnl|my_center|LOCUS_21010 42869 41817 gene locus_tag LOCUS_21020 42869 41817 CDS product proline racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252895.1 protein_id gnl|my_center|LOCUS_21020 43501 45036 gene locus_tag LOCUS_21030 43501 45036 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143249.1 protein_id gnl|my_center|LOCUS_21030 45068 45640 gene locus_tag LOCUS_21040 45068 45640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 45650 46927 gene locus_tag LOCUS_21050 45650 46927 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_21050 46924 47457 gene locus_tag LOCUS_21060 46924 47457 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235787673.1 protein_id gnl|my_center|LOCUS_21060 47454 48290 gene locus_tag LOCUS_21070 47454 48290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224688.1 protein_id gnl|my_center|LOCUS_21070 48301 50262 gene locus_tag LOCUS_21080 48301 50262 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_21080 50259 51182 gene locus_tag LOCUS_21090 50259 51182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 52431 51274 gene locus_tag LOCUS_21100 52431 51274 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258372.1 protein_id gnl|my_center|LOCUS_21100 52560 52778 gene locus_tag LOCUS_21110 52560 52778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 52904 53719 gene locus_tag LOCUS_21120 52904 53719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 54958 53798 gene locus_tag LOCUS_21130 gene ftsZ 54958 53798 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888987.1 protein_id gnl|my_center|LOCUS_21130 55073 56128 gene locus_tag LOCUS_21140 55073 56128 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_21140 56886 56143 gene locus_tag LOCUS_21150 56886 56143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 57628 56897 gene locus_tag LOCUS_21160 57628 56897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 58562 57633 gene locus_tag LOCUS_21170 58562 57633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 59505 58564 gene locus_tag LOCUS_21180 59505 58564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 60350 59478 gene locus_tag LOCUS_21190 60350 59478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 60349 62649 gene locus_tag LOCUS_21200 60349 62649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 63567 62650 gene locus_tag LOCUS_21210 63567 62650 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228782.1 protein_id gnl|my_center|LOCUS_21210 63831 63589 gene locus_tag LOCUS_21220 63831 63589 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872031.1 protein_id gnl|my_center|LOCUS_21220 64220 63828 gene locus_tag LOCUS_21230 64220 63828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 65574 64240 gene locus_tag LOCUS_21240 gene ffh 65574 64240 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232020.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence022 2331 3161 gene locus_tag LOCUS_21250 2331 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 4207 3158 gene locus_tag LOCUS_21260 4207 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 4961 4521 gene locus_tag LOCUS_21270 4961 4521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 5365 4961 gene locus_tag LOCUS_21280 5365 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 6086 5373 gene locus_tag LOCUS_21290 6086 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 7426 6083 gene locus_tag LOCUS_21300 7426 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 8103 7423 gene locus_tag LOCUS_21310 8103 7423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 8762 8097 gene locus_tag LOCUS_21320 8762 8097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 9025 8750 gene locus_tag LOCUS_21330 9025 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 9450 9022 gene locus_tag LOCUS_21340 9450 9022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 9640 9425 gene locus_tag LOCUS_21350 9640 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 9996 9637 gene locus_tag LOCUS_21360 9996 9637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 10367 9993 gene locus_tag LOCUS_21370 10367 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 11524 10514 gene locus_tag LOCUS_21380 11524 10514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 11974 11558 gene locus_tag LOCUS_21390 11974 11558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 12994 12074 gene locus_tag LOCUS_21400 12994 12074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 13585 13010 gene locus_tag LOCUS_21410 13585 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 14604 13618 gene locus_tag LOCUS_21420 14604 13618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 15915 14605 gene locus_tag LOCUS_21430 15915 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 17270 15912 gene locus_tag LOCUS_21440 gene terL 17270 15912 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003697216.1 protein_id gnl|my_center|LOCUS_21440 17817 17290 gene locus_tag LOCUS_21450 17817 17290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 18768 18217 gene locus_tag LOCUS_21460 18768 18217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 19048 18773 gene locus_tag LOCUS_21470 19048 18773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 19578 19045 gene locus_tag LOCUS_21480 19578 19045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 19839 20132 gene locus_tag LOCUS_21490 19839 20132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 20415 20678 gene locus_tag LOCUS_21500 20415 20678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 20668 20850 gene locus_tag LOCUS_21510 20668 20850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 20838 21101 gene locus_tag LOCUS_21520 20838 21101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 21583 21098 gene locus_tag LOCUS_21530 21583 21098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 22007 21570 gene locus_tag LOCUS_21540 22007 21570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 22953 21991 gene locus_tag LOCUS_21550 22953 21991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 24647 22956 gene locus_tag LOCUS_21560 24647 22956 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922064.1 protein_id gnl|my_center|LOCUS_21560 24938 24753 gene locus_tag LOCUS_21570 24938 24753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 25336 24935 gene locus_tag LOCUS_21580 25336 24935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 25815 25333 gene locus_tag LOCUS_21590 25815 25333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 26207 25812 gene locus_tag LOCUS_21600 26207 25812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 26440 26204 gene locus_tag LOCUS_21610 26440 26204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 26970 26437 gene locus_tag LOCUS_21620 26970 26437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 27793 26978 gene locus_tag LOCUS_21630 27793 26978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 28094 27873 gene locus_tag LOCUS_21640 28094 27873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 28162 28893 gene locus_tag LOCUS_21650 28162 28893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 29038 29391 gene locus_tag LOCUS_21660 29038 29391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 29388 29630 gene locus_tag LOCUS_21670 29388 29630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 29627 30013 gene locus_tag LOCUS_21680 29627 30013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 30321 31199 gene locus_tag LOCUS_21690 30321 31199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 31196 31663 gene locus_tag LOCUS_21700 31196 31663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 31660 31953 gene locus_tag LOCUS_21710 31660 31953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 31950 32423 gene locus_tag LOCUS_21720 31950 32423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 32528 32752 gene locus_tag LOCUS_21730 32528 32752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 32749 32952 gene locus_tag LOCUS_21740 32749 32952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 32949 34439 gene locus_tag LOCUS_21750 32949 34439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 34488 34694 gene locus_tag LOCUS_21760 34488 34694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 34691 34876 gene locus_tag LOCUS_21770 34691 34876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 34873 35184 gene locus_tag LOCUS_21780 34873 35184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 35066 36208 gene locus_tag LOCUS_21790 35066 36208 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228388.1 protein_id gnl|my_center|LOCUS_21790 36317 36241 gene locus_tag LOCUS_t00220 36317 36241 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 36372 37811 gene locus_tag LOCUS_21800 36372 37811 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257638.1 protein_id gnl|my_center|LOCUS_21800 38484 37774 gene locus_tag LOCUS_21810 38484 37774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 39468 38629 gene locus_tag LOCUS_21820 gene htpX 39468 38629 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066876568.1 protein_id gnl|my_center|LOCUS_21820 39557 40111 gene locus_tag LOCUS_21830 39557 40111 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703843.1 protein_id gnl|my_center|LOCUS_21830 40104 40496 gene locus_tag LOCUS_21840 40104 40496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 40551 40829 gene locus_tag LOCUS_21850 40551 40829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 40819 41277 gene locus_tag LOCUS_21860 gene aroQ 40819 41277 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583808.1 protein_id gnl|my_center|LOCUS_21860 41274 42347 gene locus_tag LOCUS_21870 gene pepQ 41274 42347 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 protein_id gnl|my_center|LOCUS_21870 42355 43173 gene locus_tag LOCUS_21880 42355 43173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 43268 44059 gene locus_tag LOCUS_21890 43268 44059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 44061 45233 gene locus_tag LOCUS_21900 44061 45233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 45886 45284 gene locus_tag LOCUS_21910 gene tmk 45886 45284 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942869.1 protein_id gnl|my_center|LOCUS_21910 46811 45891 gene locus_tag LOCUS_21920 gene fabD 46811 45891 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_21920 46868 49669 gene locus_tag LOCUS_21930 46868 49669 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_21930 49697 50977 gene locus_tag LOCUS_21940 49697 50977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 51576 50983 gene locus_tag LOCUS_21950 51576 50983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 53933 51597 gene locus_tag LOCUS_21960 53933 51597 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_21960 55125 54022 gene locus_tag LOCUS_21970 55125 54022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 55778 55206 gene locus_tag LOCUS_21980 55778 55206 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530196.1 protein_id gnl|my_center|LOCUS_21980 56236 55775 gene locus_tag LOCUS_21990 56236 55775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 57638 56253 gene locus_tag LOCUS_22000 57638 56253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 58161 57826 gene locus_tag LOCUS_22010 58161 57826 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089378.1 protein_id gnl|my_center|LOCUS_22010 >Feature sequence023 1138 827 gene locus_tag LOCUS_22020 1138 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 1509 2081 gene locus_tag LOCUS_22030 1509 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3114 2533 gene locus_tag LOCUS_22040 3114 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 3393 3184 gene locus_tag LOCUS_22050 3393 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 4588 3413 gene locus_tag LOCUS_22060 4588 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 4768 5886 gene locus_tag LOCUS_22070 gene hppD 4768 5886 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810913.1 protein_id gnl|my_center|LOCUS_22070 6045 6332 gene locus_tag LOCUS_22080 6045 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 6705 6932 gene locus_tag LOCUS_22090 6705 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 7658 6861 gene locus_tag LOCUS_22100 7658 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 8125 7664 gene locus_tag LOCUS_22110 8125 7664 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_22110 8282 8073 gene locus_tag LOCUS_22120 8282 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 9444 8314 gene locus_tag LOCUS_22130 9444 8314 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967232.1 protein_id gnl|my_center|LOCUS_22130 10232 9441 gene locus_tag LOCUS_22140 gene trpA 10232 9441 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_22140 12244 10235 gene locus_tag LOCUS_22150 12244 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 12611 12357 gene locus_tag LOCUS_22160 12611 12357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 13440 12751 gene locus_tag LOCUS_22170 gene purQ 13440 12751 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228731.1 protein_id gnl|my_center|LOCUS_22170 13670 13437 gene locus_tag LOCUS_22180 gene purS 13670 13437 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278823.1 protein_id gnl|my_center|LOCUS_22180 14405 13695 gene locus_tag LOCUS_22190 14405 13695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 15145 14585 gene locus_tag LOCUS_22200 15145 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 15825 15226 gene locus_tag LOCUS_22210 15825 15226 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903528.1 protein_id gnl|my_center|LOCUS_22210 15872 17092 gene locus_tag LOCUS_22220 15872 17092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 18144 17089 gene locus_tag LOCUS_22230 18144 17089 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_22230 19937 18141 gene locus_tag LOCUS_22240 19937 18141 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_22240 20262 21131 gene locus_tag LOCUS_22250 gene focA 20262 21131 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705812.1 protein_id gnl|my_center|LOCUS_22250 22587 21124 gene locus_tag LOCUS_22260 22587 21124 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_22260 22708 24561 gene locus_tag LOCUS_22270 22708 24561 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922256.1 protein_id gnl|my_center|LOCUS_22270 24577 24999 gene locus_tag LOCUS_22280 24577 24999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 25150 26244 gene locus_tag LOCUS_22290 25150 26244 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056643.1 protein_id gnl|my_center|LOCUS_22290 26567 26184 gene locus_tag LOCUS_22300 26567 26184 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256880.1 protein_id gnl|my_center|LOCUS_22300 26687 27472 gene locus_tag LOCUS_22310 26687 27472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 28004 27441 gene locus_tag LOCUS_22320 28004 27441 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114630.1 protein_id gnl|my_center|LOCUS_22320 28077 28559 gene locus_tag LOCUS_22330 28077 28559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 28556 29242 gene locus_tag LOCUS_22340 28556 29242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 30182 29289 gene locus_tag LOCUS_22350 30182 29289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 31633 30257 gene locus_tag LOCUS_22360 31633 30257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 31737 32600 gene locus_tag LOCUS_22370 31737 32600 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535020.1 protein_id gnl|my_center|LOCUS_22370 33490 32621 gene locus_tag LOCUS_22380 33490 32621 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816010.1 protein_id gnl|my_center|LOCUS_22380 33574 33948 gene locus_tag LOCUS_22390 33574 33948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 34784 34053 gene locus_tag LOCUS_22400 34784 34053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 34985 34910 gene locus_tag LOCUS_t00230 34985 34910 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35072 35791 gene locus_tag LOCUS_22410 35072 35791 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331802.1 protein_id gnl|my_center|LOCUS_22410 35813 37168 gene locus_tag LOCUS_22420 35813 37168 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085076.1 protein_id gnl|my_center|LOCUS_22420 37203 37409 gene locus_tag LOCUS_22430 37203 37409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 37452 38354 gene locus_tag LOCUS_22440 37452 38354 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403254.1 protein_id gnl|my_center|LOCUS_22440 38962 38351 gene locus_tag LOCUS_22450 38962 38351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 40232 38976 gene locus_tag LOCUS_22460 40232 38976 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932891.1 protein_id gnl|my_center|LOCUS_22460 41655 40249 gene locus_tag LOCUS_22470 41655 40249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 43537 41672 gene locus_tag LOCUS_22480 43537 41672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 43987 43541 gene locus_tag LOCUS_22490 43987 43541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 44452 44018 gene locus_tag LOCUS_22500 44452 44018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 44717 44538 gene locus_tag LOCUS_22510 44717 44538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 44632 45612 gene locus_tag LOCUS_22520 44632 45612 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228820.1 protein_id gnl|my_center|LOCUS_22520 45760 46695 gene locus_tag LOCUS_22530 45760 46695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 46695 46922 gene locus_tag LOCUS_22540 46695 46922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 47083 47913 gene locus_tag LOCUS_22550 47083 47913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 48158 49468 gene locus_tag LOCUS_22560 48158 49468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 50122 49571 gene locus_tag LOCUS_22570 50122 49571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 50719 50177 gene locus_tag LOCUS_22580 50719 50177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 51507 50716 gene locus_tag LOCUS_22590 gene tpiA 51507 50716 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_22590 51993 51538 gene locus_tag LOCUS_22600 51993 51538 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245175.1 protein_id gnl|my_center|LOCUS_22600 53677 52112 gene locus_tag LOCUS_22610 53677 52112 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_22610 55232 53733 gene locus_tag LOCUS_22620 gene nadB 55232 53733 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_22620 55295 56587 gene locus_tag LOCUS_22630 55295 56587 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_22630 57043 56591 gene locus_tag LOCUS_22640 57043 56591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 57110 57460 gene locus_tag LOCUS_22650 57110 57460 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_22650 57464 57901 gene locus_tag LOCUS_22660 57464 57901 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050984093.1 protein_id gnl|my_center|LOCUS_22660 >Feature sequence024 519 1946 gene locus_tag LOCUS_22670 519 1946 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_22670 2045 3127 gene locus_tag LOCUS_22680 2045 3127 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259309.1 protein_id gnl|my_center|LOCUS_22680 3134 4027 gene locus_tag LOCUS_22690 gene hutG 3134 4027 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243908.1 protein_id gnl|my_center|LOCUS_22690 4024 5262 gene locus_tag LOCUS_22700 gene hutI 4024 5262 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256863.1 protein_id gnl|my_center|LOCUS_22700 5412 6032 gene locus_tag LOCUS_22710 5412 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 6220 7191 gene locus_tag LOCUS_22720 6220 7191 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615404.1 protein_id gnl|my_center|LOCUS_22720 8812 7277 gene locus_tag LOCUS_22730 8812 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 10162 8831 gene locus_tag LOCUS_22740 10162 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 12030 10414 gene locus_tag LOCUS_22750 12030 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 12807 12190 gene locus_tag LOCUS_22760 12807 12190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 14041 13010 gene locus_tag LOCUS_22770 gene hrcA 14041 13010 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392120.1 protein_id gnl|my_center|LOCUS_22770 14090 14920 gene locus_tag LOCUS_22780 14090 14920 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391143.1 protein_id gnl|my_center|LOCUS_22780 14980 15585 gene locus_tag LOCUS_22790 14980 15585 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528615.1 protein_id gnl|my_center|LOCUS_22790 15634 15708 gene locus_tag LOCUS_t00240 15634 15708 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16240 15722 gene locus_tag LOCUS_22800 16240 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 16274 18457 gene locus_tag LOCUS_22810 16274 18457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 20385 18523 gene locus_tag LOCUS_22820 20385 18523 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861073.1 protein_id gnl|my_center|LOCUS_22820 23013 20536 gene locus_tag LOCUS_22830 gene gyrA 23013 20536 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391557.1 protein_id gnl|my_center|LOCUS_22830 23492 23103 gene locus_tag LOCUS_22840 23492 23103 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_22840 23970 23476 gene locus_tag LOCUS_22850 23970 23476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 24908 23979 gene locus_tag LOCUS_22860 24908 23979 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_22860 26182 24905 gene locus_tag LOCUS_22870 gene serS 26182 24905 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_22870 27011 26214 gene locus_tag LOCUS_22880 27011 26214 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921173.1 protein_id gnl|my_center|LOCUS_22880 27518 27084 gene locus_tag LOCUS_22890 gene crcB 27518 27084 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227866.1 protein_id gnl|my_center|LOCUS_22890 27517 28689 gene locus_tag LOCUS_22900 27517 28689 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615469.1 protein_id gnl|my_center|LOCUS_22900 28971 28807 gene locus_tag LOCUS_22910 28971 28807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 29270 29896 gene locus_tag LOCUS_22920 gene rplC 29270 29896 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_22920 29893 30561 gene locus_tag LOCUS_22930 gene rplD 29893 30561 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_22930 30561 30905 gene locus_tag LOCUS_22940 gene rplW 30561 30905 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258233.1 protein_id gnl|my_center|LOCUS_22940 30907 31734 gene locus_tag LOCUS_22950 gene rplB 30907 31734 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869925.1 protein_id gnl|my_center|LOCUS_22950 31768 32055 gene locus_tag LOCUS_22960 gene rpsS 31768 32055 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173711.1 protein_id gnl|my_center|LOCUS_22960 32075 32617 gene locus_tag LOCUS_22970 32075 32617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 32620 33360 gene locus_tag LOCUS_22980 gene rpsC 32620 33360 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_22980 33347 33844 gene locus_tag LOCUS_22990 gene rplP 33347 33844 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_22990 33847 34053 gene locus_tag LOCUS_23000 33847 34053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 34050 34322 gene locus_tag LOCUS_23010 gene rpsQ 34050 34322 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974258.1 protein_id gnl|my_center|LOCUS_23010 34419 34763 gene locus_tag LOCUS_23020 gene rplN 34419 34763 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228844.1 protein_id gnl|my_center|LOCUS_23020 34768 35175 gene locus_tag LOCUS_23030 gene rplX 34768 35175 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_23030 35196 35792 gene locus_tag LOCUS_23040 gene rplE 35196 35792 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886968.1 protein_id gnl|my_center|LOCUS_23040 38359 35858 gene locus_tag LOCUS_23050 38359 35858 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093950372.1 protein_id gnl|my_center|LOCUS_23050 38364 38891 gene locus_tag LOCUS_23060 gene idi 38364 38891 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972247.1 protein_id gnl|my_center|LOCUS_23060 38902 39573 gene locus_tag LOCUS_23070 38902 39573 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_23070 40546 40286 gene locus_tag LOCUS_23080 40546 40286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 41439 40735 gene locus_tag LOCUS_23090 41439 40735 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_23090 42538 41453 gene locus_tag LOCUS_23100 42538 41453 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_23100 42568 43029 gene locus_tag LOCUS_23110 42568 43029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 44102 43026 gene locus_tag LOCUS_23120 44102 43026 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_23120 45046 44102 gene locus_tag LOCUS_23130 gene glyQ 45046 44102 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869809.1 protein_id gnl|my_center|LOCUS_23130 45166 46005 gene locus_tag LOCUS_23140 45166 46005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 46231 46488 gene locus_tag LOCUS_23150 46231 46488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23150 46485 46826 gene locus_tag LOCUS_23160 46485 46826 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084909.1 protein_id gnl|my_center|LOCUS_23160 47093 48121 gene locus_tag LOCUS_23170 47093 48121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 48275 49489 gene locus_tag LOCUS_23180 48275 49489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 49504 50535 gene locus_tag LOCUS_23190 49504 50535 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143091.1 protein_id gnl|my_center|LOCUS_23190 50532 51467 gene locus_tag LOCUS_23200 gene gnd 50532 51467 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933532.1 protein_id gnl|my_center|LOCUS_23200 51488 52576 gene locus_tag LOCUS_23210 gene aroC 51488 52576 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_23210 53329 52643 gene locus_tag LOCUS_23220 53329 52643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 54126 53338 gene locus_tag LOCUS_23230 54126 53338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 >Feature sequence025 1561 506 gene locus_tag LOCUS_23240 1561 506 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_23240 1697 2083 gene locus_tag LOCUS_23250 1697 2083 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030668.1 protein_id gnl|my_center|LOCUS_23250 2134 3189 gene locus_tag LOCUS_23260 gene neuB 2134 3189 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066398080.1 protein_id gnl|my_center|LOCUS_23260 3186 3707 gene locus_tag LOCUS_23270 3186 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 3697 4494 gene locus_tag LOCUS_23280 3697 4494 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_23280 4511 4957 gene locus_tag LOCUS_23290 4511 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 4996 5886 gene locus_tag LOCUS_23300 4996 5886 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_23300 5883 6611 gene locus_tag LOCUS_23310 5883 6611 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074690.1 protein_id gnl|my_center|LOCUS_23310 6611 8017 gene locus_tag LOCUS_23320 6611 8017 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018377.1 protein_id gnl|my_center|LOCUS_23320 8041 9024 gene locus_tag LOCUS_23330 gene trpS 8041 9024 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257293.1 protein_id gnl|my_center|LOCUS_23330 9065 9973 gene locus_tag LOCUS_23340 gene prpB 9065 9973 CDS product methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763428.1 protein_id gnl|my_center|LOCUS_23340 9991 11130 gene locus_tag LOCUS_23350 gene citZ 9991 11130 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398810.1 protein_id gnl|my_center|LOCUS_23350 13853 11082 gene locus_tag LOCUS_23360 13853 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 15618 13873 gene locus_tag LOCUS_23370 15618 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 15682 17160 gene locus_tag LOCUS_23380 gene hutH 