>Feature sequence01 493 125 gene locus_tag LOCUS_00010 493 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 736 957 gene locus_tag LOCUS_00020 736 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 939 1070 gene locus_tag LOCUS_00030 939 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1475 1113 gene locus_tag LOCUS_00040 gene crcB 1475 1113 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072309.1 protein_id gnl|my_center|LOCUS_00040 1910 4006 gene locus_tag LOCUS_00050 1910 4006 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930970.1 protein_id gnl|my_center|LOCUS_00050 4009 6087 gene locus_tag LOCUS_00060 4009 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6259 6816 gene locus_tag LOCUS_00070 6259 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7533 6898 gene locus_tag LOCUS_00080 7533 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7555 8355 gene locus_tag LOCUS_00090 7555 8355 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262928.1 protein_id gnl|my_center|LOCUS_00090 8352 8828 gene locus_tag LOCUS_00100 gene rlmH 8352 8828 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966801.1 protein_id gnl|my_center|LOCUS_00100 9270 8950 gene locus_tag LOCUS_00110 9270 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9566 10957 gene locus_tag LOCUS_00120 9566 10957 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860810.1 protein_id gnl|my_center|LOCUS_00120 11247 12305 gene locus_tag LOCUS_00130 gene ord 11247 12305 CDS product 2,4-diaminopentanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895461.1 protein_id gnl|my_center|LOCUS_00130 12375 12671 gene locus_tag LOCUS_00140 gene ortA 12375 12671 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860811.1 protein_id gnl|my_center|LOCUS_00140 12671 14077 gene locus_tag LOCUS_00150 gene ortB 12671 14077 CDS product 2-amino-4-oxopentanoate thiolase subunit OrtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032507361.1 protein_id gnl|my_center|LOCUS_00150 14098 14463 gene locus_tag LOCUS_00160 14098 14463 CDS product ornithine aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434665.1 protein_id gnl|my_center|LOCUS_00160 14466 16721 gene locus_tag LOCUS_00170 gene oraE 14466 16721 CDS product D-ornithine 4,5-aminomutase subunit OraE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895465.1 protein_id gnl|my_center|LOCUS_00170 16788 18377 gene locus_tag LOCUS_00180 16788 18377 CDS product GlmL-related ornithine degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895468.1 protein_id gnl|my_center|LOCUS_00180 18390 19478 gene locus_tag LOCUS_00190 gene orr 18390 19478 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860813.1 protein_id gnl|my_center|LOCUS_00190 19645 20211 gene locus_tag LOCUS_00200 19645 20211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681641.1 protein_id gnl|my_center|LOCUS_00200 20467 21915 gene locus_tag LOCUS_00210 gene nhaC 20467 21915 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426252.1 protein_id gnl|my_center|LOCUS_00210 22087 23244 gene locus_tag LOCUS_00220 22087 23244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 24025 23351 gene locus_tag LOCUS_00230 24025 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24219 24674 gene locus_tag LOCUS_00240 gene tadA 24219 24674 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000180281.1 protein_id gnl|my_center|LOCUS_00240 24674 25531 gene locus_tag LOCUS_00250 24674 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 25570 26547 gene locus_tag LOCUS_00260 gene ispE 25570 26547 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_00260 26576 27271 gene locus_tag LOCUS_00270 26576 27271 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892132.1 protein_id gnl|my_center|LOCUS_00270 28934 27402 gene locus_tag LOCUS_00280 28934 27402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 29176 29604 gene locus_tag LOCUS_00290 29176 29604 CDS product DUF1934 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966177.1 protein_id gnl|my_center|LOCUS_00290 29730 31244 gene locus_tag LOCUS_00300 29730 31244 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_00300 31263 32651 gene locus_tag LOCUS_00310 31263 32651 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387108.1 protein_id gnl|my_center|LOCUS_00310 34062 32704 gene locus_tag LOCUS_00320 gene brnQ 34062 32704 CDS product branched-chain amino acid transport system II carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032833879.1 protein_id gnl|my_center|LOCUS_00320 34723 34289 gene locus_tag LOCUS_00330 34723 34289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36312 34780 gene locus_tag LOCUS_00340 36312 34780 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_00340 36886 36332 gene locus_tag LOCUS_00350 36886 36332 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016017.1 protein_id gnl|my_center|LOCUS_00350 38420 37050 gene locus_tag LOCUS_00360 38420 37050 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002671452.1 protein_id gnl|my_center|LOCUS_00360 39634 38738 gene locus_tag LOCUS_00370 39634 38738 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_00370 39801 40949 gene locus_tag LOCUS_00380 gene cobT 39801 40949 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964681.1 protein_id gnl|my_center|LOCUS_00380 40951 41490 gene locus_tag LOCUS_00390 gene cobU 40951 41490 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975899.1 protein_id gnl|my_center|LOCUS_00390 41517 42308 gene locus_tag LOCUS_00400 gene cobS 41517 42308 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989692.1 protein_id gnl|my_center|LOCUS_00400 42333 42713 gene locus_tag LOCUS_00410 42333 42713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 42714 43373 gene locus_tag LOCUS_00420 42714 43373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 43389 44183 gene locus_tag LOCUS_00430 gene srtB 43389 44183 CDS product class B sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000095595.1 protein_id gnl|my_center|LOCUS_00430 45311 44343 gene locus_tag LOCUS_00440 45311 44343 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_00440 45488 46777 gene locus_tag LOCUS_00450 45488 46777 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869172.1 protein_id gnl|my_center|LOCUS_00450 46774 49566 gene locus_tag LOCUS_00460 gene secA 46774 49566 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895216.1 protein_id gnl|my_center|LOCUS_00460 49670 50707 gene locus_tag LOCUS_00470 gene prfB 49670 50707 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177451831.1 protein_id gnl|my_center|LOCUS_00470 51003 50725 gene locus_tag LOCUS_00480 51003 50725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51203 51631 gene locus_tag LOCUS_00490 51203 51631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 51666 52739 gene locus_tag LOCUS_00500 51666 52739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 52897 53745 gene locus_tag LOCUS_00510 52897 53745 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_00510 54063 54473 gene locus_tag LOCUS_00520 54063 54473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 54628 54846 gene locus_tag LOCUS_00530 54628 54846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 54881 55951 gene locus_tag LOCUS_00540 54881 55951 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162618262.1 protein_id gnl|my_center|LOCUS_00540 56217 56014 gene locus_tag LOCUS_00550 56217 56014 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_00550 57014 56310 gene locus_tag LOCUS_00560 57014 56310 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665989.1 protein_id gnl|my_center|LOCUS_00560 57173 57835 gene locus_tag LOCUS_00570 57173 57835 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_00570 57838 59043 gene locus_tag LOCUS_00580 57838 59043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 59046 59747 gene locus_tag LOCUS_00590 59046 59747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_00590 59740 61185 gene locus_tag LOCUS_00600 59740 61185 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454160.1 protein_id gnl|my_center|LOCUS_00600 61447 61193 gene locus_tag LOCUS_00610 61447 61193 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_00610 61601 62341 gene locus_tag LOCUS_00620 61601 62341 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_00620 62363 64732 gene locus_tag LOCUS_00630 62363 64732 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384650.1 protein_id gnl|my_center|LOCUS_00630 64873 65415 gene locus_tag LOCUS_00640 64873 65415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 65438 66052 gene locus_tag LOCUS_00650 65438 66052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 66039 66620 gene locus_tag LOCUS_00660 66039 66620 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_00660 67217 67855 gene locus_tag LOCUS_00670 67217 67855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 68005 68676 gene locus_tag LOCUS_00680 68005 68676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 68848 69468 gene locus_tag LOCUS_00690 68848 69468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 69485 70300 gene locus_tag LOCUS_00700 69485 70300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 72387 70618 gene locus_tag LOCUS_00710 gene thrS 72387 70618 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080983.1 protein_id gnl|my_center|LOCUS_00710 73893 72520 gene locus_tag LOCUS_00720 73893 72520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 74100 73903 gene locus_tag LOCUS_00730 74100 73903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 74322 75434 gene locus_tag LOCUS_00740 74322 75434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 75448 76098 gene locus_tag LOCUS_00750 75448 76098 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_00750 76350 78257 gene locus_tag LOCUS_00760 76350 78257 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748895.1 protein_id gnl|my_center|LOCUS_00760 78399 79340 gene locus_tag LOCUS_00770 78399 79340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 79340 80416 gene locus_tag LOCUS_00780 79340 80416 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103700.1 protein_id gnl|my_center|LOCUS_00780 80429 81496 gene locus_tag LOCUS_00790 80429 81496 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002902455.1 protein_id gnl|my_center|LOCUS_00790 81498 82448 gene locus_tag LOCUS_00800 81498 82448 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893618.1 protein_id gnl|my_center|LOCUS_00800 82602 84575 gene locus_tag LOCUS_00810 gene uvrB 82602 84575 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000441046.1 protein_id gnl|my_center|LOCUS_00810 84624 87467 gene locus_tag LOCUS_00820 gene uvrA 84624 87467 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_00820 87542 88978 gene locus_tag LOCUS_00830 87542 88978 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_00830 89336 89076 gene locus_tag LOCUS_00840 89336 89076 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002903988.1 protein_id gnl|my_center|LOCUS_00840 90423 89494 gene locus_tag LOCUS_00850 gene fba 90423 89494 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_00850 90997 90488 gene locus_tag LOCUS_00860 90997 90488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 91086 92126 gene locus_tag LOCUS_00870 91086 92126 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949019.1 protein_id gnl|my_center|LOCUS_00870 92092 93036 gene locus_tag LOCUS_00880 92092 93036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 93046 93507 gene locus_tag LOCUS_00890 gene smpB 93046 93507 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391819.1 protein_id gnl|my_center|LOCUS_00890 93603 93958 gene locus_tag LOCUS_tm00010 93603 93958 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 94297 94803 gene locus_tag LOCUS_00900 94297 94803 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366315.1 protein_id gnl|my_center|LOCUS_00900 95043 100421 gene locus_tag LOCUS_00910 95043 100421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 102101 100476 gene locus_tag LOCUS_00920 102101 100476 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_00920 104590 102317 gene locus_tag LOCUS_00930 104590 102317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 105296 104598 gene locus_tag LOCUS_00940 105296 104598 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964843.1 protein_id gnl|my_center|LOCUS_00940 105606 106538 gene locus_tag LOCUS_00950 gene cysK 105606 106538 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_00950 106667 107380 gene locus_tag LOCUS_00960 106667 107380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 107426 108229 gene locus_tag LOCUS_00970 gene truA 107426 108229 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048349.1 protein_id gnl|my_center|LOCUS_00970 108232 109380 gene locus_tag LOCUS_00980 108232 109380 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966159.1 protein_id gnl|my_center|LOCUS_00980 109493 110872 gene locus_tag LOCUS_00990 109493 110872 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425390.1 protein_id gnl|my_center|LOCUS_00990 111828 110941 gene locus_tag LOCUS_01000 111828 110941 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490772.1 protein_id gnl|my_center|LOCUS_01000 111941 112864 gene locus_tag LOCUS_01010 111941 112864 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_01010 113015 114310 gene locus_tag LOCUS_01020 gene eno 113015 114310 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_01020 114395 115825 gene locus_tag LOCUS_01030 114395 115825 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853317.1 protein_id gnl|my_center|LOCUS_01030 115836 116342 gene locus_tag LOCUS_01040 115836 116342 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_01040 116459 116773 gene locus_tag LOCUS_01050 116459 116773 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813255.1 protein_id gnl|my_center|LOCUS_01050 116799 119354 gene locus_tag LOCUS_01060 116799 119354 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_01060 119517 119735 gene locus_tag LOCUS_01070 119517 119735 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360986.1 protein_id gnl|my_center|LOCUS_01070 119752 119976 gene locus_tag LOCUS_01080 119752 119976 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_01080 120013 122298 gene locus_tag LOCUS_01090 gene feoB 120013 122298 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_01090 122338 122541 gene locus_tag LOCUS_01100 122338 122541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 123920 122604 gene locus_tag LOCUS_01110 123920 122604 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_01110 124258 124509 gene locus_tag LOCUS_01120 124258 124509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 124466 124777 gene locus_tag LOCUS_01130 gene rpsJ 124466 124777 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156464.1 protein_id gnl|my_center|LOCUS_01130 124854 125489 gene locus_tag LOCUS_01140 gene rplC 124854 125489 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421173.1 protein_id gnl|my_center|LOCUS_01140 125516 126139 gene locus_tag LOCUS_01150 gene rplD 125516 126139 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_01150 126139 126429 gene locus_tag LOCUS_01160 gene rplW 126139 126429 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_01160 126447 127280 gene locus_tag LOCUS_01170 gene rplB 126447 127280 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357299.1 protein_id gnl|my_center|LOCUS_01170 127297 127575 gene locus_tag LOCUS_01180 gene rpsS 127297 127575 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_01180 127593 127934 gene locus_tag LOCUS_01190 gene rplV 127593 127934 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966407.1 protein_id gnl|my_center|LOCUS_01190 127946 128824 gene locus_tag LOCUS_01200 127946 128824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 128845 129276 gene locus_tag LOCUS_01210 gene rplP 128845 129276 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_01210 129276 129479 gene locus_tag LOCUS_01220 gene rpmC 129276 129479 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_01220 129498 129758 gene locus_tag LOCUS_01230 gene rpsQ 129498 129758 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_01230 129773 130147 gene locus_tag LOCUS_01240 gene rplN 129773 130147 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616546.1 protein_id gnl|my_center|LOCUS_01240 130160 130465 gene locus_tag LOCUS_01250 gene rplX 130160 130465 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975178.1 protein_id gnl|my_center|LOCUS_01250 130483 131025 gene locus_tag LOCUS_01260 gene rplE 130483 131025 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357534.1 protein_id gnl|my_center|LOCUS_01260 131035 131220 gene locus_tag LOCUS_01270 131035 131220 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_01270 131287 131685 gene locus_tag LOCUS_01280 gene rpsH 131287 131685 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_01280 131698 132240 gene locus_tag LOCUS_01290 gene rplF 131698 132240 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_01290 132258 132623 gene locus_tag LOCUS_01300 gene rplR 132258 132623 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_01300 132640 133143 gene locus_tag LOCUS_01310 gene rpsE 132640 133143 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_01310 133155 133337 gene locus_tag LOCUS_01320 gene rpmD 133155 133337 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894509.1 protein_id gnl|my_center|LOCUS_01320 133356 133796 gene locus_tag LOCUS_01330 gene rplO 133356 133796 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_01330 133798 135081 gene locus_tag LOCUS_01340 gene secY 133798 135081 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427725.1 protein_id gnl|my_center|LOCUS_01340 135096 135743 gene locus_tag LOCUS_01350 135096 135743 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_01350 135746 136507 gene locus_tag LOCUS_01360 gene map 135746 136507 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_01360 136513 136731 gene locus_tag LOCUS_01370 gene infA 136513 136731 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421127.1 protein_id gnl|my_center|LOCUS_01370 137016 137384 gene locus_tag LOCUS_01380 gene rpsM 137016 137384 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421125.1 protein_id gnl|my_center|LOCUS_01380 137402 137800 gene locus_tag LOCUS_01390 gene rpsK 137402 137800 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_01390 137822 138409 gene locus_tag LOCUS_01400 gene rpsD 137822 138409 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_01400 138463 139407 gene locus_tag LOCUS_01410 138463 139407 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427733.1 protein_id gnl|my_center|LOCUS_01410 139432 139773 gene locus_tag LOCUS_01420 gene rplQ 139432 139773 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_01420 140387 139824 gene locus_tag LOCUS_01430 gene ahpC 140387 139824 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_01430 141011 141814 gene locus_tag LOCUS_01440 141011 141814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 141830 144055 gene locus_tag LOCUS_01450 gene pcrA 141830 144055 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_01450 144079 146055 gene locus_tag LOCUS_01460 gene ligA 144079 146055 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989804.1 protein_id gnl|my_center|LOCUS_01460 146072 147070 gene locus_tag LOCUS_01470 146072 147070 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146584.1 protein_id gnl|my_center|LOCUS_01470 147337 149082 gene locus_tag LOCUS_01480 gene dnaX 147337 149082 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421622.1 protein_id gnl|my_center|LOCUS_01480 149094 149462 gene locus_tag LOCUS_01490 149094 149462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 149474 150073 gene locus_tag LOCUS_01500 gene recR 149474 150073 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_01500 150423 151823 gene locus_tag LOCUS_01510 150423 151823 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_01510 151853 153271 gene locus_tag LOCUS_01520 151853 153271 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462328.1 protein_id gnl|my_center|LOCUS_01520 153457 153741 gene locus_tag LOCUS_01530 153457 153741 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262697.1 protein_id gnl|my_center|LOCUS_01530 153725 154366 gene locus_tag LOCUS_01540 153725 154366 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_01540 154408 155052 gene locus_tag LOCUS_01550 154408 155052 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262698.1 protein_id gnl|my_center|LOCUS_01550 155354 156568 gene locus_tag LOCUS_01560 155354 156568 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016377.1 protein_id gnl|my_center|LOCUS_01560 156628 159801 gene locus_tag LOCUS_01570 gene carB 156628 159801 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001126116.1 protein_id gnl|my_center|LOCUS_01570 159902 160633 gene locus_tag LOCUS_01580 159902 160633 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_01580 160627 161538 gene locus_tag LOCUS_01590 160627 161538 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_01590 161538 162266 gene locus_tag LOCUS_01600 gene pyrF 161538 162266 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000083510.1 protein_id gnl|my_center|LOCUS_01600 162287 162931 gene locus_tag LOCUS_01610 gene pyrE 162287 162931 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989825.1 protein_id gnl|my_center|LOCUS_01610 162931 164049 gene locus_tag LOCUS_01620 gene pyrB 162931 164049 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048210.1 protein_id gnl|my_center|LOCUS_01620 164143 164301 gene locus_tag LOCUS_01630 164143 164301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 165623 164403 gene locus_tag LOCUS_01640 gene fmhA 165623 164403 CDS product FemA/FemB family glycyltransferase FmhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012225.1 protein_id gnl|my_center|LOCUS_01640 166901 165669 gene locus_tag LOCUS_01650 166901 165669 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068407.1 protein_id gnl|my_center|LOCUS_01650 168229 167024 gene locus_tag LOCUS_01660 168229 167024 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373411.1 protein_id gnl|my_center|LOCUS_01660 168478 169287 gene locus_tag LOCUS_01670 168478 169287 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_01670 169336 170400 gene locus_tag LOCUS_01680 169336 170400 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867209.1 protein_id gnl|my_center|LOCUS_01680 170416 171129 gene locus_tag LOCUS_01690 170416 171129 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_01690 171133 171588 gene locus_tag LOCUS_01700 gene dtd 171133 171588 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_01700 171724 172635 gene locus_tag LOCUS_01710 171724 172635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 172608 174278 gene locus_tag LOCUS_01720 172608 174278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 174257 175231 gene locus_tag LOCUS_01730 174257 175231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 175247 175777 gene locus_tag LOCUS_01740 175247 175777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 175788 177635 gene locus_tag LOCUS_01750 175788 177635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 177632 178723 gene locus_tag LOCUS_01760 177632 178723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 178736 179686 gene locus_tag LOCUS_01770 178736 179686 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989474.1 protein_id gnl|my_center|LOCUS_01770 179696 180796 gene locus_tag LOCUS_01780 179696 180796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 180812 183193 gene locus_tag LOCUS_01790 180812 183193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 183488 187933 gene locus_tag LOCUS_01800 183488 187933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 188091 188612 gene locus_tag LOCUS_01810 188091 188612 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_01810 188578 189204 gene locus_tag LOCUS_01820 188578 189204 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476311.1 protein_id gnl|my_center|LOCUS_01820 189223 190308 gene locus_tag LOCUS_01830 gene mtnA 189223 190308 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392224.1 protein_id gnl|my_center|LOCUS_01830 190308 191084 gene locus_tag LOCUS_01840 gene scpA 190308 191084 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001199753.1 protein_id gnl|my_center|LOCUS_01840 191074 191649 gene locus_tag LOCUS_01850 gene scpB 191074 191649 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965360.1 protein_id gnl|my_center|LOCUS_01850 192411 191686 gene locus_tag LOCUS_01860 192411 191686 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_01860 192548 194470 gene locus_tag LOCUS_01870 192548 194470 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903247.1 protein_id gnl|my_center|LOCUS_01870 194470 195678 gene locus_tag LOCUS_01880 194470 195678 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_01880 195838 196680 gene locus_tag LOCUS_01890 195838 196680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 196687 197535 gene locus_tag LOCUS_01900 gene proB 196687 197535 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966527.1 protein_id gnl|my_center|LOCUS_01900 197548 198789 gene locus_tag LOCUS_01910 197548 198789 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932313.1 protein_id gnl|my_center|LOCUS_01910 198800 199117 gene locus_tag LOCUS_01920 198800 199117 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396712.1 protein_id gnl|my_center|LOCUS_01920 199632 199486 gene locus_tag LOCUS_01930 199632 199486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 200191 201306 gene locus_tag LOCUS_01940 200191 201306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 201630 201911 gene locus_tag LOCUS_01950 201630 201911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 201945 202805 gene locus_tag LOCUS_01960 201945 202805 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_01960 202850 203233 gene locus_tag LOCUS_01970 202850 203233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 203254 204480 gene locus_tag LOCUS_01980 203254 204480 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_01980 204501 204986 gene locus_tag LOCUS_01990 204501 204986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 204991 205671 gene locus_tag LOCUS_02000 204991 205671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 >Feature sequence02 92 180 gene locus_tag LOCUS_t00010 92 180 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 209 301 gene locus_tag LOCUS_t00020 209 301 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 311 386 gene locus_tag LOCUS_t00030 311 386 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 402 478 gene locus_tag LOCUS_t00040 402 478 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 492 568 gene locus_tag