>Feature sequence001 1 774 gene locus_tag LOCUS_0010 1 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 1355 981 gene locus_tag LOCUS_0020 1355 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 1547 1969 gene locus_tag LOCUS_0030 1547 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 1979 2707 gene locus_tag LOCUS_0040 1979 2707 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_0040 2863 3270 gene locus_tag LOCUS_0050 2863 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 4075 5172 gene locus_tag LOCUS_0060 4075 5172 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392074.1 protein_id gnl|my_center|LOCUS_0060 5235 6014 gene locus_tag LOCUS_0070 gene mreC 5235 6014 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_0070 6557 8506 gene locus_tag LOCUS_0080 gene mrdA 6557 8506 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802923.1 protein_id gnl|my_center|LOCUS_0080 8520 9908 gene locus_tag LOCUS_0090 gene murJ 8520 9908 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_0090 10071 12725 gene locus_tag LOCUS_0100 gene secA 10071 12725 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945439.1 protein_id gnl|my_center|LOCUS_0100 12754 13269 gene locus_tag LOCUS_0110 12754 13269 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_0110 13372 15108 gene locus_tag LOCUS_0120 13372 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 15132 16049 gene locus_tag LOCUS_0130 gene secF 15132 16049 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947716.1 protein_id gnl|my_center|LOCUS_0130 16086 16466 gene locus_tag LOCUS_0140 16086 16466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 16597 16998 gene locus_tag LOCUS_0150 16597 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 17124 18335 gene locus_tag LOCUS_0160 gene tyrS 17124 18335 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_0160 18323 18916 gene locus_tag LOCUS_0170 18323 18916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 18962 19984 gene locus_tag LOCUS_0180 gene pheS 18962 19984 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388219.1 protein_id gnl|my_center|LOCUS_0180 20038 22392 gene locus_tag LOCUS_0190 gene pheT 20038 22392 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_0190 22617 23810 gene locus_tag LOCUS_0200 22617 23810 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 protein_id gnl|my_center|LOCUS_0200 23927 24727 gene locus_tag LOCUS_0210 23927 24727 CDS product DUF3820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871608.1 protein_id gnl|my_center|LOCUS_0210 25299 26609 gene locus_tag LOCUS_0220 25299 26609 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_0220 26631 27383 gene locus_tag LOCUS_0230 26631 27383 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_0230 >Feature sequence002 740 300 gene locus_tag LOCUS_0240 740 300 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023127.1 protein_id gnl|my_center|LOCUS_0240 1517 810 gene locus_tag LOCUS_0250 gene uppS 1517 810 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250124.1 protein_id gnl|my_center|LOCUS_0250 2607 1528 gene locus_tag LOCUS_0260 2607 1528 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804096.1 protein_id gnl|my_center|LOCUS_0260 3378 2680 gene locus_tag LOCUS_0270 3378 2680 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_0270 4842 3469 gene locus_tag LOCUS_0280 gene murC 4842 3469 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018214193.1 protein_id gnl|my_center|LOCUS_0280 5998 4880 gene locus_tag LOCUS_0290 5998 4880 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946544.1 protein_id gnl|my_center|LOCUS_0290 7313 6081 gene locus_tag LOCUS_0300 gene spoVE 7313 6081 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_0300 8023 7373 gene locus_tag LOCUS_0310 gene trmD 8023 7373 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686903.1 protein_id gnl|my_center|LOCUS_0310 8531 8163 gene locus_tag LOCUS_0320 8531 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 8817 10076 gene locus_tag LOCUS_0330 8817 10076 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583463.1 protein_id gnl|my_center|LOCUS_0330 10760 10221 gene locus_tag LOCUS_0340 10760 10221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 11513 10764 gene locus_tag LOCUS_0350 11513 10764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 11836 12414 gene locus_tag LOCUS_0360 11836 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 12971 12411 gene locus_tag LOCUS_0370 12971 12411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 14255 13014 gene locus_tag LOCUS_0380 14255 13014 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938060.1 protein_id gnl|my_center|LOCUS_0380 15676 14270 gene locus_tag LOCUS_0390 15676 14270 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656113.1 protein_id gnl|my_center|LOCUS_0390 16518 15787 gene locus_tag LOCUS_0400 gene pgeF 16518 15787 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972144.1 protein_id gnl|my_center|LOCUS_0400 17673 16522 gene locus_tag LOCUS_0410 17673 16522 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258698.1 protein_id gnl|my_center|LOCUS_0410 19565 17673 gene locus_tag LOCUS_0420 19565 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 20362 19613 gene locus_tag LOCUS_0430 gene recO 20362 19613 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861552.1 protein_id gnl|my_center|LOCUS_0430 23344 20393 gene locus_tag LOCUS_0440 gene ileS 23344 20393 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680710.1 protein_id gnl|my_center|LOCUS_0440 24895 23726 gene locus_tag LOCUS_0450 24895 23726 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355946.1 protein_id gnl|my_center|LOCUS_0450 >Feature sequence003 <1 1371 gene locus_tag LOCUS_0460 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881091.1:ATP-dependent Clp protease ATP-binding subunit 1467 2633 gene locus_tag LOCUS_0470 1467 2633 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941287.1 protein_id gnl|my_center|LOCUS_0470 2691 5030 gene locus_tag LOCUS_0480 2691 5030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 6043 5081 gene locus_tag LOCUS_0490 gene miaA 6043 5081 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759993.1 protein_id gnl|my_center|LOCUS_0490 6087 6293 gene locus_tag LOCUS_0500 6087 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0500 8154 6358 gene locus_tag LOCUS_0510 gene thrS 8154 6358 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058036.1 protein_id gnl|my_center|LOCUS_0510 12068 8499 gene locus_tag LOCUS_0520 12068 8499 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_0520 12331 12984 gene locus_tag LOCUS_0530 12331 12984 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546482.1 protein_id gnl|my_center|LOCUS_0530 14928 13009 gene locus_tag LOCUS_0540 14928 13009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 15103 15537 gene locus_tag LOCUS_0550 15103 15537 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887264.1 protein_id gnl|my_center|LOCUS_0550 15549 16307 gene locus_tag LOCUS_0560 15549 16307 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029261.1 protein_id gnl|my_center|LOCUS_0560 16800 16339 gene locus_tag LOCUS_0570 16800 16339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 17944 17153 gene locus_tag LOCUS_0580 17944 17153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 18152 20233 gene locus_tag LOCUS_0590 18152 20233 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878706.1 protein_id gnl|my_center|LOCUS_0590 20271 21233 gene locus_tag LOCUS_0600 20271 21233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 21311 23044 gene locus_tag LOCUS_0610 21311 23044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 23063 23890 gene locus_tag LOCUS_0620 gene yaaA 23063 23890 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814010.1 protein_id gnl|my_center|LOCUS_0620 23890 24342 gene locus_tag LOCUS_0630 gene rnhA 23890 24342 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770770.1 protein_id gnl|my_center|LOCUS_0630 24380 25957 gene locus_tag LOCUS_0640 24380 25957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 25994 26584 gene locus_tag LOCUS_0650 25994 26584 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021108.1 protein_id gnl|my_center|LOCUS_0650 >Feature sequence004 <1 770 gene locus_tag LOCUS_0660 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256654.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 902 975 gene locus_tag LOCUS_t0010 902 975 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 981 1055 gene locus_tag LOCUS_t0020 981 1055 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1418 2911 gene locus_tag LOCUS_0670 1418 2911 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258481.1 protein_id gnl|my_center|LOCUS_0670 2972 3814 gene locus_tag LOCUS_0680 2972 3814 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_0680 4225 5415 gene locus_tag LOCUS_0690 gene tuf 4225 5415 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040579.1 protein_id gnl|my_center|LOCUS_0690 5536 5859 gene locus_tag LOCUS_0700 gene rpsJ 5536 5859 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_0700 6234 6794 gene locus_tag LOCUS_0710 gene rplC 6234 6794 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290445.1 protein_id gnl|my_center|LOCUS_0710 6829 7458 gene locus_tag LOCUS_0720 gene rplD 6829 7458 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_0720 7482 7889 gene locus_tag LOCUS_0730 7482 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0730 8010 8840 gene locus_tag LOCUS_0740 gene rplB 8010 8840 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727696.1 protein_id gnl|my_center|LOCUS_0740 8877 9191 gene locus_tag LOCUS_0750 gene rpsS 8877 9191 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091384.1 protein_id gnl|my_center|LOCUS_0750 9234 9914 gene locus_tag LOCUS_0760 9234 9914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 9941 10594 gene locus_tag LOCUS_0770 gene rpsC 9941 10594 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957458.1 protein_id gnl|my_center|LOCUS_0770 10647 11057 gene locus_tag LOCUS_0780 gene rplP 10647 11057 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_0780 11094 11288 gene locus_tag LOCUS_0790 11094 11288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 11318 11578 gene locus_tag LOCUS_0800 gene rpsQ 11318 11578 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919136.1 protein_id gnl|my_center|LOCUS_0800 11646 12017 gene locus_tag LOCUS_0810 gene rplN 11646 12017 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_0810 12155 12472 gene locus_tag LOCUS_0820 gene rplX 12155 12472 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547687.1 protein_id gnl|my_center|LOCUS_0820 12521 13084 gene locus_tag LOCUS_0830 gene rplE 12521 13084 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455660.1 protein_id gnl|my_center|LOCUS_0830 13349 13759 gene locus_tag LOCUS_0840 gene rpsH 13349 13759 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099025.1 protein_id gnl|my_center|LOCUS_0840 13795 14334 gene locus_tag LOCUS_0850 gene rplF 13795 14334 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904134.1 protein_id gnl|my_center|LOCUS_0850 14380 14727 gene locus_tag LOCUS_0860 gene rplR 14380 14727 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624044.1 protein_id gnl|my_center|LOCUS_0860 14749 15606 gene locus_tag LOCUS_0870 14749 15606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 15654 16136 gene locus_tag LOCUS_0880 15654 16136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 16560 17372 gene locus_tag LOCUS_0890 gene rlmB 16560 17372 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_0890 17514 18950 gene locus_tag LOCUS_0900 gene pyk 17514 18950 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232673.1 protein_id gnl|my_center|LOCUS_0900 18962 19711 gene locus_tag LOCUS_0910 18962 19711 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897510.1 protein_id gnl|my_center|LOCUS_0910 19839 20048 gene locus_tag LOCUS_0920 19839 20048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 