15682 17160 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_23380 17377 17784 gene locus_tag LOCUS_23390 17377 17784 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229349.1 protein_id gnl|my_center|LOCUS_23390 17778 18542 gene locus_tag LOCUS_23400 17778 18542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 20138 18549 gene locus_tag LOCUS_23410 20138 18549 CDS product AbgT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142253.1 protein_id gnl|my_center|LOCUS_23410 20895 20170 gene locus_tag LOCUS_23420 20895 20170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 21737 20892 gene locus_tag LOCUS_23430 21737 20892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 21862 22452 gene locus_tag LOCUS_23440 21862 22452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 22551 23216 gene locus_tag LOCUS_23450 22551 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 24899 23223 gene locus_tag LOCUS_23460 24899 23223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 25618 24896 gene locus_tag LOCUS_23470 25618 24896 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983379.1 protein_id gnl|my_center|LOCUS_23470 26156 25704 gene locus_tag LOCUS_23480 26156 25704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 27312 26158 gene locus_tag LOCUS_23490 gene mqnE 27312 26158 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393346.1 protein_id gnl|my_center|LOCUS_23490 28811 27363 gene locus_tag LOCUS_23500 28811 27363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 29799 28864 gene locus_tag LOCUS_23510 29799 28864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085059.1 protein_id gnl|my_center|LOCUS_23510 31307 29814 gene locus_tag LOCUS_23520 31307 29814 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528380.1 protein_id gnl|my_center|LOCUS_23520 32341 31304 gene locus_tag LOCUS_23530 32341 31304 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922375.1 protein_id gnl|my_center|LOCUS_23530 32741 32409 gene locus_tag LOCUS_23540 32741 32409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 33624 32851 gene locus_tag LOCUS_23550 33624 32851 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229088.1 protein_id gnl|my_center|LOCUS_23550 33887 33621 gene locus_tag LOCUS_23560 33887 33621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 34663 33935 gene locus_tag LOCUS_23570 gene hisA 34663 33935 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_23570 35244 34657 gene locus_tag LOCUS_23580 gene hisH 35244 34657 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817212.1 protein_id gnl|my_center|LOCUS_23580 35846 35241 gene locus_tag LOCUS_23590 gene hisB 35846 35241 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_23590 38172 36346 gene locus_tag LOCUS_23600 gene typA 38172 36346 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232278.1 protein_id gnl|my_center|LOCUS_23600 40019 38202 gene locus_tag LOCUS_23610 gene aspS 40019 38202 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_23610 40908 40042 gene locus_tag LOCUS_23620 40908 40042 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_23620 41795 40908 gene locus_tag LOCUS_23630 41795 40908 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286787.1 protein_id gnl|my_center|LOCUS_23630 43114 41792 gene locus_tag LOCUS_23640 43114 41792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 45044 43212 gene locus_tag LOCUS_23650 45044 43212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 45104 45655 gene locus_tag LOCUS_23660 45104 45655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 45661 47034 gene locus_tag LOCUS_23670 45661 47034 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_23670 47142 48227 gene locus_tag LOCUS_23680 47142 48227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 48217 48771 gene locus_tag LOCUS_23690 48217 48771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 48814 50058 gene locus_tag LOCUS_23700 48814 50058 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583105.1 protein_id gnl|my_center|LOCUS_23700 50673 50131 gene locus_tag LOCUS_23710 50673 50131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 51892 50711 gene locus_tag LOCUS_23720 51892 50711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 53966 52020 gene locus_tag LOCUS_23730 gene uvrC 53966 52020 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_23730 >Feature sequence026 746 1369 gene locus_tag LOCUS_23740 746 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2381 1746 gene locus_tag LOCUS_23750 2381 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 2841 3311 gene locus_tag LOCUS_23760 2841 3311 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_23760 3308 5353 gene locus_tag LOCUS_23770 3308 5353 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940876.1 protein_id gnl|my_center|LOCUS_23770 5353 6276 gene locus_tag LOCUS_23780 5353 6276 CDS product XdhC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140080.1 protein_id gnl|my_center|LOCUS_23780 6273 6842 gene locus_tag LOCUS_23790 6273 6842 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337853.1 protein_id gnl|my_center|LOCUS_23790 6864 8126 gene locus_tag LOCUS_23800 6864 8126 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 protein_id gnl|my_center|LOCUS_23800 8567 9163 gene locus_tag LOCUS_23810 8567 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 9262 9346 gene locus_tag LOCUS_t00250 9262 9346 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10855 9419 gene locus_tag LOCUS_23820 10855 9419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 10974 13703 gene locus_tag LOCUS_23830 10974 13703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 13749 14654 gene locus_tag LOCUS_23840 gene pdxS 13749 14654 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_23840 14763 15137 gene locus_tag LOCUS_23850 14763 15137 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014497752.1 protein_id gnl|my_center|LOCUS_23850 15113 15469 gene locus_tag LOCUS_23860 15113 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 15596 16654 gene locus_tag LOCUS_23870 gene ychF 15596 16654 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_23870 17642 16656 gene locus_tag LOCUS_23880 17642 16656 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338290.1 protein_id gnl|my_center|LOCUS_23880 17776 19707 gene locus_tag LOCUS_23890 17776 19707 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184203568.1 protein_id gnl|my_center|LOCUS_23890 20414 19701 gene locus_tag LOCUS_23900 20414 19701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 20898 20329 gene locus_tag LOCUS_23910 gene purN 20898 20329 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932011.1 protein_id gnl|my_center|LOCUS_23910 21889 20906 gene locus_tag LOCUS_23920 21889 20906 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_23920 22379 22077 gene locus_tag LOCUS_23930 22379 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 22476 24002 gene locus_tag LOCUS_23940 22476 24002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 24012 24560 gene locus_tag LOCUS_23950 24012 24560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 24690 27365 gene locus_tag LOCUS_23960 gene topA 24690 27365 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047812879.1 protein_id gnl|my_center|LOCUS_23960 27433 28632 gene locus_tag LOCUS_23970 27433 28632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 28613 32260 gene locus_tag LOCUS_23980 28613 32260 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_23980 32314 32550 gene locus_tag LOCUS_23990 gene acpP 32314 32550 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000786062.1 protein_id gnl|my_center|LOCUS_23990 32551 33804 gene locus_tag LOCUS_24000 gene fabF 32551 33804 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_24000 33806 34669 gene locus_tag LOCUS_24010 gene xerC 33806 34669 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_24010 35745 34864 gene locus_tag LOCUS_24020 gene lipA 35745 34864 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_24020 35810 36016 gene locus_tag LOCUS_24030 35810 36016 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391951.1 protein_id gnl|my_center|LOCUS_24030 36372 36297 gene locus_tag LOCUS_t00260 36372 36297 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 36481 36729 gene locus_tag LOCUS_24040 36481 36729 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_24040 38125 36779 gene locus_tag LOCUS_24050 gene der 38125 36779 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_24050 38940 38170 gene locus_tag LOCUS_24060 38940 38170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 39644 38937 gene locus_tag LOCUS_24070 39644 38937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 40901 39765 gene locus_tag LOCUS_24080 40901 39765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 43030 40898 gene locus_tag LOCUS_24090 43030 40898 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_24090 43099 43437 gene locus_tag LOCUS_24100 43099 43437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 43505 44731 gene locus_tag LOCUS_24110 43505 44731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 45046 44735 gene locus_tag LOCUS_24120 45046 44735 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224368.1 protein_id gnl|my_center|LOCUS_24120 45486 45034 gene locus_tag LOCUS_24130 45486 45034 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525102.1 protein_id gnl|my_center|LOCUS_24130 46328 45528 gene locus_tag LOCUS_24140 46328 45528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 47859 46507 gene locus_tag LOCUS_24150 47859 46507 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_24150 48775 47966 gene locus_tag LOCUS_24160 48775 47966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 48847 49305 gene locus_tag LOCUS_24170 48847 49305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 51147 49297 gene locus_tag LOCUS_24180 51147 49297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 51392 51147 gene locus_tag LOCUS_24190 51392 51147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 51516 52163 gene locus_tag LOCUS_24200 gene pdeM 51516 52163 CDS product ligase-associated DNA damage response endonuclease PdeM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268716.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence027 148 735 gene locus_tag LOCUS_24210 148 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 1134 754 gene locus_tag LOCUS_24220 1134 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 1523 1212 gene locus_tag LOCUS_24230 1523 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1647 4052 gene locus_tag LOCUS_24240 1647 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 4133 4522 gene locus_tag LOCUS_24250 4133 4522 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_24250 4548 6287 gene locus_tag LOCUS_24260 4548 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 6760 6338 gene locus_tag LOCUS_24270 6760 6338 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_24270 7806 6757 gene locus_tag LOCUS_24280 gene arsB 7806 6757 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933386.1 protein_id gnl|my_center|LOCUS_24280 8144 7803 gene locus_tag LOCUS_24290 8144 7803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 8137 8430 gene locus_tag LOCUS_24300 8137 8430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 10172 8322 gene locus_tag LOCUS_24310 10172 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393364.1 protein_id gnl|my_center|LOCUS_24310 11227 10259 gene locus_tag LOCUS_24320 11227 10259 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094548211.1 protein_id gnl|my_center|LOCUS_24320 12343 11249 gene locus_tag LOCUS_24330 12343 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 12401 13327 gene locus_tag LOCUS_24340 12401 13327 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225108.1 protein_id gnl|my_center|LOCUS_24340 13324 14241 gene locus_tag LOCUS_24350 13324 14241 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867073.1 protein_id gnl|my_center|LOCUS_24350 16178 14238 gene locus_tag LOCUS_24360 16178 14238 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838414.1 protein_id gnl|my_center|LOCUS_24360 16468 16316 gene locus_tag LOCUS_24370 16468 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 17287 16526 gene locus_tag LOCUS_24380 17287 16526 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_24380 18477 17287 gene locus_tag LOCUS_24390 18477 17287 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 protein_id gnl|my_center|LOCUS_24390 18466 19650 gene locus_tag LOCUS_24400 18466 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 19647 20405 gene locus_tag LOCUS_24410 19647 20405 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640595.1 protein_id gnl|my_center|LOCUS_24410 21108 20695 gene locus_tag LOCUS_24420 21108 20695 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027865.1 protein_id gnl|my_center|LOCUS_24420 21165 23273 gene locus_tag LOCUS_24430 21165 23273 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_24430 23351 24493 gene locus_tag LOCUS_24440 23351 24493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 24486 25580 gene locus_tag LOCUS_24450 gene mnmA 24486 25580 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_24450 25593 25874 gene locus_tag LOCUS_24460 25593 25874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 25906 26670 gene locus_tag LOCUS_24470 gene lgt 25906 26670 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_24470 26794 27177 gene locus_tag LOCUS_24480 26794 27177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 27956 27294 gene locus_tag LOCUS_24490 27956 27294 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_24490 28413 27961 gene locus_tag LOCUS_24500 28413 27961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 30812 28410 gene locus_tag LOCUS_24510 30812 28410 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337000.1 protein_id gnl|my_center|LOCUS_24510 32719 30809 gene locus_tag LOCUS_24520 32719 30809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 33379 33008 gene locus_tag LOCUS_24530 33379 33008 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_24530 34563 33376 gene locus_tag LOCUS_24540 34563 33376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 35504 34692 gene locus_tag LOCUS_24550 35504 34692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 36509 35640 gene locus_tag LOCUS_24560 36509 35640 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704940.1 protein_id gnl|my_center|LOCUS_24560 37821 36520 gene locus_tag LOCUS_24570 37821 36520 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618783.1 protein_id gnl|my_center|LOCUS_24570 38591 37818 gene locus_tag LOCUS_24580 38591 37818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 39995 38604 gene locus_tag LOCUS_24590 39995 38604 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_24590 39982 42810 gene locus_tag LOCUS_24600 39982 42810 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117740.1 protein_id gnl|my_center|LOCUS_24600 44891 42864 gene locus_tag LOCUS_24610 44891 42864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 44930 45400 gene locus_tag LOCUS_24620 44930 45400 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_24620 45400 46185 gene locus_tag LOCUS_24630 45400 46185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 46230 47150 gene locus_tag LOCUS_24640 46230 47150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 47143 48126 gene locus_tag LOCUS_24650 47143 48126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 48123 49040 gene locus_tag LOCUS_24660 48123 49040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_24660 49037 49810 gene locus_tag LOCUS_24670 49037 49810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 51294 49807 gene locus_tag LOCUS_24680 51294 49807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24680 >Feature sequence028 2656 563 gene locus_tag LOCUS_24690 2656 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393307.1 protein_id gnl|my_center|LOCUS_24690 3934 3740 gene locus_tag LOCUS_24700 3934 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 9529 4460 gene locus_tag LOCUS_24710 9529 4460 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257798.1 protein_id gnl|my_center|LOCUS_24710 10413 9583 gene locus_tag LOCUS_24720 10413 9583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 11888 10413 gene locus_tag LOCUS_24730 11888 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 12263 11901 gene locus_tag LOCUS_24740 12263 11901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 12631 12260 gene locus_tag LOCUS_24750 12631 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 15893 12681 gene locus_tag LOCUS_24760 15893 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24760 18313 15896 gene locus_tag LOCUS_24770 18313 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 18287 18436 gene locus_tag LOCUS_24780 18287 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 18467 18706 gene locus_tag LOCUS_24790 18467 18706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 19944 18841 gene locus_tag LOCUS_24800 19944 18841 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_24800 20880 20413 gene locus_tag LOCUS_24810 20880 20413 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247259.1 protein_id gnl|my_center|LOCUS_24810 22969 20897 gene locus_tag LOCUS_24820 22969 20897 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_24820 24520 22988 gene locus_tag LOCUS_24830 24520 22988 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_24830 25571 24600 gene locus_tag LOCUS_24840 gene meaB 25571 24600 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390231.1 protein_id gnl|my_center|LOCUS_24840 26181 25564 gene locus_tag LOCUS_24850 26181 25564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 28340 26178 gene locus_tag LOCUS_24860 gene scpA 28340 26178 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887727.1 protein_id gnl|my_center|LOCUS_24860 28662 29342 gene locus_tag LOCUS_24870 28662 29342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 29404 29829 gene locus_tag LOCUS_24880 29404 29829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 31453 29984 gene locus_tag LOCUS_24890 31453 29984 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021220.1 protein_id gnl|my_center|LOCUS_24890 31615 32562 gene locus_tag LOCUS_24900 31615 32562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 32566 33138 gene locus_tag LOCUS_24910 32566 33138 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104910.1 protein_id gnl|my_center|LOCUS_24910 33142 35286 gene locus_tag LOCUS_24920 33142 35286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 36505 35336 gene locus_tag LOCUS_24930 36505 35336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 38625 37378 gene locus_tag LOCUS_24940 38625 37378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 40947 38686 gene locus_tag LOCUS_24950 40947 38686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 41127 46175 gene locus_tag LOCUS_24960 41127 46175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 46263 46442 gene locus_tag LOCUS_24970 46263 46442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 46446 48083 gene locus_tag LOCUS_24980 46446 48083 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_24980 48145 48496 gene locus_tag LOCUS_tm00010 48145 48496 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 51055 48518 gene locus_tag LOCUS_24990 gene ppc 51055 48518 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728811.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence029 1316 123 gene locus_tag LOCUS_25000 gene glcF 1316 123 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888365.1 protein_id gnl|my_center|LOCUS_25000 2194 1313 gene locus_tag LOCUS_25010 2194 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 3639 2188 gene locus_tag LOCUS_25020 3639 2188 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_25020 4773 3655 gene locus_tag LOCUS_25030 4773 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 5333 4773 gene locus_tag LOCUS_25040 5333 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 5391 7169 gene locus_tag LOCUS_25050 5391 7169 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980092.1 protein_id gnl|my_center|LOCUS_25050 7253 7543 gene locus_tag LOCUS_25060 7253 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 7569 7778 gene locus_tag LOCUS_25070 7569 7778 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889077.1 protein_id gnl|my_center|LOCUS_25070 7775 10030 gene locus_tag LOCUS_25080 7775 10030 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730259.1 protein_id gnl|my_center|LOCUS_25080 10047 12653 gene locus_tag LOCUS_25090 gene clpB 10047 12653 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869824.1 protein_id gnl|my_center|LOCUS_25090 12702 13709 gene locus_tag LOCUS_25100 12702 13709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 13741 14250 gene locus_tag LOCUS_25110 13741 14250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 14354 14872 gene locus_tag LOCUS_25120 14354 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 14900 18145 gene locus_tag LOCUS_25130 14900 18145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 18155 18478 gene locus_tag LOCUS_25140 18155 18478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 18937 18862 gene locus_tag LOCUS_t00270 18937 18862 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 19147 20160 gene locus_tag LOCUS_25150 gene gap 19147 20160 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976871.1 protein_id gnl|my_center|LOCUS_25150 20255 21121 gene locus_tag LOCUS_25160 20255 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 22241 21168 gene locus_tag LOCUS_25170 22241 21168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 24367 22196 gene locus_tag LOCUS_25180 24367 22196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 24626 26437 gene locus_tag LOCUS_25190 24626 26437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 26471 26725 gene locus_tag LOCUS_25200 gene rpsT 26471 26725 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976241.1 protein_id gnl|my_center|LOCUS_25200 26763 27971 gene locus_tag LOCUS_25210 26763 27971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 28545 29333 gene locus_tag LOCUS_25220 28545 29333 CDS product Ku protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392998.1 protein_id gnl|my_center|LOCUS_25220 29374 30468 gene locus_tag LOCUS_25230 29374 30468 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529143.1 protein_id gnl|my_center|LOCUS_25230 31320 30523 gene locus_tag LOCUS_25240 gene pstB 31320 30523 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_25240 32238 31366 gene locus_tag LOCUS_25250 32238 31366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 32281 33732 gene locus_tag LOCUS_25260 32281 33732 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_25260 34513 34046 gene locus_tag LOCUS_25270 gene rplI 34513 34046 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_25270 35917 34526 gene locus_tag LOCUS_25280 35917 34526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 37088 36027 gene locus_tag LOCUS_25290 37088 36027 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_25290 37224 37658 gene locus_tag LOCUS_25300 37224 37658 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349893.1 protein_id gnl|my_center|LOCUS_25300 37655 41131 gene locus_tag LOCUS_25310 37655 41131 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_25310 41131 41403 gene locus_tag LOCUS_25320 41131 41403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 41396 42643 gene locus_tag LOCUS_25330 41396 42643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 42694 43377 gene locus_tag LOCUS_25340 42694 43377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 43625 44209 gene locus_tag LOCUS_25350 43625 44209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 44206 45075 gene locus_tag LOCUS_25360 44206 45075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 45458 45156 gene locus_tag LOCUS_25370 45458 45156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 46250 46924 gene locus_tag LOCUS_25380 46250 46924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 47022 47285 gene locus_tag LOCUS_25390 47022 47285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 48306 47293 gene locus_tag LOCUS_25400 48306 47293 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530990.1 protein_id gnl|my_center|LOCUS_25400 48347 50275 gene locus_tag LOCUS_25410 48347 50275 CDS product FdhF/YdeP family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121932.