LOCUS_t00050 492 568 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 586 661 gene locus_tag LOCUS_t00060 586 661 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1084 1668 gene locus_tag LOCUS_02010 1084 1668 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897586.1 protein_id gnl|my_center|LOCUS_02010 2843 1722 gene locus_tag LOCUS_02020 gene alr 2843 1722 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_02020 3850 2852 gene locus_tag LOCUS_02030 3850 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 4281 4826 gene locus_tag LOCUS_02040 4281 4826 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428379.1 protein_id gnl|my_center|LOCUS_02040 4819 5706 gene locus_tag LOCUS_02050 gene xerD 4819 5706 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_02050 5859 6197 gene locus_tag LOCUS_02060 gene rplS 5859 6197 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362586.1 protein_id gnl|my_center|LOCUS_02060 6279 7121 gene locus_tag LOCUS_02070 gene ylqF 6279 7121 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_02070 7123 7791 gene locus_tag LOCUS_02080 7123 7791 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_02080 7952 9319 gene locus_tag LOCUS_02090 7952 9319 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_02090 9306 9980 gene locus_tag LOCUS_02100 9306 9980 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_02100 9949 11895 gene locus_tag LOCUS_02110 9949 11895 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948184.1 protein_id gnl|my_center|LOCUS_02110 11900 13051 gene locus_tag LOCUS_02120 11900 13051 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014128488.1 protein_id gnl|my_center|LOCUS_02120 14247 13084 gene locus_tag LOCUS_02130 14247 13084 CDS product DHHW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138263010.1 protein_id gnl|my_center|LOCUS_02130 15644 14259 gene locus_tag LOCUS_02140 15644 14259 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_02140 16092 15631 gene locus_tag LOCUS_02150 16092 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 16870 16094 gene locus_tag LOCUS_02160 16870 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 17111 19801 gene locus_tag LOCUS_02170 17111 19801 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_02170 19831 20751 gene locus_tag LOCUS_02180 19831 20751 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356507.1 protein_id gnl|my_center|LOCUS_02180 20753 21559 gene locus_tag LOCUS_02190 20753 21559 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948565.1 protein_id gnl|my_center|LOCUS_02190 21556 22005 gene locus_tag LOCUS_02200 21556 22005 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860846.1 protein_id gnl|my_center|LOCUS_02200 21995 23230 gene locus_tag LOCUS_02210 21995 23230 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_02210 23241 24254 gene locus_tag LOCUS_02220 gene plsX 23241 24254 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_02220 24264 24941 gene locus_tag LOCUS_02230 gene rnc 24264 24941 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965055.1 protein_id gnl|my_center|LOCUS_02230 24941 28486 gene locus_tag LOCUS_02240 gene smc 24941 28486 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_02240 28496 29398 gene locus_tag LOCUS_02250 28496 29398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 29391 30710 gene locus_tag LOCUS_02260 gene der 29391 30710 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426959.1 protein_id gnl|my_center|LOCUS_02260 30713 31318 gene locus_tag LOCUS_02270 gene plsY 30713 31318 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_02270 31311 32321 gene locus_tag LOCUS_02280 31311 32321 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426955.1 protein_id gnl|my_center|LOCUS_02280 32335 33648 gene locus_tag LOCUS_02290 gene miaB 32335 33648 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_02290 33664 34380 gene locus_tag LOCUS_02300 33664 34380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 34530 37115 gene locus_tag LOCUS_02310 gene clpB 34530 37115 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939160.1 protein_id gnl|my_center|LOCUS_02310 37383 38366 gene locus_tag LOCUS_02320 37383 38366 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_02320 39123 38434 gene locus_tag LOCUS_02330 39123 38434 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_02330 39172 39795 gene locus_tag LOCUS_02340 gene nth 39172 39795 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387915.1 protein_id gnl|my_center|LOCUS_02340 39797 40327 gene locus_tag LOCUS_02350 39797 40327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 40933 40433 gene locus_tag LOCUS_02360 40933 40433 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_02360 41930 40965 gene locus_tag LOCUS_02370 41930 40965 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986281.1 protein_id gnl|my_center|LOCUS_02370 42076 43035 gene locus_tag LOCUS_02380 42076 43035 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_02380 43035 43505 gene locus_tag LOCUS_02390 gene trmL 43035 43505 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356826.1 protein_id gnl|my_center|LOCUS_02390 43573 44943 gene locus_tag LOCUS_02400 gene rpoN 43573 44943 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462176.1 protein_id gnl|my_center|LOCUS_02400 45007 46026 gene locus_tag LOCUS_02410 gene gap 45007 46026 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707358.1 protein_id gnl|my_center|LOCUS_02410 46029 47216 gene locus_tag LOCUS_02420 46029 47216 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_02420 47218 47970 gene locus_tag LOCUS_02430 gene tpiA 47218 47970 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_02430 48040 48273 gene locus_tag LOCUS_02440 gene secG 48040 48273 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220028.1 protein_id gnl|my_center|LOCUS_02440 48353 50350 gene locus_tag LOCUS_02450 48353 50350 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392862.1 protein_id gnl|my_center|LOCUS_02450 51266 50490 gene locus_tag LOCUS_02460 51266 50490 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_02460 51988 51356 gene locus_tag LOCUS_02470 51988 51356 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906154.1 protein_id gnl|my_center|LOCUS_02470 52067 53143 gene locus_tag LOCUS_02480 52067 53143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 53146 53916 gene locus_tag LOCUS_02490 53146 53916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 54883 53975 gene locus_tag LOCUS_02500 54883 53975 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861083.1 protein_id gnl|my_center|LOCUS_02500 55716 54907 gene locus_tag LOCUS_02510 55716 54907 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418878.1 protein_id gnl|my_center|LOCUS_02510 57535 55736 gene locus_tag LOCUS_02520 gene pepF 57535 55736 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_02520 57604 58416 gene locus_tag LOCUS_02530 gene murI 57604 58416 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_02530 58457 58978 gene locus_tag LOCUS_02540 58457 58978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 58975 60021 gene locus_tag LOCUS_02550 58975 60021 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393376.1 protein_id gnl|my_center|LOCUS_02550 60035 60982 gene locus_tag LOCUS_02560 60035 60982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 60984 62240 gene locus_tag LOCUS_02570 60984 62240 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_02570 62237 62668 gene locus_tag LOCUS_02580 gene dut 62237 62668 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_02580 62670 63668 gene locus_tag LOCUS_02590 62670 63668 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_02590 63729 65465 gene locus_tag LOCUS_02600 gene dnaG 63729 65465 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_02600 65482 66672 gene locus_tag LOCUS_02610 gene rpoD 65482 66672 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_02610 66676 67431 gene locus_tag LOCUS_02620 66676 67431 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_02620 67421 68185 gene locus_tag LOCUS_02630 67421 68185 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_02630 68511 70739 gene locus_tag LOCUS_02640 68511 70739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 70799 71401 gene locus_tag LOCUS_02650 70799 71401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 71391 73202 gene locus_tag LOCUS_02660 71391 73202 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462083.1 protein_id gnl|my_center|LOCUS_02660 73199 74932 gene locus_tag LOCUS_02670 73199 74932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272781.1 protein_id gnl|my_center|LOCUS_02670 75002 76057 gene locus_tag LOCUS_02680 75002 76057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 76121 79027 gene locus_tag LOCUS_02690 76121 79027 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115928912.1 protein_id gnl|my_center|LOCUS_02690 79024 80103 gene locus_tag LOCUS_02700 79024 80103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 80100 81197 gene locus_tag LOCUS_02710 80100 81197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 81201 85169 gene locus_tag LOCUS_02720 81201 85169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 85190 92266 gene locus_tag LOCUS_02730 85190 92266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 92259 93110 gene locus_tag LOCUS_02740 92259 93110 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_02740 93111 93887 gene locus_tag LOCUS_02750 93111 93887 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227215.1 protein_id gnl|my_center|LOCUS_02750 93955 96984 gene locus_tag LOCUS_02760 93955 96984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 97053 97739 gene locus_tag LOCUS_02770 97053 97739 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182762.1 protein_id gnl|my_center|LOCUS_02770 97937 98311 gene locus_tag LOCUS_02780 97937 98311 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379711.1 protein_id gnl|my_center|LOCUS_02780 98819 100195 gene locus_tag LOCUS_02790 98819 100195 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_02790 100244 104467 gene locus_tag LOCUS_02800 100244 104467 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965697.1 protein_id gnl|my_center|LOCUS_02800 104534 105256 gene locus_tag LOCUS_02810 104534 105256 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_02810 105520 106059 gene locus_tag LOCUS_02820 gene pgsA 105520 106059 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_02820 106131 107375 gene locus_tag LOCUS_02830 106131 107375 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948020.1 protein_id gnl|my_center|LOCUS_02830 107507 108598 gene locus_tag LOCUS_02840 gene recA 107507 108598 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_02840 108782 109261 gene locus_tag LOCUS_02850 108782 109261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 109293 109553 gene locus_tag LOCUS_02860 gene rpmA 109293 109553 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_02860 109609 110910 gene locus_tag LOCUS_02870 gene obgE 109609 110910 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888921.1 protein_id gnl|my_center|LOCUS_02870 110903 113281 gene locus_tag LOCUS_02880 110903 113281 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099491.1 protein_id gnl|my_center|LOCUS_02880 113274 113987 gene locus_tag LOCUS_02890 113274 113987 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048024.1 protein_id gnl|my_center|LOCUS_02890 114007 114747 gene locus_tag LOCUS_02900 114007 114747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 114807 115001 gene locus_tag LOCUS_02910 114807 115001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 115112 116281 gene locus_tag LOCUS_02920 gene nifS 115112 116281 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861166.1 protein_id gnl|my_center|LOCUS_02920 116284 116733 gene locus_tag LOCUS_02930 gene nifU 116284 116733 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_02930 116798 118441 gene locus_tag LOCUS_02940 116798 118441 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_02940 118494 121115 gene locus_tag LOCUS_02950 gene alaS 118494 121115 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889064.1 protein_id gnl|my_center|LOCUS_02950 121157 121402 gene locus_tag LOCUS_02960 121157 121402 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_02960 121463 121903 gene locus_tag LOCUS_02970 gene ruvX 121463 121903 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_02970 122105 122602 gene locus_tag LOCUS_02980 gene purE 122105 122602 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_02980 122603 124042 gene locus_tag LOCUS_02990 gene purF 122603 124042 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964701.1 protein_id gnl|my_center|LOCUS_02990 124067 125107 gene locus_tag LOCUS_03000 gene purM 124067 125107 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813914.1 protein_id gnl|my_center|LOCUS_03000 125101 125688 gene locus_tag LOCUS_03010 gene purN 125101 125688 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_03010 125690 126400 gene locus_tag LOCUS_03020 125690 126400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 126404 127588 gene locus_tag LOCUS_03030 126404 127588 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_03030 127602 128867 gene locus_tag LOCUS_03040 gene purD 127602 128867 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_03040 128869 132570 gene locus_tag LOCUS_03050 128869 132570 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_03050 133022 132837 gene locus_tag LOCUS_03060 133022 132837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 133498 133199 gene locus_tag LOCUS_03070 133498 133199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 134309 133596 gene locus_tag LOCUS_03080 134309 133596 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965993.1 protein_id gnl|my_center|LOCUS_03080 135604 134309 gene locus_tag LOCUS_03090 135604 134309 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_03090 136780 135623 gene locus_tag LOCUS_03100 136780 135623 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_03100 137685 136759 gene locus_tag LOCUS_03110 gene miaA 137685 136759 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861408.1 protein_id gnl|my_center|LOCUS_03110 139614 137695 gene locus_tag LOCUS_03120 gene mutL 139614 137695 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861409.1 protein_id gnl|my_center|LOCUS_03120 142262 139656 gene locus_tag LOCUS_03130 gene mutS 142262 139656 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965142.1 protein_id gnl|my_center|LOCUS_03130 143535 142336 gene locus_tag LOCUS_03140 143535 142336 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_03140 144381 143569 gene locus_tag LOCUS_03150 144381 143569 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358964.1 protein_id gnl|my_center|LOCUS_03150 146209 144365 gene locus_tag LOCUS_03160 gene dxs 146209 144365 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_03160 147115 146222 gene locus_tag LOCUS_03170 147115 146222 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_03170 147315 147118 gene locus_tag LOCUS_03180 147315 147118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 148462 147317 gene locus_tag LOCUS_03190 gene xseA 148462 147317 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438130.1 protein_id gnl|my_center|LOCUS_03190 149412 148453 gene locus_tag LOCUS_03200 149412 148453 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861140.1 protein_id gnl|my_center|LOCUS_03200 149820 149419 gene locus_tag LOCUS_03210 gene nusB 149820 149419 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_03210 150176 149817 gene locus_tag LOCUS_03220 150176 149817 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701710.1 protein_id gnl|my_center|LOCUS_03220 152745 150223 gene locus_tag LOCUS_03230 152745 150223 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_03230 154024 152732 gene locus_tag LOCUS_03240 154024 152732 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963782.1 protein_id gnl|my_center|LOCUS_03240 155264 154035 gene locus_tag LOCUS_03250 155264 154035 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_03250 155923 155252 gene locus_tag LOCUS_03260 155923 155252 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_03260 156993 155926 gene locus_tag LOCUS_03270 gene mltG 156993 155926 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393139.1 protein_id gnl|my_center|LOCUS_03270 157581 157021 gene locus_tag LOCUS_03280 gene efp 157581 157021 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_03280 159654 157654 gene locus_tag LOCUS_03290 159654 157654 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_03290 162141 159664 gene locus_tag LOCUS_03300 gene leuS 162141 159664 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_03300 162487 162143 gene locus_tag LOCUS_03310 gene rsfS 162487 162143 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475792.1 protein_id gnl|my_center|LOCUS_03310 163050 162493 gene locus_tag LOCUS_03320 gene yqeK 163050 162493 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_03320 163630 163028 gene locus_tag LOCUS_03330 gene nadD 163630 163028 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_03330 165405 163630 gene locus_tag LOCUS_03340 gene aspS 165405 163630 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_03340 166668 165415 gene locus_tag LOCUS_03350 gene hisS 166668 165415 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422928.1 protein_id gnl|my_center|LOCUS_03350 168044 166662 gene locus_tag LOCUS_03360 168044 166662 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_03360 168654 168031 gene locus_tag LOCUS_03370 168654 168031 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_03370 170900 168699 gene locus_tag LOCUS_03380 170900 168699 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048080.1 protein_id gnl|my_center|LOCUS_03380 173147 170925 gene locus_tag LOCUS_03390 173147 170925 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944693.1 protein_id gnl|my_center|LOCUS_03390 173740 173333 gene locus_tag LOCUS_03400 173740 173333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 173855 173769 gene locus_tag LOCUS_t00070 173855 173769 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 174023 173942 gene locus_tag LOCUS_t00080 174023 173942 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 175719 174091 gene locus_tag LOCUS_03410 175719 174091 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_03410 176302 175706 gene locus_tag LOCUS_03420 gene coaE 176302 175706 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438041.1 protein_id gnl|my_center|LOCUS_03420 178965 176311 gene locus_tag LOCUS_03430 gene polA 178965 176311 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048038.1 protein_id gnl|my_center|LOCUS_03430 180299 178983 gene locus_tag LOCUS_03440 gene rimO 180299 178983 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_03440 183021 180289 gene locus_tag LOCUS_03450 183021 180289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 184137 183043 gene locus_tag LOCUS_03460 gene asd 184137 183043 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699652.1 protein_id gnl|my_center|LOCUS_03460 187810 184352 gene locus_tag LOCUS_03470 187810 184352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence03 2356 107 gene locus_tag LOCUS_03480 2356 107 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860926.1 protein_id gnl|my_center|LOCUS_03480 3488 2325 gene locus_tag LOCUS_03490 3488 2325 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963546.1 protein_id gnl|my_center|LOCUS_03490 4692 3676 gene locus_tag LOCUS_03500 4692 3676 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_03500 5827 4787 gene locus_tag LOCUS_03510 5827 4787 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_03510 6381 5830 gene locus_tag LOCUS_03520 6381 5830 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_03520 7710 6526 gene locus_tag LOCUS_03530 7710 6526 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966157.1 protein_id gnl|my_center|LOCUS_03530 8784 7849 gene locus_tag LOCUS_03540 8784 7849 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454768.1 protein_id gnl|my_center|LOCUS_03540 9533 8781 gene locus_tag LOCUS_03550 gene surE 9533 8781 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948033.1 protein_id gnl|my_center|LOCUS_03550 10255 9533 gene locus_tag LOCUS_03560 10255 9533 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_03560 10345 11508 gene locus_tag LOCUS_03570 10345 11508 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431793.1 protein_id gnl|my_center|LOCUS_03570 12196 11489 gene locus_tag LOCUS_03580 12196 11489 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894626.1 protein_id gnl|my_center|LOCUS_03580 12882 12223 gene locus_tag LOCUS_03590 12882 12223 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000120401.1 protein_id gnl|my_center|LOCUS_03590 13737 12886 gene locus_tag LOCUS_03600 13737 12886 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272547.1 protein_id gnl|my_center|LOCUS_03600 15089 13896 gene locus_tag LOCUS_03610 gene tuf 15089 13896 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_03610 17183 15111 gene locus_tag LOCUS_03620 gene fusA 17183 15111 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436178.1 protein_id gnl|my_center|LOCUS_03620 17677 17207 gene locus_tag LOCUS_03630 gene rpsG 17677 17207 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421180.1 protein_id gnl|my_center|LOCUS_03630 18355 17939 gene locus_tag LOCUS_03640 gene rpsL 18355 17939 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720973.1 protein_id gnl|my_center|LOCUS_03640 22362 18478 gene locus_tag LOCUS_03650 gene rpoC 22362 18478 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641247.1 protein_id gnl|my_center|LOCUS_03650 26063 22380 gene locus_tag LOCUS_03660 gene rpoB 26063 22380 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436174.1 protein_id gnl|my_center|LOCUS_03660 26798 26247 gene locus_tag LOCUS_03670 26798 26247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 27283 26801 gene locus_tag LOCUS_03680 27283 26801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 27899 27276 gene locus_tag LOCUS_03690 27899 27276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 28365 28000 gene locus_tag LOCUS_03700 gene rplL 28365 28000 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966422.1 protein_id gnl|my_center|LOCUS_03700 28904 28410 gene locus_tag LOCUS_03710 gene rplJ 28904 28410 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_03710 29775 29080 gene locus_tag LOCUS_03720 gene rplA 29775 29080 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421188.1 protein_id gnl|my_center|LOCUS_03720 30281 29856 gene locus_tag LOCUS_03730 gene rplK 30281 29856 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_03730 30882 30307 gene locus_tag LOCUS_03740 gene nusG 30882 30307 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_03740 31129 30902 gene locus_tag LOCUS_03750 gene secE 31129 30902 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728078.1 protein_id gnl|my_center|LOCUS_03750 31289 31140 gene locus_tag LOCUS_03760 gene rpmG 31289 31140 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_03760 32542 31490 gene locus_tag LOCUS_03770 32542 31490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 33685 32819 gene locus_tag LOCUS_03780 33685 32819 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356230.1 protein_id gnl|my_center|LOCUS_03780 34998 33805 gene locus_tag LOCUS_03790 gene tuf 34998 33805 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887863.1 protein_id gnl|my_center|LOCUS_03790 35111 35035 gene locus_tag LOCUS_t00090 35111 35035 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35826 35188 gene locus_tag LOCUS_03800 35826 35188 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387199.1 protein_id gnl|my_center|LOCUS_03800 36566 35826 gene locus_tag LOCUS_03810 gene rlmB 36566 35826 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000093759.1 protein_id gnl|my_center|LOCUS_03810 37054 36563 gene locus_tag LOCUS_03820 gene dfrA 37054 36563 CDS product dihydrofolate reductase DfrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230799.1 protein_id gnl|my_center|LOCUS_03820 37892 37062 gene locus_tag LOCUS_03830 37892 37062 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_03830 38293 37904 gene locus_tag LOCUS_03840 38293 37904 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930887.1 protein_id gnl|my_center|LOCUS_03840 39696 38290 gene locus_tag LOCUS_03850 gene cysS 39696 38290 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895184.1 protein_id gnl|my_center|LOCUS_03850 40243 39767 gene locus_tag LOCUS_03860 40243 39767 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_03860 41978 40245 gene locus_tag LOCUS_03870 41978 40245 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966455.1 protein_id gnl|my_center|LOCUS_03870 43203 42061 gene locus_tag LOCUS_03880 gene ispD 43203 42061 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_03880 44350 43205 gene locus_tag LOCUS_03890 44350 43205 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860623.1 protein_id gnl|my_center|LOCUS_03890 44638 45315 gene locus_tag LOCUS_03900 44638 45315 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_03900 45299 46768 gene locus_tag LOCUS_03910 45299 46768 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494832.1 protein_id gnl|my_center|LOCUS_03910 47430 46864 gene locus_tag LOCUS_03920 47430 46864 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_03920 48270 47497 gene locus_tag LOCUS_03930 48270 47497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 48975 48439 gene locus_tag LOCUS_03940 48975 48439 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_03940 49458 49015 gene locus_tag LOCUS_03950 49458 49015 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_03950 49645 50022 gene locus_tag LOCUS_03960 49645 50022 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_03960 50680 50213 gene locus_tag LOCUS_03970 50680 50213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 52328 50685 gene locus_tag LOCUS_03980 52328 50685 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_03980 54018 52354 gene locus_tag LOCUS_03990 54018 52354 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080960.1 protein_id gnl|my_center|LOCUS_03990 56547 54247 gene locus_tag LOCUS_04000 56547 54247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 56993 56766 gene locus_tag LOCUS_04010 56993 56766 CDS product PC4/YdbC family ssDNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925352.1 protein_id gnl|my_center|LOCUS_04010 57292 57705 gene locus_tag LOCUS_04020 57292 57705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 57727 58140 gene locus_tag LOCUS_04030 57727 58140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 60693 58405 gene locus_tag