20225 22177 gene locus_tag LOCUS_0930 20225 22177 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_0930 22320 23078 gene locus_tag LOCUS_0940 22320 23078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 23119 23400 gene locus_tag LOCUS_0950 23119 23400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 >Feature sequence005 6 81 gene locus_tag LOCUS_t0030 6 81 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 711 148 gene locus_tag LOCUS_0960 711 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 1507 740 gene locus_tag LOCUS_0970 1507 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 2078 1500 gene locus_tag LOCUS_0980 2078 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 3145 2084 gene locus_tag LOCUS_0990 gene ftsA 3145 2084 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_0990 4768 3344 gene locus_tag LOCUS_1000 4768 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 5399 4785 gene locus_tag LOCUS_1010 5399 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 6789 5407 gene locus_tag LOCUS_1020 6789 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 8092 6866 gene locus_tag LOCUS_1030 8092 6866 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_1030 9944 8229 gene locus_tag LOCUS_1040 gene pilB 9944 8229 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_1040 11898 10240 gene locus_tag LOCUS_1050 gene groL 11898 10240 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567042.1 protein_id gnl|my_center|LOCUS_1050 13148 12096 gene locus_tag LOCUS_1060 gene ychF 13148 12096 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_1060 13932 13186 gene locus_tag LOCUS_1070 13932 13186 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130508.1 protein_id gnl|my_center|LOCUS_1070 14044 14238 gene locus_tag LOCUS_1080 14044 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 16075 14333 gene locus_tag LOCUS_1090 16075 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 17344 16097 gene locus_tag LOCUS_1100 17344 16097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 18399 17410 gene locus_tag LOCUS_1110 gene trpS 18399 17410 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_1110 20761 18557 gene locus_tag LOCUS_1120 20761 18557 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256877.1 protein_id gnl|my_center|LOCUS_1120 23686 21269 gene locus_tag LOCUS_1130 23686 21269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 >Feature sequence006 538 59 gene locus_tag LOCUS_1140 538 59 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480055.1 protein_id gnl|my_center|LOCUS_1140 807 1535 gene locus_tag LOCUS_1150 807 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 2969 1638 gene locus_tag LOCUS_1160 gene ftsZ 2969 1638 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_1160 4467 3190 gene locus_tag LOCUS_1170 gene ftsA 4467 3190 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_1170 4868 4494 gene locus_tag LOCUS_1180 4868 4494 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565665.1 protein_id gnl|my_center|LOCUS_1180 5395 4898 gene locus_tag LOCUS_1190 gene ybeY 5395 4898 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494134.1 protein_id gnl|my_center|LOCUS_1190 5902 5450 gene locus_tag LOCUS_1200 5902 5450 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_1200 6281 6018 gene locus_tag LOCUS_1210 6281 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 6935 6582 gene locus_tag LOCUS_1220 6935 6582 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816465.1 protein_id gnl|my_center|LOCUS_1220 8373 6946 gene locus_tag LOCUS_1230 gene hisS 8373 6946 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 protein_id gnl|my_center|LOCUS_1230 9103 8453 gene locus_tag LOCUS_1240 gene lepB 9103 8453 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358039.1 protein_id gnl|my_center|LOCUS_1240 9349 10746 gene locus_tag LOCUS_1250 9349 10746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 10688 11362 gene locus_tag LOCUS_1260 gene pth 10688 11362 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_1260 11553 12671 gene locus_tag LOCUS_1270 gene dprA 11553 12671 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_1270 12756 15056 gene locus_tag LOCUS_1280 gene topA 12756 15056 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705339.1 protein_id gnl|my_center|LOCUS_1280 17654 15144 gene locus_tag LOCUS_1290 17654 15144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 18111 17677 gene locus_tag LOCUS_1300 18111 17677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 18473 18141 gene locus_tag LOCUS_1310 18473 18141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 >Feature sequence007 491 799 gene locus_tag LOCUS_1320 491 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 1801 911 gene locus_tag LOCUS_1330 1801 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 2019 4904 gene locus_tag LOCUS_1340 2019 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 5276 4908 gene locus_tag LOCUS_1350 5276 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 5703 7637 gene locus_tag LOCUS_1360 5703 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 7798 8088 gene locus_tag LOCUS_1370 7798 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 8096 9118 gene locus_tag LOCUS_1380 8096 9118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 9172 9876 gene locus_tag LOCUS_1390 9172 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 9894 10544 gene locus_tag LOCUS_1400 9894 10544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 10713 11795 gene locus_tag LOCUS_1410 10713 11795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 12923 12051 gene locus_tag LOCUS_1420 12923 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 13200 14759 gene locus_tag LOCUS_1430 13200 14759 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 protein_id gnl|my_center|LOCUS_1430 15337 15065 gene locus_tag LOCUS_1440 15337 15065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 15522 16478 gene locus_tag LOCUS_1450 15522 16478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 16532 16732 gene locus_tag LOCUS_1460 16532 16732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 16838 18139 gene locus_tag LOCUS_1470 16838 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 18281 18481 gene locus_tag LOCUS_1480 18281 18481 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_1480 18787 18527 gene locus_tag LOCUS_1490 18787 18527 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377064.1 protein_id gnl|my_center|LOCUS_1490 18978 20363 gene locus_tag LOCUS_1500 18978 20363 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666062.1 protein_id gnl|my_center|LOCUS_1500 20968 20456 gene locus_tag LOCUS_1510 20968 20456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1510 >Feature sequence008 <1 722 gene locus_tag LOCUS_1520 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873400.1:cysteine--tRNA ligase 1988 804 gene locus_tag LOCUS_1530 1988 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 2774 2139 gene locus_tag LOCUS_1540 2774 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 3734 2787 gene locus_tag LOCUS_1550 3734 2787 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895705.1 protein_id gnl|my_center|LOCUS_1550 3942 5312 gene locus_tag LOCUS_1560 gene dnaB 3942 5312 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_1560 5349 5945 gene locus_tag LOCUS_1570 gene recR 5349 5945 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963454.1 protein_id gnl|my_center|LOCUS_1570 5979 6200 gene locus_tag LOCUS_1580 5979 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 6695 6387 gene locus_tag LOCUS_1590 gene rplU 6695 6387 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_1590 7556 7305 gene locus_tag LOCUS_1600 7556 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 9454 7580 gene locus_tag LOCUS_1610 9454 7580 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_1610 9785 9513 gene locus_tag LOCUS_1620 9785 9513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 10926 9943 gene locus_tag LOCUS_1630 10926 9943 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_1630 12798 10936 gene locus_tag LOCUS_1640 12798 10936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 14142 12877 gene locus_tag LOCUS_1650 14142 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 15231 14215 gene locus_tag LOCUS_1660 15231 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 16374 15346 gene locus_tag LOCUS_1670 16374 15346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 17493 16438 gene locus_tag LOCUS_1680 17493 16438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 18957 17686 gene locus_tag LOCUS_1690 18957 17686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 >Feature sequence009 <1 2638 gene locus_tag LOCUS_1700 <1 2638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436266.1:excinuclease ABC subunit UvrA 2730 3668 gene locus_tag LOCUS_1710 2730 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 3697 4767 gene locus_tag LOCUS_1720 3697 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 5124 6242 gene locus_tag LOCUS_1730 5124 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 6298 7500 gene locus_tag LOCUS_1740 6298 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 8554 10584 gene locus_tag LOCUS_1750 8554 10584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 10581 13232 gene locus_tag LOCUS_1760 10581 13232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1760 13314 14126 gene locus_tag LOCUS_1770 13314 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 14468 14148 gene locus_tag LOCUS_1780 14468 14148 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722920.1 protein_id gnl|my_center|LOCUS_1780 14791 14531 gene locus_tag LOCUS_1790 14791 14531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 15164 14793 gene locus_tag LOCUS_1800 15164 14793 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_1800 16396 15191 gene locus_tag LOCUS_1810 16396 15191 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_1810 16572 18449 gene locus_tag LOCUS_1820 gene dxs 16572 18449 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 protein_id gnl|my_center|LOCUS_1820 >Feature sequence010 1843 935 gene locus_tag LOCUS_1830 gene corA 1843 935 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259376.1 protein_id gnl|my_center|LOCUS_1830 2672 1911 gene locus_tag LOCUS_1840 2672 1911 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_1840 3617 2691 gene locus_tag LOCUS_1850 3617 2691 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921202.1 protein_id gnl|my_center|LOCUS_1850 3751 4311 gene locus_tag LOCUS_1860 3751 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 4465 5682 gene locus_tag LOCUS_1870 4465 5682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 5798 6442 gene locus_tag LOCUS_1880 5798 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1880 7010 7360 gene locus_tag LOCUS_1890 gene rpsL 7010 7360 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142340.1 protein_id gnl|my_center|LOCUS_1890 7398 7865 gene locus_tag LOCUS_1900 gene rpsG 7398 7865 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_1900 7985 10075 gene locus_tag LOCUS_1910 gene fusA 7985 10075 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_1910 10122 10724 gene locus_tag LOCUS_1920 10122 10724 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763353.1 protein_id gnl|my_center|LOCUS_1920 10818 11372 gene locus_tag LOCUS_1930 10818 11372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 11393 12160 gene locus_tag LOCUS_1940 11393 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 12174 13220 gene locus_tag LOCUS_1950 12174 13220 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097157.1 protein_id gnl|my_center|LOCUS_1950 13226 13534 gene locus_tag LOCUS_1960 13226 13534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 13694 14866 gene locus_tag LOCUS_1970 13694 14866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 14959 15681 gene locus_tag LOCUS_1980 14959 15681 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986419.1 protein_id