>Feature sequence01 347 1102 gene locus_tag LOCUS_00010 347 1102 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056908.1 protein_id gnl|my_center|LOCUS_00010 1161 2057 gene locus_tag LOCUS_00020 1161 2057 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056925.1 protein_id gnl|my_center|LOCUS_00020 2243 3238 gene locus_tag LOCUS_00030 2243 3238 CDS product 2-keto-3-deoxygluconate permease 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001022089.1 protein_id gnl|my_center|LOCUS_00030 3581 3300 gene locus_tag LOCUS_00040 3581 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3699 4787 gene locus_tag LOCUS_00050 3699 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4886 6127 gene locus_tag LOCUS_00060 4886 6127 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273947.1 protein_id gnl|my_center|LOCUS_00060 6233 7564 gene locus_tag LOCUS_00070 6233 7564 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_00070 7656 8267 gene locus_tag LOCUS_00080 7656 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8274 8657 gene locus_tag LOCUS_00090 8274 8657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8650 9504 gene locus_tag LOCUS_00100 8650 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9504 10886 gene locus_tag LOCUS_00110 9504 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10891 13557 gene locus_tag LOCUS_00120 gene alaS 10891 13557 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703239.1 protein_id gnl|my_center|LOCUS_00120 13561 13983 gene locus_tag LOCUS_00130 gene ruvX 13561 13983 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_00130 13984 15294 gene locus_tag LOCUS_00140 gene mltG 13984 15294 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_00140 15311 15802 gene locus_tag LOCUS_00150 15311 15802 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001879564.1 protein_id gnl|my_center|LOCUS_00150 15867 16415 gene locus_tag LOCUS_00160 gene aroK 15867 16415 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381319.1 protein_id gnl|my_center|LOCUS_00160 16412 17548 gene locus_tag LOCUS_00170 16412 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17640 18764 gene locus_tag LOCUS_00180 17640 18764 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_00180 19018 20019 gene locus_tag LOCUS_00190 19018 20019 CDS product mannose/fructose/sorbose PTS transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289456.1 protein_id gnl|my_center|LOCUS_00190 20036 20851 gene locus_tag LOCUS_00200 20036 20851 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294546.1 protein_id gnl|my_center|LOCUS_00200 20873 21790 gene locus_tag LOCUS_00210 20873 21790 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700025.1 protein_id gnl|my_center|LOCUS_00210 21877 22284 gene locus_tag LOCUS_00220 21877 22284 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356033.1 protein_id gnl|my_center|LOCUS_00220 22421 22984 gene locus_tag LOCUS_00230 gene efp 22421 22984 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224610.1 protein_id gnl|my_center|LOCUS_00230 23067 23432 gene locus_tag LOCUS_00240 23067 23432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23435 23938 gene locus_tag LOCUS_00250 23435 23938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23941 24288 gene locus_tag LOCUS_00260 23941 24288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24288 25094 gene locus_tag LOCUS_00270 24288 25094 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_00270 25212 26069 gene locus_tag LOCUS_00280 25212 26069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 26081 27712 gene locus_tag LOCUS_00290 gene recN 26081 27712 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_00290 27847 29496 gene locus_tag LOCUS_00300 27847 29496 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_00300 29525 30433 gene locus_tag LOCUS_00310 gene xerD 29525 30433 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_00310 30872 31306 gene locus_tag LOCUS_00320 30872 31306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 31322 32305 gene locus_tag LOCUS_00330 gene rsmH 31322 32305 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_00330 32363 32782 gene locus_tag LOCUS_00340 32363 32782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 32874 34598 gene locus_tag LOCUS_00350 32874 34598 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_00350 34607 36043 gene locus_tag LOCUS_00360 34607 36043 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246696.1 protein_id gnl|my_center|LOCUS_00360 36043 37074 gene locus_tag LOCUS_00370 gene mraY 36043 37074 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460699.1 protein_id gnl|my_center|LOCUS_00370 37104 38507 gene locus_tag LOCUS_00380 gene murD 37104 38507 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_00380 38507 40033 gene locus_tag LOCUS_00390 38507 40033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40057 41190 gene locus_tag LOCUS_00400 gene murG 40057 41190 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392362.1 protein_id gnl|my_center|LOCUS_00400 41272 42687 gene locus_tag LOCUS_00410 gene murC 41272 42687 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_00410 42698 43612 gene locus_tag LOCUS_00420 gene murB 42698 43612 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437020.1 protein_id gnl|my_center|LOCUS_00420 43620 44678 gene locus_tag LOCUS_00430 43620 44678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44926 46062 gene locus_tag LOCUS_00440 gene ftsZ 44926 46062 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976733.1 protein_id gnl|my_center|LOCUS_00440 46065 46889 gene locus_tag LOCUS_00450 gene pgeF 46065 46889 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460686.1 protein_id gnl|my_center|LOCUS_00450 46978 47712 gene locus_tag LOCUS_00460 46978 47712 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_00460 47774 48454 gene locus_tag LOCUS_00470 47774 48454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 48467 48745 gene locus_tag LOCUS_00480 48467 48745 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221463.1 protein_id gnl|my_center|LOCUS_00480 48825 49460 gene locus_tag LOCUS_00490 48825 49460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 50420 49542 gene locus_tag LOCUS_00500 50420 49542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 51936 50527 gene locus_tag LOCUS_00510 51936 50527 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_00510 52116 53540 gene locus_tag LOCUS_00520 52116 53540 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_00520 55758 53584 gene locus_tag LOCUS_00530 55758 53584 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068490.1 protein_id gnl|my_center|LOCUS_00530 58390 55760 gene locus_tag LOCUS_00540 58390 55760 CDS product YhgE/Pip family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143686.1 protein_id gnl|my_center|LOCUS_00540 58616 59332 gene locus_tag LOCUS_00550 58616 59332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 59520 60782 gene locus_tag LOCUS_00560 gene metK 59520 60782 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_00560 62944 60788 gene locus_tag LOCUS_00570 62944 60788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63176 63100 gene locus_tag LOCUS_t00010 63176 63100 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 63269 63196 gene locus_tag LOCUS_t00020 63269 63196 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 65036 63387 gene locus_tag LOCUS_00580 65036 63387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 66684 65170 gene locus_tag LOCUS_00590 gene gltX 66684 65170 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392646.1 protein_id gnl|my_center|LOCUS_00590 67744 66776 gene locus_tag LOCUS_00600 67744 66776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 67898 69256 gene locus_tag LOCUS_00610 67898 69256 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_00610 69330 70085 gene locus_tag LOCUS_00620 69330 70085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 71322 70060 gene locus_tag LOCUS_00630 71322 70060 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461387.1 protein_id gnl|my_center|LOCUS_00630 73031 71442 gene locus_tag LOCUS_00640 73031 71442 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939860.1 protein_id gnl|my_center|LOCUS_00640 74314 73139 gene locus_tag LOCUS_00650 74314 73139 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_056938137.1 protein_id gnl|my_center|LOCUS_00650 74392 75543 gene locus_tag LOCUS_00660 74392 75543 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_00660 75772 77076 gene locus_tag LOCUS_00670 75772 77076 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837362.1 protein_id gnl|my_center|LOCUS_00670 77092 77985 gene locus_tag LOCUS_00680 gene dapA 77092 77985 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286879.1 protein_id gnl|my_center|LOCUS_00680 77978 78694 gene locus_tag LOCUS_00690 gene dapB 77978 78694 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_00690 78749 79450 gene locus_tag LOCUS_00700 gene dapD 78749 79450 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286875.1 protein_id gnl|my_center|LOCUS_00700 79461 80678 gene locus_tag LOCUS_00710 gene tgt 79461 80678 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_00710 80919 84281 gene locus_tag LOCUS_00720 80919 84281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 84274 86619 gene locus_tag LOCUS_00730 84274 86619 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422921.1 protein_id gnl|my_center|LOCUS_00730 86612 87403 gene locus_tag LOCUS_00740 86612 87403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 87477 87560 gene locus_tag LOCUS_t00030 87477 87560 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 87809 88390 gene locus_tag LOCUS_00750 gene infC 87809 88390 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027874.1 protein_id gnl|my_center|LOCUS_00750 88392 88592 gene locus_tag LOCUS_00760 gene rpmI 88392 88592 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_00760 88634 88993 gene locus_tag LOCUS_00770 gene rplT 88634 88993 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132352.1 protein_id gnl|my_center|LOCUS_00770 90851 89631 gene locus_tag LOCUS_00780 90851 89631 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000378318.1 protein_id gnl|my_center|LOCUS_00780 91316 91391 gene locus_tag LOCUS_t00040 91316 91391 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 91473 92510 gene locus_tag LOCUS_00790 91473 92510 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_00790 92513 92965 gene locus_tag LOCUS_00800 92513 92965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 93026 94522 gene locus_tag LOCUS_00810 93026 94522 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_00810 94591 96435 gene locus_tag LOCUS_00820 gene argS 94591 96435 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_00820 96765 97445 gene locus_tag LOCUS_00830 96765 97445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 97688 99793 gene locus_tag LOCUS_00840 gene rho 97688 99793 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110131.1 protein_id gnl|my_center|LOCUS_00840 100092 101474 gene locus_tag LOCUS_00850 100092 101474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 101665 102846 gene locus_tag LOCUS_00860 101665 102846 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_00860 102862 103734 gene locus_tag LOCUS_00870 102862 103734 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_00870 103745 104962 gene locus_tag LOCUS_00880 103745 104962 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_00880 104968 105813 gene locus_tag LOCUS_00890 104968 105813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_00890 105813 106562 gene locus_tag LOCUS_00900 105813 106562 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_00900 107960 107031 gene locus_tag LOCUS_00910 gene thrB 107960 107031 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674786.1 protein_id gnl|my_center|LOCUS_00910 109527 107983 gene locus_tag LOCUS_00920 gene thrC 109527 107983 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068263.1 protein_id gnl|my_center|LOCUS_00920 109840 110979 gene locus_tag LOCUS_00930 109840 110979 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_00930 110982 112310 gene locus_tag LOCUS_00940 110982 112310 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_00940 112313 113335 gene locus_tag LOCUS_00950 112313 113335 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_00950 113944 113868 gene locus_tag LOCUS_t00050 113944 113868 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 114091 115281 gene locus_tag LOCUS_00960 114091 115281 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679364.1 protein_id gnl|my_center|LOCUS_00960 115536 115611 gene locus_tag LOCUS_t00060 115536 115611 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 115627 115702 gene locus_tag LOCUS_t00070 115627 115702 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 115834 116847 gene locus_tag LOCUS_00970 gene pfkB 115834 116847 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861506.1 protein_id gnl|my_center|LOCUS_00970 117139 118842 gene locus_tag LOCUS_00980 gene ptsP 117139 118842 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475729.1 protein_id gnl|my_center|LOCUS_00980 119949 119020 gene locus_tag LOCUS_00990 119949 119020 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_00990 120123 121007 gene locus_tag LOCUS_01000 120123 121007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 121734 121015 gene locus_tag LOCUS_01010 121734 121015 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861813.1 protein_id gnl|my_center|LOCUS_01010 122029 123339 gene locus_tag LOCUS_01020 122029 123339 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_01020 123423 124277 gene locus_tag LOCUS_01030 123423 124277 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112931.1 protein_id gnl|my_center|LOCUS_01030 124277 125116 gene locus_tag LOCUS_01040 124277 125116 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_01040 125165 126358 gene locus_tag LOCUS_01050 gene ugpC 125165 126358 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861561.1 protein_id gnl|my_center|LOCUS_01050 126420 127913 gene locus_tag LOCUS_01060 gene malQ 126420 127913 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000747274.1 protein_id gnl|my_center|LOCUS_01060 127913 130177 gene locus_tag LOCUS_01070 gene glgP 127913 130177 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950158.1 protein_id gnl|my_center|LOCUS_01070 130398 132278 gene locus_tag LOCUS_01080 130398 132278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 132920 132845 gene locus_tag LOCUS_t00080 132920 132845 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 133020 132944 gene locus_tag LOCUS_t00090 133020 132944 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 133176 134507 gene locus_tag LOCUS_01090 gene gdhA 133176 134507 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815054.1 protein_id gnl|my_center|LOCUS_01090 135338 134628 gene locus_tag LOCUS_01100 135338 134628 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265466.1 protein_id gnl|my_center|LOCUS_01100 135469 136758 gene locus_tag LOCUS_01110 gene carA 135469 136758 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081322.1 protein_id gnl|my_center|LOCUS_01110 136758 139979 gene locus_tag LOCUS_01120 gene carB 136758 139979 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141767.1 protein_id gnl|my_center|LOCUS_01120 140140 140225 gene locus_tag LOCUS_t00100 140140 140225 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 140284 141693 gene locus_tag LOCUS_01130 gene tig 140284 141693 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_01130 141825 142433 gene locus_tag LOCUS_01140 gene clpP 141825 142433 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812508.1 protein_id gnl|my_center|LOCUS_01140 142460 143758 gene locus_tag LOCUS_01150 gene clpX 142460 143758 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640796.1 protein_id gnl|my_center|LOCUS_01150 144015 144707 gene locus_tag LOCUS_01160 144015 144707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 145857 144781 gene locus_tag LOCUS_01170 145857 144781 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548569.1 protein_id gnl|my_center|LOCUS_01170 146714 145944 gene locus_tag LOCUS_01180 146714 145944 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974283.1 protein_id gnl|my_center|LOCUS_01180 147441 146707 gene locus_tag LOCUS_01190 147441 146707 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964226.1 protein_id gnl|my_center|LOCUS_01190 147625 150312 gene locus_tag LOCUS_01200 147625 150312 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460907.1 protein_id gnl|my_center|LOCUS_01200 150389 152062 gene locus_tag LOCUS_01210 150389 152062 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809880.1 protein_id gnl|my_center|LOCUS_01210 152062 152715 gene locus_tag LOCUS_01220 152062 152715 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198967.1 protein_id gnl|my_center|LOCUS_01220 152717 153586 gene locus_tag LOCUS_01230 152717 153586 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902122.1 protein_id gnl|my_center|LOCUS_01230 153608 154195 gene locus_tag LOCUS_01240 gene folE 153608 154195 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014794265.1 protein_id gnl|my_center|LOCUS_01240 154210 155634 gene locus_tag LOCUS_01250 154210 155634 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804613.1 protein_id gnl|my_center|LOCUS_01250 155721 156152 gene locus_tag LOCUS_01260 155721 156152 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258099.1 protein_id gnl|my_center|LOCUS_01260 156290 158056 gene locus_tag LOCUS_01270 gene thrS 156290 158056 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_01270 158046 158864 gene locus_tag LOCUS_01280 158046 158864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 158932 161550 gene locus_tag LOCUS_01290 gene adhE 158932 161550 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434815.1 protein_id gnl|my_center|LOCUS_01290 162349 161861 gene locus_tag LOCUS_01300 gene folA 162349 161861 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_01300 163333 162485 gene locus_tag LOCUS_01310 163333 162485 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966285.1 protein_id gnl|my_center|LOCUS_01310 163671 163423 gene locus_tag LOCUS_01320 163671 163423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 164273 163842 gene locus_tag LOCUS_01330 164273 163842 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854931.1 protein_id gnl|my_center|LOCUS_01330 164991 164275 gene locus_tag LOCUS_01340 164991 164275 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048437.1 protein_id gnl|my_center|LOCUS_01340 165911 165051 gene locus_tag LOCUS_01350 165911 165051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 166498 165917 gene locus_tag LOCUS_01360 166498 165917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 167605 166676 gene locus_tag LOCUS_01370 167605 166676 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888004.1 protein_id gnl|my_center|LOCUS_01370 167704 168834 gene locus_tag LOCUS_01380 gene rnd 167704 168834 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_01380 168938 169624 gene locus_tag LOCUS_01390 168938 169624 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957169.1 protein_id gnl|my_center|LOCUS_01390 169627 170976 gene locus_tag LOCUS_01400 gene xseA 169627 170976 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415260.1 protein_id gnl|my_center|LOCUS_01400 170991 171254 gene locus_tag LOCUS_01410 170991 171254 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771337.1 protein_id gnl|my_center|LOCUS_01410 171265 171609 gene locus_tag LOCUS_01420 171265 171609 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 protein_id gnl|my_center|LOCUS_01420 171743 172912 gene locus_tag LOCUS_01430 gene ackA 171743 172912 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_01430 175616 173073 gene locus_tag LOCUS_01440 175616 173073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 176705 175626 gene locus_tag LOCUS_01450 176705 175626 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_01450 178151 176706 gene locus_tag LOCUS_01460 178151 176706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 178278 178153 gene locus_tag LOCUS_01470 178278 178153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 178768 178974 gene locus_tag LOCUS_01480 178768 178974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 >Feature sequence02 979 140 gene locus_tag LOCUS_01490 gene yaaA 979 140 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729112.1 protein_id gnl|my_center|LOCUS_01490 1086 4229 gene locus_tag LOCUS_01500 1086 4229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 4236 7754 gene locus_tag LOCUS_01510 gene addA 4236 7754 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572274.1 protein_id gnl|my_center|LOCUS_01510 7767 10079 gene locus_tag LOCUS_01520 gene priA 7767 10079 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_01520 10088 10630 gene locus_tag LOCUS_01530 gene def 10088 10630 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694639.1 protein_id gnl|my_center|LOCUS_01530 10639 11562 gene locus_tag LOCUS_01540 gene fmt 10639 11562 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_01540 11562 12953 gene locus_tag LOCUS_01550 gene rsmB 11562 12953 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921990.1 protein_id gnl|my_center|LOCUS_01550 13231 13046 gene locus_tag LOCUS_01560 13231 13046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 13331 14695 gene locus_tag LOCUS_01570 13331 14695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 15047 14859 gene locus_tag LOCUS_01580 gene rpmB 15047 14859 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965040.1 protein_id gnl|my_center|LOCUS_01580 15342 15689 gene locus_tag LOCUS_01590 15342 15689 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171418.1 protein_id gnl|my_center|LOCUS_01590 15728 17392 gene locus_tag LOCUS_01600 15728 17392 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001868429.1 protein_id gnl|my_center|LOCUS_01600 17396 19588 gene locus_tag LOCUS_01610 gene recG 17396 19588 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392440.1 protein_id gnl|my_center|LOCUS_01610 19639 20217 gene locus_tag LOCUS_01620 gene rsmD 19639 20217 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582362.1 protein_id gnl|my_center|LOCUS_01620 