LOCUS_04040 60693 58405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 61892 60924 gene locus_tag LOCUS_04050 61892 60924 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964363.1 protein_id gnl|my_center|LOCUS_04050 62658 61909 gene locus_tag LOCUS_04060 62658 61909 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_04060 63198 62746 gene locus_tag LOCUS_04070 63198 62746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 63827 63228 gene locus_tag LOCUS_04080 63827 63228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747124.1 protein_id gnl|my_center|LOCUS_04080 64078 64362 gene locus_tag LOCUS_04090 64078 64362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 64372 64605 gene locus_tag LOCUS_04100 64372 64605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 66098 64713 gene locus_tag LOCUS_04110 gene nhaC 66098 64713 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896009.1 protein_id gnl|my_center|LOCUS_04110 66584 67414 gene locus_tag LOCUS_04120 66584 67414 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963823.1 protein_id gnl|my_center|LOCUS_04120 68159 67476 gene locus_tag LOCUS_04130 68159 67476 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358908.1 protein_id gnl|my_center|LOCUS_04130 68502 68194 gene locus_tag LOCUS_04140 68502 68194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 69270 68611 gene locus_tag LOCUS_04150 gene trmB 69270 68611 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239385.1 protein_id gnl|my_center|LOCUS_04150 70080 69280 gene locus_tag LOCUS_04160 70080 69280 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_04160 70975 70073 gene locus_tag LOCUS_04170 70975 70073 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_04170 71799 70960 gene locus_tag LOCUS_04180 71799 70960 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435660.1 protein_id gnl|my_center|LOCUS_04180 72036 73424 gene locus_tag LOCUS_04190 72036 73424 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948567.1 protein_id gnl|my_center|LOCUS_04190 74479 73436 gene locus_tag LOCUS_04200 74479 73436 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897671.1 protein_id gnl|my_center|LOCUS_04200 74506 74877 gene locus_tag LOCUS_04210 74506 74877 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416526.1 protein_id gnl|my_center|LOCUS_04210 74861 75403 gene locus_tag LOCUS_04220 74861 75403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 75426 77180 gene locus_tag LOCUS_04230 75426 77180 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897431.1 protein_id gnl|my_center|LOCUS_04230 78171 77314 gene locus_tag LOCUS_04240 78171 77314 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_04240 78768 78190 gene locus_tag LOCUS_04250 gene rsxA 78768 78190 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_04250 79454 78771 gene locus_tag LOCUS_04260 79454 78771 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_04260 80026 79454 gene locus_tag LOCUS_04270 80026 79454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 81011 80016 gene locus_tag LOCUS_04280 81011 80016 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_04280 82327 81011 gene locus_tag LOCUS_04290 gene rsxC 82327 81011 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948145.1 protein_id gnl|my_center|LOCUS_04290 82854 82522 gene locus_tag LOCUS_04300 82854 82522 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214419.1 protein_id gnl|my_center|LOCUS_04300 83079 83699 gene locus_tag LOCUS_04310 83079 83699 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902979.1 protein_id gnl|my_center|LOCUS_04310 86240 83808 gene locus_tag LOCUS_04320 86240 83808 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678883.1 protein_id gnl|my_center|LOCUS_04320 86828 86301 gene locus_tag LOCUS_04330 gene nrdG 86828 86301 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432598.1 protein_id gnl|my_center|LOCUS_04330 88411 86933 gene locus_tag LOCUS_04340 88411 86933 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048125.1 protein_id gnl|my_center|LOCUS_04340 89991 88501 gene locus_tag LOCUS_04350 gene cls 89991 88501 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_04350 91372 90101 gene locus_tag LOCUS_04360 gene serS 91372 90101 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435562.1 protein_id gnl|my_center|LOCUS_04360 93303 91384 gene locus_tag LOCUS_04370 93303 91384 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048401.1 protein_id gnl|my_center|LOCUS_04370 96324 93349 gene locus_tag LOCUS_04380 96324 93349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 98376 96373 gene locus_tag LOCUS_04390 98376 96373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 99003 98401 gene locus_tag LOCUS_04400 99003 98401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 99644 99213 gene locus_tag LOCUS_04410 99644 99213 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902921.1 protein_id gnl|my_center|LOCUS_04410 100287 99655 gene locus_tag LOCUS_04420 100287 99655 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_04420 100664 100924 gene locus_tag LOCUS_04430 100664 100924 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262921.1 protein_id gnl|my_center|LOCUS_04430 101088 101504 gene locus_tag LOCUS_04440 101088 101504 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_04440 102924 101587 gene locus_tag LOCUS_04450 102924 101587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 103698 103156 gene locus_tag LOCUS_04460 103698 103156 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_04460 105224 103833 gene locus_tag LOCUS_04470 gene radA 105224 103833 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966465.1 protein_id gnl|my_center|LOCUS_04470 107335 105374 gene locus_tag LOCUS_04480 107335 105374 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887791.1 protein_id gnl|my_center|LOCUS_04480 107641 108549 gene locus_tag LOCUS_04490 107641 108549 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_04490 108558 109664 gene locus_tag LOCUS_04500 108558 109664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 109674 110387 gene locus_tag LOCUS_04510 109674 110387 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068399.1 protein_id gnl|my_center|LOCUS_04510 111006 110431 gene locus_tag LOCUS_04520 111006 110431 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 protein_id gnl|my_center|LOCUS_04520 111663 111025 gene locus_tag LOCUS_04530 111663 111025 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017175.1 protein_id gnl|my_center|LOCUS_04530 112324 111665 gene locus_tag LOCUS_04540 112324 111665 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254956.1 protein_id gnl|my_center|LOCUS_04540 113111 112404 gene locus_tag LOCUS_04550 113111 112404 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009571.1 protein_id gnl|my_center|LOCUS_04550 114144 113104 gene locus_tag LOCUS_04560 gene metN 114144 113104 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242531.1 protein_id gnl|my_center|LOCUS_04560 115073 114213 gene locus_tag LOCUS_04570 115073 114213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 115688 115293 gene locus_tag LOCUS_04580 gene rpsI 115688 115293 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_04580 116136 115708 gene locus_tag LOCUS_04590 gene rplM 116136 115708 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_04590 118424 116397 gene locus_tag LOCUS_04600 118424 116397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 119967 118822 gene locus_tag LOCUS_04610 119967 118822 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_04610 120099 120857 gene locus_tag LOCUS_04620 120099 120857 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_04620 121812 120910 gene locus_tag LOCUS_04630 121812 120910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 122082 123128 gene locus_tag LOCUS_04640 122082 123128 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922256.1 protein_id gnl|my_center|LOCUS_04640 123985 123194 gene locus_tag LOCUS_04650 123985 123194 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 protein_id gnl|my_center|LOCUS_04650 125573 124008 gene locus_tag LOCUS_04660 125573 124008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085511.1 protein_id gnl|my_center|LOCUS_04660 127384 125651 gene locus_tag LOCUS_04670 gene ade 127384 125651 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476052.1 protein_id gnl|my_center|LOCUS_04670 129195 127417 gene locus_tag LOCUS_04680 129195 127417 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970160.1 protein_id gnl|my_center|LOCUS_04680 129518 129264 gene locus_tag LOCUS_04690 129518 129264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 129964 129629 gene locus_tag LOCUS_04700 129964 129629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 130307 129966 gene locus_tag LOCUS_04710 130307 129966 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074395.1 protein_id gnl|my_center|LOCUS_04710 130744 130526 gene locus_tag LOCUS_04720 130744 130526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 131683 130817 gene locus_tag LOCUS_04730 131683 130817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 131946 132440 gene locus_tag LOCUS_04740 131946 132440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 132865 132446 gene locus_tag LOCUS_04750 132865 132446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 134534 132897 gene locus_tag LOCUS_04760 134534 132897 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057658.1 protein_id gnl|my_center|LOCUS_04760 135212 134751 gene locus_tag LOCUS_04770 135212 134751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 135660 135223 gene locus_tag LOCUS_04780 135660 135223 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893678.1 protein_id gnl|my_center|LOCUS_04780 136936 135791 gene locus_tag LOCUS_04790 136936 135791 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461029.1 protein_id gnl|my_center|LOCUS_04790 137545 137150 gene locus_tag LOCUS_04800 137545 137150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 138364 137549 gene locus_tag LOCUS_04810 138364 137549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 138796 138401 gene locus_tag LOCUS_04820 138796 138401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 139228 138848 gene locus_tag LOCUS_04830 139228 138848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 139967 139395 gene locus_tag LOCUS_04840 139967 139395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964077.1 protein_id gnl|my_center|LOCUS_04840 140193 140008 gene locus_tag LOCUS_04850 140193 140008 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422320.1 protein_id gnl|my_center|LOCUS_04850 140879 140226 gene locus_tag LOCUS_04860 140879 140226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 142755 141274 gene locus_tag LOCUS_04870 142755 141274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 143616 143182 gene locus_tag LOCUS_04880 143616 143182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 143820 144482 gene locus_tag LOCUS_04890 143820 144482 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_04890 145030 144512 gene locus_tag LOCUS_04900 145030 144512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 145225 146025 gene locus_tag LOCUS_04910 145225 146025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 146022 146837 gene locus_tag LOCUS_04920 146022 146837 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403518.1 protein_id gnl|my_center|LOCUS_04920 146834 147550 gene locus_tag LOCUS_04930 146834 147550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 148337 147585 gene locus_tag LOCUS_04940 148337 147585 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_04940 148570 149187 gene locus_tag LOCUS_04950 148570 149187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 149194 149958 gene locus_tag LOCUS_04960 149194 149958 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047975.1 protein_id gnl|my_center|LOCUS_04960 149960 150574 gene locus_tag LOCUS_04970 149960 150574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 151302 150697 gene locus_tag LOCUS_04980 151302 150697 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_04980 151613 151299 gene locus_tag LOCUS_04990 151613 151299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 153252 151738 gene locus_tag LOCUS_05000 153252 151738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986592.1 protein_id gnl|my_center|LOCUS_05000 153954 153259 gene locus_tag LOCUS_05010 153954 153259 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054304.1 protein_id gnl|my_center|LOCUS_05010 154544 153951 gene locus_tag LOCUS_05020 154544 153951 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_05020 156290 154563 gene locus_tag LOCUS_05030 156290 154563 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772887.1 protein_id gnl|my_center|LOCUS_05030 158074 156284 gene locus_tag LOCUS_05040 158074 156284 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460630.1 protein_id gnl|my_center|LOCUS_05040 159142 158201 gene locus_tag LOCUS_05050 159142 158201 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417631.1 protein_id gnl|my_center|LOCUS_05050 159590 159360 gene locus_tag LOCUS_05060 159590 159360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 159868 160101 gene locus_tag LOCUS_05070 159868 160101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 160704 160108 gene locus_tag LOCUS_05080 160704 160108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681693.1 protein_id gnl|my_center|LOCUS_05080 162868 160895 gene locus_tag LOCUS_05090 gene lysS 162868 160895 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861998.1 protein_id gnl|my_center|LOCUS_05090 163369 162890 gene locus_tag LOCUS_05100 gene greA 163369 162890 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422204.1 protein_id gnl|my_center|LOCUS_05100 167023 163391 gene locus_tag LOCUS_05110 167023 163391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 168398 167067 gene locus_tag LOCUS_05120 gene tyrS 168398 167067 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_05120 169047 168418 gene locus_tag LOCUS_05130 gene upp 169047 168418 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_05130 169555 169112 gene locus_tag LOCUS_05140 gene rpiB 169555 169112 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026199035.1 protein_id gnl|my_center|LOCUS_05140 170589 169552 gene locus_tag LOCUS_05150 170589 169552 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892045.1 protein_id gnl|my_center|LOCUS_05150 171683 170619 gene locus_tag LOCUS_05160 gene prfA 171683 170619 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_05160 172576 171902 gene locus_tag LOCUS_05170 172576 171902 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943629.1 protein_id gnl|my_center|LOCUS_05170 174065 172587 gene locus_tag LOCUS_05180 174065 172587 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836536.1 protein_id gnl|my_center|LOCUS_05180 175168 174065 gene locus_tag LOCUS_05190 gene cobD 175168 174065 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392618.1 protein_id gnl|my_center|LOCUS_05190 176316 175240 gene locus_tag LOCUS_05200 gene cbiB 176316 175240 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816688.1 protein_id gnl|my_center|LOCUS_05200 177743 176313 gene locus_tag LOCUS_05210 177743 176313 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901682.1 protein_id gnl|my_center|LOCUS_05210 178964 177753 gene locus_tag LOCUS_05220 178964 177753 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214081.1 protein_id gnl|my_center|LOCUS_05220 179701 178961 gene locus_tag LOCUS_05230 gene cobK 179701 178961 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812303.1 protein_id gnl|my_center|LOCUS_05230 180428 179682 gene locus_tag LOCUS_05240 gene cobJ 180428 179682 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896461.1 protein_id gnl|my_center|LOCUS_05240 181503 180430 gene locus_tag LOCUS_05250 gene cbiG 181503 180430 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901140.1 protein_id gnl|my_center|LOCUS_05250 182255 181500 gene locus_tag LOCUS_05260 gene cobM 182255 181500 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392606.1 protein_id gnl|my_center|LOCUS_05260 183517 182354 gene locus_tag LOCUS_05270 gene cbiD 183517 182354 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836528.1 protein_id gnl|my_center|LOCUS_05270 184233 183592 gene locus_tag LOCUS_05280 184233 183592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 185171 184278 gene locus_tag LOCUS_05290 185171 184278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 185844 185644 gene locus_tag LOCUS_05300 gene rpmE 185844 185644 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence04 1646 108 gene locus_tag LOCUS_05310 1646 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 1930 2409 gene locus_tag LOCUS_05320 1930 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3901 2513 gene locus_tag LOCUS_05330 3901 2513 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_05330 5636 4308 gene locus_tag LOCUS_05340 5636 4308 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812417.1 protein_id gnl|my_center|LOCUS_05340 7875 5599 gene locus_tag LOCUS_05350 7875 5599 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200796636.1 protein_id gnl|my_center|LOCUS_05350 8226 7942 gene locus_tag LOCUS_05360 8226 7942 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437519.1 protein_id gnl|my_center|LOCUS_05360 8314 11991 gene locus_tag LOCUS_05370 8314 11991 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_05370 12010 12969 gene locus_tag LOCUS_05380 gene pfkA 12010 12969 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357588.1 protein_id gnl|my_center|LOCUS_05380 13009 14478 gene locus_tag LOCUS_05390 13009 14478 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703155.1 protein_id gnl|my_center|LOCUS_05390 14490 15251 gene locus_tag LOCUS_05400 14490 15251 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_05400 15244 16248 gene locus_tag LOCUS_05410 15244 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 16790 16611 gene locus_tag LOCUS_05420 16790 16611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 17029 16787 gene locus_tag LOCUS_05430 17029 16787 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115145.1 protein_id gnl|my_center|LOCUS_05430 17181 19121 gene locus_tag LOCUS_05440 gene rnr 17181 19121 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228386.1 protein_id gnl|my_center|LOCUS_05440 20668 19256 gene locus_tag LOCUS_05450 20668 19256 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_05450 20823 21662 gene locus_tag LOCUS_05460 20823 21662 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_05460 21663 22388 gene locus_tag LOCUS_05470 21663 22388 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_05470 22415 24184 gene locus_tag LOCUS_05480 22415 24184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 24181 25512 gene locus_tag LOCUS_05490 24181 25512 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392428.1 protein_id gnl|my_center|LOCUS_05490 25579 26844 gene locus_tag LOCUS_05500 25579 26844 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_05500 26984 27385 gene locus_tag LOCUS_05510 26984 27385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 27479 29314 gene locus_tag LOCUS_05520 gene lepA 27479 29314 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416556.1 protein_id gnl|my_center|LOCUS_05520 29298 30521 gene locus_tag LOCUS_05530 gene hemW 29298 30521 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_05530 30552 32045 gene locus_tag LOCUS_05540 gene glpK 30552 32045 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987067.1 protein_id gnl|my_center|LOCUS_05540 32011 32202 gene locus_tag LOCUS_05550 32011 32202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 32336 33385 gene locus_tag LOCUS_05560 gene hrcA 32336 33385 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964592.1 protein_id gnl|my_center|LOCUS_05560 33375 33926 gene locus_tag LOCUS_05570 33375 33926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 33970 35835 gene locus_tag LOCUS_05580 gene dnaK 33970 35835 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_05580 35867 37054 gene locus_tag LOCUS_05590 gene dnaJ 35867 37054 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454751.1 protein_id gnl|my_center|LOCUS_05590 37193 37759 gene locus_tag LOCUS_05600 37193 37759 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986729.1 protein_id gnl|my_center|LOCUS_05600 37876 38847 gene locus_tag LOCUS_05610 gene prmA 37876 38847 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_05610 39183 39413 gene locus_tag LOCUS_05620 gene acpP 39183 39413 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_05620 39416 39868 gene locus_tag LOCUS_05630 gene accB 39416 39868 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555370.1 protein_id gnl|my_center|LOCUS_05630 39862 41247 gene locus_tag LOCUS_05640 39862 41247 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_05640 41247 42971 gene locus_tag LOCUS_05650 41247 42971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 42973 43914 gene locus_tag LOCUS_05660 gene fabH 42973 43914 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100539.1 protein_id gnl|my_center|LOCUS_05660 43926 44852 gene locus_tag LOCUS_05670 43926 44852 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931899.1 protein_id gnl|my_center|LOCUS_05670 44836 45891 gene locus_tag LOCUS_05680 44836 45891 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048432.1 protein_id gnl|my_center|LOCUS_05680 45913 46836 gene locus_tag LOCUS_05690 gene fabD 45913 46836 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_05690 46842 47579 gene locus_tag LOCUS_05700 gene fabG 46842 47579 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_05700 47589 48821 gene locus_tag LOCUS_05710 gene fabF 47589 48821 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_05710 48843 49268 gene locus_tag LOCUS_05720 gene fabZ 48843 49268 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_05720 49281 49763 gene locus_tag LOCUS_05730 49281 49763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 51454 49979 gene locus_tag LOCUS_05740 51454 49979 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666927.1 protein_id gnl|my_center|LOCUS_05740 51826 53115 gene locus_tag LOCUS_05750 51826 53115 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989840.1 protein_id gnl|my_center|LOCUS_05750 53144 54709 gene locus_tag LOCUS_05760 53144 54709 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_05760 54737 56488 gene locus_tag LOCUS_05770 54737 56488 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726970.1 protein_id gnl|my_center|LOCUS_05770 56605 56946 gene locus_tag LOCUS_05780 56605 56946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 56943 57137 gene locus_tag LOCUS_05790 56943 57137 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_05790 57425 57970 gene locus_tag LOCUS_05800 57425 57970 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861585.1 protein_id gnl|my_center|LOCUS_05800 57970 59085 gene locus_tag LOCUS_05810 57970 59085 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986549.1 protein_id gnl|my_center|LOCUS_05810 59143 59610 gene locus_tag LOCUS_05820 59143 59610 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_05820 59654 60160 gene locus_tag LOCUS_05830 59654 60160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 60182 60772 gene locus_tag LOCUS_05840 gene eamB 60182 60772 CDS product cysteine/O-acetylserine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368123.1 protein_id gnl|my_center|LOCUS_05840 61008 63209 gene locus_tag LOCUS_05850 61008 63209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 63372 65669 gene locus_tag LOCUS_05860 63372 65669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 65832 68132 gene locus_tag LOCUS_05870 65832 68132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 68216 68659 gene locus_tag LOCUS_05880 68216 68659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 69303 68704 gene locus_tag LOCUS_05890 69303 68704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 69742 69434 gene locus_tag LOCUS_05900 gene trxA 69742 69434 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393175.1 protein_id gnl|my_center|LOCUS_05900 70226 69792 gene locus_tag LOCUS_05910 70226 69792 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288165.1 protein_id gnl|my_center|LOCUS_05910 70712 70236 gene locus_tag LOCUS_05920 70712 70236 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837194.1 protein_id gnl|my_center|LOCUS_05920 70859 72220 gene locus_tag LOCUS_05930 gene mtaB 70859 72220 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_05930 72213 72554 gene locus_tag LOCUS_05940 72213 72554 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_05940 72647 73090 gene locus_tag LOCUS_05950 72647 73090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 73223 73402 gene locus_tag LOCUS_05960 73223 73402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 73448 73873 gene locus_tag LOCUS_05970 73448 73873 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_05970 73938 74429 gene locus_tag LOCUS_05980 73938 74429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 74521 75189 gene locus_tag LOCUS_05990 74521 75189 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_05990 75241 77877 gene locus_tag LOCUS_06000 75241 77877 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032909521.1 protein_id gnl|my_center|LOCUS_06000 77880 78146 gene locus_tag LOCUS_06010 77880 78146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 78165 78482 gene locus_tag LOCUS_06020 78165 78482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 78740 79507 gene locus_tag LOCUS_06030 gene thiM 78740 79507 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966377.1 protein_id gnl|my_center|LOCUS_06030 79497 80138 gene locus_tag LOCUS_06040 gene thiE 79497 80138 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904284.1 protein_id gnl|my_center|LOCUS_06040 80152 80670 gene locus_tag LOCUS_06050 gene thiW 80152 80670 CDS product energy coupling factor transporter S component ThiW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829480.1 protein_id gnl|my_center|LOCUS_06050 80680 81474 gene locus_tag LOCUS_06060 gene thiD 80680 81474 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966376.1 protein_id gnl|my_center|LOCUS_06060 81568 82881 gene locus_tag LOCUS_06070 gene thiC 81568 82881 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966296.1 protein_id gnl|my_center|LOCUS_06070 82935 84038 gene locus_tag LOCUS_06080 82935 84038 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_06080 84048 84725 gene locus_tag LOCUS_06090 84048 84725 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_06090 84722 85717 gene locus_tag LOCUS_06100 84722 85717 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272213.1 