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence030 <1 666 gene locus_tag LOCUS_25420 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331492.1:ImmA/IrrE family metallo-endopeptidase 690 1157 gene locus_tag LOCUS_25430 690 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 1236 1703 gene locus_tag LOCUS_25440 1236 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 1693 1932 gene locus_tag LOCUS_25450 1693 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1929 2276 gene locus_tag LOCUS_25460 1929 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2273 2794 gene locus_tag LOCUS_25470 2273 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 2784 3575 gene locus_tag LOCUS_25480 2784 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 3636 3881 gene locus_tag LOCUS_25490 3636 3881 CDS product DUF2188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975469.1 protein_id gnl|my_center|LOCUS_25490 4981 3992 gene locus_tag LOCUS_25500 4981 3992 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384542.1 protein_id gnl|my_center|LOCUS_25500 5348 5659 gene locus_tag LOCUS_25510 5348 5659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 5656 5949 gene locus_tag LOCUS_25520 5656 5949 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971035.1 protein_id gnl|my_center|LOCUS_25520 7878 5995 gene locus_tag LOCUS_25530 7878 5995 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102961.1 protein_id gnl|my_center|LOCUS_25530 8296 7886 gene locus_tag LOCUS_25540 8296 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 8590 8300 gene locus_tag LOCUS_25550 8590 8300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 10807 8810 gene locus_tag LOCUS_25560 10807 8810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 13224 10876 gene locus_tag LOCUS_25570 13224 10876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 15797 13230 gene locus_tag LOCUS_25580 15797 13230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 16056 15805 gene locus_tag LOCUS_25590 16056 15805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 17282 16392 gene locus_tag LOCUS_25600 17282 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 17547 17293 gene locus_tag LOCUS_25610 17547 17293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 18012 17722 gene locus_tag LOCUS_25620 18012 17722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 18894 18610 gene locus_tag LOCUS_25630 18894 18610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 19214 18891 gene locus_tag LOCUS_25640 19214 18891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 19894 19214 gene locus_tag LOCUS_25650 19894 19214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 20222 20536 gene locus_tag LOCUS_25660 20222 20536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 20863 20612 gene locus_tag LOCUS_25670 20863 20612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 21063 20860 gene locus_tag LOCUS_25680 21063 20860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 21748 21053 gene locus_tag LOCUS_25690 21748 21053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 22242 21748 gene locus_tag LOCUS_25700 22242 21748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 22781 22509 gene locus_tag LOCUS_25710 22781 22509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 24420 22924 gene locus_tag LOCUS_25720 24420 22924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 25988 24414 gene locus_tag LOCUS_25730 25988 24414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 25957 26235 gene locus_tag LOCUS_25740 25957 26235 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_25740 26991 26251 gene locus_tag LOCUS_25750 26991 26251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 28183 27044 gene locus_tag LOCUS_25760 28183 27044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 28889 28218 gene locus_tag LOCUS_25770 28889 28218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 29841 28882 gene locus_tag LOCUS_25780 29841 28882 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004466992.1 protein_id gnl|my_center|LOCUS_25780 30974 32371 gene locus_tag LOCUS_25790 30974 32371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 33916 34692 gene locus_tag LOCUS_25800 33916 34692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 34619 35224 gene locus_tag LOCUS_25810 34619 35224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 35106 35849 gene locus_tag LOCUS_25820 35106 35849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 38853 35860 gene locus_tag LOCUS_25830 38853 35860 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932591.1 protein_id gnl|my_center|LOCUS_25830 40787 38862 gene locus_tag LOCUS_25840 40787 38862 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024901007.1 protein_id gnl|my_center|LOCUS_25840 41545 40793 gene locus_tag LOCUS_25850 41545 40793 CDS product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932587.1 protein_id gnl|my_center|LOCUS_25850 44736 41542 gene locus_tag LOCUS_25860 44736 41542 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932586.1 protein_id gnl|my_center|LOCUS_25860 45137 44733 gene locus_tag LOCUS_25870 45137 44733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 46217 45300 gene locus_tag LOCUS_25880 46217 45300 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011313588.1 protein_id gnl|my_center|LOCUS_25880 46873 46406 gene locus_tag LOCUS_25890 46873 46406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 47248 47045 gene locus_tag LOCUS_25900 47248 47045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 47434 48033 gene locus_tag LOCUS_25910 47434 48033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 48030 48404 gene locus_tag LOCUS_25920 48030 48404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence031 2372 1296 gene locus_tag LOCUS_25930 2372 1296 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830071.1 protein_id gnl|my_center|LOCUS_25930 2468 4768 gene locus_tag LOCUS_25940 2468 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 4853 4944 gene locus_tag LOCUS_t00280 4853 4944 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5426 4953 gene locus_tag LOCUS_25950 gene smpB 5426 4953 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_25950 6744 5473 gene locus_tag LOCUS_25960 6744 5473 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_25960 6888 7703 gene locus_tag LOCUS_25970 6888 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25970 7703 8653 gene locus_tag LOCUS_25980 7703 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 8703 10547 gene locus_tag LOCUS_25990 8703 10547 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_25990 12982 10559 gene locus_tag LOCUS_26000 12982 10559 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584148.1 protein_id gnl|my_center|LOCUS_26000 13038 13847 gene locus_tag LOCUS_26010 13038 13847 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976846.1 protein_id gnl|my_center|LOCUS_26010 17249 13848 gene locus_tag LOCUS_26020 17249 13848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 17424 20609 gene locus_tag LOCUS_26030 17424 20609 CDS product AAA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_26030 22353 20617 gene locus_tag LOCUS_26040 22353 20617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 22502 22921 gene locus_tag LOCUS_26050 22502 22921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 22959 23942 gene locus_tag LOCUS_26060 22959 23942 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_26060 24250 23993 gene locus_tag LOCUS_26070 24250 23993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 25187 24327 gene locus_tag LOCUS_26080 25187 24327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 26176 25184 gene locus_tag LOCUS_26090 26176 25184 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_26090 26694 26317 gene locus_tag LOCUS_26100 26694 26317 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_26100 29121 26701 gene locus_tag LOCUS_26110 gene rad50 29121 26701 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902341.1 protein_id gnl|my_center|LOCUS_26110 30271 29102 gene locus_tag LOCUS_26120 30271 29102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 29256 29345 gene locus_tag LOCUS_t00290 29256 29345 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 30364 31347 gene locus_tag LOCUS_26130 30364 31347 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_26130 31410 32552 gene locus_tag LOCUS_26140 31410 32552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 32811 34607 gene locus_tag LOCUS_26150 32811 34607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26150 34642 35910 gene locus_tag LOCUS_26160 34642 35910 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_26160 35907 36713 gene locus_tag LOCUS_26170 gene phnP 35907 36713 CDS product phosphonate metabolism protein PhnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059908.1 protein_id gnl|my_center|LOCUS_26170 38248 36716 gene locus_tag LOCUS_26180 38248 36716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 39082 38306 gene locus_tag LOCUS_26190 gene xth 39082 38306 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_26190 41784 39079 gene locus_tag LOCUS_26200 41784 39079 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840190.1 protein_id gnl|my_center|LOCUS_26200 42025 41873 gene locus_tag LOCUS_26210 42025 41873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 42942 42040 gene locus_tag LOCUS_26220 42942 42040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 43717 42953 gene locus_tag LOCUS_26230 43717 42953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 43841 44047 gene locus_tag LOCUS_26240 43841 44047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 44067 45011 gene locus_tag LOCUS_26250 44067 45011 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349500.1 protein_id gnl|my_center|LOCUS_26250 45069 47591 gene locus_tag LOCUS_26260 45069 47591 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_26260 >Feature sequence032 4104 5918 gene locus_tag LOCUS_26270 4104 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 5943 6581 gene locus_tag LOCUS_26280 5943 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 6637 7545 gene locus_tag LOCUS_26290 6637 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 8413 7556 gene locus_tag LOCUS_26300 8413 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 8385 8600 gene locus_tag LOCUS_26310 8385 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 8755 9612 gene locus_tag LOCUS_26320 8755 9612 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228998.1 protein_id gnl|my_center|LOCUS_26320 9996 9625 gene locus_tag LOCUS_26330 9996 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 11690 10038 gene locus_tag LOCUS_26340 gene arc 11690 10038 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027900.1 protein_id gnl|my_center|LOCUS_26340 14052 11737 gene locus_tag LOCUS_26350 14052 11737 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989370.1 protein_id gnl|my_center|LOCUS_26350 14569 14135 gene locus_tag LOCUS_26360 14569 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 15299 14679 gene locus_tag LOCUS_26370 15299 14679 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_26370 15749 15306 gene locus_tag LOCUS_26380 15749 15306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 18378 15793 gene locus_tag LOCUS_26390 18378 15793 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_26390 18500 19411 gene locus_tag LOCUS_26400 18500 19411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 19513 19428 gene locus_tag LOCUS_t00300 19513 19428 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19550 20785 gene locus_tag LOCUS_26410 19550 20785 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876500.1 protein_id gnl|my_center|LOCUS_26410 20851 22308 gene locus_tag LOCUS_26420 20851 22308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 22384 22911 gene locus_tag LOCUS_26430 22384 22911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 24650 23001 gene locus_tag LOCUS_26440 24650 23001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 26002 24830 gene locus_tag LOCUS_26450 26002 24830 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389364.1 protein_id gnl|my_center|LOCUS_26450 28808 25992 gene locus_tag LOCUS_26460 28808 25992 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392653.1 protein_id gnl|my_center|LOCUS_26460 31119 28864 gene locus_tag LOCUS_26470 31119 28864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 31202 31597 gene locus_tag LOCUS_26480 31202 31597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 31684 33438 gene locus_tag LOCUS_26490 31684 33438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 34241 33510 gene locus_tag LOCUS_26500 34241 33510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 35154 34246 gene locus_tag LOCUS_26510 35154 34246 CDS product DUF4434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762555.1 protein_id gnl|my_center|LOCUS_26510 35960 35181 gene locus_tag LOCUS_26520 35960 35181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 36774 36010 gene locus_tag LOCUS_26530 36774 36010 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_26530 37222 36941 gene locus_tag LOCUS_26540 37222 36941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 39095 37464 gene locus_tag LOCUS_26550 gene pruA 39095 37464 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_26550 39188 39796 gene locus_tag LOCUS_26560 39188 39796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 39840 40391 gene locus_tag LOCUS_26570 39840 40391 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_26570 40399 41022 gene locus_tag LOCUS_26580 40399 41022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 41128 42048 gene locus_tag LOCUS_26590 41128 42048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 <42814 42172 gene locus_tag LOCUS_26600 <42814 42172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141370.1:Fe-S cluster assembly protein SufB >Feature sequence033 453 52 gene locus_tag LOCUS_26610 453 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 518 2062 gene locus_tag LOCUS_26620 518 2062 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778938.1 protein_id gnl|my_center|LOCUS_26620 2224 2751 gene locus_tag LOCUS_26630 2224 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2748 3737 gene locus_tag LOCUS_26640 2748 3737 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064796.1 protein_id gnl|my_center|LOCUS_26640 3734 4636 gene locus_tag LOCUS_26650 3734 4636 CDS product DUF5655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004554540.1 protein_id gnl|my_center|LOCUS_26650 4633 5820 gene locus_tag LOCUS_26660 4633 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 5817 6992 gene locus_tag LOCUS_26670 5817 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 7031 9982 gene locus_tag LOCUS_26680 7031 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 10048 13392 gene locus_tag LOCUS_26690 10048 13392 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022389.1 protein_id gnl|my_center|LOCUS_26690 13799 14992 gene locus_tag LOCUS_26700 13799 14992 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256572.1 protein_id gnl|my_center|LOCUS_26700 14992 15342 gene locus_tag LOCUS_26710 14992 15342 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_26710 16717 15365 gene locus_tag LOCUS_26720 16717 15365 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118059.1 protein_id gnl|my_center|LOCUS_26720 18526 16727 gene locus_tag LOCUS_26730 18526 16727 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_26730 20176 18587 gene locus_tag LOCUS_26740 20176 18587 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162483874.1 protein_id gnl|my_center|LOCUS_26740 20366 20836 gene locus_tag LOCUS_26750 20366 20836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 20892 21611 gene locus_tag LOCUS_26760 20892 21611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 21612 21938 gene locus_tag LOCUS_26770 21612 21938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 21938 24961 gene locus_tag LOCUS_26780 21938 24961 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_26780 25077 25433 gene locus_tag LOCUS_26790 25077 25433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 25975 25442 gene locus_tag LOCUS_26800 25975 25442 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721677.1 protein_id gnl|my_center|LOCUS_26800 26871 25975 gene locus_tag LOCUS_26810 26871 25975 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_26810 26870 27736 gene locus_tag LOCUS_26820 26870 27736 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_26820 27733 28908 gene locus_tag LOCUS_26830 gene natB 27733 28908 CDS product sodium ABC transporter permease NatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246346.1 protein_id gnl|my_center|LOCUS_26830 28917 29849 gene locus_tag LOCUS_26840 28917 29849 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114954.1 protein_id gnl|my_center|LOCUS_26840 29929 30819 gene locus_tag LOCUS_26850 29929 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 31862 30840 gene locus_tag LOCUS_26860 31862 30840 CDS product DUF2332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260258.1 protein_id gnl|my_center|LOCUS_26860 33154 31856 gene locus_tag LOCUS_26870 gene nahK 33154 31856 CDS product N-acetylhexosamine 1-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068766.1 protein_id gnl|my_center|LOCUS_26870 33169 34455 gene locus_tag LOCUS_26880 33169 34455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 34582 34507 gene locus_tag LOCUS_t00310 34582 34507 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 35269 34616 gene locus_tag LOCUS_26890 35269 34616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 35393 36004 gene locus_tag LOCUS_26900 35393 36004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 36020 36631 gene locus_tag LOCUS_26910 36020 36631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 36732 36658 gene locus_tag LOCUS_t00320 36732 36658 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 36867 37739 gene locus_tag LOCUS_26920 36867 37739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 >Feature sequence034 1756 548 gene locus_tag LOCUS_26930 1756 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 1706 2020 gene locus_tag LOCUS_26940 1706 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 3107 3862 gene locus_tag LOCUS_26950 3107 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 3859 4194 gene locus_tag LOCUS_26960 3859 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 4618 5088 gene locus_tag LOCUS_26970 4618 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 5091 6566 gene locus_tag LOCUS_26980 5091 6566 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_26980 6563 9214 gene locus_tag LOCUS_26990 6563 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 9207 10184 gene locus_tag LOCUS_27000 9207 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 10168 12240 gene locus_tag LOCUS_27010 10168 12240 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_27010 13289 13591 gene locus_tag LOCUS_27020 13289 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 13657 14025 gene locus_tag LOCUS_27030 13657 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 14182 14616 gene locus_tag LOCUS_27040 14182 14616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 14672 16303 gene locus_tag LOCUS_27050 14672 16303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 17590 16379 gene locus_tag LOCUS_27060 17590 16379 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028858.1 protein_id gnl|my_center|LOCUS_27060 21278 17892 gene locus_tag LOCUS_27070 21278 17892 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_27070 23683 21275 gene locus_tag LOCUS_27080 23683 21275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 24960 23680 gene locus_tag LOCUS_27090 24960 23680 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941618.1 protein_id gnl|my_center|LOCUS_27090 25382 24957 gene locus_tag LOCUS_27100 25382 24957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 25959 26987 gene locus_tag LOCUS_27110 25959 26987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 27227 26988 gene locus_tag LOCUS_27120 27227 26988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 27718 27224 gene locus_tag LOCUS_27130 27718 27224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 28314 27715 gene locus_tag LOCUS_27140 28314 27715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 28404 30605 gene locus_tag LOCUS_27150 gene nasC 28404 30605 CDS product assimilatory nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246484.1 protein_id gnl|my_center|LOCUS_27150 30639 32570 gene locus_tag LOCUS_27160 30639 32570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 33797 32559 gene locus_tag LOCUS_27170 33797 32559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 34410 33841 gene locus_tag LOCUS_27180 34410 33841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 >Feature sequence035 1974 796 gene locus_tag LOCUS_27190 gene trpB 1974 796 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460915.1 protein_id gnl|my_center|LOCUS_27190 2049 3752 gene locus_tag LOCUS_27200 2049 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 3749 4681 gene locus_tag LOCUS_27210 3749 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 4678 5691 gene locus_tag LOCUS_27220 gene lsrB 4678 5691 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000172457.1 protein_id gnl|my_center|LOCUS_27220 6164 10012 gene locus_tag LOCUS_27230 6164 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 10062 11246 gene locus_tag LOCUS_27240 10062 11246 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_27240 11328 11687 gene locus_tag LOCUS_27250 11328 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 11684 12511 gene locus_tag LOCUS_27260 11684 12511 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461623.1 protein_id gnl|my_center|LOCUS_27260 12651 15758 gene locus_tag LOCUS_27270 12651 15758 CDS product family 78 glycoside hydrolase catalytic domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226935.1 protein_id gnl|my_center|LOCUS_27270 15751 16482 gene locus_tag LOCUS_27280 15751 16482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 16503 17327 gene locus_tag LOCUS_27290 16503 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 17436 17915 gene locus_tag LOCUS_27300 17436 17915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 17912 18334 gene locus_tag LOCUS_27310 17912 18334 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392208.1 protein_id gnl|my_center|LOCUS_27310 21738 18343 gene locus_tag LOCUS_27320 21738 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 23411 21774 gene locus_tag LOCUS_27330 23411 21774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 24076 23522 gene locus_tag LOCUS_27340 24076 23522 CDS product NAD(P)H-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082483.1 protein_id gnl|my_center|LOCUS_27340 25465 24086 gene locus_tag LOCUS_27350 25465 24086 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027550.1 protein_id gnl|my_center|LOCUS_27350 25606 25533 gene locus_tag LOCUS_t00330 25606 25533 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25768 26910 gene locus_tag LOCUS_27360 25768 26910 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932383.1 protein_id gnl|my_center|LOCUS_27360 28498 26900 gene locus_tag LOCUS_27370 28498 26900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 28593 29705 gene locus_tag LOCUS_27380 28593 29705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 29711 30448 gene locus_tag LOCUS_27390 29711 30448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 30465 31088 gene locus_tag LOCUS_27400 30465 31088 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289529.1 protein_id gnl|my_center|LOCUS_27400 31355 32299 gene locus_tag LOCUS_27410 31355 32299 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803699.1 protein_id gnl|my_center|LOCUS_27410 32328 32585 gene locus_tag LOCUS_27420 32328 32585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 32771 32589 gene locus_tag LOCUS_27430 32771 32589 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_27430 33155 32778 gene locus_tag LOCUS_27440 33155 32778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence036 725 51 gene locus_tag LOCUS_27450 725 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 1813 926 gene locus_tag LOCUS_27460 1813 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2214 1813 gene locus_tag LOCUS_27470 2214 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2855 2211 gene locus_tag LOCUS_27480 2855 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 4455 3016 gene locus_tag LOCUS_27490 4455 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 4610 5734 gene locus_tag LOCUS_27500 4610 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 6789 5785 gene locus_tag LOCUS_27510 6789 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 7912 6914 gene locus_tag LOCUS_27520 7912 6914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 7905 8117 gene locus_tag LOCUS_27530 7905 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 8127 11105 gene locus_tag LOCUS_27540 8127 11105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 11110 14244 gene locus_tag LOCUS_27550 11110 14244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 14241 17141 gene locus_tag LOCUS_27560 14241 17141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064476.1 protein_id gnl|my_center|LOCUS_27560 17150 17584 gene locus_tag LOCUS_27570 17150 17584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 17553 20453 gene locus_tag LOCUS_27580 17553 20453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 20456 22114 gene locus_tag LOCUS_27590 20456 22114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 22116 28253 gene locus_tag LOCUS_27600 22116 28253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 28347 29246 gene locus_tag LOCUS_27610 28347 29246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 29243 30946 gene locus_tag LOCUS_27620 29243 30946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 30983 32302 gene locus_tag LOCUS_27630 30983 32302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 32317 32655 gene locus_tag LOCUS_27640 32317 32655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence037 76 1 gene locus_tag LOCUS_t00340 76 1 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 215 2314 gene locus_tag LOCUS_27650 215 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3712 2387 gene locus_tag LOCUS_27660 3712 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 3880 4719 gene locus_tag LOCUS_27670 3880 4719 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_27670 4716 5204 gene locus_tag LOCUS_27680 4716 5204 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_27680 5271 5825 gene locus_tag LOCUS_27690 5271 5825 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_27690 6469 5930 gene locus_tag LOCUS_27700 6469 5930 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_27700 6820 8268 gene locus_tag LOCUS_27710 6820 8268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 8270 9328 gene locus_tag LOCUS_27720 8270 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 10022 9330 gene locus_tag LOCUS_27730 10022 9330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 10091 12229 gene locus_tag LOCUS_27740 10091 12229 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921762.1 protein_id gnl|my_center|LOCUS_27740 12368 12670 gene locus_tag LOCUS_27750 12368 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 13600 12680 gene locus_tag LOCUS_27760 gene cysK 13600 12680 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887435.1 protein_id gnl|my_center|LOCUS_27760 14094 13597 gene locus_tag LOCUS_27770 14094 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 14140 15090 gene locus_tag LOCUS_27780 gene queG 14140 15090 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_27780 15147 15488 gene locus_tag LOCUS_27790 15147 15488 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808563.1 protein_id gnl|my_center|LOCUS_27790 15481 15963 gene locus_tag LOCUS_27800 15481 15963 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126727.1 protein_id gnl|my_center|LOCUS_27800 19055 15960 gene locus_tag LOCUS_27810 19055 15960 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_27810 20587 19055 gene locus_tag LOCUS_27820 20587 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 21807 20584 gene locus_tag LOCUS_27830 21807 20584 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920567.1 protein_id gnl|my_center|LOCUS_27830 22247 21825 gene locus_tag LOCUS_27840 22247 21825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 23441 22293 gene locus_tag LOCUS_27850 23441 22293 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531089.1 protein_id gnl|my_center|LOCUS_27850 25309 23522 gene locus_tag LOCUS_27860 25309 23522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 26896 25313 gene locus_tag LOCUS_27870 26896 25313 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404351.1 protein_id gnl|my_center|LOCUS_27870 26947 27231 gene locus_tag LOCUS_27880 26947 27231 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_27880 27215 27421 gene locus_tag LOCUS_27890 27215 27421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 27761 27426 gene locus_tag LOCUS_27900 27761 27426 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079890.1 protein_id gnl|my_center|LOCUS_27900 27808 28731 gene locus_tag LOCUS_27910 27808 28731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 28728 30323 gene locus_tag LOCUS_27920 28728 30323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 30352 30834 gene locus_tag LOCUS_27930 30352 30834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 31836 30844 gene locus_tag LOCUS_27940 31836 30844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence038 421 813 gene locus_tag LOCUS_27950 421 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 1763 864 gene locus_tag LOCUS_27960 1763 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 2350 1763 gene locus_tag LOCUS_27970 2350 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 2402 3301 gene locus_tag LOCUS_27980 2402 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 4619 3381 gene locus_tag LOCUS_27990 4619 3381 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099259466.1 protein_id gnl|my_center|LOCUS_27990 4700 5062 gene locus_tag LOCUS_28000 4700 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 5065 5574 gene locus_tag LOCUS_28010 5065 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 5580 5786 gene locus_tag LOCUS_28020 5580 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 6056 6493 gene locus_tag LOCUS_28030 6056 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 6537 8249 gene locus_tag LOCUS_28040 6537 8249 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121863.1 protein_id gnl|my_center|LOCUS_28040 8282 9073 gene locus_tag LOCUS_28050 8282 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 9087 9677 gene locus_tag LOCUS_28060 9087 9677 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_28060 9914 10588 gene locus_tag LOCUS_28070 9914 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 12745 10595 gene locus_tag LOCUS_28080 12745 10595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 12809 14062 gene locus_tag LOCUS_28090 12809 14062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 15386 14121 gene locus_tag LOCUS_28100 15386 14121 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_28100 16275 15388 gene locus_tag LOCUS_28110 16275 15388 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_28110 17506 16286 gene locus_tag LOCUS_28120 17506 16286 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_28120 17748 18977 gene locus_tag LOCUS_28130 17748 18977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 20683 18980 gene locus_tag LOCUS_28140 20683 18980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 21953 20895 gene locus_tag LOCUS_28150 21953 20895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 23497 21974 gene locus_tag