20226 20735 gene locus_tag LOCUS_01630 gene coaD 20226 20735 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173005.1 protein_id gnl|my_center|LOCUS_01630 20862 21359 gene locus_tag LOCUS_01640 20862 21359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 21365 21937 gene locus_tag LOCUS_01650 21365 21937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 22085 22264 gene locus_tag LOCUS_01660 gene rpmF 22085 22264 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419113.1 protein_id gnl|my_center|LOCUS_01660 22341 23324 gene locus_tag LOCUS_01670 gene plsX 22341 23324 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003660716.1 protein_id gnl|my_center|LOCUS_01670 23494 23730 gene locus_tag LOCUS_01680 gene acpP 23494 23730 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003154310.1 protein_id gnl|my_center|LOCUS_01680 23744 24475 gene locus_tag LOCUS_01690 gene rnc 23744 24475 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905569.1 protein_id gnl|my_center|LOCUS_01690 24493 28032 gene locus_tag LOCUS_01700 gene smc 24493 28032 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111689.1 protein_id gnl|my_center|LOCUS_01700 28032 28937 gene locus_tag LOCUS_01710 28032 28937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 28937 30316 gene locus_tag LOCUS_01720 gene ffh 28937 30316 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_01720 30481 30804 gene locus_tag LOCUS_01730 30481 30804 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237004.1 protein_id gnl|my_center|LOCUS_01730 30865 31524 gene locus_tag LOCUS_01740 30865 31524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 33270 31591 gene locus_tag LOCUS_01750 33270 31591 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898068.1 protein_id gnl|my_center|LOCUS_01750 33500 35155 gene locus_tag LOCUS_01760 33500 35155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 35233 36066 gene locus_tag LOCUS_01770 35233 36066 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461790.1 protein_id gnl|my_center|LOCUS_01770 38084 36150 gene locus_tag LOCUS_01780 gene ftsH 38084 36150 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272679.1 protein_id gnl|my_center|LOCUS_01780 38551 41349 gene locus_tag LOCUS_01790 gene ileS 38551 41349 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460677.1 protein_id gnl|my_center|LOCUS_01790 41350 41847 gene locus_tag LOCUS_01800 gene lspA 41350 41847 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295859.1 protein_id gnl|my_center|LOCUS_01800 41858 42868 gene locus_tag LOCUS_01810 41858 42868 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245307.1 protein_id gnl|my_center|LOCUS_01810 43695 42874 gene locus_tag LOCUS_01820 43695 42874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 43930 45471 gene locus_tag LOCUS_01830 43930 45471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 45492 47093 gene locus_tag LOCUS_01840 45492 47093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 47226 48533 gene locus_tag LOCUS_01850 47226 48533 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_01850 48609 50132 gene locus_tag LOCUS_01860 48609 50132 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728204.1 protein_id gnl|my_center|LOCUS_01860 50208 52781 gene locus_tag LOCUS_01870 gene leuS 50208 52781 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_01870 52906 53400 gene locus_tag LOCUS_01880 gene rimP 52906 53400 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456065.1 protein_id gnl|my_center|LOCUS_01880 53417 54658 gene locus_tag LOCUS_01890 gene nusA 53417 54658 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_01890 54702 57341 gene locus_tag LOCUS_01900 54702 57341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 57353 57763 gene locus_tag LOCUS_01910 57353 57763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 57768 58787 gene locus_tag LOCUS_01920 57768 58787 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583572.1 protein_id gnl|my_center|LOCUS_01920 58788 59729 gene locus_tag LOCUS_01930 gene truB 58788 59729 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091315604.1 protein_id gnl|my_center|LOCUS_01930 59739 60776 gene locus_tag LOCUS_01940 gene ribF 59739 60776 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767320.1 protein_id gnl|my_center|LOCUS_01940 60766 62724 gene locus_tag LOCUS_01950 60766 62724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 62846 64213 gene locus_tag LOCUS_01960 62846 64213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 64333 64407 gene locus_tag LOCUS_t00110 64333 64407 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 64721 66004 gene locus_tag LOCUS_01970 64721 66004 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674469.1 protein_id gnl|my_center|LOCUS_01970 66109 67617 gene locus_tag LOCUS_01980 66109 67617 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680067.1 protein_id gnl|my_center|LOCUS_01980 67633 69288 gene locus_tag LOCUS_01990 67633 69288 CDS product galactoside ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680065.1 protein_id gnl|my_center|LOCUS_01990 69292 69492 gene locus_tag LOCUS_02000 69292 69492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 71646 70027 gene locus_tag LOCUS_02010 gene galT 71646 70027 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_02010 72848 71637 gene locus_tag LOCUS_02020 gene galK 72848 71637 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_02020 73945 72887 gene locus_tag LOCUS_02030 73945 72887 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786509.1 protein_id gnl|my_center|LOCUS_02030 74212 75243 gene locus_tag LOCUS_02040 74212 75243 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 protein_id gnl|my_center|LOCUS_02040 75316 76419 gene locus_tag LOCUS_02050 75316 76419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 76573 77148 gene locus_tag LOCUS_02060 gene pyrR 76573 77148 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431186.1 protein_id gnl|my_center|LOCUS_02060 77148 78083 gene locus_tag LOCUS_02070 77148 78083 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545982.1 protein_id gnl|my_center|LOCUS_02070 78067 79374 gene locus_tag LOCUS_02080 78067 79374 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392399.1 protein_id gnl|my_center|LOCUS_02080 79374 80168 gene locus_tag LOCUS_02090 79374 80168 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_02090 80162 81088 gene locus_tag LOCUS_02100 80162 81088 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245610.1 protein_id gnl|my_center|LOCUS_02100 81082 81813 gene locus_tag LOCUS_02110 gene pyrF 81082 81813 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_02110 81977 82285 gene locus_tag LOCUS_02120 gene mihF 81977 82285 CDS product integration host factor, actinobacterial type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003862221.1 protein_id gnl|my_center|LOCUS_02120 82285 82863 gene locus_tag LOCUS_02130 gene gmk 82285 82863 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869533.1 protein_id gnl|my_center|LOCUS_02130 82863 83147 gene locus_tag LOCUS_02140 82863 83147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 83153 84397 gene locus_tag LOCUS_02150 gene thiI 83153 84397 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 protein_id gnl|my_center|LOCUS_02150 84662 85414 gene locus_tag LOCUS_02160 84662 85414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 85551 87794 gene locus_tag LOCUS_02170 85551 87794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 87778 88749 gene locus_tag LOCUS_02180 gene holA 87778 88749 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942847.1 protein_id gnl|my_center|LOCUS_02180 89084 88821 gene locus_tag LOCUS_02190 gene rpsT 89084 88821 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113577.1 protein_id gnl|my_center|LOCUS_02190 89148 91004 gene locus_tag LOCUS_02200 gene lepA 89148 91004 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_02200 91014 92105 gene locus_tag LOCUS_02210 gene dusB 91014 92105 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966475.1 protein_id gnl|my_center|LOCUS_02210 92244 93365 gene locus_tag LOCUS_02220 gene hemW 92244 93365 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02220 93459 94565 gene locus_tag LOCUS_02230 93459 94565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 94599 95792 gene locus_tag LOCUS_02240 gene dnaJ 94599 95792 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828442.1 protein_id gnl|my_center|LOCUS_02240 95792 97063 gene locus_tag LOCUS_02250 gene mtaB 95792 97063 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_02250 97075 98034 gene locus_tag LOCUS_02260 97075 98034 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775755.1 protein_id gnl|my_center|LOCUS_02260 98036 98545 gene locus_tag LOCUS_02270 gene ybeY 98036 98545 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003039643.1 protein_id gnl|my_center|LOCUS_02270 98545 98922 gene locus_tag LOCUS_02280 98545 98922 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398824.1 protein_id gnl|my_center|LOCUS_02280 98935 99873 gene locus_tag LOCUS_02290 gene era 98935 99873 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288753.1 protein_id gnl|my_center|LOCUS_02290 99876 100625 gene locus_tag LOCUS_02300 gene recO 99876 100625 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 protein_id gnl|my_center|LOCUS_02300 100761 101039 gene locus_tag LOCUS_02310 gene rpsO 100761 101039 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005890045.1 protein_id gnl|my_center|LOCUS_02310 101124 103322 gene locus_tag LOCUS_02320 gene pnp 101124 103322 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722460.1 protein_id gnl|my_center|LOCUS_02320 103572 105236 gene locus_tag LOCUS_02330 103572 105236 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385808.1 protein_id gnl|my_center|LOCUS_02330 105242 107734 gene locus_tag LOCUS_02340 105242 107734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 107737 109242 gene locus_tag LOCUS_02350 107737 109242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 109291 109788 gene locus_tag LOCUS_02360 109291 109788 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357974.1 protein_id gnl|my_center|LOCUS_02360 109754 111160 gene locus_tag LOCUS_02370 gene rimO 109754 111160 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_02370 111173 111778 gene locus_tag LOCUS_02380 gene pgsA 111173 111778 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_02380 111872 112369 gene locus_tag LOCUS_02390 111872 112369 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919605.1 protein_id gnl|my_center|LOCUS_02390 112602 113690 gene locus_tag LOCUS_02400 gene recA 112602 113690 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113623.1 protein_id gnl|my_center|LOCUS_02400 113690 114364 gene locus_tag LOCUS_02410 113690 114364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 114648 116204 gene locus_tag LOCUS_02420 gene rny 114648 116204 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644638.1 protein_id gnl|my_center|LOCUS_02420 116250 117293 gene locus_tag LOCUS_02430 116250 117293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 117321 117644 gene locus_tag LOCUS_02440 117321 117644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 117647 119014 gene locus_tag LOCUS_02450 gene miaB 117647 119014 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030453.1 protein_id gnl|my_center|LOCUS_02450 119011 119949 gene locus_tag LOCUS_02460 gene miaA 119011 119949 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_02460 120097 121311 gene locus_tag LOCUS_02470 gene hflX 120097 121311 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090287.1 protein_id gnl|my_center|LOCUS_02470 121577 121801 gene locus_tag LOCUS_02480 121577 121801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 122707 122054 gene locus_tag LOCUS_02490 gene lexA 122707 122054 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_02490 122893 123339 gene locus_tag LOCUS_02500 122893 123339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 123438 123884 gene locus_tag LOCUS_02510 gene nrdR 123438 123884 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584044.1 protein_id gnl|my_center|LOCUS_02510 123884 124333 gene locus_tag LOCUS_02520 gene dut 123884 124333 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224478.1 protein_id gnl|my_center|LOCUS_02520 124400 125716 gene locus_tag LOCUS_02530 124400 125716 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047961.1 protein_id gnl|my_center|LOCUS_02530 125882 126832 gene locus_tag LOCUS_02540 gene trxB 125882 126832 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948886.1 protein_id gnl|my_center|LOCUS_02540 127452 126925 gene locus_tag LOCUS_02550 127452 126925 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103118.1 protein_id gnl|my_center|LOCUS_02550 128330 127488 gene locus_tag LOCUS_02560 128330 127488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 128720 128430 gene locus_tag LOCUS_02570 128720 128430 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170383.1 protein_id gnl|my_center|LOCUS_02570 128990 128721 gene locus_tag LOCUS_02580 128990 128721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 131483 129861 gene locus_tag LOCUS_02590 131483 129861 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033562369.1 protein_id gnl|my_center|LOCUS_02590 132803 131586 gene locus_tag LOCUS_02600 132803 131586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 133742 133209 gene locus_tag LOCUS_02610 133742 133209 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565731.1 protein_id gnl|my_center|LOCUS_02610 134657 133794 gene locus_tag LOCUS_02620 134657 133794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 135091 134675 gene locus_tag LOCUS_02630 135091 134675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 135510 135130 gene locus_tag LOCUS_02640 135510 135130 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_02640 136349 135507 gene locus_tag LOCUS_02650 136349 135507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 137572 136349 gene locus_tag LOCUS_02660 137572 136349 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428267.1 protein_id gnl|my_center|LOCUS_02660 138316 137585 gene locus_tag LOCUS_02670 138316 137585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 139779 138382 gene locus_tag LOCUS_02680 139779 138382 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_02680 139908 140798 gene locus_tag LOCUS_02690 139908 140798 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003662288.1 protein_id gnl|my_center|LOCUS_02690 141565 140801 gene locus_tag LOCUS_02700 141565 140801 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837344.1 protein_id gnl|my_center|LOCUS_02700 141777 142523 gene locus_tag LOCUS_02710 141777 142523 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693825.1 protein_id gnl|my_center|LOCUS_02710 144010 142667 gene locus_tag LOCUS_02720 144010 142667 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068710.1 protein_id gnl|my_center|LOCUS_02720 145474 144200 gene locus_tag LOCUS_02730 gene dcm 145474 144200 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068549.1 protein_id gnl|my_center|LOCUS_02730 146917 145574 gene locus_tag LOCUS_02740 146917 145574 CDS product Sau3AI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068548.1 protein_id gnl|my_center|LOCUS_02740 148661 147069 gene locus_tag LOCUS_02750 gene hcp 148661 147069 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433949.1 protein_id gnl|my_center|LOCUS_02750 148796 149464 gene locus_tag LOCUS_02760 148796 149464 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459526.1 protein_id gnl|my_center|LOCUS_02760 149489 149977 gene locus_tag LOCUS_02770 149489 149977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 151138 150566 gene locus_tag LOCUS_02780 151138 150566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 151566 151255 gene locus_tag LOCUS_02790 151566 151255 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_02790 151646 151722 gene locus_tag LOCUS_t00120 151646 151722 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 151912 152349 gene locus_tag LOCUS_02800 151912 152349 CDS product radical SAM mobile pair system MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679434.1 protein_id gnl|my_center|LOCUS_02800 152346 153035 gene locus_tag LOCUS_02810 152346 153035 CDS product radical SAM mobile pair protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679436.1 protein_id gnl|my_center|LOCUS_02810 153023 153931 gene locus_tag LOCUS_02820 153023 153931 CDS product radical SAM mobile pair protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679438.1 protein_id gnl|my_center|LOCUS_02820 155910 154066 gene locus_tag LOCUS_02830 155910 154066 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_02830 157655 155910 gene locus_tag LOCUS_02840 157655 155910 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364705.1 protein_id gnl|my_center|LOCUS_02840 159548 157656 gene locus_tag LOCUS_02850 159548 157656 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729311.1 protein_id gnl|my_center|LOCUS_02850 160399 159548 gene locus_tag LOCUS_02860 160399 159548 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438990.1 protein_id gnl|my_center|LOCUS_02860 161627 160401 gene locus_tag LOCUS_02870 gene coaBC 161627 160401 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967219.1 protein_id gnl|my_center|LOCUS_02870 162361 161642 gene locus_tag LOCUS_02880 162361 161642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 163607 162459 gene locus_tag LOCUS_02890 gene nifS 163607 162459 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_02890 164348 163674 gene locus_tag LOCUS_02900 gene rpe 164348 163674 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_02900 165368 164358 gene locus_tag LOCUS_02910 165368 164358 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357312.1 protein_id gnl|my_center|LOCUS_02910 166033 165371 gene locus_tag LOCUS_02920 gene plsY 166033 165371 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383394.1 protein_id gnl|my_center|LOCUS_02920 167358 166033 gene locus_tag LOCUS_02930 gene der 167358 166033 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460200.1 protein_id gnl|my_center|LOCUS_02930 168787 167405 gene locus_tag LOCUS_02940 168787 167405 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903281.1 protein_id gnl|my_center|LOCUS_02940 169643 168789 gene locus_tag LOCUS_02950 gene ispH 169643 168789 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881128.1 protein_id gnl|my_center|LOCUS_02950 171191 169647 gene locus_tag LOCUS_02960 171191 169647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 171901 171191 gene locus_tag LOCUS_02970 171901 171191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 172805 171966 gene locus_tag LOCUS_02980 172805 171966 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_02980 173483 172809 gene locus_tag LOCUS_02990 gene scpB 173483 172809 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027964.1 protein_id gnl|my_center|LOCUS_02990 174416 173487 gene locus_tag LOCUS_03000 174416 173487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 175096 174416 gene locus_tag LOCUS_03010 175096 174416 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_03010 177211 175193 gene locus_tag LOCUS_03020 177211 175193 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_03020 178274 177306 gene locus_tag LOCUS_03030 178274 177306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence03 765 259 gene locus_tag LOCUS_03040 765 259 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392625.1 protein_id gnl|my_center|LOCUS_03040 919 995 gene locus_tag LOCUS_t00130 919 995 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1084 1159 gene locus_tag LOCUS_t00140 1084 1159 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1385 2524 gene locus_tag LOCUS_03050 1385 2524 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067486.1 protein_id gnl|my_center|LOCUS_03050 2664 4373 gene locus_tag LOCUS_03060 2664 4373 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084161.1 protein_id gnl|my_center|LOCUS_03060 4377 5456 gene locus_tag LOCUS_03070 4377 5456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_03070 5580 6038 gene locus_tag LOCUS_03080 5580 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 6166 8004 gene locus_tag LOCUS_03090 gene typA 6166 8004 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_03090 8926 8183 gene locus_tag LOCUS_03100 8926 8183 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924376.1 protein_id gnl|my_center|LOCUS_03100 9053 9143 gene locus_tag LOCUS_t00150 9053 9143 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9182 9272 gene locus_tag LOCUS_t00160 9182 9272 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9392 10804 gene locus_tag LOCUS_03110 9392 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 11112 11405 gene locus_tag LOCUS_03120 gene rpsF 11112 11405 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048444.1 protein_id gnl|my_center|LOCUS_03120 11458 11910 gene locus_tag LOCUS_03130 11458 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 11959 12231 gene locus_tag LOCUS_03140 gene rpsR 11959 12231 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003949403.1 protein_id gnl|my_center|LOCUS_03140 12264 13322 gene locus_tag LOCUS_03150 12264 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 13355 13879 gene locus_tag LOCUS_03160 gene rplI 13355 13879 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869406.1 protein_id gnl|my_center|LOCUS_03160 14380 15819 gene locus_tag LOCUS_03170 gene dnaB 14380 15819 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938258.1 protein_id gnl|my_center|LOCUS_03170 15961 17241 gene locus_tag LOCUS_03180 15961 17241 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975310.1 protein_id gnl|my_center|LOCUS_03180 17245 19359 gene locus_tag LOCUS_03190 17245 19359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 19374 20219 gene locus_tag LOCUS_03200 19374 20219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 20226 22082 gene locus_tag LOCUS_03210 20226 22082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459675.1 protein_id gnl|my_center|LOCUS_03210 22282 23187 gene locus_tag LOCUS_03220 22282 23187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 24615 23746 gene locus_tag LOCUS_03230 24615 23746 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813634.1 