protein_id gnl|my_center|LOCUS_06100 85738 86559 gene locus_tag LOCUS_06110 85738 86559 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173358.1 protein_id gnl|my_center|LOCUS_06110 86552 88567 gene locus_tag LOCUS_06120 86552 88567 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837267.1 protein_id gnl|my_center|LOCUS_06120 88731 89243 gene locus_tag LOCUS_06130 88731 89243 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_06130 89478 89780 gene locus_tag LOCUS_06140 89478 89780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 89814 91895 gene locus_tag LOCUS_06150 89814 91895 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_06150 92596 91994 gene locus_tag LOCUS_06160 92596 91994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 93509 92658 gene locus_tag LOCUS_06170 93509 92658 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_06170 94212 93502 gene locus_tag LOCUS_06180 94212 93502 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213908.1 protein_id gnl|my_center|LOCUS_06180 95232 94231 gene locus_tag LOCUS_06190 95232 94231 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728914.1 protein_id gnl|my_center|LOCUS_06190 95739 95323 gene locus_tag LOCUS_06200 95739 95323 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385810.1 protein_id gnl|my_center|LOCUS_06200 95970 97613 gene locus_tag LOCUS_06210 gene hcp 95970 97613 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_06210 97882 98862 gene locus_tag LOCUS_06220 97882 98862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 99144 99013 gene locus_tag LOCUS_06230 99144 99013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 99796 99356 gene locus_tag LOCUS_06240 99796 99356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 100080 100274 gene locus_tag LOCUS_06250 100080 100274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 100277 101401 gene locus_tag LOCUS_06260 100277 101401 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_06260 101391 101753 gene locus_tag LOCUS_06270 101391 101753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 101861 102772 gene locus_tag LOCUS_06280 101861 102772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 102765 104162 gene locus_tag LOCUS_06290 102765 104162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 104481 104822 gene locus_tag LOCUS_06300 gene mobC 104481 104822 CDS product plasmid mobilization relaxosome protein MobC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860794.1 protein_id gnl|my_center|LOCUS_06300 104968 105393 gene locus_tag LOCUS_06310 104968 105393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 105386 107356 gene locus_tag LOCUS_06320 105386 107356 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045361.1 protein_id gnl|my_center|LOCUS_06320 107349 108434 gene locus_tag LOCUS_06330 107349 108434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 108434 108943 gene locus_tag LOCUS_06340 108434 108943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 108972 110513 gene locus_tag LOCUS_06350 108972 110513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 110527 112287 gene locus_tag LOCUS_06360 110527 112287 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_06360 112886 114793 gene locus_tag LOCUS_06370 112886 114793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 117086 116127 gene locus_tag LOCUS_06380 117086 116127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 118189 117890 gene locus_tag LOCUS_06390 118189 117890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 118518 118336 gene locus_tag LOCUS_06400 118518 118336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 119268 120272 gene locus_tag LOCUS_06410 gene dcm 119268 120272 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_06410 120310 121395 gene locus_tag LOCUS_06420 120310 121395 CDS product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964363.1 protein_id gnl|my_center|LOCUS_06420 121699 121821 gene locus_tag LOCUS_06430 121699 121821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 121899 122618 gene locus_tag LOCUS_06440 121899 122618 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_06440 122725 124581 gene locus_tag LOCUS_06450 122725 124581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 124641 125507 gene locus_tag LOCUS_06460 gene dapF 124641 125507 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_06460 125636 126940 gene locus_tag LOCUS_06470 gene lysA 125636 126940 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_06470 126982 127626 gene locus_tag LOCUS_06480 126982 127626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 128210 130564 gene locus_tag LOCUS_06490 128210 130564 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263668.1 protein_id gnl|my_center|LOCUS_06490 130842 131375 gene locus_tag LOCUS_06500 130842 131375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 131392 131985 gene locus_tag LOCUS_06510 131392 131985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 131978 132250 gene locus_tag LOCUS_06520 131978 132250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 132231 132638 gene locus_tag LOCUS_06530 132231 132638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 132661 133002 gene locus_tag LOCUS_06540 132661 133002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 133015 133797 gene locus_tag LOCUS_06550 133015 133797 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701079.1 protein_id gnl|my_center|LOCUS_06550 133813 134997 gene locus_tag LOCUS_06560 133813 134997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 135531 135866 gene locus_tag LOCUS_06570 135531 135866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 135869 136672 gene locus_tag LOCUS_06580 135869 136672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 136762 137394 gene locus_tag LOCUS_06590 136762 137394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 137551 139521 gene locus_tag LOCUS_06600 137551 139521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 139576 139905 gene locus_tag LOCUS_06610 139576 139905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 140027 141025 gene locus_tag LOCUS_06620 140027 141025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 141054 142010 gene locus_tag LOCUS_06630 141054 142010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 142034 142357 gene locus_tag LOCUS_06640 142034 142357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 142385 142609 gene locus_tag LOCUS_06650 142385 142609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 142660 145149 gene locus_tag LOCUS_06660 142660 145149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 145133 145828 gene locus_tag LOCUS_06670 145133 145828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 145839 147734 gene locus_tag LOCUS_06680 145839 147734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 147721 148035 gene locus_tag LOCUS_06690 147721 148035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 148028 148843 gene locus_tag LOCUS_06700 148028 148843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 148933 149361 gene locus_tag LOCUS_06710 148933 149361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 149361 150065 gene locus_tag LOCUS_06720 149361 150065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 150132 150251 gene locus_tag LOCUS_06730 150132 150251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 150235 151266 gene locus_tag LOCUS_06740 150235 151266 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498063.1 protein_id gnl|my_center|LOCUS_06740 151269 152684 gene locus_tag LOCUS_06750 151269 152684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 152699 153019 gene locus_tag LOCUS_06760 152699 153019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 153092 154693 gene locus_tag LOCUS_06770 153092 154693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 154896 155954 gene locus_tag LOCUS_06780 154896 155954 CDS product IS30-like element ISTde2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956682.1 protein_id gnl|my_center|LOCUS_06780 156191 156430 gene locus_tag LOCUS_06790 156191 156430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 156451 157182 gene locus_tag LOCUS_06800 gene cas5c 156451 157182 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205009051.1 protein_id gnl|my_center|LOCUS_06800 157186 159126 gene locus_tag LOCUS_06810 gene cas8c 157186 159126 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922511.1 protein_id gnl|my_center|LOCUS_06810 159119 159967 gene locus_tag LOCUS_06820 gene cas7c 159119 159967 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922510.1 protein_id gnl|my_center|LOCUS_06820 159980 160630 gene locus_tag LOCUS_06830 gene cas4 159980 160630 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_06830 160630 161661 gene locus_tag LOCUS_06840 gene cas1c 160630 161661 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922509.1 protein_id gnl|my_center|LOCUS_06840 161666 161959 gene locus_tag LOCUS_06850 gene cas2 161666 161959 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989044.1 protein_id gnl|my_center|LOCUS_06850 162134 >162352 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactcctcgtgagtgcgtggattgaaat >Feature sequence05 373 131 gene locus_tag LOCUS_06860 373 131 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_06860 718 440 gene locus_tag LOCUS_06870 718 440 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421415.1 protein_id gnl|my_center|LOCUS_06870 1561 797 gene locus_tag LOCUS_06880 1561 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3163 1565 gene locus_tag LOCUS_06890 3163 1565 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_06890 4476 3181 gene locus_tag LOCUS_06900 4476 3181 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583295.1 protein_id gnl|my_center|LOCUS_06900 7947 4513 gene locus_tag LOCUS_06910 gene mfd 7947 4513 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_06910 8531 7959 gene locus_tag LOCUS_06920 gene pth 8531 7959 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_06920 9516 8548 gene locus_tag LOCUS_06930 9516 8548 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_06930 10258 9566 gene locus_tag LOCUS_06940 10258 9566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 11645 10260 gene locus_tag LOCUS_06950 gene murC 11645 10260 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_06950 11761 12570 gene locus_tag LOCUS_06960 gene purR 11761 12570 CDS product pur operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425934.1 protein_id gnl|my_center|LOCUS_06960 12649 12930 gene locus_tag LOCUS_06970 gene spoVG 12649 12930 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_06970 14516 13083 gene locus_tag LOCUS_06980 gene pyk 14516 13083 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_06980 14718 14924 gene locus_tag LOCUS_06990 14718 14924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 15095 15021 gene locus_tag LOCUS_t00100 15095 15021 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 15175 15101 gene locus_tag LOCUS_t00110 15175 15101 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 15259 15184 gene locus_tag LOCUS_t00120 15259 15184 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 15361 15285 gene locus_tag LOCUS_t00130 15361 15285 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15444 15369 gene locus_tag LOCUS_t00140 15444 15369 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15525 15449 gene locus_tag LOCUS_t00150 15525 15449 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15749 16492 gene locus_tag LOCUS_07000 gene lgt 15749 16492 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_07000 16514 17608 gene locus_tag LOCUS_07010 gene ychF 16514 17608 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_07010 18112 17825 gene locus_tag LOCUS_07020 18112 17825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 18488 18327 gene locus_tag LOCUS_07030 18488 18327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 19084 18497 gene locus_tag LOCUS_07040 19084 18497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 20034 19087 gene locus_tag LOCUS_07050 20034 19087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 21474 20041 gene locus_tag LOCUS_07060 21474 20041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 22177 21464 gene locus_tag LOCUS_07070 22177 21464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 22726 22178 gene locus_tag LOCUS_07080 22726 22178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 23131 22727 gene locus_tag LOCUS_07090 23131 22727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 25031 23361 gene locus_tag LOCUS_07100 25031 23361 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_07100 25612 25055 gene locus_tag LOCUS_07110 25612 25055 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582545.1 protein_id gnl|my_center|LOCUS_07110 26420 25656 gene locus_tag LOCUS_07120 26420 25656 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_07120 27170 26433 gene locus_tag LOCUS_07130 27170 26433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 28560 27184 gene locus_tag LOCUS_07140 28560 27184 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_07140 29207 28662 gene locus_tag LOCUS_07150 29207 28662 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_07150 29879 29217 gene locus_tag LOCUS_07160 29879 29217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 30472 29939 gene locus_tag LOCUS_07170 gene hpt 30472 29939 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_07170 31141 30551 gene locus_tag LOCUS_07180 gene yihA 31141 30551 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229621.1 protein_id gnl|my_center|LOCUS_07180 33552 31141 gene locus_tag LOCUS_07190 gene lon 33552 31141 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_07190 34865 33612 gene locus_tag LOCUS_07200 gene clpX 34865 33612 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_07200 35456 34878 gene locus_tag LOCUS_07210 gene clpP 35456 34878 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049165.1 protein_id gnl|my_center|LOCUS_07210 36808 35459 gene locus_tag LOCUS_07220 gene tig 36808 35459 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_07220 37557 36925 gene locus_tag LOCUS_07230 37557 36925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 37674 38345 gene locus_tag LOCUS_07240 gene deoC 37674 38345 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130468.1 protein_id gnl|my_center|LOCUS_07240 39756 38404 gene locus_tag LOCUS_07250 39756 38404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 39884 40489 gene locus_tag LOCUS_07260 39884 40489 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226290.1 protein_id gnl|my_center|LOCUS_07260 40483 40833 gene locus_tag LOCUS_07270 40483 40833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 41408 40902 gene locus_tag LOCUS_07280 41408 40902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 41992 41459 gene locus_tag LOCUS_07290 41992 41459 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199111.1 protein_id gnl|my_center|LOCUS_07290 43393 42041 gene locus_tag LOCUS_07300 43393 42041 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023355052.1 protein_id gnl|my_center|LOCUS_07300 44608 43502 gene locus_tag LOCUS_07310 44608 43502 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417347.1 protein_id gnl|my_center|LOCUS_07310 45422 44622 gene locus_tag LOCUS_07320 gene etfB 45422 44622 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427760.1 protein_id gnl|my_center|LOCUS_07320 46585 45446 gene locus_tag LOCUS_07330 46585 45446 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_07330 47992 46805 gene locus_tag LOCUS_07340 gene thiI 47992 46805 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_07340 49153 48014 gene locus_tag LOCUS_07350 49153 48014 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_07350 50531 49170 gene locus_tag LOCUS_07360 50531 49170 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023355052.1 protein_id gnl|my_center|LOCUS_07360 52188 50638 gene locus_tag LOCUS_07370 gene rny 52188 50638 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_07370 52324 53427 gene locus_tag LOCUS_07380 gene rodA 52324 53427 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888916.1 protein_id gnl|my_center|LOCUS_07380 54279 53524 gene locus_tag LOCUS_07390 gene minD 54279 53524 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816779.1 protein_id gnl|my_center|LOCUS_07390 57047 54309 gene locus_tag LOCUS_07400 57047 54309 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861128.1 protein_id gnl|my_center|LOCUS_07400 57547 57044 gene locus_tag LOCUS_07410 57547 57044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 58353 57544 gene locus_tag LOCUS_07420 gene mreC 58353 57544 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_07420 59414 58374 gene locus_tag LOCUS_07430 59414 58374 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_07430 60096 59458 gene locus_tag LOCUS_07440 gene radC 60096 59458 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013377.1 protein_id gnl|my_center|LOCUS_07440 60907 60257 gene locus_tag LOCUS_07450 gene cmk 60907 60257 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439454.1 protein_id gnl|my_center|LOCUS_07450 61398 60937 gene locus_tag LOCUS_07460 gene nrdR 61398 60937 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203687.1 protein_id gnl|my_center|LOCUS_07460 62738 61578 gene locus_tag LOCUS_07470 62738 61578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 63153 62938 gene locus_tag LOCUS_07480 63153 62938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 64444 63254 gene locus_tag LOCUS_07490 gene coaBC 64444 63254 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_07490 65371 64460 gene locus_tag LOCUS_07500 65371 64460 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658378.1 protein_id gnl|my_center|LOCUS_07500 65796 65437 gene locus_tag LOCUS_07510 gene rplT 65796 65437 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_07510 66018 65818 gene locus_tag LOCUS_07520 gene rpmI 66018 65818 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_07520 66665 66096 gene locus_tag LOCUS_07530 gene infC 66665 66096 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965658.1 protein_id gnl|my_center|LOCUS_07530 69610 66893 gene locus_tag LOCUS_07540 69610 66893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 70260 69607 gene locus_tag LOCUS_07550 70260 69607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 71089 70250 gene locus_tag LOCUS_07560 71089 70250 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837256.1 protein_id gnl|my_center|LOCUS_07560 72564 71089 gene locus_tag LOCUS_07570 72564 71089 CDS product isopeptide-forming domain-containing fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837257.1 protein_id gnl|my_center|LOCUS_07570 73916 72981 gene locus_tag LOCUS_07580 73916 72981 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_07580 74841 73903 gene locus_tag LOCUS_07590 gene truB 74841 73903 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_07590 75805 74843 gene locus_tag LOCUS_07600 75805 74843 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_07600 76202 75795 gene locus_tag LOCUS_07610 gene rbfA 76202 75795 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_07610 79031 76254 gene locus_tag LOCUS_07620 79031 76254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 79359 79012 gene locus_tag LOCUS_07630 79359 79012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 79609 79340 gene locus_tag LOCUS_07640 79609 79340 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583568.1 protein_id gnl|my_center|LOCUS_07640 80741 79602 gene locus_tag LOCUS_07650 gene nusA 80741 79602 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_07650 81234 80770 gene locus_tag LOCUS_07660 81234 80770 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_07660 81748 81362 gene locus_tag LOCUS_07670 gene mscL 81748 81362 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701438.1 protein_id gnl|my_center|LOCUS_07670 82212 81874 gene locus_tag LOCUS_07680 82212 81874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 86247 82456 gene locus_tag LOCUS_07690 86247 82456 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_07690 87308 86244 gene locus_tag LOCUS_07700 gene ispG 87308 86244 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_07700 88318 87305 gene locus_tag LOCUS_07710 gene rseP 88318 87305 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_07710 89482 88319 gene locus_tag LOCUS_07720 89482 88319 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_07720 90293 89508 gene locus_tag LOCUS_07730 90293 89508 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_07730 91022 90309 gene locus_tag LOCUS_07740 91022 90309 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424529.1 protein_id gnl|my_center|LOCUS_07740 91651 91103 gene locus_tag LOCUS_07750 gene frr 91651 91103 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_07750 92374 91670 gene locus_tag LOCUS_07760 gene pyrH 92374 91670 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430597.1 protein_id gnl|my_center|LOCUS_07760 93372 92455 gene locus_tag LOCUS_07770 gene trxB 93372 92455 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_07770 94587 93457 gene locus_tag LOCUS_07780 94587 93457 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143333.1 protein_id gnl|my_center|LOCUS_07780 96319 94589 gene locus_tag LOCUS_07790 96319 94589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 97363 96338 gene locus_tag LOCUS_07800 97363 96338 CDS product ribitol-5-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610204.1 protein_id gnl|my_center|LOCUS_07800 98082 97357 gene locus_tag LOCUS_07810 98082 97357 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721503.1 protein_id gnl|my_center|LOCUS_07810 98750 98181 gene locus_tag LOCUS_07820 98750 98181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 100084 98747 gene locus_tag LOCUS_07830 100084 98747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 101249 100086 gene locus_tag LOCUS_07840 101249 100086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 102664 101246 gene locus_tag LOCUS_07850 102664 101246 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101306.1 protein_id gnl|my_center|LOCUS_07850 103907 102927 gene locus_tag LOCUS_07860 103907 102927 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817344.1 protein_id gnl|my_center|LOCUS_07860 104717 104070 gene locus_tag LOCUS_07870 104717 104070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 105222 104749 gene locus_tag LOCUS_07880 gene ribE 105222 104749 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_07880 106470 105253 gene locus_tag LOCUS_07890 106470 105253 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905673.1 protein_id gnl|my_center|LOCUS_07890 107142 106489 gene locus_tag LOCUS_07900 107142 106489 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130990.1 protein_id gnl|my_center|LOCUS_07900 108248 107124 gene locus_tag LOCUS_07910 gene ribD 108248 107124 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905672.1 protein_id gnl|my_center|LOCUS_07910 109405 108605 gene locus_tag LOCUS_07920 109405 108605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 110504 109485 gene locus_tag LOCUS_07930 110504 109485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 111566 110667 gene locus_tag LOCUS_07940 111566 110667 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_07940 113136 111772 gene locus_tag LOCUS_07950 gene citG 113136 111772 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_07950 114097 113150 gene locus_tag LOCUS_07960 114097 113150 CDS product alanine-tRNA synthetase second additional domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816923.1 protein_id gnl|my_center|LOCUS_07960 115212 114151 gene locus_tag LOCUS_07970 gene citC 115212 114151 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181444.1 protein_id gnl|my_center|LOCUS_07970 115371 115649 gene locus_tag LOCUS_07980 gene citD 115371 115649 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641303.1 protein_id gnl|my_center|LOCUS_07980 115642 116526 gene locus_tag LOCUS_07990 115642 116526 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_07990 116519 117934 gene locus_tag LOCUS_08000 gene citF 116519 117934 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_08000 117949 118788 gene locus_tag LOCUS_08010 117949 118788 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519031.1 protein_id gnl|my_center|LOCUS_08010 118788 119345 gene locus_tag LOCUS_08020 118788 119345 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099538.1 protein_id gnl|my_center|LOCUS_08020 119383 120366 gene locus_tag LOCUS_08030 119383 120366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 120688 120437 gene locus_tag LOCUS_08040 120688 120437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016783.1 protein_id gnl|my_center|LOCUS_08040 120890 121387 gene locus_tag LOCUS_08050 gene glmS 120890 121387 CDS product methylaspartate mutase subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670492.1 protein_id gnl|my_center|LOCUS_08050 121384 122775 gene locus_tag LOCUS_08060 gene glmL 121384 122775 CDS product methylaspartate mutase accessory protein GlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945203.1 protein_id gnl|my_center|LOCUS_08060 122759 124210 gene locus_tag LOCUS_08070 122759 124210 CDS product methylaspartate mutase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460941.1 protein_id gnl|my_center|LOCUS_08070 124256 125509 gene locus_tag LOCUS_08080 124256 125509 CDS product methylaspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680089.1 protein_id gnl|my_center|LOCUS_08080 126100 125597 gene locus_tag LOCUS_08090 126100 125597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 126674 126174 gene locus_tag LOCUS_08100 126674 126174 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_08100 127689 126766 gene locus_tag LOCUS_08110 gene tsf 127689 126766 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424535.1 protein_id gnl|my_center|LOCUS_08110 128534 127761 gene locus_tag LOCUS_08120 gene rpsB 128534 127761 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_08120 130523 128754 gene locus_tag LOCUS_08130 130523 128754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 130861 130655 gene locus_tag LOCUS_08140 130861 130655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 131490 130861 gene locus_tag LOCUS_08150 gene gmk 131490 130861 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431170.1 protein_id gnl|my_center|LOCUS_08150 132510 131626 gene locus_tag LOCUS_08160 132510 131626 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416240.1 protein_id gnl|my_center|LOCUS_08160 132629 134356 gene locus_tag LOCUS_08170 132629 134356 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence06 1685 129 gene locus_tag LOCUS_08180 gene gpmI 1685 