LOCUS_28160 gene aglB 23497 21974 CDS product cyclomaltodextrinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082380.1 protein_id gnl|my_center|LOCUS_28160 23824 23504 gene locus_tag LOCUS_28170 23824 23504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 24777 23845 gene locus_tag LOCUS_28180 24777 23845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 26906 24774 gene locus_tag LOCUS_28190 26906 24774 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393356.1 protein_id gnl|my_center|LOCUS_28190 27931 26903 gene locus_tag LOCUS_28200 gene malR 27931 26903 CDS product maltose operon transcriptional repressor MalR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219042.1 protein_id gnl|my_center|LOCUS_28200 28209 29150 gene locus_tag LOCUS_28210 28209 29150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 29150 29350 gene locus_tag LOCUS_28220 29150 29350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 29448 29522 gene locus_tag LOCUS_t00350 29448 29522 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 29581 30729 gene locus_tag LOCUS_28230 29581 30729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 30847 31092 gene locus_tag LOCUS_28240 30847 31092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 31627 31139 gene locus_tag LOCUS_28250 31627 31139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 >Feature sequence039 406 2220 gene locus_tag LOCUS_28260 406 2220 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_28260 3289 2279 gene locus_tag LOCUS_28270 3289 2279 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774414.1 protein_id gnl|my_center|LOCUS_28270 3791 3405 gene locus_tag LOCUS_28280 3791 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 3857 5098 gene locus_tag LOCUS_28290 gene waaA 3857 5098 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074267.1 protein_id gnl|my_center|LOCUS_28290 5095 5826 gene locus_tag LOCUS_28300 5095 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 5887 6828 gene locus_tag LOCUS_28310 5887 6828 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929230.1 protein_id gnl|my_center|LOCUS_28310 8386 6899 gene locus_tag LOCUS_28320 8386 6899 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226507.1 protein_id gnl|my_center|LOCUS_28320 9393 8413 gene locus_tag LOCUS_28330 9393 8413 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_28330 9672 10793 gene locus_tag LOCUS_28340 9672 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 11055 10798 gene locus_tag LOCUS_28350 gene rpmA 11055 10798 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940600.1 protein_id gnl|my_center|LOCUS_28350 11444 11079 gene locus_tag LOCUS_28360 gene rplU 11444 11079 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_28360 11585 11851 gene locus_tag LOCUS_28370 11585 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 11848 13158 gene locus_tag LOCUS_28380 11848 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 13155 14600 gene locus_tag LOCUS_28390 13155 14600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 14610 18044 gene locus_tag LOCUS_28400 14610 18044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 18085 19089 gene locus_tag LOCUS_28410 18085 19089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 19093 20913 gene locus_tag LOCUS_28420 19093 20913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 21006 20931 gene locus_tag LOCUS_t00360 21006 20931 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 24100 21176 gene locus_tag LOCUS_28430 24100 21176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 27064 24173 gene locus_tag LOCUS_28440 27064 24173 CDS product BTAD domain-containing putative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928763.1 protein_id gnl|my_center|LOCUS_28440 28189 27137 gene locus_tag LOCUS_28450 gene solA 28189 27137 CDS product N-methyl-L-tryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_28450 28216 29733 gene locus_tag LOCUS_28460 28216 29733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 29795 29871 gene locus_tag LOCUS_t00370 29795 29871 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 29890 30399 gene locus_tag LOCUS_28470 29890 30399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 30907 30560 gene locus_tag LOCUS_28480 30907 30560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence040 1896 919 gene locus_tag LOCUS_28490 1896 919 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443118.1 protein_id gnl|my_center|LOCUS_28490 1958 2248 gene locus_tag LOCUS_28500 1958 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 2635 2255 gene locus_tag LOCUS_28510 2635 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2985 3275 gene locus_tag LOCUS_28520 2985 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 4450 3272 gene locus_tag LOCUS_28530 4450 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 5010 4447 gene locus_tag LOCUS_28540 5010 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 6989 5007 gene locus_tag LOCUS_28550 6989 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 9455 6999 gene locus_tag LOCUS_28560 9455 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 9933 9457 gene locus_tag LOCUS_28570 9933 9457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 10915 10091 gene locus_tag LOCUS_28580 10915 10091 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355975.1 protein_id gnl|my_center|LOCUS_28580 11682 10903 gene locus_tag LOCUS_28590 gene soj 11682 10903 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_28590 13583 11679 gene locus_tag LOCUS_28600 13583 11679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 13804 13589 gene locus_tag LOCUS_28610 13804 13589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 15329 15982 gene locus_tag LOCUS_28620 15329 15982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 16872 15961 gene locus_tag LOCUS_28630 16872 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 20296 16949 gene locus_tag LOCUS_28640 20296 16949 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_28640 23143 20300 gene locus_tag LOCUS_28650 23143 20300 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_28650 26700 23140 gene locus_tag LOCUS_28660 26700 23140 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_28660 26909 26697 gene locus_tag LOCUS_28670 26909 26697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 27736 27431 gene locus_tag LOCUS_28680 27736 27431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 28240 27743 gene locus_tag LOCUS_28690 28240 27743 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287700.1 protein_id gnl|my_center|LOCUS_28690 29602 28247 gene locus_tag LOCUS_28700 29602 28247 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215932.1 protein_id gnl|my_center|LOCUS_28700 30123 29689 gene locus_tag LOCUS_28710 30123 29689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence041 797 135 gene locus_tag LOCUS_28720 797 135 CDS product DUF1559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144228759.1 protein_id gnl|my_center|LOCUS_28720 847 921 gene locus_tag LOCUS_t00380 847 921 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 982 1422 gene locus_tag LOCUS_28730 982 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 1445 2083 gene locus_tag LOCUS_28740 1445 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 2594 2070 gene locus_tag LOCUS_28750 2594 2070 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932608.1 protein_id gnl|my_center|LOCUS_28750 3102 2617 gene locus_tag LOCUS_28760 3102 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 3233 3508 gene locus_tag LOCUS_28770 3233 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 5786 7030 gene locus_tag LOCUS_28780 5786 7030 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231837.1 protein_id gnl|my_center|LOCUS_28780 7166 7411 gene locus_tag LOCUS_28790 7166 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 7864 8109 gene locus_tag LOCUS_28800 7864 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 8106 8537 gene locus_tag LOCUS_28810 8106 8537 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414624.1 protein_id gnl|my_center|LOCUS_28810 10021 8534 gene locus_tag LOCUS_28820 10021 8534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 10161 10385 gene locus_tag LOCUS_28830 10161 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 10410 11306 gene locus_tag LOCUS_28840 10410 11306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 11327 11731 gene locus_tag LOCUS_28850 11327 11731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 11740 12072 gene locus_tag LOCUS_28860 11740 12072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 13318 12116 gene locus_tag LOCUS_28870 13318 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 13425 13928 gene locus_tag LOCUS_28880 13425 13928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 14716 13925 gene locus_tag LOCUS_28890 14716 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28890 15761 14733 gene locus_tag LOCUS_28900 15761 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 17014 15758 gene locus_tag LOCUS_28910 17014 15758 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583806.1 protein_id gnl|my_center|LOCUS_28910 17898 17008 gene locus_tag LOCUS_28920 17898 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 19414 18128 gene locus_tag LOCUS_28930 19414 18128 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_28930 20484 19507 gene locus_tag LOCUS_28940 20484 19507 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228311.1 protein_id gnl|my_center|LOCUS_28940 21028 20567 gene locus_tag LOCUS_28950 21028 20567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 23011 21083 gene locus_tag LOCUS_28960 gene metG 23011 21083 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930950.1 protein_id gnl|my_center|LOCUS_28960 23105 23557 gene locus_tag LOCUS_28970 23105 23557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 23554 24393 gene locus_tag LOCUS_28980 23554 24393 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921895.1 protein_id gnl|my_center|LOCUS_28980 24467 25435 gene locus_tag LOCUS_28990 24467 25435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 26496 25432 gene locus_tag LOCUS_29000 26496 25432 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391697.1 protein_id gnl|my_center|LOCUS_29000 26470 27300 gene locus_tag LOCUS_29010 26470 27300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 27431 29437 gene locus_tag LOCUS_29020 gene ligA 27431 29437 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence042 659 1009 gene locus_tag LOCUS_29030 659 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2187 1069 gene locus_tag LOCUS_29040 2187 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 3116 2283 gene locus_tag LOCUS_29050 3116 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 3191 3658 gene locus_tag LOCUS_29060 gene purE 3191 3658 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880741.1 protein_id gnl|my_center|LOCUS_29060 3936 3655 gene locus_tag LOCUS_29070 3936 3655 CDS product DUF1905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225986.1 protein_id gnl|my_center|LOCUS_29070 5412 4003 gene locus_tag LOCUS_29080 gene glnA 5412 4003 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257332.1 protein_id gnl|my_center|LOCUS_29080 6060 5629 gene locus_tag LOCUS_29090 6060 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 6227 7633 gene locus_tag LOCUS_29100 6227 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 7635 8627 gene locus_tag LOCUS_29110 7635 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 9100 8624 gene locus_tag LOCUS_29120 gene ruvC 9100 8624 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081287.1 protein_id gnl|my_center|LOCUS_29120 9160 10131 gene locus_tag LOCUS_29130 9160 10131 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803698.1 protein_id gnl|my_center|LOCUS_29130 10648 10112 gene locus_tag LOCUS_29140 10648 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 11796 10651 gene locus_tag LOCUS_29150 11796 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 12379 12032 gene locus_tag LOCUS_29160 12379 12032 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230197.1 protein_id gnl|my_center|LOCUS_29160 13485 12466 gene locus_tag LOCUS_29170 13485 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 14293 13508 gene locus_tag LOCUS_29180 14293 13508 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_29180 15447 14290 gene locus_tag LOCUS_29190 15447 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 15953 15489 gene locus_tag LOCUS_29200 15953 15489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 17272 15950 gene locus_tag LOCUS_29210 17272 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 18335 17277 gene locus_tag LOCUS_29220 18335 17277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 19368 18328 gene locus_tag LOCUS_29230 19368 18328 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_29230 20405 19365 gene locus_tag LOCUS_29240 20405 19365 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_29240 22137 20410 gene locus_tag LOCUS_29250 22137 20410 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_29250 22520 23641 gene locus_tag LOCUS_29260 gene recF 22520 23641 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_29260 23634 24041 gene locus_tag LOCUS_29270 23634 24041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 24025 25434 gene locus_tag LOCUS_29280 24025 25434 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258481.1 protein_id gnl|my_center|LOCUS_29280 25464 26249 gene locus_tag LOCUS_29290 25464 26249 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888971.1 protein_id gnl|my_center|LOCUS_29290 26246 27673 gene locus_tag LOCUS_29300 26246 27673 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_29300 28452 27679 gene locus_tag LOCUS_29310 28452 27679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence043 481 747 gene locus_tag LOCUS_29320 481 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 1323 4481 gene locus_tag LOCUS_29330 1323 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 4490 7039 gene locus_tag LOCUS_29340 4490 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 7036 7935 gene locus_tag LOCUS_29350 7036 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 7932 10970 gene locus_tag LOCUS_29360 7932 10970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 10967 11692 gene locus_tag LOCUS_29370 10967 11692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 11689 16395 gene locus_tag LOCUS_29380 11689 16395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 16392 16913 gene locus_tag LOCUS_29390 16392 16913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 16910 19138 gene locus_tag LOCUS_29400 16910 19138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 19959 19195 gene locus_tag LOCUS_29410 19959 19195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 21024 20008 gene locus_tag LOCUS_29420 21024 20008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 21782 21141 gene locus_tag LOCUS_29430 gene queE 21782 21141 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189241.1 protein_id gnl|my_center|LOCUS_29430 22896 21787 gene locus_tag LOCUS_29440 22896 21787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 23597 22893 gene locus_tag LOCUS_29450 gene queC 23597 22893 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190026.1 protein_id gnl|my_center|LOCUS_29450 24681 23602 gene locus_tag LOCUS_29460 24681 23602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 25973 24678 gene locus_tag LOCUS_29470 25973 24678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 27084 25975 gene locus_tag LOCUS_29480 27084 25975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 28040 27129 gene locus_tag LOCUS_29490 28040 27129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence044 217 1821 gene locus_tag LOCUS_29500 217 1821 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113957.1 protein_id gnl|my_center|LOCUS_29500 3220 1916 gene locus_tag LOCUS_29510 3220 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 4304 3258 gene locus_tag LOCUS_29520 4304 3258 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_29520 5282 4314 gene locus_tag LOCUS_29530 gene deoC 5282 4314 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385062.1 protein_id gnl|my_center|LOCUS_29530 5318 6589 gene locus_tag LOCUS_29540 5318 6589 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_29540 6698 8026 gene locus_tag LOCUS_29550 6698 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 9457 8045 gene locus_tag LOCUS_29560 9457 8045 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_29560 9524 9961 gene locus_tag LOCUS_29570 9524 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 10192 11406 gene locus_tag LOCUS_29580 10192 11406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 12165 11644 gene locus_tag LOCUS_29590 12165 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 14022 12400 gene locus_tag LOCUS_29600 14022 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 15187 15876 gene locus_tag LOCUS_29610 15187 15876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 16002 16316 gene locus_tag LOCUS_29620 16002 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 17326 16313 gene locus_tag LOCUS_29630 17326 16313 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_29630 18618 17323 gene locus_tag LOCUS_29640 gene murA 18618 17323 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_29640 19991 18771 gene locus_tag LOCUS_29650 19991 18771 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123735.1 protein_id gnl|my_center|LOCUS_29650 20872 19988 gene locus_tag LOCUS_29660 20872 19988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29660 21630 20869 gene locus_tag LOCUS_29670 21630 20869 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_29670 22532 21627 gene locus_tag LOCUS_29680 22532 21627 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671643.1 protein_id gnl|my_center|LOCUS_29680 23721 22624 gene locus_tag LOCUS_29690 23721 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 25799 24003 gene locus_tag LOCUS_29700 25799 24003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 27004 25796 gene locus_tag LOCUS_29710 27004 25796 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228053.1 protein_id gnl|my_center|LOCUS_29710 27611 27036 gene locus_tag LOCUS_29720 27611 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence045 535 744 gene locus_tag LOCUS_29730 535 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 832 1122 gene locus_tag LOCUS_29740 832 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 1258 1473 gene locus_tag LOCUS_29750 1258 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 1484 1666 gene locus_tag LOCUS_29760 1484 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 1668 1934 gene locus_tag LOCUS_29770 1668 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 2095 2994 gene locus_tag LOCUS_29780 2095 2994 CDS product DUF932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107012.1 protein_id gnl|my_center|LOCUS_29780 3044 3442 gene locus_tag LOCUS_29790 3044 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 3507 3764 gene locus_tag LOCUS_29800 3507 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 3761 4324 gene locus_tag LOCUS_29810 3761 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 4321 4497 gene locus_tag LOCUS_29820 4321 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 4494 4847 gene locus_tag LOCUS_29830 4494 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 4850 5059 gene locus_tag LOCUS_29840 4850 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 5056 5271 gene locus_tag LOCUS_29850 5056 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 5268 5600 gene locus_tag LOCUS_29860 5268 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 5871 6665 gene locus_tag LOCUS_29870 5871 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 6662 7150 gene locus_tag LOCUS_29880 6662 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 7168 7473 gene locus_tag LOCUS_29890 7168 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 7470 8441 gene locus_tag LOCUS_29900 7470 8441 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_29900 8438 8806 gene locus_tag LOCUS_29910 8438 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 8844 9143 gene locus_tag LOCUS_29920 8844 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 9393 9869 gene locus_tag LOCUS_29930 9393 9869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 9866 10042 gene locus_tag LOCUS_29940 9866 10042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 10042 10218 gene locus_tag LOCUS_29950 10042 10218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 10215 10556 gene locus_tag LOCUS_29960 10215 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 10638 10853 gene locus_tag LOCUS_29970 10638 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 11245 10850 gene locus_tag LOCUS_29980 11245 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 12675 11242 gene locus_tag LOCUS_29990 12675 11242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 13034 12672 gene locus_tag LOCUS_30000 13034 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 15496 13031 gene locus_tag LOCUS_30010 15496 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 16146 15493 gene locus_tag LOCUS_30020 16146 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 17354 16143 gene locus_tag LOCUS_30030 17354 16143 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976127.1 protein_id gnl|my_center|LOCUS_30030 17669 17436 gene locus_tag LOCUS_30040 17669 17436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 17996 17718 gene locus_tag LOCUS_30050 17996 17718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 18324 18479 gene locus_tag LOCUS_30060 18324 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 18521 19048 gene locus_tag LOCUS_30070 18521 19048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 19048 20196 gene locus_tag LOCUS_30080 19048 20196 CDS product DUF2800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144597911.1 protein_id gnl|my_center|LOCUS_30080 20211 20861 gene locus_tag LOCUS_30090 20211 20861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 20909 21220 gene locus_tag LOCUS_30100 20909 21220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 21234 22175 gene locus_tag LOCUS_30110 21234 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 22356 22700 gene locus_tag LOCUS_30120 22356 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 22697 24049 gene locus_tag LOCUS_30130 gene dcm 22697 24049 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_212684827.1 protein_id gnl|my_center|LOCUS_30130 24046 25170 gene locus_tag LOCUS_30140 24046 25170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30140 25167 26225 gene locus_tag LOCUS_30150 25167 26225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 26228 26743 gene locus_tag LOCUS_30160 26228 26743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 >Feature sequence046 1073 1774 gene locus_tag LOCUS_30170 1073 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 1868 2101 gene locus_tag LOCUS_30180 1868 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 2462 2250 gene locus_tag LOCUS_30190 2462 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 3757 2465 gene locus_tag LOCUS_30200 3757 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 4287 3754 gene locus_tag LOCUS_30210 4287 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 4711 4361 gene locus_tag LOCUS_30220 4711 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 5700 4903 gene locus_tag LOCUS_30230 5700 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 7015 5672 gene locus_tag LOCUS_30240 7015 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 7073 8167 gene locus_tag LOCUS_30250 7073 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30250 8291 8578 gene locus_tag LOCUS_30260 8291 8578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097906.1 protein_id gnl|my_center|LOCUS_30260 9139 8954 gene locus_tag LOCUS_30270 9139 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 9065 11068 gene locus_tag LOCUS_30280 9065 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 11148 11675 gene locus_tag LOCUS_30290 11148 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 13250 11799 gene locus_tag LOCUS_30300 13250 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 13550 13702 gene locus_tag LOCUS_30310 13550 13702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 13751 14059 gene locus_tag LOCUS_30320 13751 14059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 14412 15077 gene locus_tag LOCUS_30330 14412 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 17036 15393 gene locus_tag LOCUS_30340 17036 15393 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_30340 17196 17005 gene locus_tag LOCUS_30350 17196 17005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 17624 17187 gene locus_tag LOCUS_30360 17624 17187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 17887 17621 gene locus_tag LOCUS_30370 17887 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 18482 17925 gene locus_tag LOCUS_30380 18482 17925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 18868 18479 gene locus_tag LOCUS_30390 18868 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 19092 19649 gene locus_tag LOCUS_30400 19092 19649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 19639 20511 gene locus_tag LOCUS_30410 19639 20511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 20536 22041 gene locus_tag LOCUS_30420 20536 22041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 22220 23167 gene locus_tag LOCUS_30430 22220 23167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 23581 26730 gene locus_tag LOCUS_30440 23581 26730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence047 843 406 gene locus_tag LOCUS_30450 843 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 1630 3645 gene locus_tag LOCUS_30460 1630 3645 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243690.1 protein_id gnl|my_center|LOCUS_30460 4563 3649 gene locus_tag LOCUS_30470 4563 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 5349 4591 gene locus_tag LOCUS_30480 5349 4591 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389445.1 protein_id gnl|my_center|LOCUS_30480 6706 5333 gene locus_tag LOCUS_30490 gene glmM 6706 5333 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234946.1 protein_id gnl|my_center|LOCUS_30490 7347 6703 gene locus_tag LOCUS_30500 gene grpE 7347 6703 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_30500 7362 7949 gene locus_tag LOCUS_30510 7362 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 8030 10312 gene locus_tag LOCUS_30520 8030 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 10339 11001 gene locus_tag LOCUS_30530 gene radC 10339 11001 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723232.1 protein_id gnl|my_center|LOCUS_30530 11007 11654 gene locus_tag LOCUS_30540 11007 11654 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_30540 11651 12577 gene locus_tag LOCUS_30550 11651 12577 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_30550 12619 13605 gene locus_tag LOCUS_30560 12619 13605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 13718 14839 gene locus_tag LOCUS_30570 13718 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 15730 14849 gene locus_tag LOCUS_30580 15730 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 16922 15735 gene locus_tag LOCUS_30590 16922 15735 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_30590 17453 16926 gene locus_tag LOCUS_30600 17453 16926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 18630 17596 gene locus_tag LOCUS_30610 gene queA 18630 17596 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723535.1 protein_id gnl|my_center|LOCUS_30610 19538 18621 gene locus_tag LOCUS_30620 19538 18621 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973315.1 protein_id gnl|my_center|LOCUS_30620 19969 19547 gene locus_tag LOCUS_30630 19969 19547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 20184 19966 gene locus_tag LOCUS_30640 gene csrA 20184 19966 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960595.1 protein_id gnl|my_center|LOCUS_30640 20685 20236 gene locus_tag LOCUS_30650 20685 20236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 21578 20694 