protein_id gnl|my_center|LOCUS_03230 24732 25193 gene locus_tag LOCUS_03240 gene purE 24732 25193 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_03240 25464 26402 gene locus_tag LOCUS_03250 25464 26402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 26612 28105 gene locus_tag LOCUS_03260 gene purF 26612 28105 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804524.1 protein_id gnl|my_center|LOCUS_03260 28117 29205 gene locus_tag LOCUS_03270 gene purM 28117 29205 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461474.1 protein_id gnl|my_center|LOCUS_03270 29195 29809 gene locus_tag LOCUS_03280 gene purN 29195 29809 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_03280 29810 30943 gene locus_tag LOCUS_03290 29810 30943 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510611.1 protein_id gnl|my_center|LOCUS_03290 31373 30960 gene locus_tag LOCUS_03300 31373 30960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 31715 31431 gene locus_tag LOCUS_03310 31715 31431 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 protein_id gnl|my_center|LOCUS_03310 31912 31784 gene locus_tag LOCUS_03320 31912 31784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 32062 32685 gene locus_tag LOCUS_03330 32062 32685 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_03330 32678 33673 gene locus_tag LOCUS_03340 32678 33673 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966374.1 protein_id gnl|my_center|LOCUS_03340 33677 34354 gene locus_tag LOCUS_03350 gene trmL 33677 34354 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886453.1 protein_id gnl|my_center|LOCUS_03350 34759 34496 gene locus_tag LOCUS_03360 34759 34496 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680497.1 protein_id gnl|my_center|LOCUS_03360 37415 34836 gene locus_tag LOCUS_03370 37415 34836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 38573 37584 gene locus_tag LOCUS_03380 38573 37584 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792121.1 protein_id gnl|my_center|LOCUS_03380 39268 38660 gene locus_tag LOCUS_03390 39268 38660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 40147 39380 gene locus_tag LOCUS_03400 40147 39380 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614984.1 protein_id gnl|my_center|LOCUS_03400 40969 40244 gene locus_tag LOCUS_03410 40969 40244 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994066.1 protein_id gnl|my_center|LOCUS_03410 41140 41409 gene locus_tag LOCUS_03420 41140 41409 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041497.1 protein_id gnl|my_center|LOCUS_03420 42146 41373 gene locus_tag LOCUS_03430 42146 41373 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965767.1 protein_id gnl|my_center|LOCUS_03430 43908 42460 gene locus_tag LOCUS_03440 43908 42460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000398313.1 protein_id gnl|my_center|LOCUS_03440 44594 43920 gene locus_tag LOCUS_03450 44594 43920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 44940 44677 gene locus_tag LOCUS_03460 44940 44677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 45888 45388 gene locus_tag LOCUS_03470 45888 45388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679772.1 protein_id gnl|my_center|LOCUS_03470 47498 46233 gene locus_tag LOCUS_03480 gene rlmD 47498 46233 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922404.1 protein_id gnl|my_center|LOCUS_03480 47669 48637 gene locus_tag LOCUS_03490 47669 48637 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476460.1 protein_id gnl|my_center|LOCUS_03490 49310 50302 gene locus_tag LOCUS_03500 49310 50302 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_03500 50320 50520 gene locus_tag LOCUS_03510 50320 50520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036334.1 protein_id gnl|my_center|LOCUS_03510 50522 51823 gene locus_tag LOCUS_03520 50522 51823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 51826 53670 gene locus_tag LOCUS_03530 51826 53670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 53945 56020 gene locus_tag LOCUS_03540 gene fusA 53945 56020 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546422.1 protein_id gnl|my_center|LOCUS_03540 56538 56377 gene locus_tag LOCUS_03550 56538 56377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 57252 56992 gene locus_tag LOCUS_03560 57252 56992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 57878 57366 gene locus_tag LOCUS_03570 gene rnhA 57878 57366 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368126.1 protein_id gnl|my_center|LOCUS_03570 60651 57913 gene locus_tag LOCUS_03580 gene polA 60651 57913 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_03580 60895 62988 gene locus_tag LOCUS_03590 60895 62988 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965946.1 protein_id gnl|my_center|LOCUS_03590 64393 63107 gene locus_tag LOCUS_03600 64393 63107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 64593 64438 gene locus_tag LOCUS_03610 64593 64438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03610 65015 64620 gene locus_tag LOCUS_03620 65015 64620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03620 65121 66086 gene locus_tag LOCUS_03630 65121 66086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 66589 66221 gene locus_tag LOCUS_03640 66589 66221 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_03640 66792 66610 gene locus_tag LOCUS_03650 66792 66610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 68980 66863 gene locus_tag LOCUS_03660 gene ligA 68980 66863 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002323115.1 protein_id gnl|my_center|LOCUS_03660 72079 69035 gene locus_tag LOCUS_03670 72079 69035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 75492 72160 gene locus_tag LOCUS_03680 75492 72160 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721622.1 protein_id gnl|my_center|LOCUS_03680 76196 75495 gene locus_tag LOCUS_03690 76196 75495 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_03690 76859 76254 gene locus_tag LOCUS_03700 76859 76254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 77130 76909 gene locus_tag LOCUS_03710 77130 76909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 78463 77120 gene locus_tag LOCUS_03720 78463 77120 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102011.1 protein_id gnl|my_center|LOCUS_03720 79039 78467 gene locus_tag LOCUS_03730 79039 78467 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_03730 79640 79182 gene locus_tag LOCUS_03740 79640 79182 CDS product fructose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358680.1 protein_id gnl|my_center|LOCUS_03740 80927 79734 gene locus_tag LOCUS_03750 80927 79734 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_03750 81847 80963 gene locus_tag LOCUS_03760 81847 80963 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808296.1 protein_id gnl|my_center|LOCUS_03760 82050 82997 gene locus_tag LOCUS_03770 82050 82997 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679579.1 protein_id gnl|my_center|LOCUS_03770 83610 83068 gene locus_tag LOCUS_03780 gene nrdG 83610 83068 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262378.1 protein_id gnl|my_center|LOCUS_03780 85946 83724 gene locus_tag LOCUS_03790 gene nrdD 85946 83724 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_03790 87359 86370 gene locus_tag LOCUS_03800 87359 86370 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814104.1 protein_id gnl|my_center|LOCUS_03800 87433 88599 gene locus_tag LOCUS_03810 87433 88599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 89734 88694 gene locus_tag LOCUS_03820 89734 88694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 90647 89907 gene locus_tag LOCUS_03830 90647 89907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 91741 90845 gene locus_tag LOCUS_03840 gene truA 91741 90845 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098140.1 protein_id gnl|my_center|LOCUS_03840 92647 91871 gene locus_tag LOCUS_03850 92647 91871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 94352 92640 gene locus_tag LOCUS_03860 94352 92640 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_03860 94911 94426 gene locus_tag LOCUS_03870 gene rplQ 94911 94426 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819143.1 protein_id gnl|my_center|LOCUS_03870 95886 94945 gene locus_tag LOCUS_03880 95886 94945 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 protein_id gnl|my_center|LOCUS_03880 96504 95911 gene locus_tag LOCUS_03890 gene rpsD 96504 95911 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_03890 96923 96522 gene locus_tag LOCUS_03900 gene rpsK 96923 96522 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_03900 97306 96938 gene locus_tag LOCUS_03910 gene rpsM 97306 96938 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_03910 97800 97582 gene locus_tag LOCUS_03920 gene infA 97800 97582 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_03920 98702 97914 gene locus_tag LOCUS_03930 gene map 98702 97914 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_03930 99325 98699 gene locus_tag LOCUS_03940 99325 98699 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_03940 100673 99393 gene locus_tag LOCUS_03950 gene secY 100673 99393 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869909.1 protein_id gnl|my_center|LOCUS_03950 101119 100673 gene locus_tag LOCUS_03960 gene rplO 101119 100673 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567527.1 protein_id gnl|my_center|LOCUS_03960 101316 101131 gene locus_tag LOCUS_03970 gene rpmD 101316 101131 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_03970 101840 101319 gene locus_tag LOCUS_03980 gene rpsE 101840 101319 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854347.1 protein_id gnl|my_center|LOCUS_03980 102218 101850 gene locus_tag LOCUS_03990 gene rplR 102218 101850 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_03990 102823 102287 gene locus_tag LOCUS_04000 gene rplF 102823 102287 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_04000 103249 102851 gene locus_tag LOCUS_04010 gene rpsH 103249 102851 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854344.1 protein_id gnl|my_center|LOCUS_04010 103524 103339 gene locus_tag LOCUS_04020 103524 103339 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010550318.1 protein_id gnl|my_center|LOCUS_04020 104209 103649 gene locus_tag LOCUS_04030 gene rplE 104209 103649 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403660.1 protein_id gnl|my_center|LOCUS_04030 104831 104514 gene locus_tag LOCUS_04040 gene rplX 104831 104514 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_04040 105211 104843 gene locus_tag LOCUS_04050 gene rplN 105211 104843 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829893.1 protein_id gnl|my_center|LOCUS_04050 105588 105322 gene locus_tag LOCUS_04060 gene rpsQ 105588 105322 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_04060 105821 105606 gene locus_tag LOCUS_04070 gene rpmC 105821 105606 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258239.1 protein_id gnl|my_center|LOCUS_04070 106246 105821 gene locus_tag LOCUS_04080 gene rplP 106246 105821 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225801.1 protein_id gnl|my_center|LOCUS_04080 106956 106246 gene locus_tag LOCUS_04090 gene rpsC 106956 106246 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080488.1 protein_id gnl|my_center|LOCUS_04090 107321 106959 gene locus_tag LOCUS_04100 gene rplV 107321 106959 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156475.1 protein_id gnl|my_center|LOCUS_04100 107596 107336 gene locus_tag LOCUS_04110 gene rpsS 107596 107336 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_04110 108454 107618 gene locus_tag LOCUS_04120 gene rplB 108454 107618 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225795.1 protein_id gnl|my_center|LOCUS_04120 108892 108593 gene locus_tag LOCUS_04130 gene rplW 108892 108593 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879929.1 protein_id gnl|my_center|LOCUS_04130 109518 108892 gene locus_tag LOCUS_04140 gene rplD 109518 108892 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024827.1 protein_id gnl|my_center|LOCUS_04140 110178 109558 gene locus_tag LOCUS_04150 gene rplC 110178 109558 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184218.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence04 569 177 gene locus_tag LOCUS_04160 569 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 775 701 gene locus_tag LOCUS_t00170 775 701 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1214 807 gene locus_tag LOCUS_04170 1214 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 1672 1295 gene locus_tag LOCUS_04180 1672 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 1888 1813 gene locus_tag LOCUS_t00180 1888 1813 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2004 1929 gene locus_tag LOCUS_t00190 2004 1929 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2156 2944 gene locus_tag LOCUS_04190 2156 2944 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_04190 4677 2962 gene locus_tag LOCUS_04200 4677 2962 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_04200 5791 4718 gene locus_tag LOCUS_04210 gene ispG 5791 4718 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_04210 7164 5800 gene locus_tag LOCUS_04220 gene rseP 7164 5800 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906325.1 protein_id gnl|my_center|LOCUS_04220 8359 7172 gene locus_tag LOCUS_04230 8359 7172 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839296.1 protein_id gnl|my_center|LOCUS_04230 9391 8363 gene locus_tag LOCUS_04240 9391 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 10170 9391 gene locus_tag LOCUS_04250 10170 9391 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541499.1 protein_id gnl|my_center|LOCUS_04250 10716 10171 gene locus_tag LOCUS_04260 gene frr 10716 10171 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430598.1 protein_id gnl|my_center|LOCUS_04260 11540 10716 gene locus_tag LOCUS_04270 gene pyrH 11540 10716 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_04270 12442 11570 gene locus_tag LOCUS_04280 gene tsf 12442 11570 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933440.1 protein_id gnl|my_center|LOCUS_04280 13237 12497 gene locus_tag LOCUS_04290 gene rpsB 13237 12497 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268484.1 protein_id gnl|my_center|LOCUS_04290 14435 13509 gene locus_tag LOCUS_04300 gene xerD 14435 13509 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765876.1 protein_id gnl|my_center|LOCUS_04300 15762 14428 gene locus_tag LOCUS_04310 gene trmFO 15762 14428 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_04310 16655 15780 gene locus_tag LOCUS_04320 gene dprA 16655 15780 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870090.1 protein_id gnl|my_center|LOCUS_04320 18154 16658 gene locus_tag LOCUS_04330 18154 16658 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_04330 18669 18151 gene locus_tag LOCUS_04340 18669 18151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 19655 18882 gene locus_tag LOCUS_04350 19655 18882 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296990.1 protein_id gnl|my_center|LOCUS_04350 20071 19730 gene locus_tag LOCUS_04360 gene rplS 20071 19730 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813207.1 protein_id gnl|my_center|LOCUS_04360 21243 20185 gene locus_tag LOCUS_04370 21243 20185 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_04370 24120 21358 gene locus_tag LOCUS_04380 gene ppdK 24120 21358 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_04380 24797 24402 gene locus_tag LOCUS_04390 24797 24402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 26946 24859 gene locus_tag LOCUS_04400 gene glyS 26946 24859 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392141.1 protein_id gnl|my_center|LOCUS_04400 27861 26947 gene locus_tag LOCUS_04410 gene glyQ 27861 26947 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_04410 28449 27895 gene locus_tag LOCUS_04420 gene lepB 28449 27895 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_04420 29191 28442 gene locus_tag LOCUS_04430 gene trmD 29191 28442 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_04430 29651 29193 gene locus_tag LOCUS_04440 29651 29193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 30019 29717 gene locus_tag LOCUS_04450 30019 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 30391 30023 gene locus_tag LOCUS_04460 30391 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 30531 31913 gene locus_tag LOCUS_04470 gene dinB 30531 31913 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_04470 32400 31924 gene locus_tag LOCUS_04480 32400 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 33068 32430 gene locus_tag LOCUS_04490 gene yqeK 33068 32430 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431048.1 protein_id gnl|my_center|LOCUS_04490 33859 33173 gene locus_tag LOCUS_04500 gene nadD 33859 33173 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390005.1 protein_id gnl|my_center|LOCUS_04500 35311 33863 gene locus_tag LOCUS_04510 gene obgE 35311 33863 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_04510 36130 35381 gene locus_tag LOCUS_04520 36130 35381 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399515.1 protein_id gnl|my_center|LOCUS_04520 38048 36123 gene locus_tag LOCUS_04530 38048 36123 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574971.1 protein_id gnl|my_center|LOCUS_04530 38677 38084 gene locus_tag LOCUS_04540 38677 38084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399514.1 protein_id gnl|my_center|LOCUS_04540 39325 39071 gene locus_tag LOCUS_04550 gene rpmA 39325 39071 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896001.1 protein_id gnl|my_center|LOCUS_04550 39714 39364 gene locus_tag LOCUS_04560 gene rplU 39714 39364 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896002.1 protein_id gnl|my_center|LOCUS_04560 40731 39910 gene locus_tag LOCUS_04570 40731 39910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 42593 40728 gene locus_tag LOCUS_04580 42593 40728 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542452.1 protein_id gnl|my_center|LOCUS_04580 43599 42607 gene locus_tag LOCUS_04590 43599 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 44829 43603 gene locus_tag LOCUS_04600 gene rodA 44829 43603 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976192.1 protein_id gnl|my_center|LOCUS_04600 46854 44845 gene locus_tag LOCUS_04610 gene mrdA 46854 44845 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_04610 47424 46864 gene locus_tag LOCUS_04620 47424 46864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 48525 47434 gene locus_tag LOCUS_04630 48525 47434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 49571 48528 gene locus_tag LOCUS_04640 49571 48528 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107906544.1 protein_id gnl|my_center|LOCUS_04640 51045 49642 gene locus_tag LOCUS_04650 51045 49642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 51616 51077 gene locus_tag LOCUS_04660 51616 51077 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403256.1 protein_id gnl|my_center|LOCUS_04660 52875 51754 gene locus_tag LOCUS_04670 52875 51754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 55353 52909 gene locus_tag LOCUS_04680 55353 52909 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_04680 55470 55394 gene locus_tag LOCUS_t00200 55470 55394 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 55582 56661 gene locus_tag LOCUS_04690 gene aroB 55582 56661 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_04690 57284 56658 gene locus_tag LOCUS_04700 gene eda 57284 56658 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775173.1 protein_id gnl|my_center|LOCUS_04700 57387 58667 gene locus_tag LOCUS_04710 gene aroA 57387 58667 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_04710 58668 59810 gene locus_tag LOCUS_04720 gene aroC 58668 59810 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_04720 59803 60075 gene locus_tag LOCUS_04730 59803 60075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 60065 61369 gene locus_tag LOCUS_04740 60065 61369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 61556 62446 gene locus_tag LOCUS_04750 61556 62446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 63093 62512 gene locus_tag LOCUS_04760 63093 62512 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834333.1 protein_id gnl|my_center|LOCUS_04760 63468 65624 gene locus_tag LOCUS_04770 gene pflB 63468 65624 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894660.1 protein_id gnl|my_center|LOCUS_04770 65690 65941 gene locus_tag LOCUS_04780 65690 65941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 65955 66752 gene locus_tag LOCUS_04790 gene pflA 65955 66752 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860950.1 protein_id gnl|my_center|LOCUS_04790 70506 67123 gene locus_tag LOCUS_04800 70506 67123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 70953 72002 gene locus_tag LOCUS_04810 gene trpS 70953 72002 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815099.1 protein_id gnl|my_center|LOCUS_04810 72003 73334 gene locus_tag LOCUS_04820 gene rlmD 72003 73334 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143127.1 protein_id gnl|my_center|LOCUS_04820 73378 74367 gene locus_tag LOCUS_04830 73378 74367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 74540 74836 gene locus_tag LOCUS_04840 74540 74836 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004133089.1 protein_id gnl|my_center|LOCUS_04840 74837 75055 gene locus_tag LOCUS_04850 74837 75055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 74967 75173 gene locus_tag LOCUS_04860 74967 75173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 75815 75309 gene locus_tag LOCUS_04870 75815 75309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 76135 75977 gene locus_tag LOCUS_04880 76135 75977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 78102 76366 gene locus_tag LOCUS_04890 78102 76366 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462084.1 protein_id gnl|my_center|LOCUS_04890 79813 78095 gene locus_tag LOCUS_04900 79813 78095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462083.1 protein_id gnl|my_center|LOCUS_04900 80477 79887 gene locus_tag LOCUS_04910 80477 79887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 80957 81142 gene locus_tag LOCUS_04920 80957 81142 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811990.1 protein_id gnl|my_center|LOCUS_04920 81251 81913 gene locus_tag LOCUS_04930 81251 81913 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226275.