129 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964031.1 protein_id gnl|my_center|LOCUS_08180 1785 5366 gene locus_tag LOCUS_08190 gene addA 1785 5366 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_08190 5817 6992 gene locus_tag LOCUS_08200 5817 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 7241 8926 gene locus_tag LOCUS_08210 7241 8926 CDS product SpaA isopeptide-forming pilin-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382226.1 protein_id gnl|my_center|LOCUS_08210 9307 11247 gene locus_tag LOCUS_08220 9307 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 12791 11448 gene locus_tag LOCUS_08230 gene gdhA 12791 11448 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_08230 13125 14330 gene locus_tag LOCUS_08240 13125 14330 CDS product aminoacyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387163.1 protein_id gnl|my_center|LOCUS_08240 14385 15782 gene locus_tag LOCUS_08250 gene mgtE 14385 15782 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_08250 15804 16670 gene locus_tag LOCUS_08260 15804 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 16728 17546 gene locus_tag LOCUS_08270 16728 17546 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_08270 17546 18478 gene locus_tag LOCUS_08280 17546 18478 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_08280 18621 19499 gene locus_tag LOCUS_08290 18621 19499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 19589 20302 gene locus_tag LOCUS_08300 gene ftsE 19589 20302 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357393.1 protein_id gnl|my_center|LOCUS_08300 20283 21176 gene locus_tag LOCUS_08310 gene ftsX 20283 21176 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_08310 21195 22367 gene locus_tag LOCUS_08320 21195 22367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 22379 24031 gene locus_tag LOCUS_08330 22379 24031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 24031 25182 gene locus_tag LOCUS_08340 24031 25182 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437815.1 protein_id gnl|my_center|LOCUS_08340 25268 25570 gene locus_tag LOCUS_08350 25268 25570 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965963.1 protein_id gnl|my_center|LOCUS_08350 25653 26234 gene locus_tag LOCUS_08360 25653 26234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 26231 26746 gene locus_tag LOCUS_08370 26231 26746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 27653 26748 gene locus_tag LOCUS_08380 27653 26748 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808885.1 protein_id gnl|my_center|LOCUS_08380 27708 27941 gene locus_tag LOCUS_08390 27708 27941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 28066 29295 gene locus_tag LOCUS_08400 28066 29295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 29318 30259 gene locus_tag LOCUS_08410 29318 30259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 30301 31053 gene locus_tag LOCUS_08420 30301 31053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 31323 32024 gene locus_tag LOCUS_08430 31323 32024 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974505.1 protein_id gnl|my_center|LOCUS_08430 32039 33421 gene locus_tag LOCUS_08440 32039 33421 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804134.1 protein_id gnl|my_center|LOCUS_08440 33562 35853 gene locus_tag LOCUS_08450 33562 35853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 35859 37220 gene locus_tag LOCUS_08460 35859 37220 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_08460 37451 38713 gene locus_tag LOCUS_08470 37451 38713 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_08470 38779 40041 gene locus_tag LOCUS_08480 38779 40041 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_08480 40054 40506 gene locus_tag LOCUS_08490 40054 40506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 42915 40510 gene locus_tag LOCUS_08500 42915 40510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 43618 42917 gene locus_tag LOCUS_08510 43618 42917 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 protein_id gnl|my_center|LOCUS_08510 43860 44117 gene locus_tag LOCUS_08520 43860 44117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 44299 44730 gene locus_tag LOCUS_08530 gene mraZ 44299 44730 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965432.1 protein_id gnl|my_center|LOCUS_08530 44739 45683 gene locus_tag LOCUS_08540 gene rsmH 44739 45683 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_08540 45705 46052 gene locus_tag LOCUS_08550 45705 46052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 46139 48145 gene locus_tag LOCUS_08560 46139 48145 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_08560 48155 49537 gene locus_tag LOCUS_08570 48155 49537 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861626.1 protein_id gnl|my_center|LOCUS_08570 49612 50529 gene locus_tag LOCUS_08580 gene mraY 49612 50529 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_08580 50537 51901 gene locus_tag LOCUS_08590 gene murD 50537 51901 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454967.1 protein_id gnl|my_center|LOCUS_08590 51921 53045 gene locus_tag LOCUS_08600 gene spoVE 51921 53045 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_08600 53045 54196 gene locus_tag LOCUS_08610 gene murG 53045 54196 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893705.1 protein_id gnl|my_center|LOCUS_08610 54196 55230 gene locus_tag LOCUS_08620 54196 55230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 55335 56468 gene locus_tag LOCUS_08630 gene ftsZ 55335 56468 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_08630 56521 57423 gene locus_tag LOCUS_08640 56521 57423 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965655.1 protein_id gnl|my_center|LOCUS_08640 57457 58479 gene locus_tag LOCUS_08650 gene pheS 57457 58479 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436795.1 protein_id gnl|my_center|LOCUS_08650 58489 60942 gene locus_tag LOCUS_08660 gene pheT 58489 60942 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860925.1 protein_id gnl|my_center|LOCUS_08660 60973 61434 gene locus_tag LOCUS_08670 60973 61434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 61431 63818 gene locus_tag LOCUS_08680 61431 63818 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_08680 63898 65619 gene locus_tag LOCUS_08690 gene argS 63898 65619 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_08690 65620 66492 gene locus_tag LOCUS_08700 65620 66492 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_08700 66510 68051 gene locus_tag LOCUS_08710 66510 68051 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860933.1 protein_id gnl|my_center|LOCUS_08710 68044 69144 gene locus_tag LOCUS_08720 68044 69144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 69210 69683 gene locus_tag LOCUS_08730 69210 69683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 69676 70254 gene locus_tag LOCUS_08740 69676 70254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 71501 70731 gene locus_tag LOCUS_08750 71501 70731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 72327 72536 gene locus_tag LOCUS_08760 72327 72536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 72641 74047 gene locus_tag LOCUS_08770 72641 74047 CDS product Sau3AI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068548.1 protein_id gnl|my_center|LOCUS_08770 74177 75391 gene locus_tag LOCUS_08780 gene dcm 74177 75391 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962895.1 protein_id gnl|my_center|LOCUS_08780 75722 76546 gene locus_tag LOCUS_08790 75722 76546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 76927 78444 gene locus_tag LOCUS_08800 76927 78444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 78877 79047 gene locus_tag LOCUS_08810 78877 79047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 79830 79222 gene locus_tag LOCUS_08820 79830 79222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681728.1 protein_id gnl|my_center|LOCUS_08820 80085 80010 gene locus_tag LOCUS_t00160 80085 80010 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 80201 80113 gene locus_tag LOCUS_t00170 80201 80113 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 80284 80210 gene locus_tag LOCUS_t00180 80284 80210 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 80549 82012 gene locus_tag LOCUS_08830 80549 82012 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902277.1 protein_id gnl|my_center|LOCUS_08830 82179 83291 gene locus_tag LOCUS_08840 82179 83291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681624.1 protein_id gnl|my_center|LOCUS_08840 83329 83841 gene locus_tag LOCUS_08850 83329 83841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 83844 84560 gene locus_tag LOCUS_08860 83844 84560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 84576 85982 gene locus_tag LOCUS_08870 84576 85982 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001021210.1 protein_id gnl|my_center|LOCUS_08870 86013 86666 gene locus_tag LOCUS_08880 86013 86666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681642.1 protein_id gnl|my_center|LOCUS_08880 86681 87094 gene locus_tag LOCUS_08890 86681 87094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 87104 88177 gene locus_tag LOCUS_08900 87104 88177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 88240 88632 gene locus_tag LOCUS_08910 88240 88632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 88737 89249 gene locus_tag LOCUS_08920 88737 89249 CDS product YfbM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681732.1 protein_id gnl|my_center|LOCUS_08920 90254 89334 gene locus_tag LOCUS_08930 90254 89334 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643099.1 protein_id gnl|my_center|LOCUS_08930 90488 91201 gene locus_tag LOCUS_08940 90488 91201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424353.1 protein_id gnl|my_center|LOCUS_08940 91203 92822 gene locus_tag LOCUS_08950 91203 92822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990774.1 protein_id gnl|my_center|LOCUS_08950 92884 93579 gene locus_tag LOCUS_08960 92884 93579 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_08960 93718 94692 gene locus_tag LOCUS_08970 93718 94692 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_08970 94746 96998 gene locus_tag LOCUS_08980 94746 96998 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_08980 96998 97702 gene locus_tag LOCUS_08990 96998 97702 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_08990 98022 100586 gene locus_tag LOCUS_09000 98022 100586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 100998 101528 gene locus_tag LOCUS_09010 gene raiA 100998 101528 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360537.1 protein_id gnl|my_center|LOCUS_09010 101749 102597 gene locus_tag LOCUS_09020 gene cdaA 101749 102597 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007069.1 protein_id gnl|my_center|LOCUS_09020 102584 103786 gene locus_tag LOCUS_09030 102584 103786 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432439.1 protein_id gnl|my_center|LOCUS_09030 103819 105171 gene locus_tag LOCUS_09040 gene glmM 103819 105171 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_09040 105229 107067 gene locus_tag LOCUS_09050 gene glmS 105229 107067 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048324.1 protein_id gnl|my_center|LOCUS_09050 107077 107646 gene locus_tag LOCUS_09060 107077 107646 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921892.1 protein_id gnl|my_center|LOCUS_09060 107664 108437 gene locus_tag LOCUS_09070 107664 108437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 108444 109928 gene locus_tag LOCUS_09080 108444 109928 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_09080 111084 109978 gene locus_tag LOCUS_09090 111084 109978 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_09090 111316 111540 gene locus_tag LOCUS_09100 111316 111540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 111972 111700 gene locus_tag LOCUS_09110 gene rpsT 111972 111700 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890686.1 protein_id gnl|my_center|LOCUS_09110 112195 114498 gene locus_tag LOCUS_09120 112195 114498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 114693 115028 gene locus_tag LOCUS_09130 114693 115028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 115108 115983 gene locus_tag LOCUS_09140 115108 115983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 116037 116858 gene locus_tag LOCUS_09150 116037 116858 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_09150 117091 117372 gene locus_tag LOCUS_09160 117091 117372 CDS product DUF2325 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890712.1 protein_id gnl|my_center|LOCUS_09160 118418 117474 gene locus_tag LOCUS_09170 118418 117474 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966232.1 protein_id gnl|my_center|LOCUS_09170 118531 118971 gene locus_tag LOCUS_09180 118531 118971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 119035 120018 gene locus_tag LOCUS_09190 119035 120018 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048128.1 protein_id gnl|my_center|LOCUS_09190 120035 120637 gene locus_tag LOCUS_09200 120035 120637 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965953.1 protein_id gnl|my_center|LOCUS_09200 120618 121469 gene locus_tag LOCUS_09210 120618 121469 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286461.1 protein_id gnl|my_center|LOCUS_09210 121517 122983 gene locus_tag LOCUS_09220 121517 122983 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905870.1 protein_id gnl|my_center|LOCUS_09220 124252 123089 gene locus_tag LOCUS_09230 124252 123089 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_09230 124442 125524 gene locus_tag LOCUS_09240 gene serC 124442 125524 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_09240 125527 126750 gene locus_tag LOCUS_09250 125527 126750 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_09250 126811 128322 gene locus_tag LOCUS_09260 126811 128322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 128393 130177 gene locus_tag LOCUS_09270 gene uvrC 128393 130177 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_09270 130297 130575 gene locus_tag LOCUS_09280 130297 130575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 130780 131592 gene locus_tag LOCUS_09290 130780 131592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 131612 132511 gene locus_tag LOCUS_09300 131612 132511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence07 1281 85 gene locus_tag LOCUS_09310 1281 85 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964224.1 protein_id gnl|my_center|LOCUS_09310 2905 1655 gene locus_tag LOCUS_09320 2905 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3346 7983 gene locus_tag LOCUS_09330 3346 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 8363 9541 gene locus_tag LOCUS_09340 gene metK 8363 9541 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966140.1 protein_id gnl|my_center|LOCUS_09340 9695 11011 gene locus_tag LOCUS_09350 9695 11011 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986280.1 protein_id gnl|my_center|LOCUS_09350 11038 12384 gene locus_tag LOCUS_09360 gene trkA 11038 12384 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_09360 12396 13865 gene locus_tag LOCUS_09370 12396 13865 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_09370 13877 15343 gene locus_tag LOCUS_09380 13877 15343 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_09380 15486 15968 gene locus_tag LOCUS_09390 15486 15968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 15978 18182 gene locus_tag LOCUS_09400 15978 18182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433859.1 protein_id gnl|my_center|LOCUS_09400 18185 20020 gene locus_tag LOCUS_09410 18185 20020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433862.1 protein_id gnl|my_center|LOCUS_09410 20105 20719 gene locus_tag LOCUS_09420 20105 20719 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_09420 20732 20947 gene locus_tag LOCUS_09430 20732 20947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 21051 22973 gene locus_tag LOCUS_09440 gene metG 21051 22973 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_09440 23016 23861 gene locus_tag LOCUS_09450 23016 23861 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_09450 23848 25308 gene locus_tag LOCUS_09460 gene tilS 23848 25308 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434952.1 protein_id gnl|my_center|LOCUS_09460 25407 27419 gene locus_tag LOCUS_09470 gene ftsH 25407 27419 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373798.1 protein_id gnl|my_center|LOCUS_09470 27464 29044 gene locus_tag LOCUS_09480 27464 29044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 29099 29926 gene locus_tag LOCUS_09490 29099 29926 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861999.1 protein_id gnl|my_center|LOCUS_09490 29919 30959 gene locus_tag LOCUS_09500 gene dusB 29919 30959 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_09500 31001 32194 gene locus_tag LOCUS_09510 31001 32194 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_09510 32779 32267 gene locus_tag LOCUS_09520 32779 32267 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262516.1 protein_id gnl|my_center|LOCUS_09520 32962 34032 gene locus_tag LOCUS_09530 32962 34032 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681843.1 protein_id gnl|my_center|LOCUS_09530 34323 34916 gene locus_tag LOCUS_09540 34323 34916 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_09540 35303 35638 gene locus_tag LOCUS_09550 35303 35638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 35635 37026 gene locus_tag LOCUS_09560 35635 37026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680630.1 protein_id gnl|my_center|LOCUS_09560 37028 38050 gene locus_tag LOCUS_09570 37028 38050 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945452.1 protein_id gnl|my_center|LOCUS_09570 38070 39833 gene locus_tag LOCUS_09580 38070 39833 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680646.1 protein_id gnl|my_center|LOCUS_09580 39884 41566 gene locus_tag LOCUS_09590 39884 41566 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680643.1 protein_id gnl|my_center|LOCUS_09590 42947 41724 gene locus_tag LOCUS_09600 42947 41724 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964735.1 protein_id gnl|my_center|LOCUS_09600 43191 44468 gene locus_tag LOCUS_09610 43191 44468 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721244.1 protein_id gnl|my_center|LOCUS_09610 44461 45567 gene locus_tag LOCUS_09620 44461 45567 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896855.1 protein_id gnl|my_center|LOCUS_09620 45761 45985 gene locus_tag LOCUS_09630 45761 45985 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_09630 47322 46156 gene locus_tag LOCUS_09640 47322 46156 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010680900.1 protein_id gnl|my_center|LOCUS_09640 47600 49054 gene locus_tag LOCUS_09650 gene pepV 47600 49054 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_09650 49051 49470 gene locus_tag LOCUS_09660 gene tsaE 49051 49470 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_09660 49458 50168 gene locus_tag LOCUS_09670 gene tsaB 49458 50168 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860649.1 protein_id gnl|my_center|LOCUS_09670 50165 50614 gene locus_tag LOCUS_09680 gene rimI 50165 50614 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048263.1 protein_id gnl|my_center|LOCUS_09680 50607 51641 gene locus_tag LOCUS_09690 gene tsaD 50607 51641 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_09690 51657 53585 gene locus_tag LOCUS_09700 51657 53585 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 protein_id gnl|my_center|LOCUS_09700 53745 53975 gene locus_tag LOCUS_09710 gene acpP 53745 53975 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583309.1 protein_id gnl|my_center|LOCUS_09710 54051 54716 gene locus_tag LOCUS_09720 54051 54716 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_09720 54934 54764 gene locus_tag LOCUS_09730 54934 54764 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_09730 55003 55842 gene locus_tag LOCUS_09740 55003 55842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679695.1 protein_id gnl|my_center|LOCUS_09740 55852 56742 gene locus_tag LOCUS_09750 55852 56742 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435007.1 protein_id gnl|my_center|LOCUS_09750 56925 57203 gene locus_tag LOCUS_09760 56925 57203 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420907.1 protein_id gnl|my_center|LOCUS_09760 57226 58854 gene locus_tag LOCUS_09770 gene groL 57226 58854 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435012.1 protein_id gnl|my_center|LOCUS_09770 59020 59703 gene locus_tag LOCUS_09780 59020 59703 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460301.1 protein_id gnl|my_center|LOCUS_09780 59693 60022 gene locus_tag LOCUS_09790 gene azlD 59693 60022 CDS product branched-chain amino acid transporter AzlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245988.1 protein_id gnl|my_center|LOCUS_09790 60069 60548 gene locus_tag LOCUS_09800 gene ybaK 60069 60548 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437064.1 protein_id gnl|my_center|LOCUS_09800 60550 60696 gene locus_tag LOCUS_09810 60550 60696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 60696 61622 gene locus_tag LOCUS_09820 60696 61622 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861239.1 protein_id gnl|my_center|LOCUS_09820 61683 62243 gene locus_tag LOCUS_09830 61683 62243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 63741 62293 gene locus_tag LOCUS_09840 63741 62293 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_09840 63862 65235 gene locus_tag LOCUS_09850 63862 65235 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986767.1 protein_id gnl|my_center|LOCUS_09850 65475 65768 gene locus_tag LOCUS_09860 65475 65768 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_09860 65906 67402 gene locus_tag LOCUS_09870 gene dltA 65906 67402 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198836.1 protein_id gnl|my_center|LOCUS_09870 67402 68571 gene locus_tag LOCUS_09880 gene dltB 67402 68571 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426712.1 protein_id gnl|my_center|LOCUS_09880 68603 68836 gene locus_tag LOCUS_09890 gene dltC 68603 68836 CDS product D-alanine--poly(phosphoribitol) ligase subunit DltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227325.1 protein_id gnl|my_center|LOCUS_09890 68836 70026 gene locus_tag LOCUS_09900 gene dltD 68836 70026 CDS product D-alanyl-lipoteichoic acid biosynthesis protein DltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769415.1 protein_id gnl|my_center|LOCUS_09900 69974 70147 gene locus_tag LOCUS_09910 69974 70147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 70218 71342 gene locus_tag LOCUS_09920 70218 71342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 71604 73121 gene locus_tag LOCUS_09930 71604 73121 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272361.1 protein_id gnl|my_center|LOCUS_09930 73185 74729 gene locus_tag LOCUS_09940 gene guaA 73185 74729 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_09940 75099 75782 gene locus_tag LOCUS_09950 75099 75782 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668469.1 protein_id gnl|my_center|LOCUS_09950 75877 76410 gene locus_tag LOCUS_09960 75877 76410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836972.1 protein_id gnl|my_center|LOCUS_09960 76389 76670 gene locus_tag LOCUS_09970 76389 76670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492945.1 protein_id gnl|my_center|LOCUS_09970 76722 77690 gene locus_tag LOCUS_09980 gene msrB 76722 77690 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166942.1 protein_id gnl|my_center|LOCUS_09980 78350 77829 gene locus_tag LOCUS_09990 78350 77829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 78472 78786 gene locus_tag LOCUS_10000 78472 78786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665898.1 protein_id gnl|my_center|LOCUS_10000 78815 79336 gene locus_tag LOCUS_10010 78815 79336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681727.1 protein_id gnl|my_center|LOCUS_10010 79413 79895 gene locus_tag LOCUS_10020 79413 79895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 79975 80643 gene locus_tag LOCUS_10030 79975 80643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 80839 83370 gene locus_tag LOCUS_10040 gene mgtA 80839 83370 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402038.1 protein_id gnl|my_center|LOCUS_10040 83342 83524 gene locus_tag LOCUS_10050 83342 83524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 83862 86405 gene locus_tag LOCUS_10060 83862 86405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 86543 87610 gene locus_tag LOCUS_10070 86543 87610 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681626.1 protein_id gnl|my_center|LOCUS_10070 87827 89326 gene locus_tag LOCUS_10080 87827 89326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 89540 90709 gene locus_tag LOCUS_10090 gene sppA 89540 90709 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229337.1 protein_id gnl|my_center|LOCUS_10090 90828 91199 gene locus_tag LOCUS_10100 90828 91199 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130477.1 protein_id gnl|my_center|LOCUS_10100 91216 92559 gene locus_tag LOCUS_10110 gene ffh 91216 92559 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_10110 92675 92917 gene locus_tag LOCUS_10120 gene rpsP 92675 92917 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_10120 92933 93217 gene locus_tag LOCUS_10130 92933 93217 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965063.1 protein_id gnl|my_center|LOCUS_10130 93299 93802 gene locus_tag LOCUS_10140 gene rimM 93299 93802 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699991.1 protein_id gnl|my_center|LOCUS_10140 93802 94533 gene locus_tag LOCUS_10150 gene trmD 93802 94533 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922154.1 protein_id gnl|my_center|LOCUS_10150 94644 95549 gene locus_tag LOCUS_10160 94644 95549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 95563 96267 gene locus_tag LOCUS_10170 95563 96267 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_10170 96317 96841 gene locus_tag LOCUS_10180 96317 96841 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213920.1 protein_id gnl|my_center|LOCUS_10180 96845 97132 gene locus_tag LOCUS_10190 96845 97132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 97142 97912 gene locus_tag LOCUS_10200 97142 97912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 97954 98418 gene locus_tag LOCUS_10210 gene lspA 97954 98418 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_10210 98419 99366 gene locus_tag LOCUS_10220 98419 99366 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965413.1 protein_id gnl|my_center|LOCUS_10220 99703 100551 gene locus_tag LOCUS_10230 99703 100551 