gene locus_tag LOCUS_30660 21578 20694 CDS product flagellar hook-associated protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266408.1 protein_id gnl|my_center|LOCUS_30660 21967 23277 gene locus_tag LOCUS_30670 21967 23277 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_30670 23342 24619 gene locus_tag LOCUS_30680 23342 24619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 24616 25866 gene locus_tag LOCUS_30690 24616 25866 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880484.1 protein_id gnl|my_center|LOCUS_30690 25870 26202 gene locus_tag LOCUS_30700 25870 26202 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_30700 >Feature sequence048 1169 267 gene locus_tag LOCUS_30710 1169 267 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_30710 1211 1723 gene locus_tag LOCUS_30720 1211 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1852 3576 gene locus_tag LOCUS_30730 1852 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 3594 4823 gene locus_tag LOCUS_30740 3594 4823 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_30740 5048 6406 gene locus_tag LOCUS_30750 5048 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 6468 6866 gene locus_tag LOCUS_30760 6468 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 6863 7420 gene locus_tag LOCUS_30770 6863 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 7452 9041 gene locus_tag LOCUS_30780 7452 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 9038 9610 gene locus_tag LOCUS_30790 9038 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 9709 11481 gene locus_tag LOCUS_30800 9709 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 11492 12163 gene locus_tag LOCUS_30810 11492 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 13202 12237 gene locus_tag LOCUS_30820 13202 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 13340 14491 gene locus_tag LOCUS_30830 gene ispG 13340 14491 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056840.1 protein_id gnl|my_center|LOCUS_30830 14578 16922 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgggggtagctcccggagcctgatctgatacact 17519 17013 gene locus_tag LOCUS_30840 17519 17013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 18412 17516 gene locus_tag LOCUS_30850 gene cas1 18412 17516 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_30850 21468 18409 gene locus_tag LOCUS_30860 gene cas9 21468 18409 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_30860 21686 22492 gene locus_tag LOCUS_30870 gene accD 21686 22492 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_30870 22485 23456 gene locus_tag LOCUS_30880 22485 23456 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_30880 24121 23453 gene locus_tag LOCUS_30890 24121 23453 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_30890 24774 24277 gene locus_tag LOCUS_30900 24774 24277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 25021 24797 gene locus_tag LOCUS_30910 25021 24797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 25280 25062 gene locus_tag LOCUS_30920 25280 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 <26538 25434 gene locus_tag LOCUS_30930 <26538 25434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480344.1:DUF2336 domain-containing protein note possible pseudo, frameshifted >Feature sequence049 32 280 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgaatgtgaatcgtgaatcgtga 1001 381 gene locus_tag LOCUS_30940 gene upp 1001 381 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_30940 1939 998 gene locus_tag LOCUS_30950 1939 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 1997 3415 gene locus_tag LOCUS_30960 1997 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 3439 4482 gene locus_tag LOCUS_30970 3439 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 5669 4725 gene locus_tag LOCUS_30980 5669 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 6434 5679 gene locus_tag LOCUS_30990 6434 5679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 8479 6437 gene locus_tag LOCUS_31000 8479 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 9556 8495 gene locus_tag LOCUS_31010 9556 8495 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_31010 9581 10333 gene locus_tag LOCUS_31020 9581 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 10365 11861 gene locus_tag LOCUS_31030 gene crtI 10365 11861 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804092.1 protein_id gnl|my_center|LOCUS_31030 11858 12520 gene locus_tag LOCUS_31040 11858 12520 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404179.1 protein_id gnl|my_center|LOCUS_31040 12517 13467 gene locus_tag LOCUS_31050 12517 13467 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224196.1 protein_id gnl|my_center|LOCUS_31050 13445 15214 gene locus_tag LOCUS_31060 13445 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 15238 15954 gene locus_tag LOCUS_31070 15238 15954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 16666 15956 gene locus_tag LOCUS_31080 16666 15956 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776439.1 protein_id gnl|my_center|LOCUS_31080 18037 16688 gene locus_tag LOCUS_31090 18037 16688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 18214 20655 gene locus_tag LOCUS_31100 18214 20655 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935282.1 protein_id gnl|my_center|LOCUS_31100 20655 21359 gene locus_tag LOCUS_31110 20655 21359 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902581.1 protein_id gnl|my_center|LOCUS_31110 21356 22729 gene locus_tag LOCUS_31120 21356 22729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 22743 23255 gene locus_tag LOCUS_31130 22743 23255 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808186.1 protein_id gnl|my_center|LOCUS_31130 23259 24443 gene locus_tag LOCUS_31140 23259 24443 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942293.1 protein_id gnl|my_center|LOCUS_31140 24653 25411 gene locus_tag LOCUS_31150 24653 25411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 >Feature sequence050 346 2922 gene locus_tag LOCUS_31160 346 2922 CDS product M14 family zinc carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041976239.1 protein_id gnl|my_center|LOCUS_31160 2919 3329 gene locus_tag LOCUS_31170 2919 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 3326 4063 gene locus_tag LOCUS_31180 3326 4063 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535062.1 protein_id gnl|my_center|LOCUS_31180 4826 4080 gene locus_tag LOCUS_31190 4826 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 6230 4860 gene locus_tag LOCUS_31200 gene dnaA 6230 4860 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391551.1 protein_id gnl|my_center|LOCUS_31200 6482 8443 gene locus_tag LOCUS_31210 6482 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 8485 9030 gene locus_tag LOCUS_31220 8485 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 9050 10087 gene locus_tag LOCUS_31230 9050 10087 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730275.1 protein_id gnl|my_center|LOCUS_31230 10097 10312 gene locus_tag LOCUS_31240 10097 10312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 10302 11132 gene locus_tag LOCUS_31250 10302 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 11129 11914 gene locus_tag LOCUS_31260 gene hisF 11129 11914 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_31260 11976 13184 gene locus_tag LOCUS_31270 11976 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 13225 14019 gene locus_tag LOCUS_31280 13225 14019 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531001.1 protein_id gnl|my_center|LOCUS_31280 14043 14873 gene locus_tag LOCUS_31290 14043 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 14922 16010 gene locus_tag LOCUS_31300 14922 16010 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085128.1 protein_id gnl|my_center|LOCUS_31300 16084 16710 gene locus_tag LOCUS_31310 16084 16710 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_31310 17780 16833 gene locus_tag LOCUS_31320 17780 16833 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_31320 19022 17784 gene locus_tag LOCUS_31330 19022 17784 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_31330 19893 19027 gene locus_tag LOCUS_31340 19893 19027 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_31340 20657 19896 gene locus_tag LOCUS_31350 20657 19896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 20864 22366 gene locus_tag LOCUS_31360 20864 22366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 22827 22363 gene locus_tag LOCUS_31370 22827 22363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 24221 22824 gene locus_tag LOCUS_31380 24221 22824 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804146.1 protein_id gnl|my_center|LOCUS_31380 24680 24312 gene locus_tag LOCUS_31390 24680 24312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 24882 24667 gene locus_tag LOCUS_31400 24882 24667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 25055 25444 gene locus_tag LOCUS_31410 25055 25444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence051 2383 1574 gene locus_tag LOCUS_31420 2383 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 3427 2492 gene locus_tag LOCUS_31430 3427 2492 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226301.1 protein_id gnl|my_center|LOCUS_31430 3495 4040 gene locus_tag LOCUS_31440 3495 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 6163 3995 gene locus_tag LOCUS_31450 6163 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 7456 6218 gene locus_tag LOCUS_31460 7456 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 7511 7948 gene locus_tag LOCUS_31470 gene rpiB 7511 7948 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_31470 8886 7945 gene locus_tag LOCUS_31480 8886 7945 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287347.1 protein_id gnl|my_center|LOCUS_31480 10307 8901 gene locus_tag LOCUS_31490 gene glmU 10307 8901 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000073770.1 protein_id gnl|my_center|LOCUS_31490 11855 10392 gene locus_tag LOCUS_31500 11855 10392 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_31500 11923 13422 gene locus_tag LOCUS_31510 11923 13422 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926191.1 protein_id gnl|my_center|LOCUS_31510 14466 13495 gene locus_tag LOCUS_31520 14466 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 15984 14677 gene locus_tag LOCUS_31530 15984 14677 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_31530 17503 15995 gene locus_tag LOCUS_31540 17503 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 17736 19886 gene locus_tag LOCUS_31550 17736 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 19961 21217 gene locus_tag LOCUS_31560 19961 21217 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228287.1 protein_id gnl|my_center|LOCUS_31560 21402 22475 gene locus_tag LOCUS_31570 21402 22475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258901.1 protein_id gnl|my_center|LOCUS_31570 22484 23155 gene locus_tag LOCUS_31580 22484 23155 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_31580 >Feature sequence052 <1 1458 gene locus_tag LOCUS_31590 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615874.1:CusA/CzcA family heavy metal efflux RND transporter 1455 3902 gene locus_tag LOCUS_31600 1455 3902 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402897.1 protein_id gnl|my_center|LOCUS_31600 3899 4516 gene locus_tag LOCUS_31610 3899 4516 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_31610 4993 5418 gene locus_tag LOCUS_31620 4993 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 5408 6748 gene locus_tag LOCUS_31630 5408 6748 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003917061.1 protein_id gnl|my_center|LOCUS_31630 6745 7557 gene locus_tag LOCUS_31640 6745 7557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 8184 7603 gene locus_tag LOCUS_31650 8184 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 8332 8174 gene locus_tag LOCUS_31660 8332 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 10890 8458 gene locus_tag LOCUS_31670 10890 8458 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528058.1 protein_id gnl|my_center|LOCUS_31670 11078 12598 gene locus_tag LOCUS_31680 11078 12598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 12595 13995 gene locus_tag LOCUS_31690 gene zraR 12595 13995 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_31690 14148 14552 gene locus_tag LOCUS_31700 14148 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 14579 15973 gene locus_tag LOCUS_31710 14579 15973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 15970 17868 gene locus_tag LOCUS_31720 15970 17868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 17865 21638 gene locus_tag LOCUS_31730 17865 21638 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_31730 >Feature sequence053 2767 1610 gene locus_tag LOCUS_31740 2767 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 2685 2873 gene locus_tag LOCUS_31750 2685 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 3112 4548 gene locus_tag LOCUS_31760 3112 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 4464 4389 gene locus_tag LOCUS_t00390 4464 4389 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4559 4484 gene locus_tag LOCUS_t00400 4559 4484 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 6271 4682 gene locus_tag LOCUS_31770 6271 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 7586 6360 gene locus_tag LOCUS_31780 7586 6360 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_31780 8358 7759 gene locus_tag LOCUS_31790 8358 7759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 10784 8376 gene locus_tag LOCUS_31800 gene priA 10784 8376 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378970.1 protein_id gnl|my_center|LOCUS_31800 11427 10813 gene locus_tag LOCUS_31810 11427 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 11538 12941 gene locus_tag LOCUS_31820 gene dnaB 11538 12941 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_31820 14422 13058 gene locus_tag LOCUS_31830 14422 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 16757 14583 gene locus_tag LOCUS_31840 16757 14583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 16834 17535 gene locus_tag LOCUS_31850 16834 17535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 18634 17543 gene locus_tag LOCUS_31860 gene nagA 18634 17543 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_31860 18691 20013 gene locus_tag LOCUS_31870 18691 20013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 21632 20010 gene locus_tag LOCUS_31880 21632 20010 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036986.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence054 465 794 gene locus_tag LOCUS_31890 465 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 796 1845 gene locus_tag LOCUS_31900 gene dusB 796 1845 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642089.1 protein_id gnl|my_center|LOCUS_31900 2743 1814 gene locus_tag LOCUS_31910 2743 1814 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977097.1 protein_id gnl|my_center|LOCUS_31910 2878 5157 gene locus_tag LOCUS_31920 2878 5157 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582880.1 protein_id gnl|my_center|LOCUS_31920 5290 7311 gene locus_tag LOCUS_31930 5290 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 7319 9277 gene locus_tag LOCUS_31940 7319 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 9310 11493 gene locus_tag LOCUS_31950 9310 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 11534 12397 gene locus_tag LOCUS_31960 11534 12397 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921772.1 protein_id gnl|my_center|LOCUS_31960 13001 12399 gene locus_tag LOCUS_31970 13001 12399 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258750.1 protein_id gnl|my_center|LOCUS_31970 13458 13003 gene locus_tag LOCUS_31980 13458 13003 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_31980 13516 13992 gene locus_tag LOCUS_31990 13516 13992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 13982 14314 gene locus_tag LOCUS_32000 13982 14314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 15378 14311 gene locus_tag LOCUS_32010 15378 14311 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_32010 15468 15806 gene locus_tag LOCUS_32020 15468 15806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 16246 15932 gene locus_tag LOCUS_32030 16246 15932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 16352 17488 gene locus_tag LOCUS_32040 16352 17488 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_32040 18418 17504 gene locus_tag LOCUS_32050 18418 17504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 19337 18435 gene locus_tag LOCUS_32060 19337 18435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 20301 19348 gene locus_tag LOCUS_32070 20301 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 21208 20321 gene locus_tag LOCUS_32080 21208 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 >Feature sequence055 124 1050 gene locus_tag LOCUS_32090 124 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404655.1 protein_id gnl|my_center|LOCUS_32090 1052 2257 gene locus_tag LOCUS_32100 1052 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 2254 3285 gene locus_tag LOCUS_32110 gene gmd 2254 3285 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880676.1 protein_id gnl|my_center|LOCUS_32110 3282 4064 gene locus_tag LOCUS_32120 3282 4064 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732022.1 protein_id gnl|my_center|LOCUS_32120 4225 5679 gene locus_tag LOCUS_32130 4225 5679 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337967.1 protein_id gnl|my_center|LOCUS_32130 6373 5726 gene locus_tag LOCUS_32140 6373 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 7873 6407 gene locus_tag LOCUS_32150 gene dop 7873 6407 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977179.1 protein_id gnl|my_center|LOCUS_32150 7927 9021 gene locus_tag LOCUS_32160 7927 9021 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_32160 9014 9883 gene locus_tag LOCUS_32170 9014 9883 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258568.1 protein_id gnl|my_center|LOCUS_32170 9864 10763 gene locus_tag LOCUS_32180 9864 10763 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_32180 10760 12907 gene locus_tag LOCUS_32190 10760 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 16900 14654 gene locus_tag LOCUS_32200 16900 14654 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530142.1 protein_id gnl|my_center|LOCUS_32200 17890 16931 gene locus_tag LOCUS_32210 17890 16931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 18375 17890 gene locus_tag LOCUS_32220 18375 17890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 18998 18372 gene locus_tag LOCUS_32230 18998 18372 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_32230 19600 19103 gene locus_tag LOCUS_32240 19600 19103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 21015 19684 gene locus_tag LOCUS_32250 21015 19684 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087600.1 protein_id gnl|my_center|LOCUS_32250 <21963 21045 gene locus_tag LOCUS_32260 <21963 21045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065778.1:tetratricopeptide repeat protein >Feature sequence056 1127 531 gene locus_tag LOCUS_32270 1127 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 1894 1169 gene locus_tag LOCUS_32280 1894 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3146 2061 gene locus_tag LOCUS_32290 3146 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 4234 3143 gene locus_tag LOCUS_32300 4234 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 4547 4227 gene locus_tag LOCUS_32310 4547 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 4875 5693 gene locus_tag LOCUS_32320 4875 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 6084 6743 gene locus_tag LOCUS_32330 6084 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 7048 7620 gene locus_tag LOCUS_32340 7048 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 7630 8328 gene locus_tag LOCUS_32350 7630 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 8956 8402 gene locus_tag LOCUS_32360 8956 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 10169 8961 gene locus_tag LOCUS_32370 10169 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 10292 10570 gene locus_tag LOCUS_32380 10292 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 10567 11484 gene locus_tag LOCUS_32390 10567 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 11484 13268 gene locus_tag LOCUS_32400 11484 13268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 14978 13281 gene locus_tag LOCUS_32410 14978 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 15175 17406 gene locus_tag LOCUS_32420 15175 17406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 17406 17864 gene locus_tag LOCUS_32430 17406 17864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 17861 19213 gene locus_tag LOCUS_32440 17861 19213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 19235 19471 gene locus_tag LOCUS_32450 19235 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 19739 20479 gene locus_tag LOCUS_32460 19739 20479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence057 448 107 gene locus_tag LOCUS_32470 448 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 644 1264 gene locus_tag LOCUS_32480 644 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32480 1317 1910 gene locus_tag LOCUS_32490 1317 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 2332 1907 gene locus_tag LOCUS_32500 2332 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 2331 2846 gene locus_tag LOCUS_32510 2331 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 2843 3520 gene locus_tag LOCUS_32520 2843 3520 CDS product pyrimidine reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224546.1 protein_id gnl|my_center|LOCUS_32520 4833 3517 gene locus_tag LOCUS_32530 4833 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 6486 4954 gene locus_tag LOCUS_32540 6486 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 8262 6505 gene locus_tag LOCUS_32550 8262 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 9986 8322 gene locus_tag LOCUS_32560 9986 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 10189 10902 gene locus_tag LOCUS_32570 10189 10902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 11712 11008 gene locus_tag LOCUS_32580 11712 11008 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969450.1 protein_id gnl|my_center|LOCUS_32580 12587 11709 gene locus_tag LOCUS_32590 12587 11709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 12711 13667 gene locus_tag LOCUS_32600 gene mtnA 12711 13667 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258877.1 protein_id gnl|my_center|LOCUS_32600 13789 15174 gene locus_tag LOCUS_32610 gene purF 13789 15174 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_32610 15192 16127 gene locus_tag LOCUS_32620 15192 16127 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189376240.1 protein_id gnl|my_center|LOCUS_32620 16129 17058 gene locus_tag LOCUS_32630 16129 17058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 17849 17151 gene locus_tag LOCUS_32640 17849 17151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 18424 17846 gene locus_tag LOCUS_32650 18424 17846 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_32650 18553 18906 gene locus_tag LOCUS_32660 18553 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 18924 20312 gene locus_tag LOCUS_32670 18924 20312 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004555126.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence058 2559 556 gene locus_tag LOCUS_32680 2559 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 2678 6427 gene locus_tag LOCUS_32690 2678 6427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 6453 7544 gene locus_tag LOCUS_32700 6453 7544 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_32700 7649 8437 gene locus_tag LOCUS_32710 7649 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 8488 9099 gene locus_tag LOCUS_32720 gene rpsD 8488 9099 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583370.1 protein_id gnl|my_center|LOCUS_32720 9116 10027 gene locus_tag LOCUS_32730 9116 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 10416 10039 gene locus_tag LOCUS_32740 10416 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 10636 11418 gene locus_tag LOCUS_32750 10636 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 11481 12017 gene locus_tag LOCUS_32760 11481 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 13066 11954 gene locus_tag LOCUS_32770 13066 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 14334 13063 gene locus_tag LOCUS_32780 14334 13063 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_32780 14425 15036 gene locus_tag LOCUS_32790 14425 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 16289 15033 gene locus_tag LOCUS_32800 16289 15033 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_32800 16337 17269 gene locus_tag LOCUS_32810 16337 17269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 18213 17266 gene locus_tag LOCUS_32820 gene ispH 18213 17266 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221497.1 protein_id gnl|my_center|LOCUS_32820 18294 20081 gene locus_tag LOCUS_32830 gene fucI 18294 20081 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence059 1762 227 gene locus_tag LOCUS_32840 1762 227 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921302.1 protein_id gnl|my_center|LOCUS_32840 4701 1765 gene locus_tag LOCUS_32850 4701 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 6598 4796 gene locus_tag LOCUS_32860 6598 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 8543 6579 gene locus_tag LOCUS_32870 8543 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 10198 8615 gene locus_tag LOCUS_32880 gene murJ 10198 8615 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_32880 11867 10227 gene locus_tag LOCUS_32890 11867 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 12639 11905 gene locus_tag LOCUS_32900 12639 11905 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_32900 12691 13965 gene locus_tag LOCUS_32910 12691 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922607.1 protein_id gnl|my_center|LOCUS_32910 14052 14570 gene locus_tag LOCUS_32920 14052 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 16090 14642 gene locus_tag LOCUS_32930 16090 14642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 16235 16663 gene locus_tag LOCUS_32940 16235 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 16674 17177 gene locus_tag LOCUS_32950 16674 17177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 17571 17179 gene locus_tag LOCUS_32960 gene mntR 17571 17179 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327586.1 protein_id gnl|my_center|LOCUS_32960 18918 18646 gene locus_tag LOCUS_32970 18918 18646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence060 893 507 gene locus_tag LOCUS_32980 893 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 2011 890 gene locus_tag LOCUS_32990 2011 890 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868783.1 protein_id gnl|my_center|LOCUS_32990 2089 3597 gene locus_tag LOCUS_33000 2089 3597 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442661.1 protein_id gnl|my_center|LOCUS_33000 4903 3632 gene locus_tag LOCUS_33010 4903 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 6005 4974 gene locus_tag LOCUS_33020 6005 4974 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836546.1 protein_id gnl|my_center|LOCUS_33020 6431 6180 gene locus_tag LOCUS_33030 6431 6180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 6524 7768 gene locus_tag LOCUS_33040 6524 7768 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_33040 8062 9327 gene locus_tag LOCUS_33050 8062 9327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 9343 10629 gene locus_tag LOCUS_33060 9343 10629 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_33060 10702 11262 gene locus_tag LOCUS_33070 10702 11262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 11259 11999 gene locus_tag LOCUS_33080 11259 11999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 13049 12423 gene locus_tag LOCUS_33090 13049 12423 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230784.1 protein_id gnl|my_center|LOCUS_33090 13079 13747 gene locus_tag LOCUS_33100 13079 13747 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918966.1 