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence05 <1 950 gene locus_tag LOCUS_04940 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986283.1:iron-containing alcohol dehydrogenase 1516 2544 gene locus_tag LOCUS_04950 1516 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2714 3355 gene locus_tag LOCUS_04960 gene deoC 2714 3355 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001017446.1 protein_id gnl|my_center|LOCUS_04960 4433 3489 gene locus_tag LOCUS_04970 4433 3489 CDS product YjjW family glycine radical enzyme activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064935.1 protein_id gnl|my_center|LOCUS_04970 5955 4453 gene locus_tag LOCUS_04980 5955 4453 CDS product YjjI family glycine radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099547.1 protein_id gnl|my_center|LOCUS_04980 6835 6104 gene locus_tag LOCUS_04990 6835 6104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 8571 7645 gene locus_tag LOCUS_05000 8571 7645 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_05000 9744 8662 gene locus_tag LOCUS_05010 9744 8662 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948815.1 protein_id gnl|my_center|LOCUS_05010 10127 11317 gene locus_tag LOCUS_05020 10127 11317 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082794.1 protein_id gnl|my_center|LOCUS_05020 11317 12027 gene locus_tag LOCUS_05030 gene deoD 11317 12027 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829961.1 protein_id gnl|my_center|LOCUS_05030 12191 13267 gene locus_tag LOCUS_05040 gene nupN 12191 13267 CDS product guanosine ABC transporter substrate-binding protein NupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228831.1 protein_id gnl|my_center|LOCUS_05040 13415 14944 gene locus_tag LOCUS_05050 13415 14944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_05050 14941 16143 gene locus_tag LOCUS_05060 14941 16143 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_05060 16133 17056 gene locus_tag LOCUS_05070 16133 17056 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008856.1 protein_id gnl|my_center|LOCUS_05070 17056 17604 gene locus_tag LOCUS_05080 17056 17604 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086294.1 protein_id gnl|my_center|LOCUS_05080 17787 19112 gene locus_tag LOCUS_05090 17787 19112 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_05090 20008 20715 gene locus_tag LOCUS_05100 20008 20715 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205505.1 protein_id gnl|my_center|LOCUS_05100 20708 25462 gene locus_tag LOCUS_05110 20708 25462 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002352208.1 protein_id gnl|my_center|LOCUS_05110 27684 26029 gene locus_tag LOCUS_05120 gene sacA 27684 26029 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886636.1 protein_id gnl|my_center|LOCUS_05120 27904 29166 gene locus_tag LOCUS_05130 gene pepT 27904 29166 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437954.1 protein_id gnl|my_center|LOCUS_05130 29352 29894 gene locus_tag LOCUS_05140 29352 29894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 30050 30910 gene locus_tag LOCUS_05150 30050 30910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 30912 31709 gene locus_tag LOCUS_05160 30912 31709 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861671.1 protein_id gnl|my_center|LOCUS_05160 31798 31873 gene locus_tag LOCUS_t00210 31798 31873 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 31924 32727 gene locus_tag LOCUS_05170 gene rph 31924 32727 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247089.1 protein_id gnl|my_center|LOCUS_05170 32730 33380 gene locus_tag LOCUS_05180 gene rdgB 32730 33380 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694045.1 protein_id gnl|my_center|LOCUS_05180 33711 34445 gene locus_tag LOCUS_05190 gene nagB 33711 34445 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868991.1 protein_id gnl|my_center|LOCUS_05190 35346 34609 gene locus_tag LOCUS_05200 35346 34609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 35652 35942 gene locus_tag LOCUS_05210 35652 35942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 35980 36903 gene locus_tag LOCUS_05220 35980 36903 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229975.1 protein_id gnl|my_center|LOCUS_05220 36964 37040 gene locus_tag LOCUS_t00220 36964 37040 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 37923 39392 gene locus_tag LOCUS_05230 37923 39392 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775482.1 protein_id gnl|my_center|LOCUS_05230 39564 39848 gene locus_tag LOCUS_05240 39564 39848 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098120.1 protein_id gnl|my_center|LOCUS_05240 39949 40770 gene locus_tag LOCUS_05250 39949 40770 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_05250 40772 41713 gene locus_tag LOCUS_05260 40772 41713 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430702.1 protein_id gnl|my_center|LOCUS_05260 44814 42343 gene locus_tag LOCUS_05270 44814 42343 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112522.1 protein_id gnl|my_center|LOCUS_05270 46529 45363 gene locus_tag LOCUS_05280 46529 45363 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521613.1 protein_id gnl|my_center|LOCUS_05280 46718 48082 gene locus_tag LOCUS_05290 46718 48082 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461680.1 protein_id gnl|my_center|LOCUS_05290 49329 48187 gene locus_tag LOCUS_05300 49329 48187 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016646.1 protein_id gnl|my_center|LOCUS_05300 50490 49432 gene locus_tag LOCUS_05310 50490 49432 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874921.1 protein_id gnl|my_center|LOCUS_05310 51518 53755 gene locus_tag LOCUS_05320 51518 53755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 53748 54533 gene locus_tag LOCUS_05330 53748 54533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 54573 55934 gene locus_tag LOCUS_05340 54573 55934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 55934 56176 gene locus_tag LOCUS_05350 55934 56176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 56284 56087 gene locus_tag LOCUS_05360 56284 56087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 56939 56454 gene locus_tag LOCUS_05370 56939 56454 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459155.1 protein_id gnl|my_center|LOCUS_05370 57707 57144 gene locus_tag LOCUS_05380 57707 57144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 58437 57820 gene locus_tag LOCUS_05390 58437 57820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 59421 58678 gene locus_tag LOCUS_05400 59421 58678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 59670 60059 gene locus_tag LOCUS_05410 59670 60059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 60246 60064 gene locus_tag LOCUS_05420 60246 60064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 60364 62709 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttgattaccgtacgatctcccaggtagtaaaat 62959 63849 gene locus_tag LOCUS_05430 gene cas1 62959 63849 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_05430 63858 64178 gene locus_tag LOCUS_05440 gene cas2 63858 64178 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263547.1 protein_id gnl|my_center|LOCUS_05440 67240 64157 gene locus_tag LOCUS_05450 gene cas9 67240 64157 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_05450 69035 67440 gene locus_tag LOCUS_05460 69035 67440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 69021 69173 gene locus_tag LOCUS_05470 69021 69173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 69828 69250 gene locus_tag LOCUS_05480 69828 69250 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000158722.1 protein_id gnl|my_center|LOCUS_05480 70923 69973 gene locus_tag LOCUS_05490 70923 69973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 71909 70974 gene locus_tag LOCUS_05500 71909 70974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 72910 71957 gene locus_tag LOCUS_05510 72910 71957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 73039 73638 gene locus_tag LOCUS_05520 73039 73638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 >Feature sequence06 152 499 gene locus_tag LOCUS_05530 152 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05530 3037 782 gene locus_tag LOCUS_05540 3037 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3185 3586 gene locus_tag LOCUS_05550 3185 3586 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_05550 4058 4132 gene locus_tag LOCUS_t00230 4058 4132 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4299 5576 gene locus_tag LOCUS_05560 4299 5576 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_05560 5625 5700 gene locus_tag LOCUS_t00240 5625 5700 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5769 7115 gene locus_tag LOCUS_05570 gene purB 5769 7115 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817240.1 protein_id gnl|my_center|LOCUS_05570 7119 8330 gene locus_tag LOCUS_05580 7119 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 8431 9144 gene locus_tag LOCUS_05590 8431 9144 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_05590 9156 10661 gene locus_tag LOCUS_05600 9156 10661 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_05600 10737 11633 gene locus_tag LOCUS_05610 10737 11633 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_05610 11620 12246 gene locus_tag LOCUS_05620 11620 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 12329 12404 gene locus_tag LOCUS_t00250 12329 12404 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 15000 13075 gene locus_tag LOCUS_05630 gene pknB 15000 13075 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776674.1 protein_id gnl|my_center|LOCUS_05630 17965 15101 gene locus_tag LOCUS_05640 17965 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 19227 17968 gene locus_tag LOCUS_05650 19227 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 19648 19235 gene locus_tag LOCUS_05660 19648 19235 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811806.1 protein_id gnl|my_center|LOCUS_05660 20772 19648 gene locus_tag LOCUS_05670 20772 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 22555 20759 gene locus_tag LOCUS_05680 22555 20759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 22689 22775 gene locus_tag LOCUS_t00260 22689 22775 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23034 22816 gene locus_tag LOCUS_05690 23034 22816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 23145 24428 gene locus_tag LOCUS_05700 gene serS 23145 24428 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_05700 24570 24890 gene locus_tag LOCUS_05710 24570 24890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 25002 24926 gene locus_tag LOCUS_t00270 25002 24926 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25383 25078 gene locus_tag LOCUS_05720 25383 25078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 25604 25514 gene locus_tag LOCUS_t00280 25604 25514 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 26595 25660 gene locus_tag LOCUS_05730 26595 25660 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993597.1 protein_id gnl|my_center|LOCUS_05730 27227 26598 gene locus_tag LOCUS_05740 27227 26598 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476018.1 protein_id gnl|my_center|LOCUS_05740 27368 28957 gene locus_tag LOCUS_05750 gene purH 27368 28957 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_05750 29010 29672 gene locus_tag LOCUS_05760 29010 29672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 30067 33621 gene locus_tag LOCUS_05770 gene nifJ 30067 33621 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_05770 33770 35182 gene locus_tag LOCUS_05780 33770 35182 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830445.1 protein_id gnl|my_center|LOCUS_05780 35175 35921 gene locus_tag LOCUS_05790 35175 35921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 36006 36629 gene locus_tag LOCUS_05800 36006 36629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 36729 37976 gene locus_tag LOCUS_05810 36729 37976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 38016 38738 gene locus_tag LOCUS_05820 38016 38738 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393659.1 protein_id gnl|my_center|LOCUS_05820 38790 39287 gene locus_tag LOCUS_05830 38790 39287 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762812.1 protein_id gnl|my_center|LOCUS_05830 39963 39247 gene locus_tag LOCUS_05840 gene pgpB 39963 39247 CDS product phosphatidylglycerophosphatase PgpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399336.1 protein_id gnl|my_center|LOCUS_05840 40374 40057 gene locus_tag LOCUS_05850 gene trxA 40374 40057 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693835.1 protein_id gnl|my_center|LOCUS_05850 40527 41054 gene locus_tag LOCUS_05860 40527 41054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 41151 42857 gene locus_tag LOCUS_05870 gene pgi 41151 42857 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 protein_id gnl|my_center|LOCUS_05870 43089 43775 gene locus_tag LOCUS_05880 43089 43775 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390357.1 protein_id gnl|my_center|LOCUS_05880 45591 43852 gene locus_tag LOCUS_05890 45591 43852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 45806 46873 gene locus_tag LOCUS_05900 gene prfA 45806 46873 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_05900 46886 47779 gene locus_tag LOCUS_05910 gene prmC 46886 47779 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_05910 47889 48536 gene locus_tag LOCUS_05920 47889 48536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 48630 49094 gene locus_tag LOCUS_05930 gene rpiB 48630 49094 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_05930 49218 49862 gene locus_tag LOCUS_05940 gene upp 49218 49862 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_05940 50372 51172 gene locus_tag LOCUS_05950 50372 51172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 51309 51503 gene locus_tag LOCUS_05960 51309 51503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 51546 52157 gene locus_tag LOCUS_05970 51546 52157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 52147 52620 gene locus_tag LOCUS_05980 52147 52620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 52620 54293 gene locus_tag LOCUS_05990 gene atpA 52620 54293 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027518.1 protein_id gnl|my_center|LOCUS_05990 54351 55217 gene locus_tag LOCUS_06000 gene atpG 54351 55217 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244388.1 protein_id gnl|my_center|LOCUS_06000 55217 56698 gene locus_tag LOCUS_06010 gene atpD 55217 56698 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564972.1 protein_id gnl|my_center|LOCUS_06010 56707 57129 gene locus_tag LOCUS_06020 56707 57129 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114076.1 protein_id gnl|my_center|LOCUS_06020 57159 58442 gene locus_tag LOCUS_06030 gene murA 57159 58442 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393852.1 protein_id gnl|my_center|LOCUS_06030 58446 59669 gene locus_tag LOCUS_06040 58446 59669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 59778 60206 gene locus_tag LOCUS_06050 59778 60206 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673217.1 protein_id gnl|my_center|LOCUS_06050 60343 61236 gene locus_tag LOCUS_06060 gene galU 60343 61236 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965632.1 protein_id gnl|my_center|LOCUS_06060 61217 62632 gene locus_tag LOCUS_06070 61217 62632 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_06070 63179 64687 gene locus_tag LOCUS_r00010 63179 64687 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 65245 65445 gene locus_tag LOCUS_06080 65245 65445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence07 3575 138 gene locus_tag LOCUS_06090 3575 138 CDS product bifunctional glycogen debranching protein GlgX/4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460009.1 protein_id gnl|my_center|LOCUS_06090 5077 3578 gene locus_tag LOCUS_06100 gene glgA 5077 3578 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965537.1 protein_id gnl|my_center|LOCUS_06100 6183 5080 gene locus_tag LOCUS_06110 gene glgD 6183 5080 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183792.1 protein_id gnl|my_center|LOCUS_06110 7331 6183 gene locus_tag LOCUS_06120 gene glgC 7331 6183 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_06120 9836 7407 gene locus_tag LOCUS_06130 9836 7407 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272357.1 protein_id gnl|my_center|LOCUS_06130 11838 9823 gene locus_tag LOCUS_06140 gene glgB 11838 9823 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_06140 13407 12181 gene locus_tag LOCUS_06150 13407 12181 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303623.1 protein_id gnl|my_center|LOCUS_06150 14142 13459 gene locus_tag LOCUS_06160 14142 13459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 16678 14219 gene locus_tag LOCUS_06170 gene pheT 16678 14219 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_06170 17776 16709 gene locus_tag LOCUS_06180 gene pheS 17776 16709 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003736387.1 protein_id gnl|my_center|LOCUS_06180 18874 18062 gene locus_tag LOCUS_06190 18874 18062 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815052.1 protein_id gnl|my_center|LOCUS_06190 19729 18875 gene locus_tag LOCUS_06200 19729 18875 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815055.1 protein_id gnl|my_center|LOCUS_06200 20762 19767 gene locus_tag LOCUS_06210 20762 19767 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458890.1 protein_id gnl|my_center|LOCUS_06210 21733 21089 gene locus_tag LOCUS_06220 21733 21089 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262703.1 protein_id gnl|my_center|LOCUS_06220 22181 21738 gene locus_tag LOCUS_06230 22181 21738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 23382 22216 gene locus_tag LOCUS_06240 gene nagA 23382 22216 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357814.1 protein_id gnl|my_center|LOCUS_06240 24606 23440 gene locus_tag LOCUS_06250 24606 23440 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357242.1 protein_id gnl|my_center|LOCUS_06250 25357 24629 gene locus_tag LOCUS_06260 25357 24629 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360115.1 protein_id gnl|my_center|LOCUS_06260 26492 25413 gene locus_tag LOCUS_06270 26492 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 27288 26482 gene locus_tag LOCUS_06280 gene agaW 27288 26482 CDS product PTS N-acetylgalactosamine transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406209.1 protein_id gnl|my_center|LOCUS_06280 27909 27427 gene locus_tag LOCUS_06290 gene agaV 27909 27427 CDS product PTS N-acetylgalactosamine transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387360.1 protein_id gnl|my_center|LOCUS_06290 28295 28005 gene locus_tag LOCUS_06300 28295 28005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 28769 28329 gene locus_tag LOCUS_06310 28769 28329 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361048.1 protein_id gnl|my_center|LOCUS_06310 29307 30242 gene locus_tag LOCUS_06320 gene pfkB 29307 30242 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_06320 30378 31229 gene locus_tag LOCUS_06330 30378 31229 CDS product tagatose-bisphosphate aldolase subunit GatY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_06330 32393 31347 gene locus_tag LOCUS_06340 32393 31347 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_06340 32530 32889 gene locus_tag LOCUS_06350 32530 32889 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563881.1 protein_id gnl|my_center|LOCUS_06350 33718 32909 gene locus_tag LOCUS_06360 gene murI 33718 32909 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966524.1 protein_id gnl|my_center|LOCUS_06360 33831 34259 gene locus_tag LOCUS_06370 33831 34259 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933554.1 protein_id gnl|my_center|LOCUS_06370 35644 34403 gene locus_tag LOCUS_06380 35644 34403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 36862 35801 gene locus_tag LOCUS_06390 36862 35801 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968655.1 protein_id gnl|my_center|LOCUS_06390 37470 36907 gene locus_tag LOCUS_06400 37470 36907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 39713 37608 gene locus_tag LOCUS_06410 39713 37608 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986650.1 protein_id gnl|my_center|LOCUS_06410 40533 39703 gene locus_tag LOCUS_06420 40533 39703 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986651.1 protein_id gnl|my_center|LOCUS_06420 40686 41681 gene locus_tag LOCUS_06430 40686 41681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 42731 41691 gene locus_tag LOCUS_06440 42731 41691 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986639.1 protein_id gnl|my_center|LOCUS_06440 43409 42738 gene locus_tag LOCUS_06450 43409 42738 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986640.1 protein_id gnl|my_center|LOCUS_06450 44450 43431 gene locus_tag LOCUS_06460 44450 43431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 45399 44443 gene locus_tag LOCUS_06470 gene rsmA 45399 44443 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975667.1 protein_id gnl|my_center|LOCUS_06470 47012 45402 gene locus_tag LOCUS_06480 gene metG 47012 45402 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942872.1 protein_id gnl|my_center|LOCUS_06480 47966 47091 gene locus_tag LOCUS_06490 gene rsmI 47966 47091 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905318.1 protein_id gnl|my_center|LOCUS_06490 49006 47966 gene locus_tag LOCUS_06500 49006 47966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 49527 49099 gene locus_tag LOCUS_06510 gene queD 49527 49099 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949100.1 protein_id gnl|my_center|LOCUS_06510 51092 49527 gene locus_tag LOCUS_06520 51092 49527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 52255 51071 gene locus_tag LOCUS_06530 gene holB 52255 51071 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244417.1 protein_id gnl|my_center|LOCUS_06530 52907 52248 gene locus_tag LOCUS_06540 gene tmk 52907 52248 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405407.1 protein_id gnl|my_center|LOCUS_06540 55609 53096 gene locus_tag LOCUS_06550 55609 53096 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902213.1 protein_id gnl|my_center|LOCUS_06550 56431 55643 gene locus_tag LOCUS_06560 gene tatC 56431 55643 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887452.1 protein_id gnl|my_center|LOCUS_06560 57037 56450 gene locus_tag LOCUS_06570 57037 56450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 57423 57112 gene locus_tag LOCUS_06580 57423 57112 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429306.1 protein_id gnl|my_center|LOCUS_06580 58209 57433 gene locus_tag LOCUS_06590 58209 57433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 59689 58298 gene locus_tag LOCUS_06600 59689 58298 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731178.1 protein_id gnl|my_center|LOCUS_06600 59762 60031 gene locus_tag LOCUS_06610 59762 60031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 61432 60056 gene locus_tag LOCUS_06620 gene nhaA 61432 60056 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_06620 61640 62497 gene locus_tag LOCUS_06630 61640 62497 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357950.