gnl|my_center|LOCUS_1980 15687 16322 gene locus_tag LOCUS_1990 gene scpB 15687 16322 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_1990 16348 17400 gene locus_tag LOCUS_2000 16348 17400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 17466 18566 gene locus_tag LOCUS_2010 gene mraY 17466 18566 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_2010 >Feature sequence011 1233 604 gene locus_tag LOCUS_2020 1233 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 1776 1243 gene locus_tag LOCUS_2030 1776 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 2439 1858 gene locus_tag LOCUS_2040 2439 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 3245 2865 gene locus_tag LOCUS_2050 3245 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 4554 3346 gene locus_tag LOCUS_2060 4554 3346 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_2060 5737 4637 gene locus_tag LOCUS_2070 5737 4637 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_2070 6228 5785 gene locus_tag LOCUS_2080 6228 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 7978 6263 gene locus_tag LOCUS_2090 7978 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 8722 8027 gene locus_tag LOCUS_2100 8722 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 9363 8797 gene locus_tag LOCUS_2110 9363 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 10476 9439 gene locus_tag LOCUS_2120 10476 9439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 10775 13246 gene locus_tag LOCUS_2130 10775 13246 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723897.1 protein_id gnl|my_center|LOCUS_2130 13682 13990 gene locus_tag LOCUS_2140 13682 13990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 14646 14005 gene locus_tag LOCUS_2150 14646 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816577.1 protein_id gnl|my_center|LOCUS_2150 15250 14654 gene locus_tag LOCUS_2160 gene yihA 15250 14654 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 protein_id gnl|my_center|LOCUS_2160 16031 15255 gene locus_tag LOCUS_2170 16031 15255 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002836742.1 protein_id gnl|my_center|LOCUS_2170 16740 16126 gene locus_tag LOCUS_2180 16740 16126 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_2180 17205 16819 gene locus_tag LOCUS_2190 17205 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 >Feature sequence012 759 319 gene locus_tag LOCUS_2200 759 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 976 2013 gene locus_tag LOCUS_2210 976 2013 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480366.1 protein_id gnl|my_center|LOCUS_2210 1994 2215 gene locus_tag LOCUS_2220 1994 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 2348 3538 gene locus_tag LOCUS_2230 2348 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 4774 3542 gene locus_tag LOCUS_2240 4774 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 4979 5191 gene locus_tag LOCUS_2250 4979 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 6689 7468 gene locus_tag LOCUS_2260 gene map 6689 7468 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_2260 7541 7951 gene locus_tag LOCUS_2270 7541 7951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 8133 8921 gene locus_tag LOCUS_2280 8133 8921 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_2280 8966 10045 gene locus_tag LOCUS_2290 gene galT 8966 10045 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_2290 10053 10820 gene locus_tag LOCUS_2300 gene tpiA 10053 10820 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861867.1 protein_id gnl|my_center|LOCUS_2300 11412 13481 gene locus_tag LOCUS_2310 gene gyrB 11412 13481 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_2310 13528 14304 gene locus_tag LOCUS_2320 13528 14304 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257802.1 protein_id gnl|my_center|LOCUS_2320 14371 15021 gene locus_tag LOCUS_2330 14371 15021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 15164 15715 gene locus_tag LOCUS_2340 15164 15715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 15735 16139 gene locus_tag LOCUS_2350 15735 16139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 16267 17274 gene locus_tag LOCUS_2360 gene gap 16267 17274 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_2360 >Feature sequence013 646 1644 gene locus_tag LOCUS_2370 646 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 1752 1678 gene locus_tag LOCUS_t0040 1752 1678 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3888 2014 gene locus_tag LOCUS_2380 gene ftsH 3888 2014 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942598.1 protein_id gnl|my_center|LOCUS_2380 4980 3994 gene locus_tag LOCUS_2390 4980 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 5539 4988 gene locus_tag LOCUS_2400 5539 4988 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_2400 6992 5622 gene locus_tag LOCUS_2410 gene rpsA 6992 5622 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_2410 7328 7990 gene locus_tag LOCUS_2420 7328 7990 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_2420 8030 8383 gene locus_tag LOCUS_2430 8030 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 8506 10968 gene locus_tag LOCUS_2440 gene gyrA 8506 10968 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429305.1 protein_id gnl|my_center|LOCUS_2440 11657 11106 gene locus_tag LOCUS_2450 11657 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2450 12780 13052 gene locus_tag LOCUS_2460 gene rpsO 12780 13052 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_2460 13150 13860 gene locus_tag LOCUS_2470 13150 13860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 14066 16207 gene locus_tag LOCUS_2480 14066 16207 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_2480 >Feature sequence014 86 541 gene locus_tag LOCUS_2490 gene greA 86 541 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391698.1 protein_id gnl|my_center|LOCUS_2490 651 2585 gene locus_tag LOCUS_2500 651 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 2683 3303 gene locus_tag LOCUS_2510 2683 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 3400 3804 gene locus_tag LOCUS_2520 3400 3804 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553178.1 protein_id gnl|my_center|LOCUS_2520 3812 4225 gene locus_tag LOCUS_2530 gene ribL 3812 4225 CDS product FAD synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870692.1 protein_id gnl|my_center|LOCUS_2530 4312 4740 gene locus_tag LOCUS_2540 4312 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 4730 5707 gene locus_tag LOCUS_2550 gene obgE 4730 5707 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871770.1 protein_id gnl|my_center|LOCUS_2550 5780 6871 gene locus_tag LOCUS_2560 5780 6871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 6955 7230 gene locus_tag LOCUS_2570 6955 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 7320 8654 gene locus_tag LOCUS_2580 7320 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 8863 9666 gene locus_tag LOCUS_2590 8863 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 9743 10699 gene locus_tag LOCUS_2600 9743 10699 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_2600 10932 11888 gene locus_tag LOCUS_2610 gene prfB 10932 11888 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056447.1 protein_id gnl|my_center|LOCUS_2610 11988 12674 gene locus_tag LOCUS_2620 gene ftsE 11988 12674 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_2620 12723 13637 gene locus_tag LOCUS_2630 gene ftsX 12723 13637 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263538.1 protein_id gnl|my_center|LOCUS_2630 14857 13691 gene locus_tag LOCUS_2640 14857 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 15581 14916 gene locus_tag LOCUS_2650 15581 14916 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_2650 <16472 15676 gene locus_tag LOCUS_2660 <16472 15676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048315.1:alanine racemase >Feature sequence015 1809 250 gene locus_tag LOCUS_2670 gene gltX 1809 250 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435581.1 protein_id gnl|my_center|LOCUS_2670 2002 1775 gene locus_tag LOCUS_2680 2002 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 2777 2004 gene locus_tag LOCUS_2690 2777 2004 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080843.1 protein_id gnl|my_center|LOCUS_2690 5104 2783 gene locus_tag LOCUS_2700 5104 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 6801 5158 gene locus_tag LOCUS_2710 6801 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 6955 7551 gene locus_tag LOCUS_2720 6955 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 9130 7646 gene locus_tag LOCUS_2730 gene gatB 9130 7646 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_2730 9639 9217 gene locus_tag LOCUS_2740 gene dut 9639 9217 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728566.1 protein_id gnl|my_center|LOCUS_2740 10243 9647 gene locus_tag LOCUS_2750 10243 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 10797 10240 gene locus_tag LOCUS_2760 10797 10240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 11340 10819 gene locus_tag LOCUS_2770 11340 10819 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962499.1 protein_id gnl|my_center|LOCUS_2770 11875 12474 gene locus_tag LOCUS_2780 11875 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 12582 13415 gene locus_tag LOCUS_2790 12582 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2790 13855 13412 gene locus_tag LOCUS_2800 13855 13412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 14831 13863 gene locus_tag LOCUS_2810 14831 13863 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972021.1 protein_id gnl|my_center|LOCUS_2810 15597 15001 gene locus_tag LOCUS_2820 15597 15001 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_2820 >Feature sequence016 25 149 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgtaaagttgcaaaaagaaaagt 1221 295 gene locus_tag LOCUS_2830 gene prmC 1221 295 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_2830 1434 1796 gene locus_tag LOCUS_2840 1434 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 3054 1951 gene locus_tag LOCUS_2850 gene prfA 3054 1951 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_2850 3516 3154 gene locus_tag LOCUS_2860 3516 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2860 3868 4620 gene locus_tag LOCUS_2870 gene rpsB 3868 4620 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933441.1 protein_id gnl|my_center|LOCUS_2870 4717 5301 gene locus_tag LOCUS_2880 gene tsf 4717 5301 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_2880 5424 6014 gene locus_tag LOCUS_2890 5424 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 6131 6204 gene locus_tag LOCUS_t0050 6131 6204 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6292 6376 gene locus_tag LOCUS_t0060 6292 6376 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6427 6500 gene locus_tag LOCUS_t0070 6427 6500 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6566 6637 gene locus_tag LOCUS_t0080 6566 6637 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6750 7460 gene locus_tag LOCUS_2900 gene fabG 6750 7460 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_2900 7861 10227 gene locus_tag LOCUS_2910 7861 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 10257 10925 gene locus_tag LOCUS_2920 gene ung 10257 10925 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759768.1 protein_id gnl|my_center|LOCUS_2920 11167 12933 gene locus_tag LOCUS_2930 gene aspS 11167 12933 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932992.1 protein_id gnl|my_center|LOCUS_2930 13240 13458 gene locus_tag LOCUS_2940 13240 13458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 13475 14644 gene locus_tag LOCUS_2950 13475 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 >Feature sequence017 131 1228 gene locus_tag LOCUS_2960 131 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 2392 1304 gene locus_tag LOCUS_2970 gene ddlA 2392 1304 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121973253.1 protein_id gnl|my_center|LOCUS_2970 2547 4592 gene locus_tag LOCUS_2980 2547 