protein_id gnl|my_center|LOCUS_33100 13790 14938 gene locus_tag LOCUS_33110 13790 14938 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_33110 15917 14949 gene locus_tag LOCUS_33120 gene galT 15917 14949 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229184.1 protein_id gnl|my_center|LOCUS_33120 16991 15930 gene locus_tag LOCUS_33130 16991 15930 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_33130 17449 16991 gene locus_tag LOCUS_33140 17449 16991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 17738 17451 gene locus_tag LOCUS_33150 gene rpsF 17738 17451 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_33150 18468 17803 gene locus_tag LOCUS_33160 18468 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 >Feature sequence061 702 97 gene locus_tag LOCUS_33170 702 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 1833 838 gene locus_tag LOCUS_33180 1833 838 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003573417.1 protein_id gnl|my_center|LOCUS_33180 3311 1833 gene locus_tag LOCUS_33190 3311 1833 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338818.1 protein_id gnl|my_center|LOCUS_33190 3374 4150 gene locus_tag LOCUS_33200 3374 4150 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034286316.1 protein_id gnl|my_center|LOCUS_33200 4147 4341 gene locus_tag LOCUS_33210 4147 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 5811 4366 gene locus_tag LOCUS_33220 gene glpK 5811 4366 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261933.1 protein_id gnl|my_center|LOCUS_33220 6275 5808 gene locus_tag LOCUS_33230 6275 5808 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_33230 6346 7971 gene locus_tag LOCUS_33240 6346 7971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 8528 7956 gene locus_tag LOCUS_33250 8528 7956 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015463.1 protein_id gnl|my_center|LOCUS_33250 10054 8528 gene locus_tag LOCUS_33260 gene lysS 10054 8528 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809769.1 protein_id gnl|my_center|LOCUS_33260 10442 10948 gene locus_tag LOCUS_33270 10442 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 10842 11111 gene locus_tag LOCUS_33280 10842 11111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 11770 11255 gene locus_tag LOCUS_33290 11770 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 12185 11877 gene locus_tag LOCUS_33300 12185 11877 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257604.1 protein_id gnl|my_center|LOCUS_33300 12966 12187 gene locus_tag LOCUS_33310 gene folE2 12966 12187 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_33310 13127 13564 gene locus_tag LOCUS_33320 13127 13564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 13561 14394 gene locus_tag LOCUS_33330 gene nadC 13561 14394 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942603.1 protein_id gnl|my_center|LOCUS_33330 14391 15104 gene locus_tag LOCUS_33340 14391 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 16050 15148 gene locus_tag LOCUS_33350 16050 15148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_33350 16432 16052 gene locus_tag LOCUS_33360 16432 16052 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416451.1 protein_id gnl|my_center|LOCUS_33360 17055 16465 gene locus_tag LOCUS_33370 gene pth 17055 16465 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_33370 17117 17204 gene locus_tag LOCUS_t00410 17117 17204 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18744 18469 gene locus_tag LOCUS_33380 18744 18469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 >Feature sequence062 1062 22 gene locus_tag LOCUS_33390 1062 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 1112 2821 gene locus_tag LOCUS_33400 1112 2821 CDS product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867884.1 protein_id gnl|my_center|LOCUS_33400 4068 2818 gene locus_tag LOCUS_33410 4068 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 4493 4074 gene locus_tag LOCUS_33420 4493 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 5156 4530 gene locus_tag LOCUS_33430 5156 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 5446 5156 gene locus_tag LOCUS_33440 5446 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 6000 5443 gene locus_tag LOCUS_33450 6000 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 6521 5997 gene locus_tag LOCUS_33460 6521 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 7980 6586 gene locus_tag LOCUS_33470 7980 6586 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_33470 8270 7977 gene locus_tag LOCUS_33480 8270 7977 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223978.1 protein_id gnl|my_center|LOCUS_33480 9472 8267 gene locus_tag LOCUS_33490 9472 8267 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_33490 9607 11055 gene locus_tag LOCUS_33500 gene crtI 9607 11055 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_134752840.1 protein_id gnl|my_center|LOCUS_33500 12034 11066 gene locus_tag LOCUS_33510 12034 11066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 12085 12501 gene locus_tag LOCUS_33520 12085 12501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 13407 12520 gene locus_tag LOCUS_33530 13407 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 14926 13475 gene locus_tag LOCUS_33540 14926 13475 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889170.1 protein_id gnl|my_center|LOCUS_33540 15108 15797 gene locus_tag LOCUS_33550 15108 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 16808 15804 gene locus_tag LOCUS_33560 16808 15804 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_33560 16853 18154 gene locus_tag LOCUS_33570 16853 18154 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_33570 >Feature sequence063 <1 886 gene locus_tag LOCUS_33580 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390320.1:cysteine desulfurase 883 1311 gene locus_tag LOCUS_33590 883 1311 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_33590 1308 1628 gene locus_tag LOCUS_33600 1308 1628 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213210.1 protein_id gnl|my_center|LOCUS_33600 1628 2107 gene locus_tag LOCUS_33610 1628 2107 CDS product RrF2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479949.1 protein_id gnl|my_center|LOCUS_33610 2109 2441 gene locus_tag LOCUS_33620 2109 2441 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144365.1 protein_id gnl|my_center|LOCUS_33620 3884 2499 gene locus_tag LOCUS_33630 3884 2499 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328455.1 protein_id gnl|my_center|LOCUS_33630 5571 3862 gene locus_tag LOCUS_33640 gene recJ 5571 3862 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_33640 6127 5639 gene locus_tag LOCUS_33650 6127 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 6286 6792 gene locus_tag LOCUS_33660 6286 6792 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061729.1 protein_id gnl|my_center|LOCUS_33660 6785 7804 gene locus_tag LOCUS_33670 6785 7804 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_33670 7810 8919 gene locus_tag LOCUS_33680 7810 8919 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_33680 8930 10195 gene locus_tag LOCUS_33690 8930 10195 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 protein_id gnl|my_center|LOCUS_33690 10207 12348 gene locus_tag LOCUS_33700 10207 12348 CDS product bi-domain-containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924817.1 protein_id gnl|my_center|LOCUS_33700 12433 12981 gene locus_tag LOCUS_33710 12433 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 12986 13720 gene locus_tag LOCUS_33720 12986 13720 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_33720 13734 15596 gene locus_tag LOCUS_33730 13734 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 17031 15604 gene locus_tag LOCUS_33740 17031 15604 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246263.1 protein_id gnl|my_center|LOCUS_33740 >Feature sequence064 1602 2819 gene locus_tag LOCUS_33750 1602 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 3036 3353 gene locus_tag LOCUS_33760 3036 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 3397 4482 gene locus_tag LOCUS_33770 3397 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 4490 5212 gene locus_tag LOCUS_33780 4490 5212 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863367.1 protein_id gnl|my_center|LOCUS_33780 5188 6609 gene locus_tag LOCUS_33790 5188 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 6606 9938 gene locus_tag LOCUS_33800 6606 9938 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104752311.1 protein_id gnl|my_center|LOCUS_33800 9916 11490 gene locus_tag LOCUS_33810 9916 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 11494 13962 gene locus_tag LOCUS_33820 11494 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 13959 16208 gene locus_tag LOCUS_33830 13959 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence065 682 77 gene locus_tag LOCUS_33840 682 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 2304 916 gene locus_tag LOCUS_33850 gene leuC 2304 916 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095560.1 protein_id gnl|my_center|LOCUS_33850 2967 2458 gene locus_tag LOCUS_33860 2967 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 2857 3138 gene locus_tag LOCUS_33870 2857 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 3135 3596 gene locus_tag LOCUS_33880 3135 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 3606 4652 gene locus_tag LOCUS_33890 3606 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 4711 5187 gene locus_tag LOCUS_33900 4711 5187 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 protein_id gnl|my_center|LOCUS_33900 8113 5144 gene locus_tag LOCUS_33910 8113 5144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 8231 8157 gene locus_tag LOCUS_t00420 8231 8157 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8355 8270 gene locus_tag LOCUS_t00430 8355 8270 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 9970 8453 gene locus_tag LOCUS_33920 9970 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 10368 11312 gene locus_tag LOCUS_33930 10368 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 11803 11973 gene locus_tag LOCUS_33940 11803 11973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 12120 12563 gene locus_tag LOCUS_33950 12120 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 12759 13502 gene locus_tag LOCUS_33960 12759 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 13568 14212 gene locus_tag LOCUS_33970 13568 14212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 14232 14444 gene locus_tag LOCUS_33980 14232 14444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 14907 15404 gene locus_tag LOCUS_33990 14907 15404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 15408 16232 gene locus_tag LOCUS_34000 15408 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 >Feature sequence066 445 1245 gene locus_tag LOCUS_34010 445 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_34010 1232 1783 gene locus_tag LOCUS_34020 1232 1783 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_34020 1798 5238 gene locus_tag LOCUS_34030 gene brxC 1798 5238 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_34030 5252 8623 gene locus_tag LOCUS_34040 5252 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 8628 9593 gene locus_tag LOCUS_34050 8628 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 9590 11422 gene locus_tag LOCUS_34060 9590 11422 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113630057.1 protein_id gnl|my_center|LOCUS_34060 11413 13758 gene locus_tag LOCUS_34070 gene pglZ 11413 13758 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_34070 13762 15810 gene locus_tag LOCUS_34080 gene brxL 13762 15810 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_34080 16074 15919 gene locus_tag LOCUS_34090 16074 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 >Feature sequence067 1090 608 gene locus_tag LOCUS_34100 1090 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 1112 2350 gene locus_tag LOCUS_34110 1112 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 2566 2883 gene locus_tag LOCUS_34120 2566 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 2926 3744 gene locus_tag LOCUS_34130 2926 3744 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003141.1 protein_id gnl|my_center|LOCUS_34130 3734 4474 gene locus_tag LOCUS_34140 3734 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 4450 5871 gene locus_tag LOCUS_34150 4450 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 5868 9200 gene locus_tag LOCUS_34160 5868 9200 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104752311.1 protein_id gnl|my_center|LOCUS_34160 9178 10752 gene locus_tag LOCUS_34170 9178 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 10757 13216 gene locus_tag LOCUS_34180 10757 13216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 13213 15465 gene locus_tag LOCUS_34190 13213 15465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 >Feature sequence068 261 5117 gene locus_tag LOCUS_34200 261 5117 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229642.1 protein_id gnl|my_center|LOCUS_34200 5142 6668 gene locus_tag LOCUS_34210 5142 6668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 6726 12110 gene locus_tag LOCUS_34220 6726 12110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34220 12031 13149 gene locus_tag LOCUS_34230 12031 13149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 13146 15272 gene locus_tag LOCUS_34240 13146 15272 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218177.1 protein_id gnl|my_center|LOCUS_34240 >Feature sequence069 341 1438 gene locus_tag LOCUS_34250 341 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 1451 2320 gene locus_tag LOCUS_34260 1451 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 2558 2911 gene locus_tag LOCUS_34270 2558 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 2979 4295 gene locus_tag LOCUS_34280 gene mukF 2979 4295 CDS product chromosome partition protein MukF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706221.1 protein_id gnl|my_center|LOCUS_34280 4288 4947 gene locus_tag LOCUS_34290 gene mukE 4288 4947 CDS product chromosome partition protein MukE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706220.1 protein_id gnl|my_center|LOCUS_34290 4944 9380 gene locus_tag LOCUS_34300 gene mukB 4944 9380 CDS product chromosome partition protein MukB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706219.1 protein_id gnl|my_center|LOCUS_34300 9364 10335 gene locus_tag LOCUS_34310 9364 10335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 12115 11075 gene locus_tag LOCUS_34320 12115 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 12450 14738 gene locus_tag LOCUS_34330 12450 14738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 14745 15170 gene locus_tag LOCUS_34340 14745 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence070 25 1407 gene locus_tag LOCUS_34350 25 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 1796 1404 gene locus_tag LOCUS_34360 1796 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 2497 1850 gene locus_tag LOCUS_34370 2497 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 2649 3167 gene locus_tag LOCUS_34380 2649 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34380 3408 3935 gene locus_tag LOCUS_34390 3408 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 3997 5103 gene locus_tag LOCUS_34400 3997 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 5303 5512 gene locus_tag LOCUS_34410 5303 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 5608 5835 gene locus_tag LOCUS_34420 5608 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 6029 6298 gene locus_tag LOCUS_34430 6029 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 6354 6593 gene locus_tag LOCUS_34440 6354 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 6583 6957 gene locus_tag LOCUS_34450 6583 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 6950 7174 gene locus_tag LOCUS_34460 6950 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 7171 8028 gene locus_tag LOCUS_34470 7171 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 8233 8012 gene locus_tag LOCUS_34480 8233 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 8684 8178 gene locus_tag LOCUS_34490 8684 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 9112 8681 gene locus_tag LOCUS_34500 9112 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 11120 9126 gene locus_tag LOCUS_34510 11120 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 11794 11120 gene locus_tag LOCUS_34520 11794 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 12240 11791 gene locus_tag LOCUS_34530 12240 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 12785 12291 gene locus_tag LOCUS_34540 gene ssb 12785 12291 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806953.1 protein_id gnl|my_center|LOCUS_34540 13585 12782 gene locus_tag LOCUS_34550 13585 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 14673 13903 gene locus_tag LOCUS_34560 14673 13903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 >Feature sequence071 56 1351 gene locus_tag LOCUS_34570 56 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 2024 2914 gene locus_tag LOCUS_34580 2024 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 3946 2918 gene locus_tag LOCUS_34590 3946 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 5629 3950 gene locus_tag LOCUS_34600 5629 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 6429 5626 gene locus_tag LOCUS_34610 6429 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 7273 6413 gene locus_tag LOCUS_34620 7273 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 7590 7273 gene locus_tag LOCUS_34630 7590 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 7856 7587 gene locus_tag LOCUS_34640 7856 7587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 9213 7990 gene locus_tag LOCUS_34650 9213 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 10501 9143 gene locus_tag LOCUS_34660 10501 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 11769 10498 gene locus_tag LOCUS_34670 11769 10498 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242904.1 protein_id gnl|my_center|LOCUS_34670 11883 12596 gene locus_tag LOCUS_34680 11883 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 12593 13459 gene locus_tag LOCUS_34690 12593 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence072 1 213 gene locus_tag LOCUS_34700 1 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 186 776 gene locus_tag LOCUS_34710 gene vpsN 186 776 CDS product exopolysaccharide export protein VpsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978825.1 protein_id gnl|my_center|LOCUS_34710 786 1985 gene locus_tag LOCUS_34720 786 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34720 1868 2200 gene locus_tag LOCUS_34730 1868 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 2739 3158 gene locus_tag LOCUS_34740 2739 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 3168 4514 gene locus_tag LOCUS_34750 3168 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 4623 6608 gene locus_tag LOCUS_34760 4623 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 6672 7430 gene locus_tag LOCUS_34770 6672 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 7434 8351 gene locus_tag LOCUS_34780 7434 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 9498 8281 gene locus_tag LOCUS_34790 9498 8281 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940254.1 protein_id gnl|my_center|LOCUS_34790 10729 9500 gene locus_tag LOCUS_34800 10729 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 10779 11447 gene locus_tag LOCUS_34810 10779 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 12037 11453 gene locus_tag LOCUS_34820 12037 11453 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088749.1 protein_id gnl|my_center|LOCUS_34820 13338 12034 gene locus_tag LOCUS_34830 13338 12034 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118891.1 protein_id gnl|my_center|LOCUS_34830 <14694 13344 gene locus_tag LOCUS_34840 <14694 13344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001207182.1:CpsD/CapB family tyrosine-protein kinase >Feature sequence073 824 366 gene locus_tag LOCUS_34850 824 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 2116 836 gene locus_tag LOCUS_34860 gene sufD 2116 836 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390321.1 protein_id gnl|my_center|LOCUS_34860 2940 2119 gene locus_tag LOCUS_34870 gene sufC 2940 2119 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_34870 3011 3475 gene locus_tag LOCUS_34880 3011 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3508 4455 gene locus_tag LOCUS_34890 3508 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 4471 4908 gene locus_tag LOCUS_34900 4471 4908 CDS product 1-methylthio-xylulose 5-phosphate sulfo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389753.1 protein_id gnl|my_center|LOCUS_34900 4905 6290 gene locus_tag LOCUS_34910 4905 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 6360 7646 gene locus_tag LOCUS_34920 6360 7646 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223825.1 protein_id gnl|my_center|LOCUS_34920 8748 7654 gene locus_tag LOCUS_34930 8748 7654 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928605.1 protein_id gnl|my_center|LOCUS_34930 9647 8772 gene locus_tag LOCUS_34940 9647 8772 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140650.1 protein_id gnl|my_center|LOCUS_34940 10350 9631 gene locus_tag LOCUS_34950 gene ftsE 10350 9631 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985455.1 protein_id gnl|my_center|LOCUS_34950 11709 10366 gene locus_tag LOCUS_34960 gene cpsG 11709 10366 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097871.1 protein_id gnl|my_center|LOCUS_34960 11907 12197 gene locus_tag LOCUS_34970 gene gatC 11907 12197 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257310.1 protein_id gnl|my_center|LOCUS_34970 12207 13658 gene locus_tag LOCUS_34980 gene gatA 12207 13658 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393505.1 protein_id gnl|my_center|LOCUS_34980 >Feature sequence074 953 2392 gene locus_tag LOCUS_34990 953 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 7431 2452 gene locus_tag LOCUS_35000 7431 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 8217 8585 gene locus_tag LOCUS_35010 8217 8585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 8566 9165 gene locus_tag LOCUS_35020 8566 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 11075 9264 gene locus_tag LOCUS_35030 11075 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204879.1 protein_id gnl|my_center|LOCUS_35030 11566 11072 gene locus_tag LOCUS_35040 11566 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204878.1 protein_id gnl|my_center|LOCUS_35040 12663 11554 gene locus_tag LOCUS_35050 12663 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204877.1 protein_id gnl|my_center|LOCUS_35050 13338 12862 gene locus_tag LOCUS_35060 13338 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 13626 13408 gene locus_tag LOCUS_35070 13626 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 14091 13636 gene locus_tag LOCUS_35080 14091 13636 CDS product antirestriction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042894353.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence075 398 928 gene locus_tag LOCUS_35090 398 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 1563 3902 gene locus_tag LOCUS_35100 1563 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 3918 5753 gene locus_tag LOCUS_35110 3918 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 6574 5750 gene locus_tag LOCUS_35120 6574 5750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 7461 6574 gene locus_tag LOCUS_35130 7461 6574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 7521 8285 gene locus_tag LOCUS_35140 7521 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 8290 10218 gene locus_tag LOCUS_35150 8290 10218 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028675.1 protein_id gnl|my_center|LOCUS_35150 10218 10484 gene locus_tag LOCUS_35160 10218 10484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 11779 10481 gene locus_tag LOCUS_35170 11779 10481 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259148.1 protein_id gnl|my_center|LOCUS_35170 13221 11776 gene locus_tag LOCUS_35180 13221 11776 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063852.1 protein_id gnl|my_center|LOCUS_35180 13730 13221 gene locus_tag LOCUS_35190 13730 13221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 >Feature sequence076 870 526 gene locus_tag LOCUS_35200 870 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 1444 923 gene locus_tag LOCUS_35210 1444 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 3599 1803 gene locus_tag LOCUS_35220 3599 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 4374 3589 gene locus_tag LOCUS_35230 4374 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 4618 5037 gene locus_tag LOCUS_35240 4618 5037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 5431 4946 gene locus_tag LOCUS_35250 5431 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 6993 5428 gene locus_tag LOCUS_35260 6993 5428 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_35260 7517 6990 gene locus_tag LOCUS_35270 7517 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 7766 7542 gene locus_tag LOCUS_35280 7766 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 8130 10325 gene locus_tag LOCUS_35290 8130 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 10345 11031 gene locus_tag LOCUS_35300 10345 11031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 11719 11465 gene locus_tag LOCUS_35310 11719 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 12255 13670 gene locus_tag LOCUS_35320 12255 13670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 >Feature sequence077 934 164 gene locus_tag LOCUS_35330 934 164 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777044.1 protein_id gnl|my_center|LOCUS_35330 1293 931 gene locus_tag LOCUS_35340 1293 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 2702 1290 gene locus_tag LOCUS_35350 2702 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 3481 2759 gene locus_tag LOCUS_35360 3481 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 6019 3545 gene locus_tag LOCUS_35370 6019 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 6761 6006 gene locus_tag LOCUS_35380 6761 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 7335 6754 gene locus_tag LOCUS_35390 7335 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 8637 7339 gene locus_tag LOCUS_35400 8637 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35400 9908 8634 gene locus_tag LOCUS_35410 9908 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 10612 9905 gene locus_tag LOCUS_35420 10612 9905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 11001 10609 gene locus_tag LOCUS_35430 11001 10609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 11569 10994 gene locus_tag LOCUS_35440 11569 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 12000 11566 gene locus_tag LOCUS_35450 gene gspG 12000 11566 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087289.1 protein_id gnl|my_center|LOCUS_35450 13244 12036 gene locus_tag LOCUS_35460 13244 12036 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_35460 13431 13249 gene locus_tag LOCUS_35470 13431 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 >Feature sequence078 139 822 gene locus_tag LOCUS_35480 139 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 849 1343 gene locus_tag LOCUS_35490 849 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 1358 2971 gene locus_tag LOCUS_35500 1358 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939880.1 protein_id gnl|my_center|LOCUS_35500 2973 3146 gene locus_tag LOCUS_35510 2973 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 3143 3340 gene locus_tag LOCUS_35520 3143 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 3324 3467 gene locus_tag LOCUS_35530 3324 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 3464 3703 gene locus_tag LOCUS_35540 3464 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 3700 4044 gene locus_tag LOCUS_35550 3700 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 4047 6224 gene locus_tag LOCUS_35560 4047 6224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 6224 6508 gene locus_tag LOCUS_35570 6224 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 6520 7605 gene locus_tag LOCUS_35580 6520 7605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 7631 8599 gene locus_tag LOCUS_35590 7631 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 8655 8858 gene locus_tag LOCUS_35600 8655 8858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 8870 9076 gene locus_tag LOCUS_35610 8870 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 9082 9423 gene locus_tag LOCUS_35620 9082 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 9427 10086 gene locus_tag LOCUS_35630 9427 10086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 10086 10424 gene locus_tag LOCUS_35640 10086 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 10421 11149 gene locus_tag LOCUS_35650 10421 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 11146 11325 gene locus_tag LOCUS_35660 11146 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 11306 11485 gene locus_tag LOCUS_35670 11306 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 11487 12101 gene locus_tag LOCUS_35680 11487 12101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 12108 12530 gene locus_tag LOCUS_35690 12108 12530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 12545 12970 gene locus_tag LOCUS_35700 12545 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence079 <1 554 gene locus_tag LOCUS_35710 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966758.1:FCD domain-containing protein 3771 1084 gene locus_tag LOCUS_35720 3771 1084 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166217565.1 protein_id gnl|my_center|LOCUS_35720 4805 3774 gene locus_tag LOCUS_35730 4805 3774 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_35730 5250 4921 gene locus_tag LOCUS_35740 5250 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 7851 5941 gene locus_tag LOCUS_35750 gene glmS 7851 5941 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064828.1 protein_id gnl|my_center|LOCUS_35750 7989 8552 gene locus_tag LOCUS_35760 7989 8552 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815701.1 protein_id gnl|my_center|LOCUS_35760 9705 8521 gene locus_tag LOCUS_35770 gene rlmI 9705 8521 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704914.1 protein_id gnl|my_center|LOCUS_35770 10240 9743 gene locus_tag LOCUS_35780 10240 9743 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405734.1 protein_id gnl|my_center|LOCUS_35780 10310 11761 gene locus_tag LOCUS_35790 10310 11761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 12389 11808 gene locus_tag LOCUS_35800 12389 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 >Feature sequence080 249 827 gene locus_tag LOCUS_35810 249 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 824 1351 gene locus_tag LOCUS_35820 824 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 1526 2887 gene locus_tag LOCUS_35830 1526 2887 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_35830 3292 4854 gene locus_tag LOCUS_35840 3292 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 5804 4815 gene locus_tag LOCUS_35850 5804 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 7948 5801 gene locus_tag LOCUS_35860 7948 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 10364 7941 gene locus_tag LOCUS_35870 10364 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 10904 10389 gene locus_tag LOCUS_35880 10904 10389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 10977 12200 gene locus_tag LOCUS_35890 gene dcm 10977 12200 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044036390.