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence08 237 458 gene locus_tag LOCUS_06640 237 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 463 1746 gene locus_tag LOCUS_06650 463 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 1751 2128 gene locus_tag LOCUS_06660 1751 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2339 2199 gene locus_tag LOCUS_06670 2339 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3189 2353 gene locus_tag LOCUS_06680 3189 2353 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777094.1 protein_id gnl|my_center|LOCUS_06680 3934 3182 gene locus_tag LOCUS_06690 3934 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4730 3942 gene locus_tag LOCUS_06700 4730 3942 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777096.1 protein_id gnl|my_center|LOCUS_06700 4729 5031 gene locus_tag LOCUS_06710 4729 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5348 6100 gene locus_tag LOCUS_06720 5348 6100 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113203.1 protein_id gnl|my_center|LOCUS_06720 6111 7106 gene locus_tag LOCUS_06730 6111 7106 CDS product 2-keto-3-deoxygluconate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113201.1 protein_id gnl|my_center|LOCUS_06730 8429 7620 gene locus_tag LOCUS_06740 8429 7620 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809818.1 protein_id gnl|my_center|LOCUS_06740 8891 10909 gene locus_tag LOCUS_06750 8891 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10902 13055 gene locus_tag LOCUS_06760 10902 13055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 13074 13718 gene locus_tag LOCUS_06770 13074 13718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 14902 14072 gene locus_tag LOCUS_06780 14902 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 15213 14899 gene locus_tag LOCUS_06790 15213 14899 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525795.1 protein_id gnl|my_center|LOCUS_06790 17444 15744 gene locus_tag LOCUS_06800 17444 15744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 17590 18993 gene locus_tag LOCUS_06810 17590 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 19182 21077 gene locus_tag LOCUS_06820 19182 21077 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459352.1 protein_id gnl|my_center|LOCUS_06820 22008 21181 gene locus_tag LOCUS_06830 22008 21181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 22663 22046 gene locus_tag LOCUS_06840 gene yfbR 22663 22046 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813854.1 protein_id gnl|my_center|LOCUS_06840 22944 24191 gene locus_tag LOCUS_06850 22944 24191 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 protein_id gnl|my_center|LOCUS_06850 24316 25461 gene locus_tag LOCUS_06860 gene zinU 24316 25461 CDS product zinc metallochaperone ZinU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234625.1 protein_id gnl|my_center|LOCUS_06860 25543 26394 gene locus_tag LOCUS_06870 25543 26394 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947920.1 protein_id gnl|my_center|LOCUS_06870 28185 26518 gene locus_tag LOCUS_06880 28185 26518 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_06880 28437 29219 gene locus_tag LOCUS_06890 28437 29219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 29209 31020 gene locus_tag LOCUS_06900 29209 31020 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184456.1 protein_id gnl|my_center|LOCUS_06900 31670 33349 gene locus_tag LOCUS_06910 gene ettA 31670 33349 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993639.1 protein_id gnl|my_center|LOCUS_06910 33521 34036 gene locus_tag LOCUS_06920 33521 34036 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_06920 34968 34063 gene locus_tag LOCUS_06930 34968 34063 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272197.1 protein_id gnl|my_center|LOCUS_06930 35994 34972 gene locus_tag LOCUS_06940 gene ansA 35994 34972 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_06940 36145 36618 gene locus_tag LOCUS_06950 36145 36618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 37525 36674 gene locus_tag LOCUS_06960 37525 36674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 39114 37633 gene locus_tag LOCUS_06970 39114 37633 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_06970 39219 39668 gene locus_tag LOCUS_06980 39219 39668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 40176 39736 gene locus_tag LOCUS_06990 gene pth2 40176 39736 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762429.1 protein_id gnl|my_center|LOCUS_06990 40394 40882 gene locus_tag LOCUS_07000 40394 40882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 41551 41970 gene locus_tag LOCUS_07010 41551 41970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 42080 42328 gene locus_tag LOCUS_07020 42080 42328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 42571 43191 gene locus_tag LOCUS_07030 42571 43191 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_07030 43277 43888 gene locus_tag LOCUS_07040 43277 43888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 44064 45062 gene locus_tag LOCUS_07050 gene manA 44064 45062 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244253.1 protein_id gnl|my_center|LOCUS_07050 45162 46340 gene locus_tag LOCUS_07060 45162 46340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 46903 46454 gene locus_tag LOCUS_07070 gene mscL 46903 46454 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814614.1 protein_id gnl|my_center|LOCUS_07070 48521 46965 gene locus_tag LOCUS_07080 gene ypwA 48521 46965 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398513.1 protein_id gnl|my_center|LOCUS_07080 48717 50015 gene locus_tag LOCUS_07090 48717 50015 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_07090 50018 51019 gene locus_tag LOCUS_07100 50018 51019 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_07100 51028 51996 gene locus_tag LOCUS_07110 51028 51996 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965901.1 protein_id gnl|my_center|LOCUS_07110 52241 53746 gene locus_tag LOCUS_07120 52241 53746 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355535.1 protein_id gnl|my_center|LOCUS_07120 53887 54804 gene locus_tag LOCUS_07130 53887 54804 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891391.1 protein_id gnl|my_center|LOCUS_07130 55035 55832 gene locus_tag LOCUS_07140 55035 55832 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113651.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence09 223 375 gene locus_tag LOCUS_07150 223 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1507 404 gene locus_tag LOCUS_07160 1507 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1936 2898 gene locus_tag LOCUS_07170 1936 2898 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836936.1 protein_id gnl|my_center|LOCUS_07170 2916 3524 gene locus_tag LOCUS_07180 2916 3524 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262251.1 protein_id gnl|my_center|LOCUS_07180 3545 4762 gene locus_tag LOCUS_07190 3545 4762 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673653.1 protein_id gnl|my_center|LOCUS_07190 7283 5367 gene locus_tag LOCUS_07200 7283 5367 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_07200 8002 7502 gene locus_tag LOCUS_07210 8002 7502 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680355.1 protein_id gnl|my_center|LOCUS_07210 8291 8980 gene locus_tag LOCUS_07220 8291 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 10306 9098 gene locus_tag LOCUS_07230 10306 9098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_07230 11133 10303 gene locus_tag LOCUS_07240 11133 10303 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_07240 12570 11143 gene locus_tag LOCUS_07250 12570 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 12948 12772 gene locus_tag LOCUS_07260 12948 12772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 12948 13070 gene locus_tag LOCUS_07270 12948 13070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 13281 13565 gene locus_tag LOCUS_07280 13281 13565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07280 13909 13631 gene locus_tag LOCUS_07290 13909 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 14193 13912 gene locus_tag LOCUS_07300 14193 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 14410 15342 gene locus_tag LOCUS_07310 14410 15342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_07310 15329 16102 gene locus_tag LOCUS_07320 15329 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 16119 16859 gene locus_tag LOCUS_07330 16119 16859 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894739.1 protein_id gnl|my_center|LOCUS_07330 18490 17342 gene locus_tag LOCUS_07340 18490 17342 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209169.1 protein_id gnl|my_center|LOCUS_07340 20401 18602 gene locus_tag LOCUS_07350 20401 18602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 22725 20401 gene locus_tag LOCUS_07360 22725 20401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 23843 23496 gene locus_tag LOCUS_07370 23843 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07370 23927 24088 gene locus_tag LOCUS_07380 23927 24088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 24092 24313 gene locus_tag LOCUS_07390 24092 24313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 26329 24389 gene locus_tag LOCUS_07400 gene feoB 26329 24389 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948746.1 protein_id gnl|my_center|LOCUS_07400 26550 26326 gene locus_tag LOCUS_07410 26550 26326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 26698 27741 gene locus_tag LOCUS_07420 26698 27741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 29397 27865 gene locus_tag LOCUS_07430 29397 27865 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_07430 30779 29982 gene locus_tag LOCUS_07440 30779 29982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 31248 32180 gene locus_tag LOCUS_07450 31248 32180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 32887 32333 gene locus_tag LOCUS_07460 32887 32333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 33228 32890 gene locus_tag LOCUS_07470 33228 32890 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184004.1 protein_id gnl|my_center|LOCUS_07470 35229 33400 gene locus_tag LOCUS_07480 gene glmS 35229 33400 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963484.1 protein_id gnl|my_center|LOCUS_07480 35602 36204 gene locus_tag LOCUS_07490 35602 36204 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_07490 36249 36938 gene locus_tag LOCUS_07500 36249 36938 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676089.1 protein_id gnl|my_center|LOCUS_07500 37542 37309 gene locus_tag LOCUS_07510 37542 37309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 37817 38821 gene locus_tag LOCUS_07520 37817 38821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 38814 40565 gene locus_tag LOCUS_07530 38814 40565 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272781.1 protein_id gnl|my_center|LOCUS_07530 41754 40780 gene locus_tag LOCUS_07540 41754 40780 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986747.1 protein_id gnl|my_center|LOCUS_07540 41859 43637 gene locus_tag LOCUS_07550 41859 43637 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948724.1 protein_id gnl|my_center|LOCUS_07550 43644 44681 gene locus_tag LOCUS_07560 43644 44681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07560 44624 45358 gene locus_tag LOCUS_07570 44624 45358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07570 45382 46011 gene locus_tag LOCUS_07580 45382 46011 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_07580 46013 46702 gene locus_tag LOCUS_07590 46013 46702 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986593.1 protein_id gnl|my_center|LOCUS_07590 46702 48267 gene locus_tag LOCUS_07600 46702 48267 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462215.1 protein_id gnl|my_center|LOCUS_07600 48294 48479 gene locus_tag LOCUS_07610 48294 48479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 51695 48729 gene locus_tag LOCUS_07620 51695 48729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence10 804 94 gene locus_tag LOCUS_07630 804 94 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_07630 979 3246 gene locus_tag LOCUS_07640 979 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 6010 3344 gene locus_tag LOCUS_07650 6010 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 6124 6786 gene locus_tag LOCUS_07660 6124 6786 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399526.1 protein_id gnl|my_center|LOCUS_07660 7077 6874 gene locus_tag LOCUS_07670 7077 6874 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719639.1 protein_id gnl|my_center|LOCUS_07670 7423 9276 gene locus_tag LOCUS_07680 7423 9276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 9753 9358 gene locus_tag LOCUS_07690 9753 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 10835 9768 gene locus_tag LOCUS_07700 gene ruvB 10835 9768 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_07700 11467 10835 gene locus_tag LOCUS_07710 gene ruvA 11467 10835 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_07710 11967 11464 gene locus_tag LOCUS_07720 gene ruvC 11967 11464 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_07720 13816 12029 gene locus_tag LOCUS_07730 13816 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 14313 13948 gene locus_tag LOCUS_07740 14313 13948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 18259 14423 gene locus_tag LOCUS_07750 gene dnaE 18259 14423 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804720.1 protein_id gnl|my_center|LOCUS_07750 18586 19944 gene locus_tag LOCUS_07760 18586 19944 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287964.1 protein_id gnl|my_center|LOCUS_07760 20019 21488 gene locus_tag LOCUS_07770 20019 21488 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812447.1 protein_id gnl|my_center|LOCUS_07770 22229 21588 gene locus_tag LOCUS_07780 22229 21588 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249474.1 protein_id gnl|my_center|LOCUS_07780 22781 22251 gene locus_tag LOCUS_07790 22781 22251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 24009 25766 gene locus_tag LOCUS_07800 24009 25766 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107752.1 protein_id gnl|my_center|LOCUS_07800 25996 25811 gene locus_tag LOCUS_07810 25996 25811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 27041 25947 gene locus_tag LOCUS_07820 27041 25947 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986532.1 protein_id gnl|my_center|LOCUS_07820 27252 28559 gene locus_tag LOCUS_07830 27252 28559 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101557.1 protein_id gnl|my_center|LOCUS_07830 28690 29892 gene locus_tag LOCUS_07840 28690 29892 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392801.1 protein_id gnl|my_center|LOCUS_07840 30625 31983 gene locus_tag LOCUS_07850 30625 31983 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594898.1 protein_id gnl|my_center|LOCUS_07850 32030 32893 gene locus_tag LOCUS_07860 32030 32893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 32951 33412 gene locus_tag LOCUS_07870 32951 33412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 33478 34464 gene locus_tag LOCUS_07880 33478 34464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 35938 34586 gene locus_tag LOCUS_07890 35938 34586 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_07890 37825 35939 gene locus_tag LOCUS_07900 37825 35939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 38804 38262 gene locus_tag LOCUS_07910 38804 38262 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985956.1 protein_id gnl|my_center|LOCUS_07910 39130 39040 gene locus_tag LOCUS_t00290 39130 39040 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 39342 39848 gene locus_tag LOCUS_07920 gene tadA 39342 39848 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003247140.1 protein_id gnl|my_center|LOCUS_07920 40357 39863 gene locus_tag LOCUS_07930 40357 39863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 41798 40479 gene locus_tag LOCUS_07940 41798 40479 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_07940 42251 41871 gene locus_tag LOCUS_07950 42251 41871 CDS product DUF1304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015615.1 protein_id gnl|my_center|LOCUS_07950 43663 42296 gene locus_tag LOCUS_07960 43663 42296 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194757.1 protein_id gnl|my_center|LOCUS_07960 43710 44693 gene locus_tag LOCUS_07970 gene metA 43710 44693 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 protein_id gnl|my_center|LOCUS_07970 44823 45383 gene locus_tag LOCUS_07980 gene yfcE 44823 45383 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948679.1 protein_id gnl|my_center|LOCUS_07980 45603 46349 gene locus_tag LOCUS_07990 45603 46349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 46389 48317 gene locus_tag LOCUS_08000 46389 48317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 49823 48447 gene locus_tag LOCUS_08010 49823 48447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 50992 49991 gene locus_tag LOCUS_08020 gene asnA 50992 49991 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427105.1 protein_id gnl|my_center|LOCUS_08020 51276 51707 gene locus_tag LOCUS_08030 51276 51707 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001041890.1 protein_id gnl|my_center|LOCUS_08030 52279 51929 gene locus_tag LOCUS_08040 52279 51929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence11 3504 1870 gene locus_tag LOCUS_08050 gene murJ 3504 1870 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806275.1 protein_id gnl|my_center|LOCUS_08050 4013 3504 gene locus_tag LOCUS_08060 gene ybaK 4013 3504 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_08060 6909 4015 gene locus_tag LOCUS_08070 gene uvrA 6909 4015 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228057.1 protein_id gnl|my_center|LOCUS_08070 7526 7065 gene locus_tag LOCUS_08080 7526 7065 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_08080 7645 8493 gene locus_tag LOCUS_08090 7645 8493 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393156.1 protein_id gnl|my_center|LOCUS_08090 8539 9792 gene locus_tag LOCUS_08100 8539 9792 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_08100 9794 11464 gene locus_tag LOCUS_08110 9794 11464 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905801.1 protein_id gnl|my_center|LOCUS_08110 13701 11461 gene locus_tag LOCUS_08120 gene uvrB 13701 11461 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_08120 13878 15962 gene locus_tag LOCUS_08130 13878 15962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 16600 15986 gene locus_tag LOCUS_08140 gene coaE 16600 15986 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_08140 17241 16612 gene locus_tag LOCUS_08150 17241 16612 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_08150 18002 17238 gene locus_tag LOCUS_08160 18002 17238 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_08160 19161 18145 gene locus_tag LOCUS_08170 19161 18145 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_08170 20357 19296 gene locus_tag LOCUS_08180 20357 19296 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673388.1 protein_id gnl|my_center|LOCUS_08180 21617 20367 gene locus_tag LOCUS_08190 gene pepT 21617 20367 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_08190 22474 21680 gene locus_tag LOCUS_08200 22474 21680 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902127.1 protein_id gnl|my_center|LOCUS_08200 22707 24311 gene locus_tag LOCUS_08210 22707 24311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 25522 24410 gene locus_tag LOCUS_08220 gene appF 25522 24410 CDS product oligopeptide ABC transporter ATP-binding protein AppF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232964.1 protein_id gnl|my_center|LOCUS_08220 26691 25525 gene locus_tag LOCUS_08230 26691 25525 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_08230 27664 26708 gene locus_tag LOCUS_08240 27664 26708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583498.1 protein_id gnl|my_center|LOCUS_08240 28485 27664 gene locus_tag LOCUS_08250 28485 27664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928488.1 protein_id gnl|my_center|LOCUS_08250 30330 28684 gene locus_tag LOCUS_08260 30330 28684 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967051.1 protein_id gnl|my_center|LOCUS_08260 32363 30642 gene locus_tag LOCUS_08270 32363 30642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 33756 32512 gene locus_tag LOCUS_08280 33756 32512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 34404 34012 gene locus_tag LOCUS_08290 34404 34012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 34918 34514 gene locus_tag LOCUS_08300 34918 34514 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666607.1 protein_id gnl|my_center|LOCUS_08300 35749 35003 gene locus_tag LOCUS_08310 35749 35003 CDS product DUF3793 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681044.1 protein_id gnl|my_center|LOCUS_08310 38241 36073 gene locus_tag LOCUS_08320 38241 36073 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860870.1 protein_id gnl|my_center|LOCUS_08320 38547 38245 gene locus_tag LOCUS_08330 38547 38245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 38950 39504 gene locus_tag LOCUS_08340 38950 39504 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_08340 39526 40041 gene locus_tag LOCUS_08350 