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence08 1734 271 gene locus_tag LOCUS_10240 1734 271 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680807.1 protein_id gnl|my_center|LOCUS_10240 3209 1731 gene locus_tag LOCUS_10250 3209 1731 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775649.1 protein_id gnl|my_center|LOCUS_10250 5554 3212 gene locus_tag LOCUS_10260 5554 3212 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_10260 6167 7663 gene locus_tag LOCUS_10270 6167 7663 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015726.1 protein_id gnl|my_center|LOCUS_10270 7716 8651 gene locus_tag LOCUS_10280 7716 8651 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106894843.1 protein_id gnl|my_center|LOCUS_10280 8648 9427 gene locus_tag LOCUS_10290 8648 9427 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062685931.1 protein_id gnl|my_center|LOCUS_10290 9489 10355 gene locus_tag LOCUS_10300 9489 10355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082281.1 protein_id gnl|my_center|LOCUS_10300 10348 11166 gene locus_tag LOCUS_10310 10348 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 11388 12785 gene locus_tag LOCUS_10320 11388 12785 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362058.1 protein_id gnl|my_center|LOCUS_10320 12778 14418 gene locus_tag LOCUS_10330 12778 14418 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_10330 14519 15502 gene locus_tag LOCUS_10340 14519 15502 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016794.1 protein_id gnl|my_center|LOCUS_10340 16398 15574 gene locus_tag LOCUS_10350 16398 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 16882 16727 gene locus_tag LOCUS_10360 16882 16727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 17978 17103 gene locus_tag LOCUS_10370 17978 17103 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245017.1 protein_id gnl|my_center|LOCUS_10370 18395 18036 gene locus_tag LOCUS_10380 18395 18036 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_10380 19925 18429 gene locus_tag LOCUS_10390 gene ypwA 19925 18429 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_10390 21011 20004 gene locus_tag LOCUS_10400 gene ansA 21011 20004 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000722312.1 protein_id gnl|my_center|LOCUS_10400 21154 22374 gene locus_tag LOCUS_10410 gene arcA 21154 22374 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385506.1 protein_id gnl|my_center|LOCUS_10410 22880 22437 gene locus_tag LOCUS_10420 22880 22437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 24429 23017 gene locus_tag LOCUS_10430 24429 23017 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948762.1 protein_id gnl|my_center|LOCUS_10430 26180 24534 gene locus_tag LOCUS_10440 26180 24534 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016558.1 protein_id gnl|my_center|LOCUS_10440 27874 26210 gene locus_tag LOCUS_10450 27874 26210 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963689.1 protein_id gnl|my_center|LOCUS_10450 29636 27999 gene locus_tag LOCUS_10460 29636 27999 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963689.1 protein_id gnl|my_center|LOCUS_10460 29947 30735 gene locus_tag LOCUS_10470 29947 30735 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392640.1 protein_id gnl|my_center|LOCUS_10470 30738 31400 gene locus_tag LOCUS_10480 30738 31400 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583415.1 protein_id gnl|my_center|LOCUS_10480 31411 32130 gene locus_tag LOCUS_10490 31411 32130 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292113.1 protein_id gnl|my_center|LOCUS_10490 32325 34493 gene locus_tag LOCUS_10500 32325 34493 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_10500 34521 37859 gene locus_tag LOCUS_10510 gene addB 34521 37859 CDS product helicase-exonuclease AddAB subunit AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151864400.1 protein_id gnl|my_center|LOCUS_10510 37915 37990 gene locus_tag LOCUS_t00190 37915 37990 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 39218 38151 gene locus_tag LOCUS_10520 39218 38151 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861856.1 protein_id gnl|my_center|LOCUS_10520 40364 39354 gene locus_tag LOCUS_10530 40364 39354 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754206.1 protein_id gnl|my_center|LOCUS_10530 40816 40547 gene locus_tag LOCUS_10540 40816 40547 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525227.1 protein_id gnl|my_center|LOCUS_10540 41537 40896 gene locus_tag LOCUS_10550 41537 40896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 41660 41875 gene locus_tag LOCUS_10560 41660 41875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 41900 42034 gene locus_tag LOCUS_10570 41900 42034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 42194 42015 gene locus_tag LOCUS_10580 42194 42015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 42254 42463 gene locus_tag LOCUS_10590 42254 42463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 42466 42663 gene locus_tag LOCUS_10600 42466 42663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 42680 43162 gene locus_tag LOCUS_10610 42680 43162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 43181 43396 gene locus_tag LOCUS_10620 43181 43396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 43756 44097 gene locus_tag LOCUS_10630 43756 44097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 44109 45629 gene locus_tag LOCUS_10640 44109 45629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 45629 46624 gene locus_tag LOCUS_10650 45629 46624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 46721 46897 gene locus_tag LOCUS_10660 46721 46897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 46881 47066 gene locus_tag LOCUS_10670 46881 47066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 47068 47793 gene locus_tag LOCUS_10680 47068 47793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 47851 48150 gene locus_tag LOCUS_10690 47851 48150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 48240 49004 gene locus_tag LOCUS_10700 48240 49004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 49034 49423 gene locus_tag LOCUS_10710 49034 49423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 49583 49897 gene locus_tag LOCUS_10720 49583 49897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 50013 50369 gene locus_tag LOCUS_10730 50013 50369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 50366 52045 gene locus_tag LOCUS_10740 50366 52045 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225426974.1 protein_id gnl|my_center|LOCUS_10740 52057 53220 gene locus_tag LOCUS_10750 52057 53220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 53223 53831 gene locus_tag LOCUS_10760 53223 53831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 53833 55014 gene locus_tag LOCUS_10770 53833 55014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 55026 55331 gene locus_tag LOCUS_10780 55026 55331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 55341 55604 gene locus_tag LOCUS_10790 55341 55604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 55606 55914 gene locus_tag LOCUS_10800 55606 55914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 55901 56377 gene locus_tag LOCUS_10810 55901 56377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 56374 56733 gene locus_tag LOCUS_10820 56374 56733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 56736 57350 gene locus_tag LOCUS_10830 56736 57350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 57350 57679 gene locus_tag LOCUS_10840 57350 57679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 57688 57945 gene locus_tag LOCUS_10850 57688 57945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 57945 59852 gene locus_tag LOCUS_10860 57945 59852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 59853 60254 gene locus_tag LOCUS_10870 59853 60254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 60247 61848 gene locus_tag LOCUS_10880 60247 61848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 61849 63657 gene locus_tag LOCUS_10890 61849 63657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 63658 64209 gene locus_tag LOCUS_10900 63658 64209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 64221 64520 gene locus_tag LOCUS_10910 64221 64520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 64579 64869 gene locus_tag LOCUS_10920 64579 64869 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359993.1 protein_id gnl|my_center|LOCUS_10920 64879 65898 gene locus_tag LOCUS_10930 64879 65898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 66123 66242 gene locus_tag LOCUS_10940 66123 66242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 66363 66533 gene locus_tag LOCUS_10950 66363 66533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 66723 66902 gene locus_tag LOCUS_10960 66723 66902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 67345 66974 gene locus_tag LOCUS_10970 67345 66974 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478297.1 protein_id gnl|my_center|LOCUS_10970 67974 67438 gene locus_tag LOCUS_10980 67974 67438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 68282 68725 gene locus_tag LOCUS_10990 68282 68725 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_10990 68735 69565 gene locus_tag LOCUS_11000 68735 69565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072143.1 protein_id gnl|my_center|LOCUS_11000 69988 69707 gene locus_tag LOCUS_11010 69988 69707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 70996 70403 gene locus_tag LOCUS_11020 70996 70403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 71221 72282 gene locus_tag LOCUS_11030 gene hydE 71221 72282 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203500.1 protein_id gnl|my_center|LOCUS_11030 72275 73717 gene locus_tag LOCUS_11040 gene hydG 72275 73717 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203501.1 protein_id gnl|my_center|LOCUS_11040 73692 74852 gene locus_tag LOCUS_11050 gene hydF 73692 74852 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_11050 74975 75979 gene locus_tag LOCUS_11060 gene pta 74975 75979 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067221.1 protein_id gnl|my_center|LOCUS_11060 76543 76049 gene locus_tag LOCUS_11070 76543 76049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 76839 77216 gene locus_tag LOCUS_11080 76839 77216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 77364 78758 gene locus_tag LOCUS_11090 gene asnS 77364 78758 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_11090 79046 80437 gene locus_tag LOCUS_11100 79046 80437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 80447 81490 gene locus_tag LOCUS_11110 80447 81490 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947980.1 protein_id gnl|my_center|LOCUS_11110 81487 82389 gene locus_tag LOCUS_11120 gene prmC 81487 82389 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966169.1 protein_id gnl|my_center|LOCUS_11120 82417 82728 gene locus_tag LOCUS_11130 82417 82728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence09 351 175 gene locus_tag LOCUS_11140 351 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 581 805 gene locus_tag LOCUS_11150 581 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2897 1017 gene locus_tag LOCUS_11160 2897 1017 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11160 3151 2933 gene locus_tag LOCUS_11170 3151 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11170 3307 3711 gene locus_tag LOCUS_11180 3307 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4584 3829 gene locus_tag LOCUS_11190 4584 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 5534 4575 gene locus_tag LOCUS_11200 5534 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6213 5731 gene locus_tag LOCUS_11210 6213 5731 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_11210 6466 7398 gene locus_tag LOCUS_11220 6466 7398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 8157 7519 gene locus_tag LOCUS_11230 8157 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 9040 8258 gene locus_tag LOCUS_11240 9040 8258 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680703.1 protein_id gnl|my_center|LOCUS_11240 9801 9070 gene locus_tag LOCUS_11250 9801 9070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211328137.1 protein_id gnl|my_center|LOCUS_11250 10680 9838 gene locus_tag LOCUS_11260 10680 9838 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_11260 10852 11427 gene locus_tag LOCUS_11270 10852 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 12247 11555 gene locus_tag LOCUS_11280 gene cobI 12247 11555 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461549.1 protein_id gnl|my_center|LOCUS_11280 13713 12274 gene locus_tag LOCUS_11290 gene cobA 13713 12274 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963425.1 protein_id gnl|my_center|LOCUS_11290 14591 13713 gene locus_tag LOCUS_11300 gene hemC 14591 13713 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836539.1 protein_id gnl|my_center|LOCUS_11300 15195 14557 gene locus_tag LOCUS_11310 15195 14557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 15807 15211 gene locus_tag LOCUS_11320 15807 15211 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 protein_id gnl|my_center|LOCUS_11320 16364 15843 gene locus_tag LOCUS_11330 gene cobO 16364 15843 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081762.1 protein_id gnl|my_center|LOCUS_11330 16512 16437 gene locus_tag LOCUS_t00200 16512 16437 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18305 16719 gene locus_tag LOCUS_11340 18305 16719 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023378.1 protein_id gnl|my_center|LOCUS_11340 19270 18323 gene locus_tag LOCUS_11350 19270 18323 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065719.1 protein_id gnl|my_center|LOCUS_11350 20069 19281 gene locus_tag LOCUS_11360 20069 19281 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030783.1 protein_id gnl|my_center|LOCUS_11360 20916 20050 gene locus_tag LOCUS_11370 gene nikC 20916 20050 CDS product nickel ABC transporter permease subunit NikC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023381.1 protein_id gnl|my_center|LOCUS_11370 21855 20926 gene locus_tag LOCUS_11380 21855 20926 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023382.1 protein_id gnl|my_center|LOCUS_11380 22634 21894 gene locus_tag LOCUS_11390 22634 21894 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023383.1 protein_id gnl|my_center|LOCUS_11390 23292 24650 gene locus_tag LOCUS_11400 23292 24650 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944264.1 protein_id gnl|my_center|LOCUS_11400 24755 25615 gene locus_tag LOCUS_11410 24755 25615 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354953.1 protein_id gnl|my_center|LOCUS_11410 26025 29417 gene locus_tag LOCUS_11420 26025 29417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 31979 29511 gene locus_tag LOCUS_11430 31979 29511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 34391 31983 gene locus_tag LOCUS_11440 34391 31983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 34673 36106 gene locus_tag LOCUS_11450 gene purB 34673 36106 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965127.1 protein_id gnl|my_center|LOCUS_11450 36130 37419 gene locus_tag LOCUS_11460 36130 37419 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837602.1 protein_id gnl|my_center|LOCUS_11460 37445 38581 gene locus_tag LOCUS_11470 gene alr 37445 38581 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_11470 39325 38735 gene locus_tag LOCUS_11480 39325 38735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681674.1 protein_id gnl|my_center|LOCUS_11480 39642 39409 gene locus_tag LOCUS_11490 gene rpsR 39642 39409 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_11490 40098 39658 gene locus_tag LOCUS_11500 gene ssb 40098 39658 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_11500 40402 40115 gene locus_tag LOCUS_11510 gene rpsF 40402 40115 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420522.1 protein_id gnl|my_center|LOCUS_11510 46055 40539 gene locus_tag LOCUS_11520 46055 40539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 47434 46493 gene locus_tag LOCUS_11530 47434 46493 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_11530 47516 48064 gene locus_tag LOCUS_11540 47516 48064 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761545.1 protein_id gnl|my_center|LOCUS_11540 48390 48232 gene locus_tag LOCUS_11550 48390 48232 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_11550 49598 48435 gene locus_tag LOCUS_11560 49598 48435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 50251 49619 gene locus_tag LOCUS_11570 50251 49619 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952715.1 protein_id gnl|my_center|LOCUS_11570 50348 51082 gene locus_tag LOCUS_11580 50348 51082 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964283.1 protein_id gnl|my_center|LOCUS_11580 51092 51700 gene locus_tag LOCUS_11590 51092 51700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 52533 51742 gene locus_tag LOCUS_11600 gene proC 52533 51742 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994145.1 protein_id gnl|my_center|LOCUS_11600 53280 52546 gene locus_tag LOCUS_11610 53280 52546 CDS product SigB/SigF/SigG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420464.1 protein_id gnl|my_center|LOCUS_11610 53675 53277 gene locus_tag LOCUS_11620 53675 53277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 56288 53793 gene locus_tag LOCUS_11630 gene gyrA 56288 53793 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_11630 58230 56305 gene locus_tag LOCUS_11640 gene gyrB 58230 56305 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_11640 59510 58407 gene locus_tag LOCUS_11650 gene recF 59510 58407 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429303.1 protein_id gnl|my_center|LOCUS_11650 60630 59512 gene locus_tag LOCUS_11660 gene dnaN 60630 59512 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_11660 62157 60802 gene locus_tag LOCUS_11670 gene dnaA 62157 60802 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_11670 62511 62645 gene locus_tag LOCUS_11680 62511 62645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 62659 63000 gene locus_tag LOCUS_11690 gene rnpA 62659 63000 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016064.1 protein_id gnl|my_center|LOCUS_11690 63360 63944 gene locus_tag LOCUS_11700 63360 63944 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903598.1 protein_id gnl|my_center|LOCUS_11700 63982 64845 gene locus_tag LOCUS_11710 63982 64845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 64896 66305 gene locus_tag LOCUS_11720 gene mnmE 64896 66305 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_11720 66335 68224 gene locus_tag LOCUS_11730 gene mnmG 66335 68224 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_11730 68205 68912 gene locus_tag LOCUS_11740 gene rsmG 68205 68912 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966992.1 protein_id gnl|my_center|LOCUS_11740 69036 69806 gene locus_tag LOCUS_11750 gene soj 69036 69806 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_11750 69806 70705 gene locus_tag LOCUS_11760 69806 70705 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_11760 70719 72485 gene locus_tag LOCUS_11770 70719 72485 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_11770 72469 72912 gene locus_tag LOCUS_11780 gene rplI 72469 72912 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_11780 72922 74235 gene locus_tag LOCUS_11790 gene dnaB 72922 74235 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_11790 74286 75566 gene locus_tag LOCUS_11800 74286 75566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 75530 75850 gene locus_tag LOCUS_11810 75530 75850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 75850 76416 gene locus_tag LOCUS_11820 gene rnmV 75850 76416 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356126.1 protein_id gnl|my_center|LOCUS_11820 76403 77287 gene locus_tag LOCUS_11830 gene rsmA 76403 77287 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_11830 77280 79265 gene locus_tag LOCUS_11840 77280 79265 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128975638.1 protein_id gnl|my_center|LOCUS_11840 80402 79353 gene locus_tag LOCUS_11850 gene aroB 80402 79353 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775572.1 protein_id gnl|my_center|LOCUS_11850 80488 81195 gene locus_tag LOCUS_11860 80488 81195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 81223 81783 gene locus_tag LOCUS_11870 81223 81783 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358306.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence10 167 679 gene locus_tag LOCUS_11880 167 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 861 1400 gene locus_tag LOCUS_11890 861 1400 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_11890 1409 2479 gene locus_tag LOCUS_11900 1409 2479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437017.1 protein_id gnl|my_center|LOCUS_11900 2472 3284 gene locus_tag LOCUS_11910 2472 3284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_11910 3281 4060 gene locus_tag LOCUS_11920 3281 4060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964156.1 protein_id gnl|my_center|LOCUS_11920 4057 5124 gene locus_tag LOCUS_11930 4057 5124 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459712.1 protein_id gnl|my_center|LOCUS_11930 6232 5204 gene locus_tag LOCUS_11940 6232 5204 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_11940 6467 8092 gene locus_tag LOCUS_11950 6467 8092 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836418.1 protein_id gnl|my_center|LOCUS_11950 8187 9134 gene locus_tag LOCUS_11960 8187 9134 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263595.1 protein_id gnl|my_center|LOCUS_11960 9144 11675 gene locus_tag LOCUS_11970 gene mprF 9144 11675 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733236.1 protein_id gnl|my_center|LOCUS_11970 11706 14033 gene locus_tag LOCUS_11980 11706 14033 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948591.1 protein_id gnl|my_center|LOCUS_11980 14193 15473 gene locus_tag LOCUS_11990 14193 15473 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889836.1 protein_id gnl|my_center|LOCUS_11990 15482 16114 gene locus_tag LOCUS_12000 15482 16114 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426165.1 protein_id gnl|my_center|LOCUS_12000 16129 17505 gene locus_tag LOCUS_12010 16129 17505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002298085.1 protein_id gnl|my_center|LOCUS_12010 17602 18258 gene locus_tag LOCUS_12020 17602 18258 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699093.1 protein_id gnl|my_center|LOCUS_12020 18255 19574 gene locus_tag LOCUS_12030 18255 19574 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889841.1 protein_id gnl|my_center|LOCUS_12030 19709 20380 gene locus_tag LOCUS_12040 19709 20380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 20383 21099 gene locus_tag LOCUS_12050 20383 21099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 22541 21153 gene locus_tag LOCUS_12060 22541 21153 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382305.1 protein_id gnl|my_center|LOCUS_12060 22754 23293 gene locus_tag LOCUS_12070 gene pyrR 22754 23293 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172875.1 protein_id gnl|my_center|LOCUS_12070 23337 24650 gene locus_tag LOCUS_12080 23337 24650 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903692.1 protein_id gnl|my_center|LOCUS_12080 26128 24707 gene locus_tag LOCUS_12090 26128 24707 CDS product DUF1958 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836696.1 protein_id gnl|my_center|LOCUS_12090 26322 26978 gene locus_tag LOCUS_12100 gene lexA 26322 26978 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_12100 27115 27381 gene locus_tag LOCUS_12110 gene rpsO 27115 27381 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419491.1 protein_id gnl|my_center|LOCUS_12110 27503 29605 gene locus_tag LOCUS_12120 gene pnp 27503 29605 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_12120 30007 33123 gene locus_tag LOCUS_12130 gene ileS 30007 33123 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454939.1 protein_id gnl|my_center|LOCUS_12130 33125 34153 gene locus_tag LOCUS_12140 gene rlmN 33125 34153 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_12140 34146 34880 gene locus_tag LOCUS_12150 34146 34880 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681676.1 protein_id gnl|my_center|LOCUS_12150 35048 35470 gene locus_tag LOCUS_12160 35048 35470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 36058 35594 gene locus_tag LOCUS_12170 gene tnpA 36058 35594 CDS product IS200/IS605-like element IS1541B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032899290.1 protein_id gnl|my_center|LOCUS_12170 37880 38050 gene locus_tag LOCUS_12180 37880 38050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 38047 38661 gene locus_tag LOCUS_12190 38047 38661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 38687 39094 gene locus_tag LOCUS_12200 38687 39094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 39120 40808 gene locus_tag LOCUS_12210 39120 40808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948347.1 protein_id gnl|my_center|LOCUS_12210 40813 42045 gene locus_tag LOCUS_12220 40813 42045 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_12220 42058 42909 gene locus_tag LOCUS_12230 42058 42909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921665.1 protein_id gnl|my_center|LOCUS_12230 42925 43176 gene locus_tag LOCUS_12240 42925 43176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 44963 43527 gene locus_tag LOCUS_12250 44963 43527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 45183 45830 gene locus_tag LOCUS_12260 45183 45830 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922781.1 protein_id gnl|my_center|LOCUS_12260 45802 46920 gene locus_tag LOCUS_12270 gene mnmA 45802 46920 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438277.1 protein_id gnl|my_center|LOCUS_12270 46942 48279 gene locus_tag LOCUS_12280 46942 48279 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541618.1 protein_id gnl|my_center|LOCUS_12280 48347 48421 gene locus_tag LOCUS_t00210 48347 48421 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 48442 48774 gene locus_tag LOCUS_12290 48442 48774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 49843 48857 gene locus_tag LOCUS_12300 gene trpS 49843 48857 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110984.1 protein_id gnl|my_center|LOCUS_12300 49999 51747 gene locus_tag LOCUS_12310 49999 51747 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_12310 51763 52221 gene locus_tag LOCUS_12320 51763 52221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 52231 53166 gene locus_tag LOCUS_12330 52231 53166 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_12330 53303 53473 gene locus_tag LOCUS_12340 53303 53473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 53448 54428 gene locus_tag LOCUS_12350 53448 54428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 54429 55661 gene locus_tag LOCUS_12360 54429 55661 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263121.1 protein_id gnl|my_center|LOCUS_12360 55624 56370 gene locus_tag LOCUS_12370 55624 56370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 56360 57355 gene locus_tag LOCUS_12380 56360 57355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 57370 57504 gene locus_tag LOCUS_12390 57370 57504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 57515 57844 gene locus_tag LOCUS_12400 57515 57844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 57846 59045 gene locus_tag LOCUS_12410 57846 59045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 59032 59820 gene locus_tag LOCUS_12420 59032 59820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 59822 60415 gene locus_tag LOCUS_12430 59822 60415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 60440 61723 gene locus_tag LOCUS_12440 60440 61723 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121727.1 protein_id gnl|my_center|LOCUS_12440 61710 63665 gene locus_tag LOCUS_12450 61710 63665 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_12450 63736 64344 gene locus_tag LOCUS_12460 63736 64344 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_12460 64334 65164 gene locus_tag LOCUS_12470 64334 65164 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462186.1 protein_id gnl|my_center|LOCUS_12470 65432 66139 gene locus_tag LOCUS_12480 65432 66139 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976477.1 protein_id gnl|my_center|LOCUS_12480 66216 67457 gene locus_tag LOCUS_12490 66216 67457 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889545.1 protein_id gnl|my_center|LOCUS_12490 67607 67936 gene locus_tag LOCUS_12500 67607 67936 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_12500 67936 69438 gene locus_tag LOCUS_12510 67936 69438 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880140.1 protein_id gnl|my_center|LOCUS_12510 69439 70293 gene locus_tag LOCUS_12520 gene dprA 69439 70293 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047859.1 protein_id gnl|my_center|LOCUS_12520 70385 72481 gene locus_tag LOCUS_12530 gene topA 70385 72481 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_12530 72503 73042 gene locus_tag LOCUS_12540 gene hslV 72503 73042 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636479.1 protein_id gnl|my_center|LOCUS_12540 73052 74464 gene locus_tag LOCUS_12550 gene hslU 73052 74464 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_12550 74516 75292 gene locus_tag LOCUS_12560 gene codY 74516 75292 CDS product GTP-sensing pleiotropic transcriptional regulator CodY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438268.1 protein_id gnl|my_center|LOCUS_12560 75361 75999 gene locus_tag LOCUS_12570 75361 75999 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009880468.1 protein_id gnl|my_center|LOCUS_12570 76216 76291 gene locus_tag LOCUS_t00220 76216 76291 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 76299 76375 gene locus_tag LOCUS_t00230 76299 76375 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 76427 76501 gene locus_tag LOCUS_t00240 76427 76501 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence11 4348 3725 gene locus_tag LOCUS_12580 4348 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 5380 4589 gene locus_tag LOCUS_12590 5380 4589 CDS product DUF4261 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681643.1 protein_id gnl|my_center|LOCUS_12590 6226 5402 gene locus_tag LOCUS_12600 6226 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 6795 6244 gene locus_tag LOCUS_12610 6795 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 7528 6806 gene locus_tag LOCUS_12620 7528 6806 CDS product DUF4241 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681658.1 protein_id gnl|my_center|LOCUS_12620 7996 7553 gene locus_tag LOCUS_12630 7996 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 10214 8190 gene locus_tag LOCUS_12640 10214 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 10462 11481 gene locus_tag LOCUS_12650 10462 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673991.1 protein_id gnl|my_center|LOCUS_12650 12406 11510 gene locus_tag LOCUS_12660 12406 11510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681682.1 protein_id gnl|my_center|LOCUS_12660 12997 12413 gene locus_tag LOCUS_12670 12997 12413 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681651.1 protein_id gnl|my_center|LOCUS_12670 14084 13011 gene locus_tag LOCUS_12680 14084 13011 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681714.1 protein_id gnl|my_center|LOCUS_12680 14667 14116 gene locus_tag LOCUS_12690 14667 14116 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869265.1 protein_id gnl|my_center|LOCUS_12690 16759 14786 gene locus_tag LOCUS_12700 16759 14786 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968865.1 protein_id gnl|my_center|LOCUS_12700 17622 16774 gene locus_tag LOCUS_12710 17622 16774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 17816 17619 gene locus_tag LOCUS_12720 17816 17619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681636.1 protein_id gnl|my_center|LOCUS_12720 18237 17836 gene locus_tag LOCUS_12730 18237 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 19337 18315 gene locus_tag LOCUS_12740 19337 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681648.1 protein_id gnl|my_center|LOCUS_12740 19763 19344 gene locus_tag LOCUS_12750 19763 19344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 20280 19804 gene locus_tag LOCUS_12760 20280 19804 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_12760 20688 20461 gene locus_tag LOCUS_12770 20688 20461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 22084 20681 gene locus_tag LOCUS_12780 22084 20681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 24389 22110 gene locus_tag LOCUS_12790 24389 22110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943948.1 protein_id gnl|my_center|LOCUS_12790 25087 24389 gene locus_tag LOCUS_12800 25087 24389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286289.1 protein_id gnl|my_center|LOCUS_12800 26589 25348 gene locus_tag LOCUS_12810 26589 25348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 28101 26764 gene locus_tag LOCUS_12820 28101 26764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 31182 28366 gene locus_tag LOCUS_12830 31182 28366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 31573 31916 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctccctgtggtggctgacc 32734 32438 gene locus_tag LOCUS_12840 32734 32438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 33707 32898 gene locus_tag LOCUS_12850 33707 32898 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681556.1 protein_id gnl|my_center|LOCUS_12850 34495 33749 gene locus_tag LOCUS_12860 34495 33749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 36148 34628 gene locus_tag LOCUS_12870 36148 34628 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836843.1 protein_id gnl|my_center|LOCUS_12870 36869 36141 gene locus_tag LOCUS_12880 36869 36141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575213.1 protein_id gnl|my_center|LOCUS_12880 37729 36881 gene locus_tag LOCUS_12890 37729 36881 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_12890 38754 37771 gene locus_tag LOCUS_12900 38754 37771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681887.1 protein_id gnl|my_center|LOCUS_12900 39541 38735 gene locus_tag LOCUS_12910 39541 38735 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681886.1 protein_id gnl|my_center|LOCUS_12910 40025 39585 gene locus_tag LOCUS_12920 40025 39585 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837227.1 protein_id gnl|my_center|LOCUS_12920 40649 40155 gene locus_tag LOCUS_12930 40649 40155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 44437 40652 gene locus_tag LOCUS_12940 44437 40652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 45169 44690 gene locus_tag LOCUS_12950 45169 44690 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481508.1 protein_id gnl|my_center|LOCUS_12950 45307 46140 gene locus_tag LOCUS_12960 45307 46140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 47196 46135 gene locus_tag LOCUS_12970 47196 46135 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255098.1 protein_id gnl|my_center|LOCUS_12970 47548 47183 gene locus_tag LOCUS_12980 47548 47183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 47857 47564 gene locus_tag LOCUS_12990 47857 47564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 48101 47880 gene locus_tag LOCUS_13000 48101 47880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 48327 49454 gene locus_tag LOCUS_13010 48327 49454 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836412.1 protein_id gnl|my_center|LOCUS_13010 50406 49555 gene locus_tag LOCUS_13020 50406 49555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 50902 50438 gene locus_tag LOCUS_13030 50902 50438 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_13030 53729 51042 gene locus_tag LOCUS_13040 53729 51042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 58420 53957 gene locus_tag LOCUS_13050 58420 53957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 59749 59279 gene locus_tag LOCUS_13060 59749 59279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 59962 59753 gene locus_tag LOCUS_13070 59962 59753 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966596.1 protein_id gnl|my_center|LOCUS_13070 60639 60193 gene locus_tag LOCUS_13080 60639 60193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 60832 61752 gene locus_tag LOCUS_13090 60832 61752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 62325 61879 gene locus_tag LOCUS_13100 62325 61879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 63339 62344 gene locus_tag LOCUS_13110 63339 62344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 64240 64476 gene locus_tag LOCUS_13120 64240 64476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 64507 64662 gene locus_tag LOCUS_13130 64507 64662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 66113 65118 gene locus_tag LOCUS_13140 66113 65118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 68268 66115 gene locus_tag LOCUS_13150 68268 66115 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291423.1 protein_id gnl|my_center|LOCUS_13150 69410 68277 gene locus_tag LOCUS_13160 69410 68277 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573847.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence12 1847 141 gene locus_tag LOCUS_13170 1847 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2007 2390 gene locus_tag LOCUS_13180 2007 2390 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_13180 3332 2481 gene locus_tag LOCUS_13190 gene mutM 3332 2481 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_13190 3501 4775 gene locus_tag LOCUS_13200 3501 4775 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870015.1 protein_id gnl|my_center|LOCUS_13200 5051 5980 gene locus_tag LOCUS_13210 5051 5980 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811999.1 protein_id gnl|my_center|LOCUS_13210 5991 7055 gene locus_tag LOCUS_13220 5991 7055 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_13220 7070 8113 gene locus_tag LOCUS_13230 7070 8113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812003.1 protein_id gnl|my_center|LOCUS_13230 8106 9098 gene locus_tag LOCUS_13240 8106 9098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812005.1 protein_id gnl|my_center|LOCUS_13240 9170 10996 gene locus_tag LOCUS_13250 9170 10996 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812007.1 protein_id gnl|my_center|LOCUS_13250 11171 11365 gene locus_tag LOCUS_13260 gene thiS 11171 11365 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379876.1 protein_id gnl|my_center|LOCUS_13260 11365 12048 gene locus_tag LOCUS_13270 gene thiF 11365 12048 CDS product thiamine biosynthesis protein ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858442.1 protein_id gnl|my_center|LOCUS_13270 12063 12842 gene locus_tag LOCUS_13280 12063 12842 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015814.1 protein_id gnl|my_center|LOCUS_13280 12860 14044 gene locus_tag LOCUS_13290 gene thiH 12860 14044 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015813.1 protein_id gnl|my_center|LOCUS_13290 14031 14585 gene locus_tag LOCUS_13300 14031 14585 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015812.1 protein_id gnl|my_center|LOCUS_13300 14690 14968 gene locus_tag LOCUS_13310 14690 14968 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702618.1 protein_id gnl|my_center|LOCUS_13310 14968 15687 gene locus_tag LOCUS_13320 gene rsmE 14968 15687 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261219.1 protein_id gnl|my_center|LOCUS_13320 15690 16820 gene locus_tag LOCUS_13330 15690 16820 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827020.1 protein_id gnl|my_center|LOCUS_13330 19963 16880 gene locus_tag LOCUS_13340 19963 16880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 20139 21920 gene locus_tag LOCUS_13350 20139 21920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 22050 22134 gene locus_tag LOCUS_t00250 22050 22134 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22408 23481 gene locus_tag LOCUS_13360 22408 23481 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_13360 23607 25451 gene locus_tag LOCUS_13370 23607 25451 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476102.1 protein_id gnl|my_center|LOCUS_13370 25465 26592 gene locus_tag LOCUS_13380 25465 26592 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767224.1 protein_id gnl|my_center|LOCUS_13380 26612 27883 gene locus_tag LOCUS_13390 26612 27883 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 protein_id gnl|my_center|LOCUS_13390 27944 29281 gene locus_tag LOCUS_13400 27944 29281 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_13400 29355 30617 gene locus_tag LOCUS_13410 29355 30617 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476101.1 protein_id gnl|my_center|LOCUS_13410 30758 32080 gene locus_tag LOCUS_13420 30758 32080 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_13420 32216 33187 gene locus_tag LOCUS_13430 32216 33187 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107852.1 protein_id gnl|my_center|LOCUS_13430 33278 33856 gene locus_tag LOCUS_13440 33278 33856 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476100.1 protein_id gnl|my_center|LOCUS_13440 33866 34522 gene locus_tag LOCUS_13450 33866 34522 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289363.1 protein_id gnl|my_center|LOCUS_13450 34532 35434 gene locus_tag LOCUS_13460 34532 35434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 35473 36459 gene locus_tag LOCUS_13470 35473 36459 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_13470 36511 37629 gene locus_tag LOCUS_13480 36511 37629 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933143.1 protein_id gnl|my_center|LOCUS_13480 37635 38870 gene locus_tag LOCUS_13490 37635 38870 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582958.1 protein_id gnl|my_center|LOCUS_13490 38887 39627 gene locus_tag LOCUS_13500 38887 39627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376454.1 protein_id gnl|my_center|LOCUS_13500 39658 40563 gene locus_tag LOCUS_13510 39658 40563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 40603 41508 gene locus_tag LOCUS_13520 gene lpxD 40603 41508 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596698.1 protein_id gnl|my_center|LOCUS_13520 41517 42599 gene locus_tag LOCUS_13530 41517 42599 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048111.1 protein_id gnl|my_center|LOCUS_13530 42659 43702 gene locus_tag LOCUS_13540 42659 43702 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 protein_id gnl|my_center|LOCUS_13540 43705 45147 gene locus_tag LOCUS_13550 43705 45147 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_13550 45149 47791 gene locus_tag LOCUS_13560 45149 47791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 47828 48985 gene locus_tag LOCUS_13570 47828 48985 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048106.1 protein_id gnl|my_center|LOCUS_13570 48975 50678 gene locus_tag LOCUS_13580 48975 50678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 50757 52604 gene locus_tag LOCUS_13590 50757 52604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 52626 54056 gene locus_tag LOCUS_13600 52626 54056 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582448.1 protein_id gnl|my_center|LOCUS_13600 54058 55305 gene locus_tag LOCUS_13610 54058 55305 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964633.1 protein_id gnl|my_center|LOCUS_13610 55316 55681 gene locus_tag LOCUS_13620 55316 55681 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925454.1 protein_id gnl|my_center|LOCUS_13620 55784 57427 gene locus_tag LOCUS_13630 55784 57427 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_13630 57531 57713 gene locus_tag LOCUS_13640 57531 57713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 57715 59088 gene locus_tag LOCUS_13650 gene scfB 57715 59088 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_13650 59134 59835 gene locus_tag LOCUS_13660 59134 59835 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909097.1 protein_id gnl|my_center|LOCUS_13660 60104 60835 gene locus_tag LOCUS_13670 60104 60835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 60909 61742 gene locus_tag LOCUS_13680 60909 61742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 61846 62667 gene locus_tag LOCUS_13690 61846 62667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence13 295 978 gene locus_tag LOCUS_13700 gene tmk 295 978 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 protein_id gnl|my_center|LOCUS_13700 993 1808 gene locus_tag LOCUS_13710 gene holB 993 1808 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_13710 1812 2771 gene locus_tag LOCUS_13720 1812 2771 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_13720 2773 3516 gene locus_tag LOCUS_13730 2773 3516 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_13730 3597 3920 gene locus_tag LOCUS_13740 3597 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3938 4180 gene locus_tag LOCUS_13750 3938 4180 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963633.1 protein_id gnl|my_center|LOCUS_13750 4218 5483 gene locus_tag LOCUS_13760 gene murA 4218 5483 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420721.1 protein_id gnl|my_center|LOCUS_13760 5601 7580 gene locus_tag LOCUS_13770 5601 7580 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_13770 7842 9101 gene locus_tag LOCUS_13780 7842 9101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 9268 9981 gene locus_tag LOCUS_13790 9268 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 10001 11200 gene locus_tag LOCUS_13800 10001 11200 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393460.1 protein_id gnl|my_center|LOCUS_13800 11405 11329 gene locus_tag LOCUS_t00260 11405 11329 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 12888 11695 gene locus_tag LOCUS_13810 12888 11695 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_13810 13320 13009 gene locus_tag LOCUS_13820 13320 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 13617 14270 gene locus_tag LOCUS_13830 13617 14270 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722300.1 protein_id gnl|my_center|LOCUS_13830 14293 14384 gene locus_tag LOCUS_t00270 14293 14384 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14549 15886 gene locus_tag LOCUS_13840 14549 15886 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682090.1 protein_id gnl|my_center|LOCUS_13840 15921 17489 gene locus_tag LOCUS_13850 gene pckA 15921 17489 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626187.1 protein_id gnl|my_center|LOCUS_13850 19403 17562 gene locus_tag LOCUS_13860 19403 17562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 19934 19416 gene locus_tag LOCUS_13870 19934 19416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 20971 20111 gene locus_tag LOCUS_13880 20971 20111 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_13880 21583 20972 gene locus_tag LOCUS_13890 21583 20972 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948818.1 protein_id gnl|my_center|LOCUS_13890 23342 21669 gene locus_tag LOCUS_13900 23342 21669 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_13900 23514 24818 gene locus_tag LOCUS_13910 gene dsdA 23514 24818 CDS product D-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658347.1 protein_id gnl|my_center|LOCUS_13910 24823 25374 gene locus_tag LOCUS_13920 24823 25374 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435609.1 protein_id gnl|my_center|LOCUS_13920 25458 26693 gene locus_tag LOCUS_13930 25458 26693 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132377852.1 protein_id gnl|my_center|LOCUS_13930 26693 27580 gene locus_tag LOCUS_13940 gene murB 26693 27580 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_13940 27570 28334 gene locus_tag LOCUS_13950 27570 28334 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_13950 28347 29207 gene locus_tag LOCUS_13960 gene rapZ 28347 29207 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_13960 29297 30130 gene locus_tag LOCUS_13970 29297 30130 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_13970 30585 31343 gene locus_tag LOCUS_13980 30585 31343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 31345 32517 gene locus_tag LOCUS_13990 31345 32517 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373662.1 protein_id gnl|my_center|LOCUS_13990 32529 33566 gene locus_tag LOCUS_14000 32529 33566 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682008.1 protein_id gnl|my_center|LOCUS_14000 33576 34676 gene locus_tag LOCUS_14010 33576 34676 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439823.1 protein_id gnl|my_center|LOCUS_14010 34677 35264 gene locus_tag LOCUS_14020 34677 35264 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_14020 35362 36324 gene locus_tag LOCUS_14030 gene whiA 35362 36324 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436252.1 protein_id gnl|my_center|LOCUS_14030 36354 36953 gene locus_tag LOCUS_14040 36354 36953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 37214 37525 gene locus_tag LOCUS_14050 37214 37525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 37683 39695 gene locus_tag LOCUS_14060 37683 39695 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898067.1 protein_id gnl|my_center|LOCUS_14060 39714 40196 gene locus_tag LOCUS_14070 39714 40196 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869602.1 protein_id gnl|my_center|LOCUS_14070 40231 40821 gene locus_tag LOCUS_14080 40231 40821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 40847 41812 gene locus_tag LOCUS_14090 40847 41812 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_14090 41805 42128 gene locus_tag LOCUS_14100 41805 42128 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002898763.1 protein_id gnl|my_center|LOCUS_14100 42150 43916 gene locus_tag LOCUS_14110 42150 43916 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_14110 43920 45293 gene locus_tag LOCUS_14120 43920 45293 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_14120 45311 45970 gene locus_tag LOCUS_14130 45311 45970 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_14130 46098 46643 gene locus_tag LOCUS_14140 46098 46643 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_14140 46647 48014 gene locus_tag LOCUS_14150 gene rlmD 46647 48014 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861959.1 protein_id gnl|my_center|LOCUS_14150 48381 48608 gene locus_tag LOCUS_14160 48381 48608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 48689 49453 gene locus_tag LOCUS_14170 48689 49453 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836669.1 protein_id gnl|my_center|LOCUS_14170 49747 49890 gene locus_tag LOCUS_14180 49747 49890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 49925 50194 gene locus_tag LOCUS_14190 49925 50194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 50677 51162 gene locus_tag LOCUS_14200 50677 51162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 51237 51431 gene locus_tag LOCUS_14210 51237 51431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 51461 51781 gene locus_tag LOCUS_14220 51461 51781 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681704.1 protein_id gnl|my_center|LOCUS_14220 52002 52160 gene locus_tag LOCUS_14230 52002 52160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 52168 52332 gene locus_tag LOCUS_14240 52168 52332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 52389 52862 gene locus_tag LOCUS_14250 52389 52862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence14 <1 631 gene locus_tag LOCUS_14260 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494815.1:DUF6138 family protein 642 1052 gene locus_tag LOCUS_14270 642 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1071 1760 gene locus_tag LOCUS_14280 1071 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1815 2486 gene locus_tag LOCUS_14290 1815 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2508 2849 gene locus_tag LOCUS_14300 2508 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 3019 3321 gene locus_tag LOCUS_14310 3019 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 3430 4323 gene locus_tag LOCUS_14320 3430 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 6010 4412 gene locus_tag LOCUS_14330 6010 4412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 6254 6955 gene locus_tag LOCUS_14340 6254 6955 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035601.1 protein_id gnl|my_center|LOCUS_14340 7158 7790 gene locus_tag LOCUS_14350 7158 7790 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262703.1 protein_id gnl|my_center|LOCUS_14350 7799 8875 gene locus_tag LOCUS_14360 7799 8875 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379407.1 protein_id gnl|my_center|LOCUS_14360 8931 9281 gene locus_tag LOCUS_14370 8931 9281 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760124.1 protein_id gnl|my_center|LOCUS_14370 9360 10022 gene locus_tag LOCUS_14380 9360 10022 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_14380 10309 11766 gene locus_tag LOCUS_14390 10309 11766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 11865 12977 gene locus_tag LOCUS_14400 11865 12977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 12997 13542 gene locus_tag LOCUS_14410 12997 13542 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389983.1 protein_id gnl|my_center|LOCUS_14410 14879 13596 gene locus_tag LOCUS_14420 14879 13596 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_14420 15213 16067 gene locus_tag LOCUS_14430 gene metF 15213 16067 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_14430 16064 16741 gene locus_tag LOCUS_14440 16064 16741 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_14440 16728 19076 gene locus_tag LOCUS_14450 16728 19076 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_14450 19284 20396 gene locus_tag LOCUS_14460 19284 20396 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_14460 20442 21935 gene locus_tag LOCUS_14470 20442 21935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681178.1 protein_id gnl|my_center|LOCUS_14470 21976 22608 gene locus_tag LOCUS_14480 21976 22608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 22674 22934 gene locus_tag LOCUS_14490 22674 22934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 22988 23248 gene locus_tag LOCUS_14500 22988 23248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 23315 24049 gene locus_tag LOCUS_14510 23315 24049 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931856.1 protein_id gnl|my_center|LOCUS_14510 24098 26197 gene locus_tag LOCUS_14520 24098 26197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 27794 26259 gene locus_tag LOCUS_14530 27794 26259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 28318 27860 gene locus_tag LOCUS_14540 28318 27860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 29670 28366 gene locus_tag LOCUS_14550 29670 28366 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804282.1 protein_id gnl|my_center|LOCUS_14550 30801 29935 gene locus_tag LOCUS_14560 30801 29935 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001035601.1 protein_id gnl|my_center|LOCUS_14560 31033 32394 gene locus_tag LOCUS_14570 31033 32394 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898090.1 protein_id gnl|my_center|LOCUS_14570 32416 33774 gene locus_tag LOCUS_14580 32416 33774 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898090.1 protein_id gnl|my_center|LOCUS_14580 33869 34816 gene locus_tag LOCUS_14590 33869 34816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 34848 35786 gene locus_tag LOCUS_14600 34848 35786 CDS product FMN-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254509.1 protein_id gnl|my_center|LOCUS_14600 35823 36785 gene locus_tag LOCUS_14610 35823 36785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 36852 37076 gene locus_tag LOCUS_14620 36852 37076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 37363 39942 gene locus_tag LOCUS_14630 37363 39942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 40200 41273 gene locus_tag LOCUS_14640 40200 41273 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681885.1 protein_id gnl|my_center|LOCUS_14640 41275 41853 gene locus_tag LOCUS_14650 41275 41853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 42648 41977 gene locus_tag LOCUS_14660 42648 41977 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_14660 43706 42696 gene locus_tag LOCUS_14670 43706 42696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 43949 44602 gene locus_tag LOCUS_14680 43949 44602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 44763 47408 gene locus_tag LOCUS_14690 44763 47408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 47582 48469 gene locus_tag LOCUS_14700 47582 48469 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267623.1 protein_id gnl|my_center|LOCUS_14700 48554 49147 gene locus_tag LOCUS_14710 48554 49147 CDS product Abortive infection protein AbiEi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072726816.1 protein_id gnl|my_center|LOCUS_14710 49144 49353 gene locus_tag LOCUS_14720 49144 49353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14720 49416 49994 gene locus_tag LOCUS_14730 49416 49994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14730 50164 52719 gene locus_tag LOCUS_14740 50164 52719 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068835.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence15 925 77 gene locus_tag LOCUS_14750 925 77 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272216.1 protein_id gnl|my_center|LOCUS_14750 1928 945 gene locus_tag LOCUS_14760 1928 945 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_14760 3550 1946 gene locus_tag LOCUS_14770 3550 1946 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_14770 3868 3683 gene locus_tag LOCUS_14780 gene rpmF 3868 3683 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_14780 5172 3967 gene locus_tag LOCUS_14790 5172 3967 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_14790 6415 5309 gene locus_tag LOCUS_14800 6415 5309 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_14800 6999 6421 gene locus_tag LOCUS_14810 6999 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 7498 7016 gene locus_tag LOCUS_14820 gene coaD 7498 7016 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416314.1 protein_id gnl|my_center|LOCUS_14820 8075 7491 gene locus_tag LOCUS_14830 gene rsmD 8075 7491 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_14830 10123 8084 gene locus_tag LOCUS_14840 gene recG 10123 8084 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_14840 10520 10110 gene locus_tag LOCUS_14850 10520 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 10775 10584 gene locus_tag LOCUS_14860 gene rpmB 10775 10584 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416297.1 protein_id gnl|my_center|LOCUS_14860 11470 10928 gene locus_tag LOCUS_14870 11470 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 11572 13020 gene locus_tag LOCUS_14880 11572 13020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 13909 13070 gene locus_tag LOCUS_14890 13909 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 14043 15974 gene locus_tag LOCUS_14900 gene htpG 14043 15974 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986521.1 protein_id gnl|my_center|LOCUS_14900 17620 16028 gene locus_tag LOCUS_14910 17620 16028 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861453.1 protein_id gnl|my_center|LOCUS_14910 18326 17613 gene locus_tag LOCUS_14920 18326 17613 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889773.1 protein_id gnl|my_center|LOCUS_14920 19241 18366 gene locus_tag LOCUS_14930 gene aroE 19241 18366 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289627.1 protein_id gnl|my_center|LOCUS_14930 19322 19822 gene locus_tag LOCUS_14940 19322 19822 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151377.1 protein_id gnl|my_center|LOCUS_14940 20288 19806 gene locus_tag LOCUS_14950 20288 19806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 21299 20460 gene locus_tag LOCUS_14960 21299 20460 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_14960 22159 21389 gene locus_tag LOCUS_14970 22159 21389 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964207.1 protein_id gnl|my_center|LOCUS_14970 23226 22156 gene locus_tag LOCUS_14980 23226 22156 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682145.1 protein_id gnl|my_center|LOCUS_14980 23404 24015 gene locus_tag LOCUS_14990 23404 24015 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_14990 25134 24088 gene locus_tag LOCUS_15000 25134 24088 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202979.1 protein_id gnl|my_center|LOCUS_15000 27699 25186 gene locus_tag LOCUS_15010 27699 25186 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788368.1 protein_id gnl|my_center|LOCUS_15010 29643 27877 gene locus_tag LOCUS_15020 29643 27877 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017171.1 protein_id gnl|my_center|LOCUS_15020 30237 29680 gene locus_tag LOCUS_15030 30237 29680 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_15030 30786 30238 gene locus_tag LOCUS_15040 30786 30238 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_15040 31694 30804 gene locus_tag LOCUS_15050 31694 30804 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016572.1 protein_id gnl|my_center|LOCUS_15050 32182 31691 gene locus_tag LOCUS_15060 32182 31691 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896783.1 protein_id gnl|my_center|LOCUS_15060 34447 32309 gene locus_tag LOCUS_15070 34447 32309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 34898 36043 gene locus_tag LOCUS_15080 34898 36043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 36663 36088 gene locus_tag LOCUS_15090 36663 36088 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017022.1 protein_id gnl|my_center|LOCUS_15090 37141 36731 gene locus_tag LOCUS_15100 37141 36731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 37561 37250 gene locus_tag LOCUS_15110 37561 37250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837146.1 protein_id gnl|my_center|LOCUS_15110 <39835 37776 gene locus_tag LOCUS_15120 <39835 37776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000044547.1:serine-rich repeat glycoprotein adhesin SasA >Feature sequence16 1215 85 gene locus_tag LOCUS_15130 1215 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1667 1215 gene locus_tag LOCUS_15140 1667 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2402 1686 gene locus_tag LOCUS_15150 2402 1686 CDS product sulfite oxidase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963524.1 protein_id gnl|my_center|LOCUS_15150 2636 2548 gene locus_tag LOCUS_t00280 2636 2548 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3682 2699 gene locus_tag LOCUS_15160 3682 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 4979 3672 gene locus_tag LOCUS_15170 4979 3672 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_15170 6172 4988 gene locus_tag LOCUS_15180 6172 4988 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965365.1 protein_id gnl|my_center|LOCUS_15180 6902 6195 gene locus_tag LOCUS_15190 6902 6195 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_15190 8189 6906 gene locus_tag LOCUS_15200 gene rmuC 8189 6906 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_15200 8656 8369 gene locus_tag LOCUS_15210 8656 8369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 9169 8744 gene locus_tag LOCUS_15220 gene aroQ 9169 8744 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860435.1 protein_id gnl|my_center|LOCUS_15220 9441 9166 gene locus_tag LOCUS_15230 9441 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 10456 9434 gene locus_tag LOCUS_15240 gene aroC 10456 9434 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249217.1 protein_id gnl|my_center|LOCUS_15240 11755 10466 gene locus_tag LOCUS_15250 gene aroA 11755 10466 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_15250 12789 11752 gene locus_tag LOCUS_15260 gene aroB 12789 11752 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_15260 13625 12786 gene locus_tag LOCUS_15270 gene aroF 13625 12786 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_15270 14404 13643 gene locus_tag LOCUS_15280 14404 13643 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286624.1 protein_id gnl|my_center|LOCUS_15280 14506 15279 gene locus_tag LOCUS_15290 14506 15279 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023529.1 protein_id gnl|my_center|LOCUS_15290 15373 16668 gene locus_tag LOCUS_15300 15373 16668 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048319.1 protein_id gnl|my_center|LOCUS_15300 16669 17751 gene locus_tag LOCUS_15310 16669 17751 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986645.1 protein_id gnl|my_center|LOCUS_15310 21383 17844 gene locus_tag LOCUS_15320 gene nifJ 21383 17844 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987043.1 protein_id gnl|my_center|LOCUS_15320 22308 21649 gene locus_tag LOCUS_15330 22308 21649 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987854.1 protein_id gnl|my_center|LOCUS_15330 23021 22296 gene locus_tag LOCUS_15340 23021 22296 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902988.1 protein_id gnl|my_center|LOCUS_15340 24513 23146 gene locus_tag LOCUS_15350 24513 23146 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015878.1 protein_id gnl|my_center|LOCUS_15350 25545 24754 gene locus_tag LOCUS_15360 25545 24754 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_15360 27118 25565 gene locus_tag LOCUS_15370 27118 25565 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_15370 28877 27096 gene locus_tag LOCUS_15380 28877 27096 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015882.1 protein_id gnl|my_center|LOCUS_15380 29899 28880 gene locus_tag LOCUS_15390 29899 28880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 31228 29969 gene locus_tag LOCUS_15400 gene ablA 31228 29969 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_15400 32444 31383 gene locus_tag LOCUS_15410 gene kdd 32444 31383 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_15410 34769 32703 gene locus_tag LOCUS_15420 34769 32703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 34942 35334 gene locus_tag LOCUS_15430 34942 35334 CDS product 3-aminobutyryl-CoA ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902967.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence17 1293 124 gene locus_tag LOCUS_15440 gene rlmD 1293 124 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434581.1 protein_id gnl|my_center|LOCUS_15440 2401 1280 gene locus_tag LOCUS_15450 gene tgt 2401 1280 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_15450 3021 2416 gene locus_tag LOCUS_15460 3021 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 4088 3033 gene locus_tag LOCUS_15470 gene queA 4088 3033 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354017.1 protein_id gnl|my_center|LOCUS_15470 5136 4102 gene locus_tag LOCUS_15480 gene ruvB 5136 4102 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965582.1 protein_id gnl|my_center|LOCUS_15480 5742 5146 gene locus_tag LOCUS_15490 gene ruvA 5742 5146 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_15490 6224 5739 gene locus_tag LOCUS_15500 gene ruvC 6224 5739 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_15500 6380 6865 gene locus_tag LOCUS_15510 6380 6865 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_15510 6865 8487 gene locus_tag LOCUS_15520 gene recN 6865 8487 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230267.1 protein_id gnl|my_center|LOCUS_15520 12110 8598 gene locus_tag LOCUS_15530 12110 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 13875 12127 gene locus_tag LOCUS_15540 gene nuoF 13875 12127 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_15540 14390 13875 gene locus_tag LOCUS_15550 gene nuoE 14390 13875 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_15550 15652 14600 gene locus_tag LOCUS_15560 gene holA 15652 14600 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964585.1 protein_id gnl|my_center|LOCUS_15560 16188 15736 gene locus_tag LOCUS_15570 16188 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 17128 16190 gene locus_tag LOCUS_15580 17128 16190 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896305.1 protein_id gnl|my_center|LOCUS_15580 17996 17184 gene locus_tag LOCUS_15590 17996 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 19833 18118 gene locus_tag LOCUS_15600 19833 18118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 20040 20660 gene locus_tag LOCUS_15610 20040 20660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 22217 20724 gene locus_tag LOCUS_15620 22217 20724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 22449 25295 gene locus_tag LOCUS_15630 22449 25295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 26253 25354 gene locus_tag LOCUS_15640 26253 25354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 26936 26283 gene locus_tag LOCUS_15650 gene rpe 26936 26283 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431138.1 protein_id gnl|my_center|LOCUS_15650 27778 26951 gene locus_tag LOCUS_15660 gene rsgA 27778 26951 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_15660 29737 27824 gene locus_tag LOCUS_15670 gene pknB 29737 27824 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986841.1 protein_id gnl|my_center|LOCUS_15670 30464 29730 gene locus_tag LOCUS_15680 30464 29730 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701707.1 protein_id gnl|my_center|LOCUS_15680 <31036 30448 gene locus_tag LOCUS_15690 <31036 30448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861607.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB >Feature sequence18 1492 785 gene locus_tag LOCUS_15700 1492 785 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_15700 2437 1496 gene locus_tag LOCUS_15710 gene fmt 2437 1496 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_15710 2919 2443 gene locus_tag LOCUS_15720 gene def 2919 2443 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388617.1 protein_id gnl|my_center|LOCUS_15720 4937 2928 gene locus_tag LOCUS_15730 gene priA 4937 2928 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_15730 5947 4937 gene locus_tag LOCUS_15740 gene asnA 5947 4937 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_15740 6628 5975 gene locus_tag LOCUS_15750 6628 5975 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_15750 6721 7671 gene locus_tag LOCUS_15760 6721 7671 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461526.1 protein_id gnl|my_center|LOCUS_15760 8087 7716 gene locus_tag LOCUS_15770 8087 7716 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016038.1 protein_id gnl|my_center|LOCUS_15770 9743 8097 gene locus_tag LOCUS_15780 gene cydC 9743 8097 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_15780 11471 9747 gene locus_tag LOCUS_15790 11471 9747 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_15790 12265 11489 gene locus_tag LOCUS_15800 12265 11489 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403758.1 protein_id gnl|my_center|LOCUS_15800 13253 12255 gene locus_tag LOCUS_15810 13253 12255 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036855.1 protein_id gnl|my_center|LOCUS_15810 14148 13276 gene locus_tag LOCUS_15820 gene isdE 14148 13276 CDS product heme ABC transporter substrate-binding protein IsdE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922615.1 protein_id gnl|my_center|LOCUS_15820 14985 14161 gene locus_tag LOCUS_15830 14985 14161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 18248 15081 gene locus_tag LOCUS_15840 18248 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 19321 18488 gene locus_tag LOCUS_15850 19321 18488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 20856 19447 gene locus_tag LOCUS_15860 20856 19447 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974991.1 protein_id gnl|my_center|LOCUS_15860 21143 21061 gene locus_tag LOCUS_t00290 21143 21061 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21224 21150 gene locus_tag LOCUS_t00300 21224 21150 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence19 724 44 gene locus_tag LOCUS_15870 724 44 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_15870 2457 805 gene locus_tag LOCUS_15880 2457 805 CDS product glutamate--tRNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225984.1 protein_id gnl|my_center|LOCUS_15880 2535 3182 gene locus_tag LOCUS_15890 2535 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965661.1 protein_id gnl|my_center|LOCUS_15890 3215 4312 gene locus_tag LOCUS_15900 3215 4312 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438208.1 protein_id gnl|my_center|LOCUS_15900 4325 4603 gene locus_tag LOCUS_15910 4325 4603 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846230.1 protein_id gnl|my_center|LOCUS_15910 4620 5978 gene locus_tag LOCUS_15920 4620 5978 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475560.1 protein_id gnl|my_center|LOCUS_15920 7776 6040 gene locus_tag LOCUS_15930 7776 6040 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964921.1 protein_id gnl|my_center|LOCUS_15930 8110 7910 gene locus_tag LOCUS_15940 8110 7910 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837579.1 protein_id gnl|my_center|LOCUS_15940 10763 8136 gene locus_tag LOCUS_15950 gene ppdK 10763 8136 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_15950 12197 10788 gene locus_tag LOCUS_15960 12197 10788 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_15960 12977 12264 gene locus_tag LOCUS_15970 12977 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 13836 12988 gene locus_tag LOCUS_15980 gene recO 13836 12988 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547622.1 protein_id gnl|my_center|LOCUS_15980 14686 13787 gene locus_tag LOCUS_15990 gene era 14686 13787 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_15990 15072 14683 gene locus_tag LOCUS_16000 gene cdd 15072 14683 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_16000 15554 15099 gene locus_tag LOCUS_16010 gene ybeY 15554 15099 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430894.1 protein_id gnl|my_center|LOCUS_16010 16558 15554 gene locus_tag LOCUS_16020 16558 15554 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_16020 20948 16749 gene locus_tag LOCUS_16030 20948 16749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence20 174 25 gene locus_tag LOCUS_16040 174 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 542 1282 gene locus_tag LOCUS_16050 gene atpB 542 1282 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437836.1 protein_id gnl|my_center|LOCUS_16050 1300 1515 gene locus_tag LOCUS_16060 1300 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1543 2064 gene locus_tag LOCUS_16070 1543 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2048 2509 gene locus_tag LOCUS_16080 2048 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2522 4036 gene locus_tag LOCUS_16090 gene atpA 2522 4036 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966151.1 protein_id gnl|my_center|LOCUS_16090 4029 4979 gene locus_tag LOCUS_16100 4029 4979 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_16100 4981 6369 gene locus_tag LOCUS_16110 gene atpD 4981 6369 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_16110 6359 6715 gene locus_tag LOCUS_16120 6359 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 6871 8412 gene locus_tag LOCUS_16130 6871 8412 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_16130 9402 8482 gene locus_tag LOCUS_16140 9402 8482 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235901447.1 protein_id gnl|my_center|LOCUS_16140 10598 9399 gene locus_tag LOCUS_16150 10598 9399 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386882.1 protein_id gnl|my_center|LOCUS_16150 11488 10646 gene locus_tag LOCUS_16160 11488 10646 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047741.1 protein_id gnl|my_center|LOCUS_16160 12198 11512 gene locus_tag LOCUS_16170 12198 11512 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678782.1 protein_id gnl|my_center|LOCUS_16170 13767 12211 gene locus_tag LOCUS_16180 13767 12211 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233752.1 protein_id gnl|my_center|LOCUS_16180 15816 14083 gene locus_tag LOCUS_16190 gene aspT 15816 14083 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549953.1 protein_id gnl|my_center|LOCUS_16190 17428 15833 gene locus_tag LOCUS_16200 17428 15833 CDS product bifunctional aspartate transaminase/aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549954.1 protein_id gnl|my_center|LOCUS_16200 >Feature sequence21 147 2015 gene locus_tag LOCUS_16210 gene typA 147 2015 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430621.1 protein_id gnl|my_center|LOCUS_16210 2086 2883 gene locus_tag LOCUS_16220 2086 2883 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902661.1 protein_id gnl|my_center|LOCUS_16220 2943 6386 gene locus_tag LOCUS_16230 2943 6386 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048255.1 protein_id gnl|my_center|LOCUS_16230 6442 7677 gene locus_tag LOCUS_16240 gene pepT 6442 7677 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_16240 7677 8456 gene locus_tag LOCUS_16250 7677 8456 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_16250 8493 9488 gene locus_tag LOCUS_16260 8493 9488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 9581 10219 gene locus_tag LOCUS_16270 9581 10219 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_16270 10188 10334 gene locus_tag LOCUS_16280 10188 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 10379 10552 gene locus_tag LOCUS_16290 10379 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 10593 10985 gene locus_tag LOCUS_16300 10593 10985 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679681.1 protein_id gnl|my_center|LOCUS_16300 11256 11384 gene locus_tag LOCUS_16310 11256 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 11513 11662 gene locus_tag LOCUS_16320 11513 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 11955 11881 gene locus_tag LOCUS_t00310 11955 11881 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12067 13545 gene locus_tag LOCUS_16330 gene thrC 12067 13545 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263406.1 protein_id gnl|my_center|LOCUS_16330 13536 14096 gene locus_tag LOCUS_16340 13536 14096 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_16340 14463 14376 gene locus_tag LOCUS_t00320 14463 14376 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14681 16291 gene locus_tag LOCUS_16350 14681 16291 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262192.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence22 284 1555 gene locus_tag LOCUS_16360 284 1555 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013611293.1 protein_id gnl|my_center|LOCUS_16360 1960 2250 gene locus_tag LOCUS_16370 1960 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 2287 2706 gene locus_tag LOCUS_16380 2287 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678829.1 protein_id gnl|my_center|LOCUS_16380 2816 3736 gene locus_tag LOCUS_16390 2816 3736 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881303.1 protein_id gnl|my_center|LOCUS_16390 3815 4357 gene locus_tag LOCUS_16400 3815 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 4372 5637 gene locus_tag LOCUS_16410 4372 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5674 6162 gene locus_tag LOCUS_16420 5674 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6224 6640 gene locus_tag LOCUS_16430 6224 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 6886 7824 gene locus_tag LOCUS_16440 6886 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 7964 8794 gene locus_tag LOCUS_16450 7964 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681682.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence23 1537 857 gene locus_tag LOCUS_16460 1537 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2079 1717 gene locus_tag LOCUS_16470 2079 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2892 2218 gene locus_tag LOCUS_16480 2892 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 <3959 2889 gene locus_tag LOCUS_16490 <3959 2889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012027255.1:DUF3114 domain-containing protein >Feature sequence24 785 108 gene locus_tag LOCUS_16500 785 108 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_16500 1663 788 gene locus_tag LOCUS_16510 1663 788 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836955.1 protein_id gnl|my_center|LOCUS_16510