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence081 1024 680 gene locus_tag LOCUS_35900 1024 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 1124 1567 gene locus_tag LOCUS_35910 1124 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 2391 1465 gene locus_tag LOCUS_35920 2391 1465 CDS product AraC family transcriptional regulator N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339122.1 protein_id gnl|my_center|LOCUS_35920 2833 3396 gene locus_tag LOCUS_35930 2833 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_35930 3400 4227 gene locus_tag LOCUS_35940 3400 4227 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973973.1 protein_id gnl|my_center|LOCUS_35940 6017 4509 gene locus_tag LOCUS_35950 6017 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 6364 6014 gene locus_tag LOCUS_35960 6364 6014 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617906.1 protein_id gnl|my_center|LOCUS_35960 6594 6358 gene locus_tag LOCUS_35970 6594 6358 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844758.1 protein_id gnl|my_center|LOCUS_35970 6859 7143 gene locus_tag LOCUS_35980 6859 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 7136 7663 gene locus_tag LOCUS_35990 7136 7663 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118351.1 protein_id gnl|my_center|LOCUS_35990 7786 8052 gene locus_tag LOCUS_36000 7786 8052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36000 9516 8230 gene locus_tag LOCUS_36010 9516 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 10107 9619 gene locus_tag LOCUS_36020 10107 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 10559 10107 gene locus_tag LOCUS_36030 10559 10107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 11656 10616 gene locus_tag LOCUS_36040 11656 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 >Feature sequence082 1549 1157 gene locus_tag LOCUS_36050 1549 1157 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_36050 2073 1558 gene locus_tag LOCUS_36060 2073 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 2506 2949 gene locus_tag LOCUS_36070 gene cadR 2506 2949 CDS product Cd(II)/Pb(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103716.1 protein_id gnl|my_center|LOCUS_36070 3295 3933 gene locus_tag LOCUS_36080 gene dsbA 3295 3933 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096976.1 protein_id gnl|my_center|LOCUS_36080 4502 4143 gene locus_tag LOCUS_36090 4502 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36090 5398 4550 gene locus_tag LOCUS_36100 5398 4550 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185904.1 protein_id gnl|my_center|LOCUS_36100 6199 5417 gene locus_tag LOCUS_36110 6199 5417 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086127.1 protein_id gnl|my_center|LOCUS_36110 6695 6192 gene locus_tag LOCUS_36120 gene lspA 6695 6192 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186086.1 protein_id gnl|my_center|LOCUS_36120 9702 6676 gene locus_tag LOCUS_36130 9702 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 10411 9791 gene locus_tag LOCUS_36140 10411 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36140 10597 11607 gene locus_tag LOCUS_36150 10597 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 >Feature sequence083 568 134 gene locus_tag LOCUS_36160 568 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 810 565 gene locus_tag LOCUS_36170 810 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 1705 971 gene locus_tag LOCUS_36180 1705 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 3696 1702 gene locus_tag LOCUS_36190 gene pglZ 3696 1702 CDS product BREX-3 system phosphatase PglZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870227.1 protein_id gnl|my_center|LOCUS_36190 6533 3693 gene locus_tag LOCUS_36200 6533 3693 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870228.1 protein_id gnl|my_center|LOCUS_36200 8278 6530 gene locus_tag LOCUS_36210 8278 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 9848 8301 gene locus_tag LOCUS_36220 9848 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 11519 11097 gene locus_tag LOCUS_36230 11519 11097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 <12068 11569 gene locus_tag LOCUS_36240 <12068 11569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870232.1:DUF6079 family protein >Feature sequence084 1102 59 gene locus_tag LOCUS_36250 1102 59 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524032.1 protein_id gnl|my_center|LOCUS_36250 1386 1099 gene locus_tag LOCUS_36260 1386 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 1276 1542 gene locus_tag LOCUS_36270 1276 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 1584 3641 gene locus_tag LOCUS_36280 gene uvrB 1584 3641 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_36280 3643 4296 gene locus_tag LOCUS_36290 3643 4296 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245013.1 protein_id gnl|my_center|LOCUS_36290 5103 4342 gene locus_tag LOCUS_36300 5103 4342 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_36300 5171 5584 gene locus_tag LOCUS_36310 5171 5584 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314952.1 protein_id gnl|my_center|LOCUS_36310 5596 6918 gene locus_tag LOCUS_36320 gene lysA 5596 6918 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398851.1 protein_id gnl|my_center|LOCUS_36320 6922 7584 gene locus_tag LOCUS_36330 6922 7584 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_36330 7584 8417 gene locus_tag LOCUS_36340 7584 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 8457 9122 gene locus_tag LOCUS_36350 8457 9122 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966222.1 protein_id gnl|my_center|LOCUS_36350 9284 9748 gene locus_tag LOCUS_36360 9284 9748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 9873 10364 gene locus_tag LOCUS_36370 9873 10364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 10413 11075 gene locus_tag LOCUS_36380 10413 11075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 11844 11011 gene locus_tag LOCUS_36390 gene ispE 11844 11011 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678892.1 protein_id gnl|my_center|LOCUS_36390 >Feature sequence085 1424 27 gene locus_tag LOCUS_36400 1424 27 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462296.1 protein_id gnl|my_center|LOCUS_36400 1917 1600 gene locus_tag LOCUS_36410 gene eutM 1917 1600 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423991.1 protein_id gnl|my_center|LOCUS_36410 2262 1957 gene locus_tag LOCUS_36420 2262 1957 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736331.1 protein_id gnl|my_center|LOCUS_36420 2464 3462 gene locus_tag LOCUS_36430 2464 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 3496 4470 gene locus_tag LOCUS_36440 3496 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 4853 5167 gene locus_tag LOCUS_36450 4853 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 5164 7698 gene locus_tag LOCUS_36460 gene ppdK 5164 7698 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_36460 7695 7997 gene locus_tag LOCUS_36470 gene pduA 7695 7997 CDS product propanediol utilization microcompartment protein PduA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183618.1 protein_id gnl|my_center|LOCUS_36470 9075 10937 gene locus_tag LOCUS_36480 9075 10937 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815090.1 protein_id gnl|my_center|LOCUS_36480 >Feature sequence086 1489 428 gene locus_tag LOCUS_36490 1489 428 CDS product PDR/VanB family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927097.1 protein_id gnl|my_center|LOCUS_36490 2940 1528 gene locus_tag LOCUS_36500 2940 1528 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927098.1 protein_id gnl|my_center|LOCUS_36500 3480 4577 gene locus_tag LOCUS_36510 3480 4577 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137395785.1 protein_id gnl|my_center|LOCUS_36510 4631 5023 gene locus_tag LOCUS_36520 4631 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 5034 7571 gene locus_tag LOCUS_36530 5034 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 7631 8524 gene locus_tag LOCUS_36540 7631 8524 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225690.1 protein_id gnl|my_center|LOCUS_36540 8606 9163 gene locus_tag LOCUS_36550 8606 9163 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533589.1 protein_id gnl|my_center|LOCUS_36550 9800 9501 gene locus_tag LOCUS_36560 9800 9501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence087 687 1721 gene locus_tag LOCUS_36570 687 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 1718 2029 gene locus_tag LOCUS_36580 1718 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 2029 2484 gene locus_tag LOCUS_36590 2029 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 2582 3010 gene locus_tag LOCUS_36600 2582 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 3154 4329 gene locus_tag LOCUS_36610 3154 4329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037154163.1 protein_id gnl|my_center|LOCUS_36610 4343 5005 gene locus_tag LOCUS_36620 4343 5005 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_36620 5042 5353 gene locus_tag LOCUS_36630 5042 5353 CDS product DsrE/DsrF/TusD sulfur relay family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705087.1 protein_id gnl|my_center|LOCUS_36630 5368 6123 gene locus_tag LOCUS_36640 5368 6123 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979688.1 protein_id gnl|my_center|LOCUS_36640 6120 6317 gene locus_tag LOCUS_36650 6120 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 6278 7411 gene locus_tag LOCUS_36660 6278 7411 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890424.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36660 7572 7907 gene locus_tag LOCUS_36670 7572 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 7904 8134 gene locus_tag LOCUS_36680 7904 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 8477 9565 gene locus_tag LOCUS_36690 8477 9565 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815544.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence088 <1 1111 gene locus_tag LOCUS_36700 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001120833.1:UvrD-helicase domain-containing protein 1171 1638 gene locus_tag LOCUS_36710 1171 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 1635 1964 gene locus_tag LOCUS_36720 1635 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 2038 2268 gene locus_tag LOCUS_36730 2038 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 3210 4715 gene locus_tag LOCUS_36740 3210 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 4759 5535 gene locus_tag LOCUS_36750 gene istB 4759 5535 CDS product IS21-like element IS21 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544830.1 protein_id gnl|my_center|LOCUS_36750 5577 5744 gene locus_tag LOCUS_36760 5577 5744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 6050 6460 gene locus_tag LOCUS_36770 6050 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 6498 6704 gene locus_tag LOCUS_36780 6498 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 6986 6786 gene locus_tag LOCUS_36790 6986 6786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 7260 6943 gene locus_tag LOCUS_36800 7260 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 7731 7465 gene locus_tag LOCUS_36810 7731 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 7821 8036 gene locus_tag LOCUS_36820 7821 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 8606 8013 gene locus_tag LOCUS_36830 8606 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 9065 8850 gene locus_tag LOCUS_36840 9065 8850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 9240 9073 gene locus_tag LOCUS_36850 9240 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence089 3568 2825 gene locus_tag LOCUS_36860 3568 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 4460 3678 gene locus_tag LOCUS_36870 4460 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 5107 4685 gene locus_tag LOCUS_36880 5107 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 5190 5633 gene locus_tag LOCUS_36890 5190 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 5630 6406 gene locus_tag LOCUS_36900 5630 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 8711 6495 gene locus_tag LOCUS_36910 8711 6495 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338082.1 protein_id gnl|my_center|LOCUS_36910 <9609 8719 gene locus_tag LOCUS_36920 <9609 8719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023003683.1:ATP-binding protein >Feature sequence090 <1 4083 gene locus_tag LOCUS_36930 <1 4083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257798.1:DEAD/DEAH box helicase 4080 6956 gene locus_tag LOCUS_36940 4080 6956 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256729.1 protein_id gnl|my_center|LOCUS_36940 >Feature sequence091 255 34 gene locus_tag LOCUS_36950 255 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 333 950 gene locus_tag LOCUS_36960 333 950 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257716.1 protein_id gnl|my_center|LOCUS_36960 1064 2350 gene locus_tag LOCUS_36970 1064 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 2377 3333 gene locus_tag LOCUS_36980 2377 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 3330 4160 gene locus_tag LOCUS_36990 3330 4160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 4191 6341 gene locus_tag LOCUS_37000 4191 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 6878 6345 gene locus_tag LOCUS_37010 6878 6345 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222951.1 protein_id gnl|my_center|LOCUS_37010 9313 6875 gene locus_tag LOCUS_37020 9313 6875 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073096256.1 protein_id gnl|my_center|LOCUS_37020 >Feature sequence092 245 1246 gene locus_tag LOCUS_37030 245 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 1284 2090 gene locus_tag LOCUS_37040 1284 2090 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038759.1 protein_id gnl|my_center|LOCUS_37040 2393 3589 gene locus_tag LOCUS_37050 2393 3589 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_37050 6873 3712 gene locus_tag LOCUS_37060 6873 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 8553 7291 gene locus_tag LOCUS_37070 gene ftsZ 8553 7291 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194380.1 protein_id gnl|my_center|LOCUS_37070 <9473 8674 gene locus_tag LOCUS_37080 <9473 8674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004545961.1:cell division protein FtsA >Feature sequence093 1711 317 gene locus_tag LOCUS_37090 gene pepV 1711 317 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966010.1 protein_id gnl|my_center|LOCUS_37090 1778 2914 gene locus_tag LOCUS_37100 gene galK 1778 2914 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707767.1 protein_id gnl|my_center|LOCUS_37100 2911 4089 gene locus_tag LOCUS_37110 2911 4089 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_37110 6069 4093 gene locus_tag LOCUS_37120 6069 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 6692 8278 gene locus_tag LOCUS_37130 6692 8278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 8218 8736 gene locus_tag LOCUS_37140 8218 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 8712 9143 gene locus_tag LOCUS_37150 8712 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 >Feature sequence094 1608 25 gene locus_tag LOCUS_37160 1608 25 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861375.1 protein_id gnl|my_center|LOCUS_37160 2234 1677 gene locus_tag LOCUS_37170 2234 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 2585 2250 gene locus_tag LOCUS_37180 2585 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 2744 2917 gene locus_tag LOCUS_37190 2744 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_37190 3389 3871 gene locus_tag LOCUS_37200 3389 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 3861 4961 gene locus_tag LOCUS_37210 3861 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 6193 5282 gene locus_tag LOCUS_37220 6193 5282 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394832.1 protein_id gnl|my_center|LOCUS_37220 6278 6790 gene locus_tag LOCUS_37230 6278 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 7304 6783 gene locus_tag LOCUS_37240 7304 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 7867 7301 gene locus_tag LOCUS_37250 7867 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 8041 8997 gene locus_tag LOCUS_37260 8041 8997 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477775.1 protein_id gnl|my_center|LOCUS_37260 >Feature sequence095 4627 1031 gene locus_tag LOCUS_37270 4627 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 4981 4784 gene locus_tag LOCUS_37280 4981 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 5189 5845 gene locus_tag LOCUS_37290 5189 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 6862 5873 gene locus_tag LOCUS_37300 6862 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 7572 6862 gene locus_tag LOCUS_37310 7572 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 7900 7529 gene locus_tag LOCUS_37320 7900 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 8553 7903 gene locus_tag LOCUS_37330 8553 7903 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256419.1 protein_id gnl|my_center|LOCUS_37330 >Feature sequence096 618 169 gene locus_tag LOCUS_37340 618 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 2512 656 gene locus_tag LOCUS_37350 2512 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 3084 2593 gene locus_tag LOCUS_37360 3084 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 4043 3087 gene locus_tag LOCUS_37370 4043 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 5693 4842 gene locus_tag LOCUS_37380 5693 4842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 7387 6197 gene locus_tag LOCUS_37390 7387 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 7993 7691 gene locus_tag LOCUS_37400 7993 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 7874 8803 gene locus_tag LOCUS_37410 7874 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 >Feature sequence097 1511 1831 gene locus_tag LOCUS_37420 1511 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 2174 1800 gene locus_tag LOCUS_37430 2174 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 2205 2867 gene locus_tag LOCUS_37440 2205 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37440 2860 5469 gene locus_tag LOCUS_37450 2860 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 5549 6508 gene locus_tag LOCUS_37460 5549 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 7226 6930 gene locus_tag LOCUS_37470 7226 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 7530 8051 gene locus_tag LOCUS_37480 7530 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 8048 8521 gene locus_tag LOCUS_37490 8048 8521 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389192.1 protein_id gnl|my_center|LOCUS_37490 >Feature sequence098 1449 289 gene locus_tag LOCUS_37500 1449 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 1976 1446 gene locus_tag LOCUS_37510 1976 1446 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_37510 2715 2038 gene locus_tag LOCUS_37520 2715 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 4575 2731 gene locus_tag LOCUS_37530 4575 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 5408 4692 gene locus_tag LOCUS_37540 5408 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 5517 6671 gene locus_tag LOCUS_37550 5517 6671 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405266.1 protein_id gnl|my_center|LOCUS_37550 7135 6719 gene locus_tag LOCUS_37560 7135 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 >Feature sequence099 1 474 gene locus_tag LOCUS_37570 1 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 1000 713 gene locus_tag LOCUS_37580 1000 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 4370 981 gene locus_tag LOCUS_37590 4370 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 5773 4382 gene locus_tag LOCUS_37600 5773 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37600 6629 5760 gene locus_tag LOCUS_37610 6629 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 6760 7122 gene locus_tag LOCUS_37620 6760 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 7516 8388 gene locus_tag LOCUS_37630 7516 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 >Feature sequence100 615 998 gene locus_tag LOCUS_37640 615 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 2116 995 gene locus_tag LOCUS_37650 2116 995 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103611.1 protein_id gnl|my_center|LOCUS_37650 3176 2286 gene locus_tag LOCUS_37660 3176 2286 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225350.1 protein_id gnl|my_center|LOCUS_37660 3396 5285 gene locus_tag LOCUS_37670 3396 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 6591 5536 gene locus_tag LOCUS_37680 6591 5536 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969672.1 protein_id gnl|my_center|LOCUS_37680 6905 7837 gene locus_tag LOCUS_37690 6905 7837 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048324208.1 protein_id gnl|my_center|LOCUS_37690 8266 7913 gene locus_tag LOCUS_37700 8266 7913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 >Feature sequence101 810 1508 gene locus_tag LOCUS_37710 810 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 1581 1820 gene locus_tag LOCUS_37720 1581 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 1827 2258 gene locus_tag LOCUS_37730 1827 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 2382 2627 gene locus_tag LOCUS_37740 2382 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 2750 3232 gene locus_tag LOCUS_37750 2750 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 3418 3789 gene locus_tag LOCUS_37760 3418 3789 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975676.1 protein_id gnl|my_center|LOCUS_37760 3779 4033 gene locus_tag LOCUS_37770 3779 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 4106 4492 gene locus_tag LOCUS_37780 4106 4492 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035582.1 protein_id gnl|my_center|LOCUS_37780 4576 5079 gene locus_tag LOCUS_37790 4576 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 5076 5681 gene locus_tag LOCUS_37800 5076 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 5678 6157 gene locus_tag LOCUS_37810 5678 6157 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532825.1 protein_id gnl|my_center|LOCUS_37810 6457 6849 gene locus_tag LOCUS_37820 6457 6849 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049863.1 protein_id gnl|my_center|LOCUS_37820 6907 7623 gene locus_tag LOCUS_37830 6907 7623 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038753.1 protein_id gnl|my_center|LOCUS_37830 >Feature sequence102 1268 1948 gene locus_tag LOCUS_37840 1268 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 3660 2182 gene locus_tag LOCUS_37850 3660 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 3807 4679 gene locus_tag LOCUS_37860 3807 4679 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_37860 5475 4660 gene locus_tag LOCUS_37870 5475 4660 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_37870 7552 5498 gene locus_tag LOCUS_37880 gene dinG 7552 5498 CDS product ATP-dependent DNA helicase DinG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039022.1 protein_id gnl|my_center|LOCUS_37880 7932 7657 gene locus_tag LOCUS_37890 7932 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence103 5684 2247 gene locus_tag LOCUS_37900 5684 2247 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_37900 5881 5681 gene locus_tag LOCUS_37910 5881 5681 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_37910 <7893 6042 gene locus_tag LOCUS_37920 <7893 6042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391838.1:S8 family peptidase >Feature sequence104 1413 355 gene locus_tag LOCUS_37930 1413 355 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742235.1 protein_id gnl|my_center|LOCUS_37930 1784 1542 gene locus_tag LOCUS_37940 1784 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 1687 2079 gene locus_tag LOCUS_37950 1687 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 3079 2162 gene locus_tag LOCUS_37960 3079 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 3237 4511 gene locus_tag LOCUS_37970 3237 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 5321 4854 gene locus_tag LOCUS_37980 5321 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 5748 5338 gene locus_tag LOCUS_37990 5748 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 6059 5745 gene locus_tag LOCUS_38000 6059 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 6390 6151 gene locus_tag LOCUS_38010 6390 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 7050 7241 gene locus_tag LOCUS_38020 7050 7241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence105 1413 475 gene locus_tag LOCUS_38030 1413 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 2969 1410 gene locus_tag LOCUS_38040 2969 1410 