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 4654 5841 gene locus_tag LOCUS_2990 4654 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 5956 7224 gene locus_tag LOCUS_3000 gene secY 5956 7224 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810127.1 protein_id gnl|my_center|LOCUS_3000 7413 7486 gene locus_tag LOCUS_t0090 7413 7486 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7755 9335 gene locus_tag LOCUS_3010 7755 9335 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_3010 9445 10842 gene locus_tag LOCUS_3020 gene murD 9445 10842 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956725.1 protein_id gnl|my_center|LOCUS_3020 10952 12196 gene locus_tag LOCUS_3030 10952 12196 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_3030 12272 12997 gene locus_tag LOCUS_3040 12272 12997 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023677.1 protein_id gnl|my_center|LOCUS_3040 >Feature sequence018 1722 1129 gene locus_tag LOCUS_3050 1722 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 3094 2006 gene locus_tag LOCUS_3060 gene ruvB 3094 2006 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_3060 6516 3505 gene locus_tag LOCUS_3070 6516 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 7851 6688 gene locus_tag LOCUS_3080 7851 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 8543 9118 gene locus_tag LOCUS_3090 gene tsaE 8543 9118 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405136.1 protein_id gnl|my_center|LOCUS_3090 9135 9902 gene locus_tag LOCUS_3100 9135 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 10183 9953 gene locus_tag LOCUS_3110 10183 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 10889 10215 gene locus_tag LOCUS_3120 10889 10215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3120 11365 11078 gene locus_tag LOCUS_3130 11365 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 >Feature sequence019 3098 2871 gene locus_tag LOCUS_3140 3098 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 3632 3498 gene locus_tag LOCUS_3150 3632 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 4811 4002 gene locus_tag LOCUS_3160 gene rsmA 4811 4002 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_3160 5904 4882 gene locus_tag LOCUS_3170 5904 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 6890 6063 gene locus_tag LOCUS_3180 6890 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3180 8532 7003 gene locus_tag LOCUS_3190 8532 7003 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_3190 9054 8605 gene locus_tag LOCUS_3200 9054 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 9412 9065 gene locus_tag LOCUS_3210 9412 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 10641 9454 gene locus_tag LOCUS_3220 gene ispG 10641 9454 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125167.1 protein_id gnl|my_center|LOCUS_3220 11171 10734 gene locus_tag LOCUS_3230 11171 10734 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_3230 >Feature sequence020 1228 656 gene locus_tag LOCUS_3240 1228 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 1932 2150 gene locus_tag LOCUS_3250 1932 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3250 2286 3770 gene locus_tag LOCUS_r0010 2286 3770 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4501 6731 gene locus_tag LOCUS_r0020 4501 6731 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 69 percent of the 23S ribosomal RNA 7943 8029 gene locus_tag LOCUS_r0030 7943 8029 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 73 percent of the 5S ribosomal RNA 8116 9165 gene locus_tag LOCUS_3260 8116 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 9418 9978 gene locus_tag LOCUS_3270 9418 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 >Feature sequence021 140 1090 gene locus_tag LOCUS_3280 140 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 1104 2207 gene locus_tag LOCUS_3290 1104 2207 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840078.1 protein_id gnl|my_center|LOCUS_3290 3829 3596 gene locus_tag LOCUS_3300 3829 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 3990 4262 gene locus_tag LOCUS_3310 3990 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 4266 4613 gene locus_tag LOCUS_3320 4266 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 5130 4660 gene locus_tag LOCUS_3330 5130 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3330 5257 6432 gene locus_tag LOCUS_3340 5257 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 6448 7974 gene locus_tag LOCUS_3350 6448 7974 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762961.1 protein_id gnl|my_center|LOCUS_3350 8003 8614 gene locus_tag LOCUS_3360 8003 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 8611 9897 gene locus_tag LOCUS_3370 8611 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 11823 10000 gene locus_tag LOCUS_3380 11823 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 >Feature sequence022 259 816 gene locus_tag LOCUS_3390 259 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 813 1160 gene locus_tag LOCUS_3400 813 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 1174 1803 gene locus_tag LOCUS_3410 gene trmB 1174 1803 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_3410 2177 4747 gene locus_tag LOCUS_3420 2177 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 4850 6475 gene locus_tag LOCUS_3430 4850 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 6745 7890 gene locus_tag LOCUS_3440 6745 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 8448 7999 gene locus_tag LOCUS_3450 8448 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 8741 9370 gene locus_tag LOCUS_3460 8741 9370 CDS product class D sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047728.1 protein_id gnl|my_center|LOCUS_3460 9385 9753 gene locus_tag LOCUS_3470 9385 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 9765 10358 gene locus_tag LOCUS_3480 9765 10358 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_3480 <11768 10502 gene locus_tag LOCUS_3490 <11768 10502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768413.1:Y-family DNA polymerase >Feature sequence023 1459 308 gene locus_tag LOCUS_3500 1459 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 5328 1522 gene locus_tag LOCUS_3510 5328 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 6664 6077 gene locus_tag LOCUS_3520 6664 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 8586 6754 gene locus_tag LOCUS_3530 8586 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 9281 8598 gene locus_tag LOCUS_3540 9281 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 9997 9455 gene locus_tag LOCUS_3550 9997 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 11504 10152 gene locus_tag LOCUS_3560 11504 10152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3560 >Feature sequence024 <1 3534 gene locus_tag LOCUS_3570 <1 3534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258209.1:lamin tail domain-containing protein 4240 3515 gene locus_tag LOCUS_3580 4240 3515 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263211.1 protein_id gnl|my_center|LOCUS_3580 4401 5123 gene locus_tag LOCUS_3590 4401 5123 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014520.1 protein_id gnl|my_center|LOCUS_3590 5140 5676 gene locus_tag LOCUS_3600 gene ruvC 5140 5676 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_3600 6290 5778 gene locus_tag LOCUS_3610 6290 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 6593 7246 gene locus_tag LOCUS_3620 6593 7246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 7291 8700 gene locus_tag LOCUS_3630 7291 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 >Feature sequence025 <1 739 gene locus_tag LOCUS_3640 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080719.1:phosphopyruvate hydratase 825 1811 gene locus_tag LOCUS_3650 825 1811 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_3650 1863 3128 gene locus_tag LOCUS_3660 1863 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 3146 5128 gene locus_tag LOCUS_3670 3146 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 5372 5590 gene locus_tag LOCUS_3680 gene infA 5372 5590 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_3680 5775 6161 gene locus_tag LOCUS_3690 gene rpsM 5775 6161 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_3690 6233 6691 gene locus_tag LOCUS_3700 gene rpsK 6233 6691 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_3700 6730 7350 gene locus_tag LOCUS_3710 gene rpsD 6730 7350 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557202.1 protein_id gnl|my_center|LOCUS_3710 7396 8100 gene locus_tag LOCUS_3720 7396 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 8154 8582 gene locus_tag LOCUS_3730 8154 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 8594 8995 gene locus_tag LOCUS_3740 gene rplM 8594 8995 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_3740 9009 9500 gene locus_tag LOCUS_3750 gene rpsI 9009 9500 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280533.1 protein_id gnl|my_center|LOCUS_3750 9702 10289 gene locus_tag LOCUS_3760 9702 10289 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946355.1 protein_id gnl|my_center|LOCUS_3760 10279 10857 gene locus_tag LOCUS_3770 10279 10857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 >Feature sequence026 1222 992 gene locus_tag LOCUS_3780 1222 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 3170 1194 gene locus_tag LOCUS_3790 3170 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 5102 3198 gene locus_tag LOCUS_3800 5102 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 5534 5328 gene locus_tag LOCUS_3810 5534 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 6607 5558 gene locus_tag LOCUS_3820 gene fba 6607 5558 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225784.1 protein_id gnl|my_center|LOCUS_3820 7315 6701 gene locus_tag LOCUS_3830 7315 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3830 >Feature sequence027 121 49 gene locus_tag LOCUS_t0100 121 49 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 322 101 gene locus_tag LOCUS_3840 322 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 2061 406 gene locus_tag LOCUS_3850 gene dnaX 2061 406 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000121588.1 protein_id gnl|my_center|LOCUS_3850 2194 3117 gene locus_tag LOCUS_3860 gene murB 2194 3117 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836888.1 protein_id gnl|my_center|LOCUS_3860 3221 3571 gene locus_tag LOCUS_3870 3221 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 3636 4451 gene locus_tag LOCUS_3880 gene lgt 3636 4451 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932768.1 protein_id gnl|my_center|LOCUS_3880 4541 5788 gene locus_tag LOCUS_3890 4541 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3890 6805 5870 gene locus_tag LOCUS_3900 6805 5870 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942295.1 protein_id gnl|my_center|LOCUS_3900 6906 8108 gene locus_tag LOCUS_3910 6906 8108 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_3910 8139 8711 gene locus_tag LOCUS_3920 8139 8711 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_3920 8751 9242 gene locus_tag LOCUS_3930 8751 9242 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_3930 9380 9538 gene locus_tag LOCUS_3940 9380 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 9913 9563 gene locus_tag LOCUS_3950 gene rplT 9913 9563 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553161.1 protein_id gnl|my_center|LOCUS_3950 10150 9956 gene locus_tag LOCUS_3960 10150 9956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 10743 10249 gene locus_tag LOCUS_3970 10743 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 >Feature sequence028 1215 2582 gene locus_tag LOCUS_3980 1215 2582 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_3980 2622 2966 gene locus_tag LOCUS_3990 2622 2966 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887808.1 protein_id gnl|my_center|LOCUS_3990 3030 4196 gene locus_tag LOCUS_4000 3030 4196 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_4000 4219 4848 gene locus_tag LOCUS_4010 4219 