39526 40041 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288165.1 protein_id gnl|my_center|LOCUS_08350 40049 41221 gene locus_tag LOCUS_08360 40049 41221 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016775.1 protein_id gnl|my_center|LOCUS_08360 44227 41567 gene locus_tag LOCUS_08370 44227 41567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 44472 44227 gene locus_tag LOCUS_08380 44472 44227 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_08380 44808 44542 gene locus_tag LOCUS_08390 44808 44542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 47916 45049 gene locus_tag LOCUS_08400 47916 45049 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 protein_id gnl|my_center|LOCUS_08400 48098 49531 gene locus_tag LOCUS_08410 48098 49531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 49962 49645 gene locus_tag LOCUS_08420 49962 49645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 50156 50081 gene locus_tag LOCUS_t00300 50156 50081 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 <1 960 gene locus_tag LOCUS_08430 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001077794.1:bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL 1078 3360 gene locus_tag LOCUS_08440 1078 3360 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387003.1 protein_id gnl|my_center|LOCUS_08440 4399 3497 gene locus_tag LOCUS_08450 gene ywpJ 4399 3497 CDS product phosphatase YwpJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242946.1 protein_id gnl|my_center|LOCUS_08450 4699 4412 gene locus_tag LOCUS_08460 4699 4412 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_08460 5237 4737 gene locus_tag LOCUS_08470 5237 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 6072 5359 gene locus_tag LOCUS_08480 6072 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 7911 6088 gene locus_tag LOCUS_08490 7911 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 8041 8310 gene locus_tag LOCUS_08500 8041 8310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 8372 8447 gene locus_tag LOCUS_t00310 8372 8447 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10946 8964 gene locus_tag LOCUS_08510 10946 8964 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016920.1 protein_id gnl|my_center|LOCUS_08510 11274 11002 gene locus_tag LOCUS_08520 11274 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 12069 11650 gene locus_tag LOCUS_08530 12069 11650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 14102 12105 gene locus_tag LOCUS_08540 14102 12105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 14601 14125 gene locus_tag LOCUS_08550 14601 14125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 14833 14585 gene locus_tag LOCUS_08560 14833 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 15246 14782 gene locus_tag LOCUS_08570 15246 14782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 15431 15243 gene locus_tag LOCUS_08580 15431 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 16061 15447 gene locus_tag LOCUS_08590 16061 15447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 16993 16058 gene locus_tag LOCUS_08600 16993 16058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 18300 16948 gene locus_tag LOCUS_08610 18300 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 19598 18300 gene locus_tag LOCUS_08620 19598 18300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 20425 19598 gene locus_tag LOCUS_08630 20425 19598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 22015 20831 gene locus_tag LOCUS_08640 gene rsgA 22015 20831 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943166.1 protein_id gnl|my_center|LOCUS_08640 24715 22031 gene locus_tag LOCUS_08650 24715 22031 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643866.1 protein_id gnl|my_center|LOCUS_08650 24991 25995 gene locus_tag LOCUS_08660 24991 25995 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707803.1 protein_id gnl|my_center|LOCUS_08660 26075 27517 gene locus_tag LOCUS_08670 gene pyk 26075 27517 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_08670 29341 27608 gene locus_tag LOCUS_08680 29341 27608 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462084.1 protein_id gnl|my_center|LOCUS_08680 31161 29356 gene locus_tag LOCUS_08690 31161 29356 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462083.1 protein_id gnl|my_center|LOCUS_08690 31478 32020 gene locus_tag LOCUS_08700 31478 32020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459532.1 protein_id gnl|my_center|LOCUS_08700 32074 32778 gene locus_tag LOCUS_08710 32074 32778 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_08710 32876 34129 gene locus_tag LOCUS_08720 32876 34129 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986771.1 protein_id gnl|my_center|LOCUS_08720 35389 34730 gene locus_tag LOCUS_08730 35389 34730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 35931 35614 gene locus_tag LOCUS_08740 35931 35614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 37631 35931 gene locus_tag LOCUS_08750 gene cydC 37631 35931 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667625.1 protein_id gnl|my_center|LOCUS_08750 39367 37631 gene locus_tag LOCUS_08760 39367 37631 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995243.1 protein_id gnl|my_center|LOCUS_08760 40061 39513 gene locus_tag LOCUS_08770 40061 39513 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797752.1 protein_id gnl|my_center|LOCUS_08770 40180 40503 gene locus_tag LOCUS_08780 40180 40503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 41553 40558 gene locus_tag LOCUS_08790 41553 40558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 42815 41688 gene locus_tag LOCUS_08800 42815 41688 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882793.1 protein_id gnl|my_center|LOCUS_08800 43561 42917 gene locus_tag LOCUS_08810 43561 42917 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679500.1 protein_id gnl|my_center|LOCUS_08810 44104 45546 gene locus_tag LOCUS_08820 44104 45546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08820 45739 48132 gene locus_tag LOCUS_08830 45739 48132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08830 49010 48234 gene locus_tag LOCUS_08840 49010 48234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence13 1794 946 gene locus_tag LOCUS_08850 1794 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2615 1929 gene locus_tag LOCUS_08860 2615 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3426 2644 gene locus_tag LOCUS_08870 3426 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 4517 3453 gene locus_tag LOCUS_08880 4517 3453 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_08880 5621 4593 gene locus_tag LOCUS_08890 5621 4593 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459812.1 protein_id gnl|my_center|LOCUS_08890 6201 5611 gene locus_tag LOCUS_08900 gene raiA 6201 5611 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_08900 7274 6339 gene locus_tag LOCUS_08910 7274 6339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 8339 7590 gene locus_tag LOCUS_08920 gene gntX 8339 7590 CDS product DNA utilization protein GntX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038420751.1 protein_id gnl|my_center|LOCUS_08920 9155 8433 gene locus_tag LOCUS_08930 9155 8433 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044887.1 protein_id gnl|my_center|LOCUS_08930 9288 9749 gene locus_tag LOCUS_08940 9288 9749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 11238 9754 gene locus_tag LOCUS_08950 11238 9754 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986509.1 protein_id gnl|my_center|LOCUS_08950 11450 11235 gene locus_tag LOCUS_08960 11450 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12823 12167 gene locus_tag LOCUS_08970 12823 12167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 16626 12823 gene locus_tag LOCUS_08980 16626 12823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 17446 16631 gene locus_tag LOCUS_08990 gene lgt 17446 16631 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942073.1 protein_id gnl|my_center|LOCUS_08990 18025 17468 gene locus_tag LOCUS_09000 gene dcd 18025 17468 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005064104.1 protein_id gnl|my_center|LOCUS_09000 18493 18257 gene locus_tag LOCUS_09010 18493 18257 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_09010 21213 18583 gene locus_tag LOCUS_09020 21213 18583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 21845 21240 gene locus_tag LOCUS_09030 gene rfbC 21845 21240 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_09030 21962 22642 gene locus_tag LOCUS_09040 21962 22642 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_09040 22652 23038 gene locus_tag LOCUS_09050 22652 23038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 24349 23099 gene locus_tag LOCUS_09060 24349 23099 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922136.1 protein_id gnl|my_center|LOCUS_09060 25275 24352 gene locus_tag LOCUS_09070 25275 24352 CDS product LicD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641097.1 protein_id gnl|my_center|LOCUS_09070 25339 26142 gene locus_tag LOCUS_09080 25339 26142 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002917001.1 protein_id gnl|my_center|LOCUS_09080 26236 27321 gene locus_tag LOCUS_09090 26236 27321 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391568.1 protein_id gnl|my_center|LOCUS_09090 27324 28667 gene locus_tag LOCUS_09100 27324 28667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 28693 30813 gene locus_tag LOCUS_09110 28693 30813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 31862 30915 gene locus_tag LOCUS_09120 31862 30915 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017005.1 protein_id gnl|my_center|LOCUS_09120 33670 31880 gene locus_tag LOCUS_09130 33670 31880 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102374990.1 protein_id gnl|my_center|LOCUS_09130 34737 33892 gene locus_tag LOCUS_09140 34737 33892 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 protein_id gnl|my_center|LOCUS_09140 35804 34737 gene locus_tag LOCUS_09150 gene rfbB 35804 34737 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965629.1 protein_id gnl|my_center|LOCUS_09150 36705 35806 gene locus_tag LOCUS_09160 gene rfbD 36705 35806 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_09160 37609 36707 gene locus_tag LOCUS_09170 gene rfbA 37609 36707 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_09170 39714 37612 gene locus_tag LOCUS_09180 39714 37612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930034.1 protein_id gnl|my_center|LOCUS_09180 40956 39745 gene locus_tag LOCUS_09190 gene tyrS 40956 39745 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583842.1 protein_id gnl|my_center|LOCUS_09190 41118 43244 gene locus_tag LOCUS_09200 41118 43244 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_09200 43646 43350 gene locus_tag LOCUS_09210 43646 43350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence14 945 106 gene locus_tag LOCUS_09220 945 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1800 976 gene locus_tag LOCUS_09230 1800 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2547 1978 gene locus_tag LOCUS_09240 gene tsaE 2547 1978 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918074.1 protein_id gnl|my_center|LOCUS_09240 3115 2540 gene locus_tag LOCUS_09250 3115 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 4269 3115 gene locus_tag LOCUS_09260 gene alr 4269 3115 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182683.1 protein_id gnl|my_center|LOCUS_09260 5904 4279 gene locus_tag LOCUS_09270 5904 4279 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_09270 6438 5908 gene locus_tag LOCUS_09280 6438 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 7806 6463 gene locus_tag LOCUS_09290 gene glmM 7806 6463 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000521427.1 protein_id gnl|my_center|LOCUS_09290 8430 8035 gene locus_tag LOCUS_09300 gene rpsI 8430 8035 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_09300 8874 8434 gene locus_tag LOCUS_09310 gene rplM 8874 8434 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_09310 9255 10193 gene locus_tag LOCUS_09320 gene pfkB 9255 10193 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_09320 11612 10656 gene locus_tag LOCUS_09330 11612 10656 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953624.1 protein_id gnl|my_center|LOCUS_09330 12563 13678 gene locus_tag LOCUS_09340 12563 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 14515 14000 gene locus_tag LOCUS_09350 14515 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 15078 14632 gene locus_tag LOCUS_09360 15078 14632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 17008 15413 gene locus_tag LOCUS_09370 17008 15413 CDS product SHIRT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018372426.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09370 17479 17030 gene locus_tag LOCUS_09380 17479 17030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09380 18057 17743 gene locus_tag LOCUS_09390 18057 17743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 19860 18172 gene locus_tag LOCUS_09400 19860 18172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 20398 19841 gene locus_tag LOCUS_09410 20398 19841 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005395734.1 protein_id gnl|my_center|LOCUS_09410 21456 20590 gene locus_tag LOCUS_09420 21456 20590 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681556.1 protein_id gnl|my_center|LOCUS_09420 21910 21761 gene locus_tag LOCUS_09430 21910 21761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 23041 22175 gene locus_tag LOCUS_09440 23041 22175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 23829 23462 gene locus_tag LOCUS_tm00010 23829 23462 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 24680 24057 gene locus_tag LOCUS_09450 24680 24057 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989471.1 protein_id gnl|my_center|LOCUS_09450 25059 24922 gene locus_tag LOCUS_09460 25059 24922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 25799 25317 gene locus_tag LOCUS_09470 gene smpB 25799 25317 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223156.1 protein_id gnl|my_center|LOCUS_09470 26737 25802 gene locus_tag LOCUS_09480 26737 25802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 28831 26819 gene locus_tag LOCUS_09490 gene rnr 28831 26819 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838893.1 protein_id gnl|my_center|LOCUS_09490 30315 29068 gene locus_tag LOCUS_09500 30315 29068 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926605.1 protein_id gnl|my_center|LOCUS_09500 31894 30452 gene locus_tag LOCUS_09510 31894 30452 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939555.1 protein_id gnl|my_center|LOCUS_09510 32967 32119 gene locus_tag LOCUS_09520 32967 32119 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000059807.1 protein_id gnl|my_center|LOCUS_09520 34102 33167 gene locus_tag LOCUS_09530 gene ftsX 34102 33167 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364071.1 protein_id gnl|my_center|LOCUS_09530 35108 34080 gene locus_tag LOCUS_09540 35108 34080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 35832 35395 gene locus_tag LOCUS_09550 35832 35395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence15 88 1437 gene locus_tag LOCUS_09560 88 1437 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989840.1 protein_id gnl|my_center|LOCUS_09560 2687 1773 gene locus_tag LOCUS_09570 2687 1773 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000669493.1 protein_id gnl|my_center|LOCUS_09570 3358 2702 gene locus_tag LOCUS_09580 gene phoU 3358 2702 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357304.1 protein_id gnl|my_center|LOCUS_09580 4142 3378 gene locus_tag LOCUS_09590 gene pstB 4142 3378 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536449.1 protein_id gnl|my_center|LOCUS_09590 4812 4135 gene locus_tag LOCUS_09600 4812 4135 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053272.1 protein_id gnl|my_center|LOCUS_09600 5452 4799 gene locus_tag LOCUS_09610 5452 4799 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058318.1 protein_id gnl|my_center|LOCUS_09610 5436 5570 gene locus_tag LOCUS_09620 5436 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 6214 5657 gene locus_tag LOCUS_09630 6214 5657 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_09630 6996 6217 gene locus_tag LOCUS_09640 6996 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7965 7003 gene locus_tag LOCUS_09650 7965 7003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 8400 9434 gene locus_tag LOCUS_09660 8400 9434 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931329.1 protein_id gnl|my_center|LOCUS_09660 9480 10478 gene locus_tag LOCUS_09670 gene add 9480 10478 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548323.1 protein_id gnl|my_center|LOCUS_09670 13071 10468 gene locus_tag LOCUS_09680 13071 10468 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_09680 13404 13081 gene locus_tag LOCUS_09690 13404 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 13733 13897 gene locus_tag LOCUS_09700 13733 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 14042 14206 gene locus_tag LOCUS_09710 14042 14206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 15035 14271 gene locus_tag LOCUS_09720 15035 14271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114776.1 protein_id gnl|my_center|LOCUS_09720 15927 15019 gene locus_tag LOCUS_09730 15927 15019 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114774.1 protein_id gnl|my_center|LOCUS_09730 17111 16089 gene locus_tag LOCUS_09740 17111 16089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 17450 17130 gene locus_tag LOCUS_09750 17450 17130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 18930 17515 gene locus_tag LOCUS_09760 18930 17515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 19801 19127 gene locus_tag LOCUS_09770 19801 19127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_09770 20812 19952 gene locus_tag LOCUS_09780 20812 19952 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986547.1 protein_id gnl|my_center|LOCUS_09780 22242 20812 gene locus_tag LOCUS_09790 22242 20812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 23195 22344 gene locus_tag LOCUS_09800 23195 22344 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877742.1 protein_id gnl|my_center|LOCUS_09800 24845 23532 gene locus_tag LOCUS_09810 gene glnA 24845 23532 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582594.1 protein_id gnl|my_center|LOCUS_09810 25177 24971 gene locus_tag LOCUS_09820 25177 24971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 25482 26243 gene locus_tag LOCUS_09830 gene gpmA 25482 26243 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_09830 26487 26332 gene locus_tag LOCUS_09840 26487 26332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 26835 28259 gene locus_tag LOCUS_09850 26835 28259 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101592.1 protein_id gnl|my_center|LOCUS_09850 28723 28352 gene locus_tag LOCUS_09860 gene crcB 28723 28352 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001318207.1 protein_id gnl|my_center|LOCUS_09860 30553 28733 gene locus_tag LOCUS_09870 30553 28733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_09870 32348 30546 gene locus_tag LOCUS_09880 32348 30546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_09880 34220 32394 gene locus_tag LOCUS_09890 gene aspS 34220 32394 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840895.1 protein_id gnl|my_center|LOCUS_09890 34467 35117 gene locus_tag LOCUS_09900 34467 35117 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_09900 35280 35588 gene locus_tag LOCUS_09910 35280 35588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence16 112 612 gene locus_tag LOCUS_09920 112 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 643 1497 gene locus_tag LOCUS_09930 643 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 2318 2037 gene locus_tag LOCUS_09940 2318 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 4239 2296 gene locus_tag LOCUS_09950 4239 2296 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230933.1 protein_id gnl|my_center|LOCUS_09950 5437 4226 gene locus_tag LOCUS_09960 5437 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 6737 5424 gene locus_tag LOCUS_09970 6737 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 10124 6741 gene locus_tag LOCUS_09980 10124 6741 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143843.1 protein_id gnl|my_center|LOCUS_09980 12229 10127 gene locus_tag LOCUS_09990 12229 10127 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000963214.1 protein_id gnl|my_center|LOCUS_09990 12445 12233 gene locus_tag LOCUS_10000 12445 12233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 13434 13688 gene locus_tag LOCUS_10010 13434 13688 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_10010 13701 14138 gene locus_tag LOCUS_10020 13701 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 14474 14283 gene locus_tag LOCUS_10030 14474 14283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 14800 15480 gene locus_tag LOCUS_10040 14800 15480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814794.1 protein_id gnl|my_center|LOCUS_10040 17123 16803 gene locus_tag LOCUS_10050 17123 16803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 19718 17136 gene locus_tag LOCUS_10060 gene clpB 19718 17136 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727152.1 protein_id gnl|my_center|LOCUS_10060 20383 19931 gene locus_tag LOCUS_10070 20383 19931 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 protein_id gnl|my_center|LOCUS_10070 20702 20361 gene locus_tag LOCUS_10080 20702 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 22402 20768 gene locus_tag LOCUS_10090 22402 20768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680518.1 protein_id gnl|my_center|LOCUS_10090 23065 22595 gene locus_tag LOCUS_10100 23065 22595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 23997 23065 gene locus_tag LOCUS_10110 23997 23065 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_10110 24876 24031 gene locus_tag LOCUS_10120 24876 24031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 26904 25000 gene locus_tag LOCUS_10130 gene dnaK 26904 25000 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_10130 27705 27082 gene locus_tag LOCUS_10140 27705 27082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 