CDS product SAVED domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337186.1 protein_id gnl|my_center|LOCUS_38040 3878 2979 gene locus_tag LOCUS_38050 3878 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 4381 3878 gene locus_tag LOCUS_38060 4381 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 4854 4378 gene locus_tag LOCUS_38070 4854 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 5756 4851 gene locus_tag LOCUS_38080 5756 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 6157 5834 gene locus_tag LOCUS_38090 6157 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 6236 7303 gene locus_tag LOCUS_38100 6236 7303 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_38100 >Feature sequence106 <1 2625 gene locus_tag LOCUS_38110 <1 2625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158908668.1:HsdR family type I site-specific deoxyribonuclease 2934 2647 gene locus_tag LOCUS_38120 2934 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 4475 3123 gene locus_tag LOCUS_38130 4475 3123 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236073048.1 protein_id gnl|my_center|LOCUS_38130 4765 7182 gene locus_tag LOCUS_38140 4765 7182 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479745.1 protein_id gnl|my_center|LOCUS_38140 >Feature sequence107 566 964 gene locus_tag LOCUS_38150 566 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38150 1925 1029 gene locus_tag LOCUS_38160 1925 1029 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155898.1 protein_id gnl|my_center|LOCUS_38160 2856 2110 gene locus_tag LOCUS_38170 2856 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 3058 2846 gene locus_tag LOCUS_38180 3058 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 3776 3129 gene locus_tag LOCUS_38190 3776 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 3842 5341 gene locus_tag LOCUS_38200 3842 5341 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939561.1 protein_id gnl|my_center|LOCUS_38200 5331 6281 gene locus_tag LOCUS_38210 5331 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38210 7165 6245 gene locus_tag LOCUS_38220 7165 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957054.1 protein_id gnl|my_center|LOCUS_38220 >Feature sequence108 3510 1852 gene locus_tag LOCUS_38230 3510 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 7069 3731 gene locus_tag LOCUS_38240 7069 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence109 1736 156 gene locus_tag LOCUS_38250 1736 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 2071 1754 gene locus_tag LOCUS_38260 2071 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 3108 2086 gene locus_tag LOCUS_38270 gene mutY 3108 2086 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207997.1 protein_id gnl|my_center|LOCUS_38270 3813 3109 gene locus_tag LOCUS_38280 gene pyrF 3813 3109 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_38280 3933 4763 gene locus_tag LOCUS_38290 3933 4763 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922725.1 protein_id gnl|my_center|LOCUS_38290 4760 5833 gene locus_tag LOCUS_38300 4760 5833 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921945.1 protein_id gnl|my_center|LOCUS_38300 5830 6618 gene locus_tag LOCUS_38310 5830 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 6612 7325 gene locus_tag LOCUS_38320 6612 7325 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907582.1 protein_id gnl|my_center|LOCUS_38320 >Feature sequence110 4334 297 gene locus_tag LOCUS_38330 4334 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 4761 4348 gene locus_tag LOCUS_38340 4761 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 5726 4758 gene locus_tag LOCUS_38350 5726 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 6979 5723 gene locus_tag LOCUS_38360 6979 5723 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081447092.1 protein_id gnl|my_center|LOCUS_38360 >Feature sequence111 2323 1361 gene locus_tag LOCUS_38370 2323 1361 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195206.1 protein_id gnl|my_center|LOCUS_38370 3280 2333 gene locus_tag LOCUS_38380 gene rocF 3280 2333 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167867.1 protein_id gnl|my_center|LOCUS_38380 3500 3336 gene locus_tag LOCUS_38390 3500 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 4435 3545 gene locus_tag LOCUS_38400 4435 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 5411 4530 gene locus_tag LOCUS_38410 5411 4530 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584011.1 protein_id gnl|my_center|LOCUS_38410 6213 5524 gene locus_tag LOCUS_38420 6213 5524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 7105 6257 gene locus_tag LOCUS_38430 7105 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 >Feature sequence112 165 431 gene locus_tag LOCUS_38440 165 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 1163 2512 gene locus_tag LOCUS_38450 1163 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 2517 4415 gene locus_tag LOCUS_38460 2517 4415 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230933.1 protein_id gnl|my_center|LOCUS_38460 4468 5232 gene locus_tag LOCUS_38470 4468 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 5229 6254 gene locus_tag LOCUS_38480 5229 6254 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_38480 >Feature sequence113 176 1993 gene locus_tag LOCUS_38490 176 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 1994 4648 gene locus_tag LOCUS_38500 1994 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 5467 5730 gene locus_tag LOCUS_38510 5467 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 >Feature sequence114 194 535 gene locus_tag LOCUS_38520 194 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 1132 2028 gene locus_tag LOCUS_38530 1132 2028 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086848494.1 protein_id gnl|my_center|LOCUS_38530 3104 2583 gene locus_tag LOCUS_38540 gene cutC 3104 2583 CDS product glyceraldehyde dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_38540 3994 3101 gene locus_tag LOCUS_38550 3994 3101 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227067.1 protein_id gnl|my_center|LOCUS_38550 5414 4164 gene locus_tag LOCUS_38560 5414 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 6231 5485 gene locus_tag LOCUS_38570 6231 5485 CDS product dithiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204250214.1 protein_id gnl|my_center|LOCUS_38570 >Feature sequence115 221 1102 gene locus_tag LOCUS_38580 221 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 1168 2070 gene locus_tag LOCUS_38590 1168 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 2180 3274 gene locus_tag LOCUS_38600 2180 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 4773 3331 gene locus_tag LOCUS_38610 4773 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 >Feature sequence116 897 121 gene locus_tag LOCUS_38620 897 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 1000 2973 gene locus_tag LOCUS_38630 1000 2973 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029237.1 protein_id gnl|my_center|LOCUS_38630 3914 2997 gene locus_tag LOCUS_38640 3914 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38640 3932 4879 gene locus_tag LOCUS_38650 3932 4879 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225563.1 protein_id gnl|my_center|LOCUS_38650 6109 4880 gene locus_tag LOCUS_38660 6109 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38660 >Feature sequence117 715 6021 gene locus_tag LOCUS_38670 715 6021 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933286.1 protein_id gnl|my_center|LOCUS_38670 >Feature sequence118 3747 3010 gene locus_tag LOCUS_38680 3747 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 4876 3752 gene locus_tag LOCUS_38690 4876 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 5992 4880 gene locus_tag LOCUS_38700 5992 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 >Feature sequence119 1602 712 gene locus_tag LOCUS_38710 1602 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 3432 1627 gene locus_tag LOCUS_38720 3432 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 3581 4057 gene locus_tag LOCUS_38730 3581 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 5906 4260 gene locus_tag LOCUS_38740 5906 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 >Feature sequence120 497 213 gene locus_tag LOCUS_38750 497 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 2990 603 gene locus_tag LOCUS_38760 2990 603 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000233452.1 protein_id gnl|my_center|LOCUS_38760 3906 3028 gene locus_tag LOCUS_38770 3906 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 4852 3896 gene locus_tag LOCUS_38780 4852 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38780 <5933 5067 gene locus_tag LOCUS_38790 <5933 5067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525821.1:tyrosine-type recombinase/integrase >Feature sequence121 401 234 gene locus_tag LOCUS_38800 401 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 980 453 gene locus_tag LOCUS_38810 980 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 1567 2043 gene locus_tag LOCUS_38820 1567 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 2040 2837 gene locus_tag LOCUS_38830 2040 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 2848 4017 gene locus_tag LOCUS_38840 2848 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 >Feature sequence122 1254 67 gene locus_tag LOCUS_38850 1254 67 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064251564.1 protein_id gnl|my_center|LOCUS_38850 1397 2269 gene locus_tag LOCUS_38860 1397 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 2862 3695 gene locus_tag LOCUS_38870 2862 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 3692 4825 gene locus_tag LOCUS_38880 3692 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38880 5103 4822 gene locus_tag LOCUS_38890 5103 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 >Feature sequence123 449 715 gene locus_tag LOCUS_38900 449 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 705 1094 gene locus_tag LOCUS_38910 705 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 1096 1794 gene locus_tag LOCUS_38920 1096 1794 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118253.1 protein_id gnl|my_center|LOCUS_38920 1791 1970 gene locus_tag LOCUS_38930 1791 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 1963 3282 gene locus_tag LOCUS_38940 1963 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 >Feature sequence124 838 1890 gene locus_tag LOCUS_38950 838 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 1890 3569 gene locus_tag LOCUS_38960 1890 3569 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_38960 3575 3721 gene locus_tag LOCUS_38970 3575 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 3783 5525 gene locus_tag LOCUS_38980 3783 5525 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204925.1 protein_id gnl|my_center|LOCUS_38980 >Feature sequence125 639 163 gene locus_tag LOCUS_38990 639 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 717 2084 gene locus_tag LOCUS_39000 717 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 2659 2429 gene locus_tag LOCUS_39010 2659 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 5019 2656 gene locus_tag LOCUS_39020 5019 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39020 >Feature sequence126 136 1323 gene locus_tag LOCUS_39030 136 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 1440 5015 gene locus_tag LOCUS_39040 1440 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 5331 5023 gene locus_tag LOCUS_39050 5331 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 5291 5467 gene locus_tag LOCUS_39060 5291 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 >Feature sequence127 1736 2740 gene locus_tag LOCUS_39070 1736 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 2841 3491 gene locus_tag LOCUS_39080 2841 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 3507 3941 gene locus_tag LOCUS_39090 3507 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 3955 4338 gene locus_tag LOCUS_39100 3955 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 <5385 4322 gene locus_tag LOCUS_39110 <5385 4322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203529.1:sialidase family protein >Feature sequence128 850 83 gene locus_tag LOCUS_39120 850 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 2241 814 gene locus_tag LOCUS_39130 2241 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 3961 2228 gene locus_tag LOCUS_39140 3961 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 5211 3961 gene locus_tag LOCUS_39150 5211 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 >Feature sequence129 1791 508 gene locus_tag LOCUS_39160 1791 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 3372 1840 gene locus_tag LOCUS_39170 3372 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 3479 4999 gene locus_tag LOCUS_39180 3479 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence130 179 361 gene locus_tag LOCUS_39190 179 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_39190 416 1672 gene locus_tag LOCUS_39200 416 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 1673 2152 gene locus_tag LOCUS_39210 1673 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 2149 3048 gene locus_tag LOCUS_39220 2149 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 4290 3163 gene locus_tag LOCUS_39230 4290 3163 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266508.1 protein_id gnl|my_center|LOCUS_39230 4963 4382 gene locus_tag LOCUS_39240 4963 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 >Feature sequence131 996 1649 gene locus_tag LOCUS_39250 996 1649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941994.1 protein_id gnl|my_center|LOCUS_39250 2978 1653 gene locus_tag LOCUS_39260 2978 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 3793 3005 gene locus_tag LOCUS_39270 3793 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 3885 4961 gene locus_tag LOCUS_39280 gene pstS 3885 4961 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_39280 >Feature sequence132 993 352 gene locus_tag LOCUS_39290 993 352 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259108.1 protein_id gnl|my_center|LOCUS_39290 1271 990 gene locus_tag LOCUS_39300 1271 990 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909394.1 protein_id gnl|my_center|LOCUS_39300 1368 1955 gene locus_tag LOCUS_39310 1368 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 2470 1952 gene locus_tag LOCUS_39320 2470 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 2522 3619 gene locus_tag LOCUS_39330 gene prfB 2522 3619 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_39330 3880 4677 gene locus_tag LOCUS_39340 3880 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39340 >Feature sequence133 1929 547 gene locus_tag LOCUS_39350 1929 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39350 2564 1923 gene locus_tag LOCUS_39360 2564 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39360 3031 2561 gene locus_tag LOCUS_39370 3031 2561 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_39370 3075 3989 gene locus_tag LOCUS_39380 3075 3989 CDS product Mph(A) family macrolide 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219391.1 protein_id gnl|my_center|LOCUS_39380 4072 4887 gene locus_tag LOCUS_39390 4072 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 >Feature sequence134 1301 873 gene locus_tag LOCUS_39400 1301 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 3441 1558 gene locus_tag LOCUS_39410 3441 1558 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266186.1 protein_id gnl|my_center|LOCUS_39410 4523 3438 gene locus_tag LOCUS_39420 4523 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 >Feature sequence135 767 3001 gene locus_tag LOCUS_39430 767 3001 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775094.1 protein_id gnl|my_center|LOCUS_39430 2974 4125 gene locus_tag LOCUS_39440 2974 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 <4901 4132 gene locus_tag LOCUS_39450 <4901 4132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000529857.1:DUF1173 family protein >Feature sequence136 579 331 gene locus_tag LOCUS_39460 579 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 1044 583 gene locus_tag LOCUS_39470 1044 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 1392 1135 gene locus_tag LOCUS_39480 1392 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 1692 1420 gene locus_tag LOCUS_39490 1692 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 1911 2108 gene locus_tag LOCUS_39500 1911 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 2098 4389 gene locus_tag LOCUS_39510 2098 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 >Feature sequence137 1901 564 gene locus_tag LOCUS_39520 1901 564 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071651.1 protein_id gnl|my_center|LOCUS_39520 3940 1898 gene locus_tag LOCUS_39530 3940 1898 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 protein_id gnl|my_center|LOCUS_39530 4148 3933 gene locus_tag LOCUS_39540 4148 3933 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932357.1 protein_id gnl|my_center|LOCUS_39540 >Feature sequence138 246 722 gene locus_tag LOCUS_39550 246 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 719 3682 gene locus_tag LOCUS_39560 719 3682 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165792415.1 protein_id gnl|my_center|LOCUS_39560 3679 4350 gene locus_tag LOCUS_39570 3679 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 >Feature sequence139 1694 582 gene locus_tag LOCUS_39580 1694 582 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535005.1 protein_id gnl|my_center|LOCUS_39580 2332 1691 gene locus_tag LOCUS_39590 2332 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 >Feature sequence140 882 97 gene locus_tag LOCUS_39600 882 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 2368 2502 gene locus_tag LOCUS_39610 2368 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39610 2722 2892 gene locus_tag LOCUS_39620 2722 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39620 2908 3129 gene locus_tag LOCUS_39630 2908 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 4466 4014 gene locus_tag LOCUS_39640 4466 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39640 >Feature sequence141 3004 899 gene locus_tag LOCUS_39650 3004 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39650 3473 2997 gene locus_tag LOCUS_39660 3473 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence142 970 224 gene locus_tag LOCUS_39670 970 224 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102969.1 protein_id gnl|my_center|LOCUS_39670 1597 1007 gene locus_tag LOCUS_39680 gene umuD 1597 1007 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_39680 2677 3558 gene locus_tag LOCUS_39690 2677 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 4044 3700 gene locus_tag LOCUS_39700 gene bprA 4044 3700 CDS product T3SS protein BprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187356.1 protein_id gnl|my_center|LOCUS_39700 >Feature sequence143 1330 2874 gene locus_tag LOCUS_39710 1330 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 2877 3758 gene locus_tag LOCUS_39720 2877 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 3748 4500 gene locus_tag LOCUS_39730 3748 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 >Feature sequence144 1345 206 gene locus_tag LOCUS_39740 1345 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 2179 1346 gene locus_tag LOCUS_39750 2179 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 3801 2815 gene locus_tag LOCUS_39760 3801 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 <4498 3948 gene locus_tag LOCUS_39770 <4498 3948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000783498.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence145 1013 162 gene locus_tag LOCUS_39780 gene rfbD 1013 162 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_39780 1798 1010 gene locus_tag LOCUS_39790 1798 1010 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954677.1 protein_id gnl|my_center|LOCUS_39790 1874 3526 gene locus_tag LOCUS_39800 1874 3526 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584095.1 protein_id gnl|my_center|LOCUS_39800 3523 4176 gene locus_tag LOCUS_39810 3523 4176 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584081.1 protein_id gnl|my_center|LOCUS_39810 >Feature sequence146 812 579 gene locus_tag LOCUS_39820 812 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 1217 987 gene locus_tag LOCUS_39830 1217 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 1643 1437 gene locus_tag LOCUS_39840 1643 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 2166 4148 gene locus_tag LOCUS_39850 2166 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 >Feature sequence147 751 446 gene locus_tag LOCUS_39860 751 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 1028 2347 gene locus_tag LOCUS_39870 1028 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 2838 2662 gene locus_tag LOCUS_39880 2838 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 3120 3803 gene locus_tag LOCUS_39890 3120 3803 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_39890 >Feature sequence148 670 1446 gene locus_tag LOCUS_39900 670 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 1443 1610 gene locus_tag LOCUS_39910 1443 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 1650 3374 gene locus_tag LOCUS_39920 1650 3374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 >Feature sequence149 709 149 gene locus_tag LOCUS_39930 709 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 1850 741 gene locus_tag LOCUS_39940 1850 741 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_39940 3037 1847 gene locus_tag LOCUS_39950 3037 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 >Feature sequence150 <1 724 gene locus_tag LOCUS_39960 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389842.1:type III restriction endonuclease subunit M 731 2230 gene locus_tag LOCUS_39970 731 2230 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932832.1 protein_id gnl|my_center|LOCUS_39970 >Feature sequence151 766 245 gene locus_tag LOCUS_39980 766 245 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_39980 1518 997 gene locus_tag LOCUS_39990 1518 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 2563 2087 gene locus_tag LOCUS_40000 2563 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 3319 2747 gene locus_tag LOCUS_40010 3319 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 >Feature sequence152 158 1753 gene locus_tag LOCUS_40020 158 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 1758 2684 gene locus_tag LOCUS_40030 1758 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 3156 3662 gene locus_tag LOCUS_40040 3156 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence153 648 79 gene locus_tag LOCUS_40050 648 79 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_40050 827 1099 gene locus_tag LOCUS_40060 827 1099 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071642.1 protein_id gnl|my_center|LOCUS_40060 1087 1380 gene locus_tag LOCUS_40070 1087 1380 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071641.1 protein_id gnl|my_center|LOCUS_40070 1486 3078 gene locus_tag LOCUS_40080 1486 3078 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205995.1 protein_id gnl|my_center|LOCUS_40080 >Feature sequence154 669 998 gene locus_tag LOCUS_40090 669 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 1146 2531 gene locus_tag LOCUS_40100 1146 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 3452 2742 gene locus_tag LOCUS_40110 3452 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 >Feature sequence155 520 1005 gene locus_tag LOCUS_40120 520 1005 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106260.1 protein_id gnl|my_center|LOCUS_40120 1002 1415 gene locus_tag LOCUS_40130 1002 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 1794 1453 gene locus_tag LOCUS_40140 1794 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 2850 1840 gene locus_tag LOCUS_40150 2850 1840 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974578.1 protein_id gnl|my_center|LOCUS_40150 2939 3532 gene locus_tag LOCUS_40160 2939 3532 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223589.1 protein_id gnl|my_center|LOCUS_40160 >Feature sequence156 <1 825 gene locus_tag LOCUS_40170 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022339.1:BREX-1 system phosphatase PglZ type A 833 2863 gene locus_tag LOCUS_40180 gene brxL 833 2863 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_40180 3097 3534 gene locus_tag LOCUS_40190 3097 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence157 3207 1954 gene locus_tag LOCUS_40200 3207 1954 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138390504.1 protein_id gnl|my_center|LOCUS_40200 >Feature sequence158 1816 1547 gene locus_tag LOCUS_40210 1816 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 2274 1918 gene locus_tag LOCUS_40220 2274 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40220 >Feature sequence159 1092 76 gene locus_tag LOCUS_40230 1092 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 2091 1222 gene locus_tag LOCUS_40240 2091 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 2309 2133 gene locus_tag LOCUS_40250 2309 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 2936 2463 gene locus_tag LOCUS_40260 2936 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence160 679 1185 gene locus_tag LOCUS_40270 679 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 1494 1883 gene locus_tag LOCUS_40280 1494 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 2376 1873 gene locus_tag LOCUS_40290 2376 1873 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030929.1 protein_id gnl|my_center|LOCUS_40290 2963 2373 gene locus_tag LOCUS_40300 2963 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 >Feature sequence161 212 1195 gene locus_tag LOCUS_40310 212 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40310 1192 1770 gene locus_tag LOCUS_40320 1192 1770 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_40320 1767 2192 gene locus_tag LOCUS_40330 1767 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 2208 3173 gene locus_tag LOCUS_40340 gene rsmH 2208 3173 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence162 429 169 gene locus_tag LOCUS_40350 429 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40350 984 436 gene locus_tag LOCUS_40360 984 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40360 2932 1883 gene locus_tag LOCUS_40370 2932 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 >Feature sequence163 >Feature sequence164 2882 1803 gene locus_tag LOCUS_40380 2882 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence165 718 1923 gene locus_tag LOCUS_40390 718 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 >Feature sequence166 <1 1375 gene locus_tag LOCUS_40400 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889379.1:class I SAM-dependent DNA methyltransferase 1397 1576 gene locus_tag LOCUS_40410 1397 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 >Feature sequence167 4 936 gene locus_tag LOCUS_40420 4 936 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_40420 1936 998 gene locus_tag LOCUS_40430 1936 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 >Feature sequence168 245 562 gene locus_tag LOCUS_40440 245 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 564 1016 gene locus_tag LOCUS_40450 564 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 1029 1346 gene locus_tag LOCUS_40460 1029 1346 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_40460 >Feature sequence169 1616 48 gene locus_tag LOCUS_40470 1616 48 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_40470 1718 2392 gene locus_tag LOCUS_40480 1718 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 >Feature sequence170 154 321 gene locus_tag LOCUS_40490 154 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 318 1280 gene locus_tag LOCUS_40500 318 1280 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40500 1277 1465 gene locus_tag LOCUS_40510 1277 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 1462 1992 gene locus_tag LOCUS_40520 1462 1992 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544978.1 protein_id gnl|my_center|LOCUS_40520 >Feature sequence171 1380 1697 gene locus_tag LOCUS_40530 1380 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530