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 4897 6090 gene locus_tag LOCUS_4020 4897 6090 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259094.1 protein_id gnl|my_center|LOCUS_4020 6532 7029 gene locus_tag LOCUS_4030 gene nusB 6532 7029 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_4030 7140 7826 gene locus_tag LOCUS_4040 gene rnc 7140 7826 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661489.1 protein_id gnl|my_center|LOCUS_4040 8008 10326 gene locus_tag LOCUS_4050 8008 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 10431 10853 gene locus_tag LOCUS_4060 10431 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 >Feature sequence029 1363 359 gene locus_tag LOCUS_4070 gene galE 1363 359 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_4070 2470 1403 gene locus_tag LOCUS_4080 2470 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 2604 3542 gene locus_tag LOCUS_4090 2604 3542 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021208.1 protein_id gnl|my_center|LOCUS_4090 3606 4946 gene locus_tag LOCUS_4100 3606 4946 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_4100 5005 6165 gene locus_tag LOCUS_4110 5005 6165 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_4110 6176 7156 gene locus_tag LOCUS_4120 6176 7156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 7250 8581 gene locus_tag LOCUS_4130 gene serS 7250 8581 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_4130 8585 9718 gene locus_tag LOCUS_4140 8585 9718 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_4140 10091 9744 gene locus_tag LOCUS_4150 10091 9744 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921253.1 protein_id gnl|my_center|LOCUS_4150 10869 10111 gene locus_tag LOCUS_4160 10869 10111 CDS product putative folate metabolism gamma-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871979.1 protein_id gnl|my_center|LOCUS_4160 >Feature sequence030 503 123 gene locus_tag LOCUS_4170 503 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 923 519 gene locus_tag LOCUS_4180 923 519 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165969.1 protein_id gnl|my_center|LOCUS_4180 1379 1053 gene locus_tag LOCUS_4190 1379 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529006.1 protein_id gnl|my_center|LOCUS_4190 1737 1396 gene locus_tag LOCUS_4200 1737 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 2695 2036 gene locus_tag LOCUS_4210 2695 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 2937 2864 gene locus_tag LOCUS_t0110 2937 2864 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3938 3108 gene locus_tag LOCUS_4220 3938 3108 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_4220 4347 3931 gene locus_tag LOCUS_4230 4347 3931 CDS product DUF2177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316411.1 protein_id gnl|my_center|LOCUS_4230 5247 4399 gene locus_tag LOCUS_4240 5247 4399 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098225.1 protein_id gnl|my_center|LOCUS_4240 6909 6064 gene locus_tag LOCUS_4250 6909 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 7038 7226 gene locus_tag LOCUS_4260 7038 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 8097 7492 gene locus_tag LOCUS_4270 gene sodA 8097 7492 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_4270 9094 8165 gene locus_tag LOCUS_4280 9094 8165 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272579.1 protein_id gnl|my_center|LOCUS_4280 9573 9169 gene locus_tag LOCUS_4290 9573 9169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 10048 9593 gene locus_tag LOCUS_4300 10048 9593 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265697.1 protein_id gnl|my_center|LOCUS_4300 >Feature sequence031 712 1353 gene locus_tag LOCUS_4310 712 1353 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_4310 1389 2588 gene locus_tag LOCUS_4320 1389 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 2625 3581 gene locus_tag LOCUS_4330 2625 3581 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706039.1 protein_id gnl|my_center|LOCUS_4330 3766 4512 gene locus_tag LOCUS_4340 3766 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 4645 5466 gene locus_tag LOCUS_4350 gene estA 4645 5466 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000761976.1 protein_id gnl|my_center|LOCUS_4350 5485 6678 gene locus_tag LOCUS_4360 5485 6678 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583323.1 protein_id gnl|my_center|LOCUS_4360 8776 6683 gene locus_tag LOCUS_4370 gene recG 8776 6683 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_4370 9493 9137 gene locus_tag LOCUS_4380 9493 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 >Feature sequence032 386 898 gene locus_tag LOCUS_4390 386 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 1116 1481 gene locus_tag LOCUS_4400 1116 1481 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288180.1 protein_id gnl|my_center|LOCUS_4400 2003 1590 gene locus_tag LOCUS_4410 2003 1590 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_4410 3187 2117 gene locus_tag LOCUS_4420 3187 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 3339 4373 gene locus_tag LOCUS_4430 3339 4373 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976297.1 protein_id gnl|my_center|LOCUS_4430 4380 5135 gene locus_tag LOCUS_4440 4380 5135 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082707.1 protein_id gnl|my_center|LOCUS_4440 5145 5951 gene locus_tag LOCUS_4450 5145 5951 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906310.1 protein_id gnl|my_center|LOCUS_4450 5997 6416 gene locus_tag LOCUS_4460 5997 6416 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964989.1 protein_id gnl|my_center|LOCUS_4460 7184 6687 gene locus_tag LOCUS_4470 7184 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 8380 7958 gene locus_tag LOCUS_4480 8380 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 8878 9480 gene locus_tag LOCUS_4490 8878 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 9669 10511 gene locus_tag LOCUS_4500 9669 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 >Feature sequence033 3063 640 gene locus_tag LOCUS_4510 3063 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 6776 3198 gene locus_tag LOCUS_4520 6776 3198 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005077661.1 protein_id gnl|my_center|LOCUS_4520 10329 6844 gene locus_tag LOCUS_4530 10329 6844 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256763.1 protein_id gnl|my_center|LOCUS_4530 >Feature sequence034 69 431 gene locus_tag LOCUS_4540 69 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 428 724 gene locus_tag LOCUS_4550 428 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 1277 816 gene locus_tag LOCUS_4560 1277 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4560 2380 1337 gene locus_tag LOCUS_4570 2380 1337 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_4570 2535 5474 gene locus_tag LOCUS_4580 gene uvrA 2535 5474 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_4580 5535 6605 gene locus_tag LOCUS_4590 5535 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 6669 7946 gene locus_tag LOCUS_4600 6669 7946 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_4600 8000 9985 gene locus_tag LOCUS_4610 8000 9985 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974668.1 protein_id gnl|my_center|LOCUS_4610 >Feature sequence035 357 1103 gene locus_tag LOCUS_4620 357 1103 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020659.1 protein_id gnl|my_center|LOCUS_4620 1151 2002 gene locus_tag LOCUS_4630 1151 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 2063 3136 gene locus_tag LOCUS_4640 2063 3136 CDS product DUF6159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227845.1 protein_id gnl|my_center|LOCUS_4640 3263 3191 gene locus_tag LOCUS_t0120 3263 3191 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3426 4454 gene locus_tag LOCUS_4650 3426 4454 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530638.1 protein_id gnl|my_center|LOCUS_4650 4457 4897 gene locus_tag LOCUS_4660 4457 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 5286 8255 gene locus_tag LOCUS_4670 5286 8255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 8385 8458 gene locus_tag LOCUS_t0130 8385 8458 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8532 8604 gene locus_tag LOCUS_t0140 8532 8604 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8831 9031 gene locus_tag LOCUS_4680 8831 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 9018 9284 gene locus_tag LOCUS_4690 9018 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 10097 9321 gene locus_tag LOCUS_4700 10097 9321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 >Feature sequence036 257 185 gene locus_tag LOCUS_t0150 257 185 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 410 784 gene locus_tag LOCUS_4710 410 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 1473 892 gene locus_tag LOCUS_4720 1473 892 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_4720 1531 2655 gene locus_tag LOCUS_4730 gene tsaD 1531 2655 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244138.1 protein_id gnl|my_center|LOCUS_4730 3010 4083 gene locus_tag LOCUS_4740 3010 4083 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086489.1 protein_id gnl|my_center|LOCUS_4740 4142 4906 gene locus_tag LOCUS_4750 4142 4906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_4750 4988 6232 gene locus_tag LOCUS_4760 4988 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 6241 7488 gene locus_tag LOCUS_4770 6241 7488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_4770 8063 7623 gene locus_tag LOCUS_4780 8063 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4780 >Feature sequence037 1138 749 gene locus_tag LOCUS_4790 1138 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4790 2177 1227 gene locus_tag LOCUS_4800 gene rsmH 2177 1227 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861627.1 protein_id gnl|my_center|LOCUS_4800 2770 2321 gene locus_tag LOCUS_4810 gene mraZ 2770 2321 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392353.1 protein_id gnl|my_center|LOCUS_4810 3079 3570 gene locus_tag LOCUS_4820 gene def 3079 3570 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583792.1 protein_id gnl|my_center|LOCUS_4820 3612 4628 gene locus_tag LOCUS_4830 gene fmt 3612 4628 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004473.1 protein_id gnl|my_center|LOCUS_4830 4638 5477 gene locus_tag LOCUS_4840 4638 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 5981 5718 gene locus_tag LOCUS_4850 gene groES 5981 5718 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_4850 7488 6076 gene locus_tag LOCUS_4860 7488 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 8338 7508 gene locus_tag LOCUS_4870 8338 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 9568 8405 gene locus_tag LOCUS_4880 9568 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 >Feature sequence038 418 735 gene locus_tag LOCUS_4890 418 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 1477 860 gene locus_tag LOCUS_4900 1477 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 1590 3068 gene locus_tag LOCUS_4910 1590 3068 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_4910 6204 3169 gene locus_tag LOCUS_4920 6204 3169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 6531 7133 gene locus_tag LOCUS_4930 6531 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 7245 8348 gene locus_tag LOCUS_4940 7245 8348 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002268877.1 protein_id gnl|my_center|LOCUS_4940 >Feature sequence039 295 2592 gene locus_tag LOCUS_4950 295 2592 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387755.1 protein_id gnl|my_center|LOCUS_4950 2678 4768 gene locus_tag LOCUS_4960 2678 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 6827 4995 gene locus_tag LOCUS_4970 6827 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 7332 6817 gene locus_tag LOCUS_4980 7332 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 8976 7360 gene locus_tag LOCUS_4990 8976 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 <9479 8955 gene locus_tag LOCUS_5000 <9479 8955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962575.1:UDP-glucose 4-epimerase GalE >Feature sequence040 341 1294 gene locus_tag LOCUS_5010 341 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 1363 2712 gene locus_tag LOCUS_5020 1363 2712 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_5020 3402 2935 gene locus_tag LOCUS_5030 3402 2935 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_5030 3503 4096 gene locus_tag LOCUS_5040 3503 4096 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764419.1 protein_id gnl|my_center|LOCUS_5040 4143 5051 gene locus_tag LOCUS_5050 4143 5051 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460068.1 protein_id gnl|my_center|LOCUS_5050 5138 5500 gene locus_tag LOCUS_5060 5138 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 5501 6331 gene locus_tag LOCUS_5070 gene dapD 5501 6331 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191680.1 protein_id gnl|my_center|LOCUS_5070 6410 6856 gene locus_tag LOCUS_5080 6410 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 6921 7271 gene locus_tag LOCUS_5090 6921 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 7398 8858 gene locus_tag LOCUS_5100 gene pyk 7398 8858 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869581.1 protein_id gnl|my_center|LOCUS_5100 9061 9324 gene locus_tag LOCUS_5110 9061 9324 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730347.1 protein_id gnl|my_center|LOCUS_5110 >Feature sequence041 3057 1900 gene locus_tag LOCUS_5120 3057 1900 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_5120 3748 3203 gene locus_tag LOCUS_5130 3748 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 4561 3824 gene locus_tag LOCUS_5140 4561 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 5236 4595 gene locus_tag LOCUS_5150 5236 4595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 5670 5311 gene locus_tag LOCUS_5160 5670 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 5883 5674 gene locus_tag LOCUS_5170 5883 5674 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966860.1 protein_id gnl|my_center|LOCUS_5170 7115 5943 gene locus_tag LOCUS_5180 7115 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 <9071 8118 gene locus_tag LOCUS_5190 <9071 8118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403686.1:efflux RND transporter permease subunit >Feature sequence042 772 185 gene locus_tag LOCUS_5200 772 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 2572 1151 gene locus_tag LOCUS_5210 2572 1151 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_5210 2744 4006 gene locus_tag LOCUS_5220 2744 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 4098 4424 gene locus_tag LOCUS_5230 4098 4424 CDS product DUF2853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531020.1 protein_id gnl|my_center|LOCUS_5230 5850 4681 gene locus_tag LOCUS_5240 5850 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 6153 6365 gene locus_tag LOCUS_5250 6153 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 6403 7461 gene locus_tag LOCUS_5260 6403 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 7648 8286 gene locus_tag LOCUS_5270 7648 8286 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932189.1 protein_id gnl|my_center|LOCUS_5270 8283 9053 gene locus_tag LOCUS_5280 8283 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 >Feature sequence043 1496 894 gene locus_tag LOCUS_5290 1496 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 2391 1648 gene locus_tag LOCUS_5300 2391 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 3656 2586 gene locus_tag LOCUS_5310 3656 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 4941 3742 gene locus_tag LOCUS_5320 4941 3742 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_5320 6149 5160 gene locus_tag LOCUS_5330 6149 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 7181 6159 gene locus_tag LOCUS_5340 7181 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 <8558 7382 gene locus_tag LOCUS_5350 <8558 7382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228311.1:glycoside hydrolase family 18 protein >Feature sequence044 509 1822 gene locus_tag LOCUS_5360 509 1822 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929956.1 protein_id gnl|my_center|LOCUS_5360 1911 2927 gene locus_tag LOCUS_5370 1911 2927 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_5370 3008 4141 gene locus_tag LOCUS_5380 3008 4141 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_5380 4215 5336 gene locus_tag LOCUS_5390 4215 5336 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_5390 5393 6271 gene locus_tag LOCUS_5400 5393 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5400 6279 7277 gene locus_tag LOCUS_5410 6279 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 >Feature sequence045 1575 610 gene locus_tag LOCUS_5420 1575 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5420 2605 1586 gene locus_tag LOCUS_5430 2605 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 3560 2940 gene locus_tag LOCUS_5440 3560 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 3773 4759 gene locus_tag LOCUS_5450 3773 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 7570 4826 gene locus_tag LOCUS_5460 7570 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 >Feature sequence046 157 669 gene locus_tag LOCUS_5470 gene rplJ 157 669 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390507.1 protein_id gnl|my_center|LOCUS_5470 696 1067 gene locus_tag LOCUS_5480 gene rplL 696 1067 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782165.1 protein_id gnl|my_center|LOCUS_5480 1154 2047 gene locus_tag LOCUS_5490 1154 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 2073 3026 gene locus_tag LOCUS_5500 gene ispH 2073 3026 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930264.1 protein_id gnl|my_center|LOCUS_5500 3163 4254 gene locus_tag LOCUS_5510 3163 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 4380 5456 gene locus_tag LOCUS_5520 gene dnaJ 4380 5456 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640710.1 protein_id gnl|my_center|LOCUS_5520 5484 6725 gene locus_tag LOCUS_5530 5484 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 6780 7457 gene locus_tag LOCUS_5540 6780 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 >Feature sequence047 <1 2010 gene locus_tag LOCUS_5550 <1 2010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256978.1:DUF11 domain-containing protein 2146 4560 gene locus_tag LOCUS_5560 2146 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 5045 5740 gene locus_tag LOCUS_5570 5045 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 5812 6837 gene locus_tag LOCUS_5580 5812 6837 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082225.1 protein_id gnl|my_center|LOCUS_5580 6842 7498 gene locus_tag LOCUS_5590 6842 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 >Feature sequence048 65 1852 gene locus_tag LOCUS_5600 65 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 1950 2603 gene locus_tag LOCUS_5610 1950 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 2827 3855 gene locus_tag LOCUS_5620 2827 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 3911 7243 gene locus_tag LOCUS_5630 3911 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 >Feature sequence049 2113 1031 gene locus_tag LOCUS_5640 gene truD 2113 1031 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867746.1 protein_id gnl|my_center|LOCUS_5640 2360 2935 gene locus_tag LOCUS_5650 2360 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 3148 4671 gene locus_tag LOCUS_5660 3148 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5660 4764 6611 gene locus_tag LOCUS_5670 4764 6611 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225853.1 protein_id gnl|my_center|LOCUS_5670 6961 6692 gene locus_tag LOCUS_5680 6961 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5680 >Feature sequence050 542 2434 gene locus_tag LOCUS_5690 542 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 2669 3922 gene locus_tag LOCUS_5700 2669 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 4286 6070 gene locus_tag LOCUS_5710 gene recQ 4286 6070 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941564.1 protein_id gnl|my_center|LOCUS_5710 6401 6150 gene locus_tag LOCUS_5720 6401 6150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 >Feature sequence051 3182 1269 gene locus_tag LOCUS_5730 gene infB 3182 1269 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965108.1 protein_id gnl|my_center|LOCUS_5730 3773 3264 gene locus_tag LOCUS_5740 3773 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 4635 3952 gene locus_tag LOCUS_5750 4635 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 4826 5527 gene locus_tag LOCUS_5760 4826 5527 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918869.1 protein_id gnl|my_center|LOCUS_5760 6316 5648 gene locus_tag LOCUS_5770 6316 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 6690 6334 gene locus_tag LOCUS_5780 6690 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 7005 7319 gene locus_tag LOCUS_5790 7005 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 >Feature sequence052 505 828 gene locus_tag LOCUS_5800 505 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5800 1439 1104 gene locus_tag LOCUS_5810 1439 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5810 2461 1802 gene locus_tag LOCUS_5820 2461 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 3008 2613 gene locus_tag LOCUS_5830 3008 2613 CDS product SMI1/KNR4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760706.1 protein_id gnl|my_center|LOCUS_5830 3211 3139 gene locus_tag LOCUS_t0160 3211 3139 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3530 3276 gene locus_tag LOCUS_5840 3530 3276 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699814.1 protein_id gnl|my_center|LOCUS_5840 3704 3631 gene locus_tag LOCUS_t0170 3704 3631 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3827 3755 gene locus_tag LOCUS_t0180 3827 3755 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4149 4075 gene locus_tag LOCUS_t0190 4149 4075 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4433 4348 gene locus_tag LOCUS_t0200 4433 4348 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5202 4684 gene locus_tag LOCUS_5850 5202 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 5491 6687 gene locus_tag LOCUS_5860 5491 6687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 >Feature sequence053 47 1393 gene locus_tag LOCUS_5870 47 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 1545 1988 gene locus_tag LOCUS_5880 gene rplI 1545 1988 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869406.1 protein_id gnl|my_center|LOCUS_5880 2113 3777 gene locus_tag LOCUS_5890 gene pyrG 2113 3777 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_5890 3876 4802 gene locus_tag LOCUS_5900 3876 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 5207 4920 gene locus_tag LOCUS_5910 gene rpmA 5207 4920 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094760.1 protein_id gnl|my_center|LOCUS_5910 5347 5796 gene locus_tag LOCUS_5920 5347 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5920 5815 6525 gene locus_tag LOCUS_5930 gene pyrH 5815 6525 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668261.1 protein_id gnl|my_center|LOCUS_5930 >Feature sequence054 2124 475 gene locus_tag LOCUS_5940 2124 475 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_5940 2637 2353 gene locus_tag LOCUS_5950 2637 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 3624 2734 gene locus_tag LOCUS_5960 3624 2734 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249767.1 protein_id gnl|my_center|LOCUS_5960 5413 3701 gene locus_tag LOCUS_5970 5413 3701 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080205.1 protein_id gnl|my_center|LOCUS_5970 6672 5536 gene locus_tag LOCUS_5980 6672 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 7181 6960 gene locus_tag LOCUS_5990 7181 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 >Feature sequence055 204 476 gene locus_tag LOCUS_6000 204 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 2225 948 gene locus_tag LOCUS_6010 2225 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 3049 2222 gene locus_tag LOCUS_6020 3049 2222 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_6020 3896 3000 gene locus_tag LOCUS_6030 3896 3000 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143639.1 protein_id gnl|my_center|LOCUS_6030 5406 3994 gene locus_tag LOCUS_6040 5406 3994 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_6040 5870 5403 gene locus_tag LOCUS_6050 5870 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 6659 5904 gene locus_tag LOCUS_6060 6659 5904 CDS product YidC/Oxa1 family membrane protein insertase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903598.1 protein_id gnl|my_center|LOCUS_6060 >Feature sequence056 2399 636 gene locus_tag LOCUS_6070 2399 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 4224 2404 gene locus_tag LOCUS_6080 4224 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 6092 4275 gene locus_tag LOCUS_6090 6092 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 6371 6589 gene locus_tag LOCUS_6100 6371 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 >Feature sequence057 919 272 gene locus_tag LOCUS_6110 919 272 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058035.1 protein_id gnl|my_center|LOCUS_6110 1666 1067 gene locus_tag LOCUS_6120 gene aqpZ 1666 1067 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089853.1 protein_id gnl|my_center|LOCUS_6120 2645 1773 gene locus_tag LOCUS_6130 2645 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 2945 2745 gene locus_tag LOCUS_6140 2945 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 3698 4210 gene locus_tag LOCUS_6150 3698 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 4623 4342 gene locus_tag LOCUS_6160 4623 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 5387 4734 gene locus_tag LOCUS_6170 5387 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 6129 5398 gene locus_tag LOCUS_6180 gene pyrF 6129 5398 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460654.1 protein_id gnl|my_center|LOCUS_6180 >Feature sequence058 232 4983 gene locus_tag LOCUS_6190 232 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6190 5035 5709 gene locus_tag LOCUS_6200 5035 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 >Feature sequence059 29 910 gene locus_tag LOCUS_6210 29 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6210 2091 1528 gene locus_tag LOCUS_6220 2091 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 2714 2211 gene locus_tag LOCUS_6230 2714 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 3265 2711 gene locus_tag LOCUS_6240 3265 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 3873 3325 gene locus_tag LOCUS_6250 3873 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 5990 4041 gene locus_tag LOCUS_6260 gene dnaK 5990 4041 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_6260 >Feature sequence060 109 879 gene locus_tag LOCUS_6270 109 879 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_6270 897 2027 gene locus_tag LOCUS_6280 897 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 3588 2086 gene locus_tag LOCUS_6290 3588 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 3836 4858 gene locus_tag LOCUS_6300 3836 4858 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287490.1 protein_id gnl|my_center|LOCUS_6300 5015 6088 gene locus_tag LOCUS_6310 gene mnmA 5015 6088 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657419.1 protein_id gnl|my_center|LOCUS_6310 >Feature sequence061 379 897 gene locus_tag LOCUS_6320 379 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 956 2602 gene locus_tag LOCUS_6330 956 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 2656 3222 gene locus_tag LOCUS_6340 gene rfbC 2656 3222 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_6340 3229 4236 gene locus_tag LOCUS_6350 gene rfbB 3229 4236 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_6350 4330 5031 gene locus_tag LOCUS_6360 4330 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6360 5065 6045 gene locus_tag LOCUS_6370 gene rfbD 5065 6045 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476435.1 protein_id gnl|my_center|LOCUS_6370 6195 6267 gene locus_tag LOCUS_t0210 6195 6267 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence062 3139 1718 gene locus_tag LOCUS_6380 3139 1718 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_6380 3801 3316 gene locus_tag LOCUS_6390 3801 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 4044 4244 gene locus_tag LOCUS_6400 4044 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 4772 4359 gene locus_tag LOCUS_6410 4772 4359 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255278.1 protein_id gnl|my_center|LOCUS_6410 6166 4799 gene locus_tag LOCUS_6420 gene atpD 6166 4799 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425850.1 protein_id gnl|my_center|LOCUS_6420 >Feature sequence063 <1 801 gene locus_tag LOCUS_6430 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460386.1:pitrilysin family protein 908 1885 gene locus_tag LOCUS_6440 908 1885 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_6440 1919 2593 gene locus_tag LOCUS_6450 gene rsmI 1919 2593 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_6450 2872 2612 gene locus_tag LOCUS_6460 2872 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 3030 4481 gene locus_tag LOCUS_6470 gene metG 3030 4481 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_6470 4488 4922 gene locus_tag LOCUS_6480 4488 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 4945 5673 gene locus_tag LOCUS_6490 4945 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6490 >Feature sequence064 1627 287 gene locus_tag LOCUS_6500 gene hisS 1627 287 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_6500 2252 1683 gene locus_tag LOCUS_6510 2252 1683 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817342.1 protein_id gnl|my_center|LOCUS_6510 2340 3356 gene locus_tag LOCUS_6520 2340 3356 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066832.1 protein_id gnl|my_center|LOCUS_6520 3491 3904 gene locus_tag LOCUS_6530 3491 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 4872 3982 gene locus_tag LOCUS_6540 4872 3982 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_6540 >Feature sequence065 398 739 gene locus_tag LOCUS_6550 398 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6550 839 2077 gene locus_tag LOCUS_6560 839 2077 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963649.1 protein_id gnl|my_center|LOCUS_6560 2087 3070 gene locus_tag LOCUS_6570 2087 3070 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719999.1 protein_id gnl|my_center|LOCUS_6570 3112 4848 gene locus_tag LOCUS_6580 3112 4848 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_6580 4874 5398 gene locus_tag LOCUS_6590 4874 5398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 >Feature sequence066 744 280 gene locus_tag LOCUS_6600 744 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 874 2280 gene locus_tag LOCUS_6610 gene sufB 874 2280 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_6610 2330 2902 gene locus_tag LOCUS_6620 2330 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 3716 2940 gene locus_tag LOCUS_6630 3716 2940 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947815.1 protein_id gnl|my_center|LOCUS_6630 4972 3728 gene locus_tag LOCUS_6640 gene msrB 4972 3728 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479994.1 protein_id gnl|my_center|LOCUS_6640 <5716 5112 gene locus_tag LOCUS_6650 <5716 5112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707088.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence067 707 1036 gene locus_tag LOCUS_6660 707 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 1071 1766 gene locus_tag LOCUS_6670 1071 1766 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157650.1 protein_id gnl|my_center|LOCUS_6670 2011 3303 gene locus_tag LOCUS_6680 2011 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 3330 5039 gene locus_tag LOCUS_6690 gene argS 3330 5039 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_6690 >Feature sequence068 855 2081 gene locus_tag LOCUS_6700 855 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 2193 3164 gene locus_tag LOCUS_6710 2193 3164 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393837.1 protein_id gnl|my_center|LOCUS_6710 3238 4437 gene locus_tag LOCUS_6720 3238 4437 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250672.1 protein_id gnl|my_center|LOCUS_6720 5086 4553 gene locus_tag LOCUS_6730 5086 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6730 >Feature sequence069 658 239 gene locus_tag LOCUS_6740 658 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6740 1330 707 gene locus_tag LOCUS_6750 1330 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 1983 1504 gene locus_tag LOCUS_6760 1983 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 2434 2111 gene locus_tag LOCUS_6770 2434 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 2799 2521 gene locus_tag LOCUS_6780 2799 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 3306 2821 gene locus_tag LOCUS_6790 3306 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 4702 3311 gene locus_tag LOCUS_6800 4702 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6800 >Feature sequence070 314 141 gene locus_tag LOCUS_6810 314 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 384 974 gene locus_tag LOCUS_6820 384 974 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258926.1 protein_id gnl|my_center|LOCUS_6820 1192 1425 gene locus_tag LOCUS_6830 1192 1425 CDS product DUF1653 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948275.1 protein_id gnl|my_center|LOCUS_6830 1435 1779 gene locus_tag LOCUS_6840 1435 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 1812 2339 gene locus_tag LOCUS_6850 gene yjjX 1812 2339 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261320.1 protein_id gnl|my_center|LOCUS_6850 2496 2981 gene locus_tag LOCUS_6860 2496 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 >Feature sequence071 1382 216 gene locus_tag LOCUS_6870 1382 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 2560 1469 gene locus_tag LOCUS_6880 2560 1469 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948179.1 protein_id gnl|my_center|LOCUS_6880 3654 2581 gene locus_tag LOCUS_6890 3654 2581 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_6890 <4915 3857 gene locus_tag LOCUS_6900 <4915 3857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000148852.1:glucose-6-phosphate isomerase >Feature sequence072 149 61 gene locus_tag LOCUS_t0220 149 61 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 237 950 gene locus_tag LOCUS_6910 237 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 1056 1928 gene locus_tag LOCUS_6920 1056 1928 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435866.1 protein_id gnl|my_center|LOCUS_6920 2507 3409 gene locus_tag LOCUS_6930 gene atpB 2507 3409 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878188.1 protein_id gnl|my_center|LOCUS_6930 3504 3749 gene locus_tag LOCUS_6940 3504 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 3969 4454 gene locus_tag LOCUS_6950 gene atpF 3969 4454 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099406.1 protein_id gnl|my_center|LOCUS_6950 >Feature sequence073 4712 3609 gene locus_tag LOCUS_6960 4712 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6960 >Feature sequence074 271 1506 gene locus_tag LOCUS_6970 271 1506 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919797.1 protein_id gnl|my_center|LOCUS_6970 1598 2002 gene locus_tag LOCUS_6980 1598 2002 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106829.1 protein_id gnl|my_center|LOCUS_6980 2009 2983 gene locus_tag LOCUS_6990 2009 2983 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742245.1 protein_id gnl|my_center|LOCUS_6990 3002 3559 gene locus_tag LOCUS_7000 3002 3559 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_7000 4007 3570 gene locus_tag LOCUS_7010 4007 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 >Feature sequence075 