28516 27788 gene locus_tag LOCUS_10150 gene trpA 28516 27788 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854645.1 protein_id gnl|my_center|LOCUS_10150 29659 28526 gene locus_tag LOCUS_10160 29659 28526 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705655.1 protein_id gnl|my_center|LOCUS_10160 30092 29811 gene locus_tag LOCUS_10170 30092 29811 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002982644.1 protein_id gnl|my_center|LOCUS_10170 32135 30099 gene locus_tag LOCUS_10180 32135 30099 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986653.1 protein_id gnl|my_center|LOCUS_10180 <32930 32346 gene locus_tag LOCUS_10190 <32930 32346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430626.1:fructose-6-phosphate aldolase >Feature sequence17 939 2408 gene locus_tag LOCUS_10200 939 2408 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864507.1 protein_id gnl|my_center|LOCUS_10200 3803 2523 gene locus_tag LOCUS_10210 3803 2523 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_10210 5213 3873 gene locus_tag LOCUS_10220 5213 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 6891 5488 gene locus_tag LOCUS_10230 gene asnS 6891 5488 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_10230 7154 7834 gene locus_tag LOCUS_10240 gene pyrE 7154 7834 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963356.1 protein_id gnl|my_center|LOCUS_10240 7868 8782 gene locus_tag LOCUS_10250 7868 8782 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263217.1 protein_id gnl|my_center|LOCUS_10250 9050 9484 gene locus_tag LOCUS_10260 9050 9484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 9559 10242 gene locus_tag LOCUS_10270 9559 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 11401 11165 gene locus_tag LOCUS_10280 11401 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 11908 11717 gene locus_tag LOCUS_10290 11908 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 12807 13466 gene locus_tag LOCUS_10300 12807 13466 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243153.1 protein_id gnl|my_center|LOCUS_10300 13463 14089 gene locus_tag LOCUS_10310 13463 14089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 14235 14819 gene locus_tag LOCUS_10320 gene yihA 14235 14819 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422605.1 protein_id gnl|my_center|LOCUS_10320 14827 17079 gene locus_tag LOCUS_10330 14827 17079 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296832.1 protein_id gnl|my_center|LOCUS_10330 17182 17538 gene locus_tag LOCUS_10340 17182 17538 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943224.1 protein_id gnl|my_center|LOCUS_10340 17792 19081 gene locus_tag LOCUS_10350 gene eno 17792 19081 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727923.1 protein_id gnl|my_center|LOCUS_10350 19351 19530 gene locus_tag LOCUS_10360 19351 19530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 19794 21101 gene locus_tag LOCUS_10370 19794 21101 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891452.1 protein_id gnl|my_center|LOCUS_10370 22140 21214 gene locus_tag LOCUS_10380 gene murB 22140 21214 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_10380 22513 23100 gene locus_tag LOCUS_10390 22513 23100 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117814.1 protein_id gnl|my_center|LOCUS_10390 23093 24991 gene locus_tag LOCUS_10400 23093 24991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 24981 25775 gene locus_tag LOCUS_10410 24981 25775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 25976 29731 gene locus_tag LOCUS_10420 25976 29731 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence18 605 1660 gene locus_tag LOCUS_10430 gene galE 605 1660 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_10430 1668 2765 gene locus_tag LOCUS_10440 gene idsA 1668 2765 CDS product short chain isoprenyl diphosphate synthase IdsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_10440 2768 3697 gene locus_tag LOCUS_10450 2768 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 3742 3816 gene locus_tag LOCUS_t00320 3742 3816 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3885 5273 gene locus_tag LOCUS_10460 gene glmU 3885 5273 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975692.1 protein_id gnl|my_center|LOCUS_10460 5274 6269 gene locus_tag LOCUS_10470 5274 6269 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966497.1 protein_id gnl|my_center|LOCUS_10470 7575 6925 gene locus_tag LOCUS_10480 gene pcp 7575 6925 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287081.1 protein_id gnl|my_center|LOCUS_10480 8664 7687 gene locus_tag LOCUS_10490 8664 7687 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355267.1 protein_id gnl|my_center|LOCUS_10490 9443 8664 gene locus_tag LOCUS_10500 9443 8664 CDS product DUF969 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024797200.1 protein_id gnl|my_center|LOCUS_10500 9863 10246 gene locus_tag LOCUS_10510 9863 10246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 10843 11220 gene locus_tag LOCUS_10520 10843 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 11500 11922 gene locus_tag LOCUS_10530 11500 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 11915 12427 gene locus_tag LOCUS_10540 11915 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 12747 13589 gene locus_tag LOCUS_10550 12747 13589 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002370486.1 protein_id gnl|my_center|LOCUS_10550 13571 14974 gene locus_tag LOCUS_10560 gene gltA 13571 14974 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_10560 16587 15661 gene locus_tag LOCUS_10570 16587 15661 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462197.1 protein_id gnl|my_center|LOCUS_10570 17509 16580 gene locus_tag LOCUS_10580 17509 16580 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943550.1 protein_id gnl|my_center|LOCUS_10580 18247 17567 gene locus_tag LOCUS_10590 gene fsa 18247 17567 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228415.1 protein_id gnl|my_center|LOCUS_10590 19189 18470 gene locus_tag LOCUS_10600 19189 18470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10600 19450 19250 gene locus_tag LOCUS_10610 19450 19250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10610 20013 19564 gene locus_tag LOCUS_10620 20013 19564 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210291.1 protein_id gnl|my_center|LOCUS_10620 20699 20247 gene locus_tag LOCUS_10630 20699 20247 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531476.1 protein_id gnl|my_center|LOCUS_10630 20940 21815 gene locus_tag LOCUS_10640 20940 21815 CDS product ketose 1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038418474.1 protein_id gnl|my_center|LOCUS_10640 22544 21888 gene locus_tag LOCUS_10650 22544 21888 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453954.1 protein_id gnl|my_center|LOCUS_10650 23047 22547 gene locus_tag LOCUS_10660 23047 22547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 24492 23098 gene locus_tag LOCUS_10670 24492 23098 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887822.1 protein_id gnl|my_center|LOCUS_10670 24812 24513 gene locus_tag LOCUS_10680 24812 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 25361 24840 gene locus_tag LOCUS_10690 25361 24840 CDS product YjbQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576695.1 protein_id gnl|my_center|LOCUS_10690 26082 25384 gene locus_tag LOCUS_10700 26082 25384 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674983.1 protein_id gnl|my_center|LOCUS_10700 26753 26190 gene locus_tag LOCUS_10710 26753 26190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 27154 27309 gene locus_tag LOCUS_10720 27154 27309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 27815 27522 gene locus_tag LOCUS_10730 27815 27522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 28254 28060 gene locus_tag LOCUS_10740 28254 28060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence19 1648 50 gene locus_tag LOCUS_10750 gene lysS 1648 50 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905307.1 protein_id gnl|my_center|LOCUS_10750 2194 1715 gene locus_tag LOCUS_10760 gene greA 2194 1715 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_10760 2453 2244 gene locus_tag LOCUS_10770 2453 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2661 3380 gene locus_tag LOCUS_10780 2661 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4008 5642 gene locus_tag LOCUS_10790 4008 5642 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003601491.1 protein_id gnl|my_center|LOCUS_10790 6781 5795 gene locus_tag LOCUS_10800 gene rihC 6781 5795 CDS product ribonucleoside hydrolase RihC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052500.1 protein_id gnl|my_center|LOCUS_10800 7836 6916 gene locus_tag LOCUS_10810 gene rbsK 7836 6916 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267464.1 protein_id gnl|my_center|LOCUS_10810 8428 11325 gene locus_tag LOCUS_10820 gene mgtA 8428 11325 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861942.1 protein_id gnl|my_center|LOCUS_10820 11348 12118 gene locus_tag LOCUS_10830 11348 12118 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_10830 12270 12977 gene locus_tag LOCUS_10840 12270 12977 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243096.1 protein_id gnl|my_center|LOCUS_10840 13789 13241 gene locus_tag LOCUS_10850 13789 13241 CDS product NADPH-dependent FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837101.1 protein_id gnl|my_center|LOCUS_10850 14450 13887 gene locus_tag LOCUS_10860 14450 13887 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268542.1 protein_id gnl|my_center|LOCUS_10860 14821 14453 gene locus_tag LOCUS_10870 14821 14453 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016333.1 protein_id gnl|my_center|LOCUS_10870 16681 14888 gene locus_tag LOCUS_10880 gene pepF 16681 14888 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_10880 16919 17686 gene locus_tag LOCUS_10890 16919 17686 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964759.1 protein_id gnl|my_center|LOCUS_10890 17829 19082 gene locus_tag LOCUS_10900 17829 19082 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945405.1 protein_id gnl|my_center|LOCUS_10900 19283 20527 gene locus_tag LOCUS_10910 19283 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 20604 20882 gene locus_tag LOCUS_10920 20604 20882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 20836 21084 gene locus_tag LOCUS_10930 20836 21084 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830141.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence20 673 1218 gene locus_tag LOCUS_10940 673 1218 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_10940 2264 1593 gene locus_tag LOCUS_10950 gene nth 2264 1593 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814299.1 protein_id gnl|my_center|LOCUS_10950 2532 5975 gene locus_tag LOCUS_10960 gene mfd 2532 5975 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391629.1 protein_id gnl|my_center|LOCUS_10960 5978 7075 gene locus_tag LOCUS_10970 5978 7075 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774928.1 protein_id gnl|my_center|LOCUS_10970 7081 8013 gene locus_tag LOCUS_10980 7081 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 8209 9159 gene locus_tag LOCUS_10990 8209 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 9159 10181 gene locus_tag LOCUS_11000 9159 10181 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975718.1 protein_id gnl|my_center|LOCUS_11000 10211 10295 gene locus_tag LOCUS_t00330 10211 10295 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10416 11105 gene locus_tag LOCUS_11010 10416 11105 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073934.1 protein_id gnl|my_center|LOCUS_11010 11123 11605 gene locus_tag LOCUS_11020 11123 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 11809 11958 gene locus_tag LOCUS_11030 11809 11958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 11951 12208 gene locus_tag LOCUS_11040 11951 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 12210 12515 gene locus_tag LOCUS_11050 12210 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 12708 12532 gene locus_tag LOCUS_11060 12708 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 12860 12711 gene locus_tag LOCUS_11070 12860 12711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 13034 12861 gene locus_tag LOCUS_11080 13034 12861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 13296 13036 gene locus_tag LOCUS_11090 13296 13036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 13622 13380 gene locus_tag LOCUS_11100 13622 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 13815 15554 gene locus_tag LOCUS_11110 13815 15554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 15548 16627 gene locus_tag LOCUS_11120 15548 16627 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067336.1 protein_id gnl|my_center|LOCUS_11120 16763 16689 gene locus_tag LOCUS_t00340 16763 16689 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17860 16832 gene locus_tag LOCUS_11130 17860 16832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 19032 17857 gene locus_tag LOCUS_11140 19032 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence21 2223 1264 gene locus_tag LOCUS_11150 2223 1264 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392654.1 protein_id gnl|my_center|LOCUS_11150 2323 3441 gene locus_tag LOCUS_11160 gene rlmN 2323 3441 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232066.1 protein_id gnl|my_center|LOCUS_11160 3764 3525 gene locus_tag LOCUS_11170 3764 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4624 3764 gene locus_tag LOCUS_11180 4624 3764 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_11180 5417 4617 gene locus_tag LOCUS_11190 5417 4617 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_11190 6239 5481 gene locus_tag LOCUS_11200 gene rsmG 6239 5481 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476459.1 protein_id gnl|my_center|LOCUS_11200 6927 6343 gene locus_tag LOCUS_11210 6927 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 7776 7018 gene locus_tag LOCUS_11220 7776 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 8033 7797 gene locus_tag LOCUS_11230 gene yidD 8033 7797 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462333.1 protein_id gnl|my_center|LOCUS_11230 8353 8030 gene locus_tag LOCUS_11240 8353 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 8499 8365 gene locus_tag LOCUS_11250 8499 8365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8862 9740 gene locus_tag LOCUS_11260 8862 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 9824 11353 gene locus_tag LOCUS_11270 gene dnaA 9824 11353 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_11270 11587 12687 gene locus_tag LOCUS_11280 gene dnaN 11587 12687 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012615304.1 protein_id gnl|my_center|LOCUS_11280 12703 13794 gene locus_tag LOCUS_11290 gene recF 12703 13794 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549377.1 protein_id gnl|my_center|LOCUS_11290 13787 14320 gene locus_tag LOCUS_11300 13787 14320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 14481 16424 gene locus_tag LOCUS_11310 gene gyrB 14481 16424 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_11310 16469 19249 gene locus_tag LOCUS_11320 gene gyrA 16469 19249 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641633.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence22 1848 2843 gene locus_tag LOCUS_11330 1848 2843 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143687.1 protein_id gnl|my_center|LOCUS_11330 3992 2919 gene locus_tag LOCUS_11340 3992 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3972 4193 gene locus_tag LOCUS_11350 3972 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4287 5219 gene locus_tag LOCUS_11360 4287 5219 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645539.1 protein_id gnl|my_center|LOCUS_11360 5371 7809 gene locus_tag LOCUS_11370 5371 7809 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804532.1 protein_id gnl|my_center|LOCUS_11370 7812 8594 gene locus_tag LOCUS_11380 7812 8594 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081708.1 protein_id gnl|my_center|LOCUS_11380 8596 9294 gene locus_tag LOCUS_11390 8596 9294 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_11390 9495 10544 gene locus_tag LOCUS_11400 9495 10544 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_11400 10603 11223 gene locus_tag LOCUS_11410 10603 11223 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_11410 11347 12042 gene locus_tag LOCUS_11420 11347 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 12035 12277 gene locus_tag LOCUS_11430 12035 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 12291 12779 gene locus_tag LOCUS_11440 12291 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 12870 15341 gene locus_tag LOCUS_11450 12870 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 15567 16331 gene locus_tag LOCUS_11460 15567 16331 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242836.1 protein_id gnl|my_center|LOCUS_11460 16432 17073 gene locus_tag LOCUS_11470 16432 17073 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922263.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence23 516 85 gene locus_tag LOCUS_11480 516 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1742 609 gene locus_tag LOCUS_11490 1742 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1815 3041 gene locus_tag LOCUS_11500 1815 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3387 3010 gene locus_tag LOCUS_11510 3387 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3728 3456 gene locus_tag LOCUS_11520 3728 3456 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422895.1 protein_id gnl|my_center|LOCUS_11520 3911 5221 gene locus_tag LOCUS_11530 3911 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6503 5340 gene locus_tag LOCUS_11540 gene queA 6503 5340 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460358.1 protein_id gnl|my_center|LOCUS_11540 7125 6493 gene locus_tag LOCUS_11550 7125 6493 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_11550 7991 7125 gene locus_tag LOCUS_11560 7991 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 8119 10158 gene locus_tag LOCUS_11570 8119 10158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 10180 11076 gene locus_tag LOCUS_11580 10180 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 11221 11685 gene locus_tag LOCUS_11590 11221 11685 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224731.1 protein_id gnl|my_center|LOCUS_11590 11670 13571 gene locus_tag LOCUS_11600 11670 13571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052496.1 protein_id gnl|my_center|LOCUS_11600 13564 15480 gene locus_tag LOCUS_11610 13564 15480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence24 186 1226 gene locus_tag LOCUS_11620 186 1226 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_11620 1258 2103 gene locus_tag LOCUS_11630 1258 2103 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_11630 3671 2250 gene locus_tag LOCUS_11640 3671 2250 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964406.1 protein_id gnl|my_center|LOCUS_11640 4769 3828 gene locus_tag LOCUS_11650 4769 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 5058 5930 gene locus_tag LOCUS_11660 gene fba 5058 5930 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964145.1 protein_id gnl|my_center|LOCUS_11660 6757 7494 gene locus_tag LOCUS_11670 6757 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 8244 7792 gene locus_tag LOCUS_11680 gene iscR 8244 7792 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417910.1 protein_id gnl|my_center|LOCUS_11680 8777 8247 gene locus_tag LOCUS_11690 8777 8247 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966566.1 protein_id gnl|my_center|LOCUS_11690 10067 8796 gene locus_tag LOCUS_11700 10067 8796 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966565.1 protein_id gnl|my_center|LOCUS_11700 11272 10067 gene locus_tag LOCUS_11710 gene sufD 11272 10067 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681871.1 protein_id gnl|my_center|LOCUS_11710 12690 11272 gene locus_tag LOCUS_11720 gene sufB 12690 11272 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_11720 13457 12690 gene locus_tag LOCUS_11730 gene sufC 13457 12690 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966562.1 protein_id gnl|my_center|LOCUS_11730 13792 15102 gene locus_tag LOCUS_11740 gene hisS 13792 15102 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393179.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence25 1212 163 gene locus_tag LOCUS_11750 1212 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1483 4419 gene locus_tag LOCUS_11760 1483 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 4582 4974 gene locus_tag LOCUS_11770 4582 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 5230 6516 gene locus_tag LOCUS_11780 gene celB 5230 6516 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_11780 6741 6929 gene locus_tag LOCUS_11790 6741 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6961 9477 gene locus_tag LOCUS_11800 6961 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 9488 11539 gene locus_tag LOCUS_11810 9488 11539 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965088.1 protein_id gnl|my_center|LOCUS_11810 12293 12583 gene locus_tag LOCUS_11820 gene groES 12293 12583 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_11820 12681 14318 gene locus_tag LOCUS_11830 gene groL 12681 14318 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974678.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence26 663 1328 gene locus_tag LOCUS_11840 gene fsa 663 1328 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430626.1 protein_id gnl|my_center|LOCUS_11840 2643 1450 gene locus_tag LOCUS_11850 2643 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 3539 2655 gene locus_tag LOCUS_11860 3539 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 3824 3645 gene locus_tag LOCUS_11870 3824 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4720 4887 gene locus_tag LOCUS_11880 4720 4887 CDS product CD1871A family CXXC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426158.1 protein_id gnl|my_center|LOCUS_11880 4967 5857 gene locus_tag LOCUS_11890 4967 5857 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_11890 5917 6555 gene locus_tag LOCUS_11900 5917 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 6734 7414 gene locus_tag LOCUS_11910 6734 7414 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_11910 7407 8567 gene locus_tag LOCUS_11920 7407 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 8686 9441 gene locus_tag LOCUS_11930 8686 9441 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963440.1 protein_id gnl|my_center|LOCUS_11930 9861 9553 gene locus_tag LOCUS_11940 9861 9553 CDS product PTS fructose-like transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000161265.1 protein_id gnl|my_center|LOCUS_11940 10971 9871 gene locus_tag LOCUS_11950 10971 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 11260 13581 gene locus_tag LOCUS_11960 11260 13581 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000184858.1 protein_id gnl|my_center|LOCUS_11960 13571 14449 gene locus_tag LOCUS_11970 13571 14449 CDS product [formate-C-acetyltransferase]-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204153.