106 429 gene locus_tag LOCUS_7020 106 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 661 933 gene locus_tag LOCUS_7030 gene rpsT 661 933 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004617408.1 protein_id gnl|my_center|LOCUS_7030 1957 1010 gene locus_tag LOCUS_7040 gene holA 1957 1010 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229987.1 protein_id gnl|my_center|LOCUS_7040 3308 2061 gene locus_tag LOCUS_7050 3308 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 <4625 3455 gene locus_tag LOCUS_7060 <4625 3455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260947.1:DNA polymerase I >Feature sequence076 1653 568 gene locus_tag LOCUS_7070 1653 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 1783 2229 gene locus_tag LOCUS_7080 gene smpB 1783 2229 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001123905.1 protein_id gnl|my_center|LOCUS_7080 2323 2742 gene locus_tag LOCUS_tm0010 2323 2742 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 <4598 2847 gene locus_tag LOCUS_7090 <4598 2847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227075.1:discoidin domain-containing protein >Feature sequence077 475 1506 gene locus_tag LOCUS_7100 gene mltG 475 1506 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944665.1 protein_id gnl|my_center|LOCUS_7100 1627 2298 gene locus_tag LOCUS_7110 1627 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 3288 2374 gene locus_tag LOCUS_7120 3288 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7120 >Feature sequence078 <1 652 gene locus_tag LOCUS_7130 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000020273.1:methylated-DNA--[protein]-cysteine S-methyltransferase 778 1554 gene locus_tag LOCUS_7140 778 1554 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222468.1 protein_id gnl|my_center|LOCUS_7140 1917 1600 gene locus_tag LOCUS_7150 1917 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 2124 2462 gene locus_tag LOCUS_7160 2124 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7160 3016 2564 gene locus_tag LOCUS_7170 3016 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7170 <4322 3066 gene locus_tag LOCUS_7180 <4322 3066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948005.1:leucine--tRNA ligase >Feature sequence079 399 1169 gene locus_tag LOCUS_7190 399 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 1181 2878 gene locus_tag LOCUS_7200 1181 2878 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726840.1 protein_id gnl|my_center|LOCUS_7200 2927 3262 gene locus_tag LOCUS_7210 2927 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7210 3349 4092 gene locus_tag LOCUS_7220 3349 4092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7220 >Feature sequence080 682 431 gene locus_tag LOCUS_7230 682 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 820 2034 gene locus_tag LOCUS_7240 820 2034 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_7240 2408 3652 gene locus_tag LOCUS_7250 2408 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7250 3642 4175 gene locus_tag LOCUS_7260 3642 4175 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791456.1 protein_id gnl|my_center|LOCUS_7260 >Feature sequence081 1044 1940 gene locus_tag LOCUS_7270 1044 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7270 1937 2629 gene locus_tag LOCUS_7280 1937 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7280 2626 3417 gene locus_tag LOCUS_7290 2626 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 >Feature sequence082 83 1180 gene locus_tag LOCUS_7300 gene recA 83 1180 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918971.1 protein_id gnl|my_center|LOCUS_7300 1812 1243 gene locus_tag LOCUS_7310 gene efp 1812 1243 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626504.1 protein_id gnl|my_center|LOCUS_7310 2083 1877 gene locus_tag LOCUS_7320 2083 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7320 2615 2112 gene locus_tag LOCUS_7330 2615 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 3178 2681 gene locus_tag LOCUS_7340 3178 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 3346 4155 gene locus_tag LOCUS_7350 3346 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7350 >Feature sequence083 1070 621 gene locus_tag LOCUS_7360 1070 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 1334 2728 gene locus_tag LOCUS_7370 gene dnaA 1334 2728 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_7370 2978 4105 gene locus_tag LOCUS_7380 gene dnaN 2978 4105 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_7380 >Feature sequence084 352 1788 gene locus_tag LOCUS_7390 352 1788 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839765.1 protein_id gnl|my_center|LOCUS_7390 1866 2510 gene locus_tag LOCUS_7400 gene rpe 1866 2510 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_7400 2588 3850 gene locus_tag LOCUS_7410 2588 3850 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_7410 >Feature sequence085 323 631 gene locus_tag LOCUS_7420 gene mscL 323 631 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994532.1 protein_id gnl|my_center|LOCUS_7420 930 1697 gene locus_tag LOCUS_7430 930 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7430 >Feature sequence086 621 974 gene locus_tag LOCUS_7440 621 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 1095 2768 gene locus_tag LOCUS_7450 1095 2768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974106.1 protein_id gnl|my_center|LOCUS_7450 3335 2880 gene locus_tag LOCUS_7460 gene nrdR 3335 2880 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565887.1 protein_id gnl|my_center|LOCUS_7460 3718 3404 gene locus_tag LOCUS_7470 3718 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7470 >Feature sequence087 1153 857 gene locus_tag LOCUS_7480 1153 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7480 1763 1158 gene locus_tag LOCUS_7490 1763 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7490 <3975 1791 gene locus_tag LOCUS_7500 <3975 1791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393509.1:NAD-dependent DNA ligase LigA >Feature sequence088 <1 2358 gene locus_tag LOCUS_7510 <1 2358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003082358.1:ribonucleoside-diphosphate reductase subunit alpha 2480 3472 gene locus_tag LOCUS_7520 2480 3472 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883618.1 protein_id gnl|my_center|LOCUS_7520 >Feature sequence089 1231 1410 gene locus_tag LOCUS_7530 1231 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7530 2226 1615 gene locus_tag LOCUS_7540 2226 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7540 3504 2377 gene locus_tag LOCUS_7550 3504 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 >Feature sequence090 1709 183 gene locus_tag LOCUS_7560 gene rny 1709 183 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_7560 2144 3715 gene locus_tag LOCUS_7570 gene gpmI 2144 3715 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_7570 >Feature sequence091 1492 335 gene locus_tag LOCUS_7580 1492 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7580 1693 2685 gene locus_tag LOCUS_7590 gene xerD 1693 2685 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204200.1 protein_id gnl|my_center|LOCUS_7590 2783 3247 gene locus_tag LOCUS_7600 2783 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7600 >Feature sequence092 1308 1739 gene locus_tag LOCUS_7610 1308 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7610 1747 3108 gene locus_tag LOCUS_7620 1747 3108 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_7620 >Feature sequence093 1772 1350 gene locus_tag LOCUS_7630 1772 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7630 2310 1981 gene locus_tag LOCUS_7640 2310 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7640 >Feature sequence094 1839 1279 gene locus_tag LOCUS_7650 gene frr 1839 1279 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140292.1 protein_id gnl|my_center|LOCUS_7650 3143 2109 gene locus_tag LOCUS_7660 3143 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7660 >Feature sequence095 3101 1263 gene locus_tag LOCUS_7670 3101 1263 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_7670 3517 3263 gene locus_tag LOCUS_7680 3517 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7680 >Feature sequence096 <1 1650 gene locus_tag LOCUS_7690 <1 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438328.1:DNA translocase FtsK 1755 2885 gene locus_tag LOCUS_7700 1755 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7700 3264 2980 gene locus_tag LOCUS_7710 3264 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7710 >Feature sequence097 743 2326 gene locus_tag LOCUS_7720 743 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 >Feature sequence098 1671 358 gene locus_tag LOCUS_7730 1671 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7730 2327 1803 gene locus_tag LOCUS_7740 2327 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7740 2939 2430 gene locus_tag LOCUS_7750 2939 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7750 >Feature sequence099 743 976 gene locus_tag LOCUS_7760 743 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7760 1003 1713 gene locus_tag LOCUS_7770 gene truB 1003 1713 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_7770 1739 2863 gene locus_tag LOCUS_7780 1739 2863 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255994.1 protein_id gnl|my_center|LOCUS_7780 >Feature sequence100 198 1544 gene locus_tag LOCUS_7790 198 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7790 1914 1612 gene locus_tag LOCUS_7800 1914 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7800 2114 2509 gene locus_tag LOCUS_7810 2114 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7810 >Feature sequence101 994 791 gene locus_tag LOCUS_7820 994 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7820 1460 1532 gene locus_tag LOCUS_t0230 1460 1532 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1558 1902 gene locus_tag LOCUS_7830 1558 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7830 1936 2925 gene locus_tag LOCUS_7840 1936 2925 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583572.1 protein_id gnl|my_center|LOCUS_7840 >Feature sequence102 850 1455 gene locus_tag LOCUS_7850 850 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7850 1691 2452 gene locus_tag LOCUS_7860 1691 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7860 2707 2634 gene locus_tag LOCUS_t0240 2707 2634 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence103 2936 1266 gene locus_tag LOCUS_7870 2936 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7870 >Feature sequence104 1351 1485 gene locus_tag LOCUS_7880 1351 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7880 >Feature sequence105 613 155 gene locus_tag LOCUS_7890 613 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7890 1762 650 gene locus_tag LOCUS_7900 1762 650 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227919.1 protein_id gnl|my_center|LOCUS_7900 1931 2491 gene locus_tag LOCUS_7910 gene lexA 1931 2491 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986377.1 protein_id gnl|my_center|LOCUS_7910 >Feature sequence106 <1 1613 gene locus_tag LOCUS_7920 <1 1613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931824.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 1668 2501 gene locus_tag LOCUS_7930 gene folD 1668 2501 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729163.1 protein_id gnl|my_center|LOCUS_7930 2682 2598 gene locus_tag LOCUS_t0250 2682 2598 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence107 1565 708 gene locus_tag LOCUS_7940 1565 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7940 2104 1574 gene locus_tag LOCUS_7950 2104 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7950 >Feature sequence108 <1 2226 gene locus_tag LOCUS_7960 <1 2226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230104.1:glycoside hydrolase family 16 protein >Feature sequence109 1917 1426 gene locus_tag LOCUS_7970 1917 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7970 2611 1955 gene locus_tag LOCUS_7980 2611 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7980