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence27 1320 136 gene locus_tag LOCUS_11980 1320 136 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108806343.1 protein_id gnl|my_center|LOCUS_11980 2088 1540 gene locus_tag LOCUS_11990 gene hpt 2088 1540 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804893.1 protein_id gnl|my_center|LOCUS_11990 3563 2088 gene locus_tag LOCUS_12000 3563 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3474 3686 gene locus_tag LOCUS_12010 3474 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3822 4661 gene locus_tag LOCUS_12020 3822 4661 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_12020 5355 4921 gene locus_tag LOCUS_12030 5355 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5623 6231 gene locus_tag LOCUS_12040 5623 6231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6501 6791 gene locus_tag LOCUS_12050 6501 6791 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_12050 6823 6969 gene locus_tag LOCUS_12060 6823 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6988 7683 gene locus_tag LOCUS_12070 6988 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12070 8240 7758 gene locus_tag LOCUS_12080 8240 7758 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459155.1 protein_id gnl|my_center|LOCUS_12080 8821 8357 gene locus_tag LOCUS_12090 8821 8357 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986720.1 protein_id gnl|my_center|LOCUS_12090 9594 8959 gene locus_tag LOCUS_12100 9594 8959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 9924 11210 gene locus_tag LOCUS_12110 9924 11210 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054178.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence28 972 160 gene locus_tag LOCUS_12120 972 160 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_12120 1853 1074 gene locus_tag LOCUS_12130 1853 1074 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438367.1 protein_id gnl|my_center|LOCUS_12130 2058 3530 gene locus_tag LOCUS_12140 2058 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3521 4249 gene locus_tag LOCUS_12150 3521 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 5082 4300 gene locus_tag LOCUS_12160 5082 4300 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_12160 5315 5722 gene locus_tag LOCUS_12170 5315 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5857 8169 gene locus_tag LOCUS_12180 5857 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 8276 8614 gene locus_tag LOCUS_12190 8276 8614 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_12190 8618 9229 gene locus_tag LOCUS_12200 gene recR 8618 9229 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_12200 9232 9903 gene locus_tag LOCUS_12210 9232 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 10068 10144 gene locus_tag LOCUS_t00350 10068 10144 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10337 11095 gene locus_tag LOCUS_12220 10337 11095 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005067866.1 protein_id gnl|my_center|LOCUS_12220 11248 11844 gene locus_tag LOCUS_12230 11248 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence29 284 211 gene locus_tag LOCUS_t00360 284 211 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 398 323 gene locus_tag LOCUS_t00370 398 323 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 601 1473 gene locus_tag LOCUS_12240 601 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1586 2791 gene locus_tag LOCUS_12250 gene nifS 1586 2791 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_12250 2779 3864 gene locus_tag LOCUS_12260 gene mnmA 2779 3864 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072580.1 protein_id gnl|my_center|LOCUS_12260 3972 5270 gene locus_tag LOCUS_12270 3972 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 5357 5560 gene locus_tag LOCUS_12280 5357 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6116 5568 gene locus_tag LOCUS_12290 6116 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966212.1 protein_id gnl|my_center|LOCUS_12290 6387 6462 gene locus_tag LOCUS_t00380 6387 6462 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6609 7172 gene locus_tag LOCUS_12300 gene ahpC 6609 7172 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_12300 7189 8832 gene locus_tag LOCUS_12310 7189 8832 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810050.1 protein_id gnl|my_center|LOCUS_12310 10556 8958 gene locus_tag LOCUS_12320 10556 8958 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250525.1 protein_id gnl|my_center|LOCUS_12320 10880 11689 gene locus_tag LOCUS_12330 10880 11689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence30 767 516 gene locus_tag LOCUS_12340 gene secG 767 516 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016325957.1 protein_id gnl|my_center|LOCUS_12340 1709 942 gene locus_tag LOCUS_12350 gene tpiA 1709 942 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292815.1 protein_id gnl|my_center|LOCUS_12350 2892 1702 gene locus_tag LOCUS_12360 2892 1702 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243051.1 protein_id gnl|my_center|LOCUS_12360 4006 2981 gene locus_tag LOCUS_12370 gene gap 4006 2981 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_12370 5067 4099 gene locus_tag LOCUS_12380 gene whiA 5067 4099 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_12380 5998 5081 gene locus_tag LOCUS_12390 gene rapZ 5998 5081 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289695.1 protein_id gnl|my_center|LOCUS_12390 6734 6045 gene locus_tag LOCUS_12400 6734 6045 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113937.1 protein_id gnl|my_center|LOCUS_12400 7818 6829 gene locus_tag LOCUS_12410 7818 6829 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993557.1 protein_id gnl|my_center|LOCUS_12410 8757 7834 gene locus_tag LOCUS_12420 8757 7834 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993834.1 protein_id gnl|my_center|LOCUS_12420 9207 8884 gene locus_tag LOCUS_12430 9207 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence31 84 866 gene locus_tag LOCUS_12440 84 866 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568030.1 protein_id gnl|my_center|LOCUS_12440 1918 1037 gene locus_tag LOCUS_12450 1918 1037 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357595.1 protein_id gnl|my_center|LOCUS_12450 3029 1920 gene locus_tag LOCUS_12460 gene prfB 3029 1920 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_12460 5806 3032 gene locus_tag LOCUS_12470 gene secA 5806 3032 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_12470 8909 5874 gene locus_tag LOCUS_12480 8909 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence32 220 471 gene locus_tag LOCUS_12490 220 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254332.1 protein_id gnl|my_center|LOCUS_12490 680 1327 gene locus_tag LOCUS_12500 680 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1750 3351 gene locus_tag LOCUS_12510 1750 3351 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116517.1 protein_id gnl|my_center|LOCUS_12510 3509 4465 gene locus_tag LOCUS_12520 3509 4465 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137618.1 protein_id gnl|my_center|LOCUS_12520 4470 6509 gene locus_tag LOCUS_12530 4470 6509 CDS product dipeptide/oligopeptide/nickel ABC transporter permease/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993832.1 protein_id gnl|my_center|LOCUS_12530 6510 7331 gene locus_tag LOCUS_12540 6510 7331 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116524.1 protein_id gnl|my_center|LOCUS_12540 7398 8438 gene locus_tag LOCUS_12550 7398 8438 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000795124.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence33 477 109 gene locus_tag LOCUS_12560 477 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 5102 672 gene locus_tag LOCUS_12570 5102 672 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974308.1 protein_id gnl|my_center|LOCUS_12570 8623 5108 gene locus_tag LOCUS_12580 gene rpoB 8623 5108 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272205.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence34 364 1443 gene locus_tag LOCUS_12590 gene disA 364 1443 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975482.1 protein_id gnl|my_center|LOCUS_12590 1443 2246 gene locus_tag LOCUS_12600 gene ispD 1443 2246 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000288292.1 protein_id gnl|my_center|LOCUS_12600 2243 2734 gene locus_tag LOCUS_12610 gene ispF 2243 2734 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_12610 4417 2777 gene locus_tag LOCUS_12620 4417 2777 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948315.1 protein_id gnl|my_center|LOCUS_12620 4659 6140 gene locus_tag LOCUS_12630 gene cysS 4659 6140 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459084.1 protein_id gnl|my_center|LOCUS_12630 6143 7213 gene locus_tag LOCUS_12640 6143 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 7259 7837 gene locus_tag LOCUS_12650 7259 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence35 303 2468 gene locus_tag LOCUS_12660 303 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2471 3124 gene locus_tag LOCUS_12670 2471 3124 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571333.1 protein_id gnl|my_center|LOCUS_12670 4651 3191 gene locus_tag LOCUS_12680 4651 3191 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016800.1 protein_id gnl|my_center|LOCUS_12680 4768 5709 gene locus_tag LOCUS_12690 4768 5709 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068301.1 protein_id gnl|my_center|LOCUS_12690 5711 6448 gene locus_tag LOCUS_12700 5711 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 6536 8131 gene locus_tag LOCUS_12710 6536 8131 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence36 1361 15 gene locus_tag LOCUS_12720 1361 15 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287699.1 protein_id gnl|my_center|LOCUS_12720 3041 1452 gene locus_tag LOCUS_12730 gene guaA 3041 1452 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965987.1 protein_id gnl|my_center|LOCUS_12730 3431 5119 gene locus_tag LOCUS_12740 3431 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5124 5303 gene locus_tag LOCUS_12750 5124 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 6364 5300 gene locus_tag LOCUS_12760 gene ychF 6364 5300 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence37 <1 1358 gene locus_tag LOCUS_12770 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964961.1:insulinase family protein 4873 1481 gene locus_tag LOCUS_12780 4873 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 5442 4921 gene locus_tag LOCUS_12790 5442 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5587 7032 gene locus_tag LOCUS_12800 5587 7032 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537832.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence38 399 474 gene locus_tag LOCUS_t00390 399 474 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 543 785 gene locus_tag LOCUS_12810 543 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 949 1032 gene locus_tag LOCUS_t00400 949 1032 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1034 1109 gene locus_tag LOCUS_t00410 1034 1109 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1129 1205 gene locus_tag LOCUS_t00420 1129 1205 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1312 2517 gene locus_tag LOCUS_12820 gene tuf 1312 2517 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903497.1 protein_id gnl|my_center|LOCUS_12820 2702 2851 gene locus_tag LOCUS_12830 gene rpmG 2702 2851 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583730.1 protein_id gnl|my_center|LOCUS_12830 2870 2945 gene locus_tag LOCUS_t00430 2870 2945 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3017 3379 gene locus_tag LOCUS_12840 3017 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3383 3928 gene locus_tag LOCUS_12850 gene nusG 3383 3928 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003726896.1 protein_id gnl|my_center|LOCUS_12850 4025 4453 gene locus_tag LOCUS_12860 gene rplK 4025 4453 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776394.1 protein_id gnl|my_center|LOCUS_12860 4612 5319 gene locus_tag LOCUS_12870 gene rplA 4612 5319 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974314.1 protein_id gnl|my_center|LOCUS_12870 5773 6294 gene locus_tag LOCUS_12880 gene rplJ 5773 6294 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870241.1 protein_id gnl|my_center|LOCUS_12880 6427 6807 gene locus_tag LOCUS_12890 gene rplL 6427 6807 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854210.1 protein_id gnl|my_center|LOCUS_12890 7045 6860 gene locus_tag LOCUS_12900 7045 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence39 1121 390 gene locus_tag LOCUS_12910 1121 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3615 1207 gene locus_tag LOCUS_12920 3615 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3793 3704 gene locus_tag LOCUS_t00440 3793 3704 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5667 3892 gene locus_tag LOCUS_12930 5667 3892 CDS product ABC transporter family substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389694.1 protein_id gnl|my_center|LOCUS_12930 <6924 5825 gene locus_tag LOCUS_12940 <6924 5825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812442.1:ABC transporter ATP-binding protein >Feature sequence40 1597 896 gene locus_tag LOCUS_12950 1597 896 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837546.1 protein_id gnl|my_center|LOCUS_12950 2728 1610 gene locus_tag LOCUS_12960 gene ulaG 2728 1610 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295191.1 protein_id gnl|my_center|LOCUS_12960 3910 2855 gene locus_tag LOCUS_12970 3910 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700534.1 protein_id gnl|my_center|LOCUS_12970 4248 3940 gene locus_tag LOCUS_12980 4248 3940 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288830.1 protein_id gnl|my_center|LOCUS_12980 5925 4414 gene locus_tag LOCUS_12990 5925 4414 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366460.1 protein_id gnl|my_center|LOCUS_12990 6519 6061 gene locus_tag LOCUS_13000 6519 6061 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358021.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence41 270 4703 gene locus_tag LOCUS_13010 270 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 4802 5299 gene locus_tag LOCUS_13020 4802 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 5320 6171 gene locus_tag LOCUS_13030 5320 6171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13030 >Feature sequence42 <1 1821 gene locus_tag LOCUS_13040 <1 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392668.1:helicase C-terminal domain-containing protein 2832 1846 gene locus_tag LOCUS_13050 2832 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3802 2822 gene locus_tag LOCUS_13060 3802 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3992 5917 gene locus_tag LOCUS_13070 3992 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence43 834 184 gene locus_tag LOCUS_13080 834 184 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862015.1 protein_id gnl|my_center|LOCUS_13080 1803 907 gene locus_tag LOCUS_13090 gene dapA 1803 907 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435760.1 protein_id gnl|my_center|LOCUS_13090 2449 1841 gene locus_tag LOCUS_13100 2449 1841 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373863.1 protein_id gnl|my_center|LOCUS_13100 3105 2506 gene locus_tag LOCUS_13110 3105 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4512 3205 gene locus_tag LOCUS_13120 4512 3205 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435758.1 protein_id gnl|my_center|LOCUS_13120 4975 4676 gene locus_tag LOCUS_13130 4975 4676 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435756.1 protein_id gnl|my_center|LOCUS_13130 5430 4975 gene locus_tag LOCUS_13140 5430 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence44 421 1470 gene locus_tag LOCUS_13150 421 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 3283 1562 gene locus_tag LOCUS_13160 3283 1562 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002338467.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence45 1158 850 gene locus_tag LOCUS_13170 gene rpsJ 1158 850 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_13170 3298 1202 gene locus_tag LOCUS_13180 gene fusA 3298 1202 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_13180 3793 3323 gene locus_tag LOCUS_13190 gene rpsG 3793 3323 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055588.1 protein_id gnl|my_center|LOCUS_13190 4203 3832 gene locus_tag LOCUS_13200 gene rpsL 4203 3832 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545079.1 protein_id gnl|my_center|LOCUS_13200 4913 4458 gene locus_tag LOCUS_13210 4913 4458 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665857.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence46 1909 374 gene locus_tag LOCUS_13220 1909 374 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285962.1 protein_id gnl|my_center|LOCUS_13220 2126 2202 gene locus_tag LOCUS_t00450 2126 2202 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2353 3276 gene locus_tag LOCUS_13230 2353 3276 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949075.1 protein_id gnl|my_center|LOCUS_13230 3699 3385 gene locus_tag LOCUS_13240 3699 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 3939 4193 gene locus_tag LOCUS_13250 3939 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4431 4249 gene locus_tag LOCUS_13260 4431 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence47 2243 1041 gene locus_tag LOCUS_13270 gene glf 2243 1041 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875983.1 protein_id gnl|my_center|LOCUS_13270 2482 3462 gene locus_tag LOCUS_13280 gene pta 2482 3462 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_13280 3538 4437 gene locus_tag LOCUS_13290 3538 4437 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence48 1240 119 gene locus_tag LOCUS_13300 gene lsrB 1240 119 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823631.1 protein_id gnl|my_center|LOCUS_13300 2320 1286 gene locus_tag LOCUS_13310 2320 1286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878521.1 protein_id gnl|my_center|LOCUS_13310 3396 2320 gene locus_tag LOCUS_13320 3396 2320 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682144.1 protein_id gnl|my_center|LOCUS_13320 <4584 3407 gene locus_tag LOCUS_13330 <4584 3407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000432606.1:sugar ABC transporter ATP-binding protein >Feature sequence49 523 1413 gene locus_tag LOCUS_13340 gene murQ 523 1413 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098312.1 protein_id gnl|my_center|LOCUS_13340 1670 3157 gene locus_tag LOCUS_13350 1670 3157 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775345.1 protein_id gnl|my_center|LOCUS_13350 3328 4383 gene locus_tag LOCUS_13360 3328 4383 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364446.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence50 2823 1468 gene locus_tag LOCUS_13370 2823 1468 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287584.1 protein_id gnl|my_center|LOCUS_13370 3266 2955 gene locus_tag LOCUS_13380 gene licB 3266 2955 CDS product PTS lichenan transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003218755.1 protein_id gnl|my_center|LOCUS_13380 3652 3326 gene locus_tag LOCUS_13390 3652 3326 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836401.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence51 2171 1101 gene locus_tag LOCUS_13400 2171 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13400 2536 2216 gene locus_tag LOCUS_13410 2536 2216 CDS product PTS fructose transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705652.1 protein_id gnl|my_center|LOCUS_13410 2788 3786 gene locus_tag LOCUS_13420 2788 3786 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412453.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence52 953 2950 gene locus_tag LOCUS_13430 gene pbp4b 953 2950 CDS product penicillin binding protein PBP4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679898.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence53 943 1857 gene locus_tag LOCUS_13440 943 1857 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000192708.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence54 2026 1079 gene locus_tag LOCUS_13450 2026 1079 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153115.1 protein_id gnl|my_center|LOCUS_13450 2295 2591 gene locus_tag LOCUS_13460 2295 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence55 150 533 gene locus_tag LOCUS_13470 150 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 563 1237 gene locus_tag LOCUS_13480 gene hypB 563 1237 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence56 >Feature sequence57 1808 105 gene locus_tag LOCUS_13490 1808 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence58 <1 1358 gene locus_tag LOCUS_13500 <1 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964961.1:insulinase family protein <2061 1482 gene locus_tag LOCUS_13510 <2061 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263553.1:ATP-binding cassette domain-containing protein >Feature sequence59 >Feature sequence60 1261 1028 gene locus_tag LOCUS_13520 1261 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence61 223 1197 gene locus_tag LOCUS_13530 223 1197 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049518049.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence62 1108 59 gene locus_tag LOCUS_13540 1108 59 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674778.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence63