>Feature sequence001 1172 168 gene locus_tag LOCUS_00010 1172 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1630 1208 gene locus_tag LOCUS_00020 1630 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1802 1593 gene locus_tag LOCUS_00030 1802 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2911 1799 gene locus_tag LOCUS_00040 2911 1799 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272381.1 protein_id gnl|my_center|LOCUS_00040 3218 2904 gene locus_tag LOCUS_00050 3218 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 3397 3218 gene locus_tag LOCUS_00060 3397 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4009 3551 gene locus_tag LOCUS_00070 4009 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4458 4009 gene locus_tag LOCUS_00080 4458 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 4921 4541 gene locus_tag LOCUS_00090 4921 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 5412 4921 gene locus_tag LOCUS_00100 5412 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6108 5560 gene locus_tag LOCUS_00110 6108 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 6973 6119 gene locus_tag LOCUS_00120 6973 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7197 6976 gene locus_tag LOCUS_00130 7197 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 9635 7197 gene locus_tag LOCUS_00140 9635 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 10183 9602 gene locus_tag LOCUS_00150 10183 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 10392 10228 gene locus_tag LOCUS_00160 10392 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 10739 10401 gene locus_tag LOCUS_00170 10739 10401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 11278 10751 gene locus_tag LOCUS_00180 11278 10751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 12737 11292 gene locus_tag LOCUS_00190 12737 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 12976 12737 gene locus_tag LOCUS_00200 12976 12737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 13434 12976 gene locus_tag LOCUS_00210 13434 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 13989 13438 gene locus_tag LOCUS_00220 13989 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 14331 14002 gene locus_tag LOCUS_00230 14331 14002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 14559 14341 gene locus_tag LOCUS_00240 14559 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 15610 14570 gene locus_tag LOCUS_00250 15610 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 15942 15613 gene locus_tag LOCUS_00260 15942 15613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 16994 15945 gene locus_tag LOCUS_00270 16994 15945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 18525 16948 gene locus_tag LOCUS_00280 18525 16948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 18767 18546 gene locus_tag LOCUS_00290 18767 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 20628 18778 gene locus_tag LOCUS_00300 20628 18778 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104537.1 protein_id gnl|my_center|LOCUS_00300 21160 20588 gene locus_tag LOCUS_00310 21160 20588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 >Feature sequence002 106 1083 gene locus_tag LOCUS_00320 106 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 1337 1849 gene locus_tag LOCUS_00330 1337 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 1915 2763 gene locus_tag LOCUS_00340 gene ftsZ 1915 2763 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869625.1 protein_id gnl|my_center|LOCUS_00340 2848 3285 gene locus_tag LOCUS_00350 2848 3285 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114745.1 protein_id gnl|my_center|LOCUS_00350 3590 4084 gene locus_tag LOCUS_00360 gene rfaE2 3590 4084 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896999.1 protein_id gnl|my_center|LOCUS_00360 5799 4420 gene locus_tag LOCUS_00370 gene argH 5799 4420 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940832.1 protein_id gnl|my_center|LOCUS_00370 6220 8019 gene locus_tag LOCUS_00380 gene pepF 6220 8019 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903691.1 protein_id gnl|my_center|LOCUS_00380 8126 8401 gene locus_tag LOCUS_00390 8126 8401 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_00390 8459 9232 gene locus_tag LOCUS_00400 8459 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 9266 9667 gene locus_tag LOCUS_00410 9266 9667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 9678 10028 gene locus_tag LOCUS_00420 9678 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 10157 10525 gene locus_tag LOCUS_00430 10157 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 11392 10577 gene locus_tag LOCUS_00440 11392 10577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 12272 11361 gene locus_tag LOCUS_00450 12272 11361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898362.1 protein_id gnl|my_center|LOCUS_00450 12819 12286 gene locus_tag LOCUS_00460 12819 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 13594 12803 gene locus_tag LOCUS_00470 13594 12803 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903485.1 protein_id gnl|my_center|LOCUS_00470 15328 13676 gene locus_tag LOCUS_00480 15328 13676 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891845.1 protein_id gnl|my_center|LOCUS_00480 15764 15402 gene locus_tag LOCUS_00490 gene trxA 15764 15402 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476363.1 protein_id gnl|my_center|LOCUS_00490 <16471 15767 gene locus_tag LOCUS_00500 <16471 15767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003642722.1:TerC family protein >Feature sequence003 1304 603 gene locus_tag LOCUS_00510 1304 603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816590.1 protein_id gnl|my_center|LOCUS_00510 1891 1325 gene locus_tag LOCUS_00520 gene pth 1891 1325 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015693.1 protein_id gnl|my_center|LOCUS_00520 3325 1922 gene locus_tag LOCUS_00530 3325 1922 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016772.1 protein_id gnl|my_center|LOCUS_00530 5319 3427 gene locus_tag LOCUS_00540 gene mnmG 5319 3427 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016068.1 protein_id gnl|my_center|LOCUS_00540 6179 5772 gene locus_tag LOCUS_00550 6179 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 7381 6179 gene locus_tag LOCUS_00560 7381 6179 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891031.1 protein_id gnl|my_center|LOCUS_00560 8231 7398 gene locus_tag LOCUS_00570 8231 7398 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897935.1 protein_id gnl|my_center|LOCUS_00570 9026 8253 gene locus_tag LOCUS_00580 9026 8253 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366366.1 protein_id gnl|my_center|LOCUS_00580 9958 9191 gene locus_tag LOCUS_00590 9958 9191 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902370.1 protein_id gnl|my_center|LOCUS_00590 10441 9968 gene locus_tag LOCUS_00600 10441 9968 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770492.1 protein_id gnl|my_center|LOCUS_00600 11404 10463 gene locus_tag LOCUS_00610 11404 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 12815 11421 gene locus_tag LOCUS_00620 12815 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 13403 15400 gene locus_tag LOCUS_00630 13403 15400 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887791.1 protein_id gnl|my_center|LOCUS_00630 15498 16085 gene locus_tag LOCUS_00640 gene cobU 15498 16085 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964692.1 protein_id gnl|my_center|LOCUS_00640 >Feature sequence004 2151 1783 gene locus_tag LOCUS_00650 gene rbfA 2151 1783 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931015.1 protein_id gnl|my_center|LOCUS_00650 5227 2174 gene locus_tag LOCUS_00660 5227 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 5793 5224 gene locus_tag LOCUS_00670 5793 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 7048 5846 gene locus_tag LOCUS_00680 gene nusA 7048 5846 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903346.1 protein_id gnl|my_center|LOCUS_00680 7536 7048 gene locus_tag LOCUS_00690 7536 7048 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015988.1 protein_id gnl|my_center|LOCUS_00690 8153 7989 gene locus_tag LOCUS_00700 8153 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 8454 8173 gene locus_tag LOCUS_00710 8454 8173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 8680 8513 gene locus_tag LOCUS_00720 8680 8513 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893919.1 protein_id gnl|my_center|LOCUS_00720 9652 8759 gene locus_tag LOCUS_00730 gene thrB 9652 8759 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964548.1 protein_id gnl|my_center|LOCUS_00730 12043 9746 gene locus_tag LOCUS_00740 12043 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 13748 12156 gene locus_tag LOCUS_00750 gene serA 13748 12156 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878316.1 protein_id gnl|my_center|LOCUS_00750 14510 13941 gene locus_tag LOCUS_00760 14510 13941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence005 189 764 gene locus_tag LOCUS_00770 189 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 891 1487 gene locus_tag LOCUS_00780 891 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 1497 1889 gene locus_tag LOCUS_00790 1497 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 1901 2956 gene locus_tag LOCUS_00800 1901 2956 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922218.1 protein_id gnl|my_center|LOCUS_00800 2966 3139 gene locus_tag LOCUS_00810 2966 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 3139 3447 gene locus_tag LOCUS_00820 3139 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 3458 3715 gene locus_tag LOCUS_00830 3458 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 3690 4112 gene locus_tag LOCUS_00840 3690 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 4112 4492 gene locus_tag LOCUS_00850 4112 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 4476 4940 gene locus_tag LOCUS_00860 4476 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 4940 6088 gene locus_tag LOCUS_00870 4940 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 6103 6534 gene locus_tag LOCUS_00880 6103 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 6617 7129 gene locus_tag LOCUS_00890 6617 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 7158 7394 gene locus_tag LOCUS_00900 7158 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 7396 10410 gene locus_tag LOCUS_00910 7396 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 10422 11015 gene locus_tag LOCUS_00920 10422 11015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 11012 11347 gene locus_tag LOCUS_00930 11012 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 11347 12507 gene locus_tag LOCUS_00940 11347 12507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 12504 13088 gene locus_tag LOCUS_00950 12504 13088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 13937 14461 gene locus_tag LOCUS_00960 13937 14461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 14572 14742 gene locus_tag LOCUS_00970 14572 14742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 14855 15154 gene locus_tag LOCUS_00980 14855 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 >Feature sequence006 1394 192 gene locus_tag LOCUS_00990 1394 192 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986966.1 protein_id gnl|my_center|LOCUS_00990 2011 1412 gene locus_tag LOCUS_01000 2011 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 2622 2260 gene locus_tag LOCUS_01010 2622 2260 CDS product TIGR02328 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672197.1 protein_id gnl|my_center|LOCUS_01010 3010 2606 gene locus_tag LOCUS_01020 3010 2606 CDS product YbgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836793.1 protein_id gnl|my_center|LOCUS_01020 3283 3651 gene locus_tag LOCUS_01030 gene acpS 3283 3651 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017085.1 protein_id gnl|my_center|LOCUS_01030 3673 4962 gene locus_tag LOCUS_01040 3673 4962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150048584.1 protein_id gnl|my_center|LOCUS_01040 5081 5896 gene locus_tag LOCUS_01050 5081 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 6174 6965 gene locus_tag LOCUS_01060 6174 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 7044 8081 gene locus_tag LOCUS_01070 7044 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 8109 9026 gene locus_tag LOCUS_01080 8109 9026 CDS product lipopolysaccharide kinase InaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963748.1 protein_id gnl|my_center|LOCUS_01080 10619 9351 gene locus_tag LOCUS_01090 gene murA 10619 9351 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015649.1 protein_id gnl|my_center|LOCUS_01090 11211 10612 gene locus_tag LOCUS_01100 11211 10612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 11813 11394 gene locus_tag LOCUS_01110 11813 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 12819 11818 gene locus_tag LOCUS_01120 gene xerD 12819 11818 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644441.1 protein_id gnl|my_center|LOCUS_01120 14474 12795 gene locus_tag LOCUS_01130 gene recN 14474 12795 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016269.1 protein_id gnl|my_center|LOCUS_01130 15342 14500 gene locus_tag LOCUS_01140 15342 14500 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016268.1 protein_id gnl|my_center|LOCUS_01140 >Feature sequence007 768 115 gene locus_tag LOCUS_01150 gene eutL 768 115 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016126.1 protein_id gnl|my_center|LOCUS_01150 1740 814 gene locus_tag LOCUS_01160 gene eutC 1740 814 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904029.1 protein_id gnl|my_center|LOCUS_01160 3118 1754 gene locus_tag LOCUS_01170 3118 1754 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861389.1 protein_id gnl|my_center|LOCUS_01170 4579 3149 gene locus_tag LOCUS_01180 gene eutA 4579 3149 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016124.1 protein_id gnl|my_center|LOCUS_01180 6009 4606 gene locus_tag LOCUS_01190 6009 4606 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966007.1 protein_id gnl|my_center|LOCUS_01190 6580 6002 gene locus_tag LOCUS_01200 6580 6002 CDS product ANTAR domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724712.1 protein_id gnl|my_center|LOCUS_01200 7720 6602 gene locus_tag LOCUS_01210 7720 6602 CDS product 1-propanol dehydrogenase PduQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016135.1 protein_id gnl|my_center|LOCUS_01210 8141 7839 gene locus_tag LOCUS_01220 8141 7839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 8415 8146 gene locus_tag LOCUS_01230 8415 8146 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435411.1 protein_id gnl|my_center|LOCUS_01230 9061 8417 gene locus_tag LOCUS_01240 9061 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 9722 9084 gene locus_tag LOCUS_01250 gene eutD 9722 9084 CDS product ethanolamine utilization phosphate acetyltransferase EutD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002896361.1 protein_id gnl|my_center|LOCUS_01250 10528 9743 gene locus_tag LOCUS_01260 10528 9743 CDS product ethanolamine corrinoid cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861391.1 protein_id gnl|my_center|LOCUS_01260 12012 10546 gene locus_tag LOCUS_01270 12012 10546 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016128.1 protein_id gnl|my_center|LOCUS_01270 12360 12064 gene locus_tag LOCUS_01280 gene eutM 12360 12064 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895463.1 protein_id gnl|my_center|LOCUS_01280 13121 12363 gene locus_tag LOCUS_01290 13121 12363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 13571 13122 gene locus_tag LOCUS_01300 13571 13122 CDS product EutP/PduV family microcompartment system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721544.1 protein_id gnl|my_center|LOCUS_01300 13924 13574 gene locus_tag LOCUS_01310 13924 13574 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423973.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence008 1596 289 gene locus_tag LOCUS_01320 gene secY 1596 289 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904128.1 protein_id gnl|my_center|LOCUS_01320 2257 1643 gene locus_tag LOCUS_01330 gene rplO 2257 1643 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899800.1 protein_id gnl|my_center|LOCUS_01330 2442 2263 gene locus_tag LOCUS_01340 gene rpmD 2442 2263 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892817.1 protein_id gnl|my_center|LOCUS_01340 2973 2464 gene locus_tag LOCUS_01350 gene rpsE 2973 2464 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015714.1 protein_id gnl|my_center|LOCUS_01350 3354 2992 gene locus_tag LOCUS_01360 gene rplR 3354 2992 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904133.1 protein_id gnl|my_center|LOCUS_01360 3901 3368 gene locus_tag LOCUS_01370 gene rplF 3901 3368 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379228.1 protein_id gnl|my_center|LOCUS_01370 4329 3934 gene locus_tag LOCUS_01380 gene rpsH 4329 3934 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904135.1 protein_id gnl|my_center|LOCUS_01380 4638 4351 gene locus_tag LOCUS_01390 gene rpsN 4638 4351 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015715.1 protein_id gnl|my_center|LOCUS_01390 5223 4669 gene locus_tag LOCUS_01400 gene rplE 5223 4669 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892302.1 protein_id gnl|my_center|LOCUS_01400 5632 5249 gene locus_tag LOCUS_01410 gene rplX 5632 5249 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897291.1 protein_id gnl|my_center|LOCUS_01410 6016 5648 gene locus_tag LOCUS_01420 gene rplN 6016 5648 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904136.1 protein_id gnl|my_center|LOCUS_01420 6372 6112 gene locus_tag LOCUS_01430 gene rpsQ 6372 6112 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904137.1 protein_id gnl|my_center|LOCUS_01430 6575 6384 gene locus_tag LOCUS_01440 gene rpmC 6575 6384 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156482.1 protein_id gnl|my_center|LOCUS_01440 7000 6575 gene locus_tag LOCUS_01450 gene rplP 7000 6575 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904138.1 protein_id gnl|my_center|LOCUS_01450 7658 7002 gene locus_tag LOCUS_01460 gene rpsC 7658 7002 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005892367.1 protein_id gnl|my_center|LOCUS_01460 8022 7684 gene locus_tag LOCUS_01470 gene rplV 8022 7684 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897300.1 protein_id gnl|my_center|LOCUS_01470 8335 8063 gene locus_tag LOCUS_01480 gene rpsS 8335 8063 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829710.1 protein_id gnl|my_center|LOCUS_01480 8615 8412 gene locus_tag LOCUS_01490 8615 8412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 9378 8551 gene locus_tag LOCUS_01500 gene rplB 9378 8551 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904139.1 protein_id gnl|my_center|LOCUS_01500 9851 9567 gene locus_tag LOCUS_01510 gene rplW 9851 9567 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015719.1 protein_id gnl|my_center|LOCUS_01510 10495 9851 gene locus_tag LOCUS_01520 gene rplD 10495 9851 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904141.1 protein_id gnl|my_center|LOCUS_01520 11143 10517 gene locus_tag LOCUS_01530 gene rplC 11143 10517 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015720.1 protein_id gnl|my_center|LOCUS_01530 11514 11209 gene locus_tag LOCUS_01540 gene rpsJ 11514 11209 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897308.1 protein_id gnl|my_center|LOCUS_01540 12893 11709 gene locus_tag LOCUS_01550 gene tuf 12893 11709 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903497.1 protein_id gnl|my_center|LOCUS_01550 12971 13240 gene locus_tag LOCUS_01560 12971 13240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence009 46 762 gene locus_tag LOCUS_01570 46 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 1640 834 gene locus_tag LOCUS_01580 1640 834 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682228.1 protein_id gnl|my_center|LOCUS_01580 2464 1670 gene locus_tag LOCUS_01590 gene phnE 2464 1670 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643944.1 protein_id gnl|my_center|LOCUS_01590 3231 2488 gene locus_tag LOCUS_01600 gene phnC 3231 2488 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682233.1 protein_id gnl|my_center|LOCUS_01600 4830 3316 gene locus_tag LOCUS_01610 4830 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 5898 5017 gene locus_tag LOCUS_01620 5898 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 6447 8276 gene locus_tag LOCUS_01630 gene glmS 6447 8276 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048324.1 protein_id gnl|my_center|LOCUS_01630 8326 8637 gene locus_tag LOCUS_01640 8326 8637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 9005 9769 gene locus_tag LOCUS_01650 9005 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 9902 10783 gene locus_tag LOCUS_01660 9902 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 10801 11955 gene locus_tag LOCUS_01670 10801 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 12166 12756 gene locus_tag LOCUS_01680 12166 12756 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015911.1 protein_id gnl|my_center|LOCUS_01680 12875 12949 gene locus_tag LOCUS_t00010 12875 12949 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 12994 13069 gene locus_tag LOCUS_t00020 12994 13069 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 768 124 gene locus_tag LOCUS_01690 768 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 1902 901 gene locus_tag LOCUS_01700 gene lpxD 1902 901 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903952.1 protein_id gnl|my_center|LOCUS_01700 4339 2000 gene locus_tag LOCUS_01710 4339 2000 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367282.1 protein_id gnl|my_center|LOCUS_01710 8907 4348 gene locus_tag LOCUS_01720 8907 4348 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627076.1 protein_id gnl|my_center|LOCUS_01720 9627 9211 gene locus_tag LOCUS_01730 gene accB 9627 9211 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966835.1 protein_id gnl|my_center|LOCUS_01730 10738 9734 gene locus_tag LOCUS_01740 10738 9734 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016387.1 protein_id gnl|my_center|LOCUS_01740 11484 10741 gene locus_tag LOCUS_01750 gene pxpB 11484 10741 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494307.1 protein_id gnl|my_center|LOCUS_01750 12725 11505 gene locus_tag LOCUS_01760 12725 11505 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016389.1 protein_id gnl|my_center|LOCUS_01760 >Feature sequence011 <1 772 gene locus_tag LOCUS_01770 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016556.1:glutamyl-tRNA reductase 769 1737 gene locus_tag LOCUS_01780 gene hemC 769 1737 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016555.1 protein_id gnl|my_center|LOCUS_01780 1724 3208 gene locus_tag LOCUS_01790 gene cobA 1724 3208 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016554.1 protein_id gnl|my_center|LOCUS_01790 3921 3289 gene locus_tag LOCUS_01800 3921 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 5777 4191 gene locus_tag LOCUS_01810 5777 4191 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_01810 7455 5866 gene locus_tag LOCUS_01820 7455 5866 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913630.1 protein_id gnl|my_center|LOCUS_01820 9141 7552 gene locus_tag LOCUS_01830 9141 7552 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731898.1 protein_id gnl|my_center|LOCUS_01830 10787 9189 gene locus_tag LOCUS_01840 10787 9189 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823513.1 protein_id gnl|my_center|LOCUS_01840 11808 10858 gene locus_tag LOCUS_01850 11808 10858 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166348.1 protein_id gnl|my_center|LOCUS_01850 12845 11808 gene locus_tag LOCUS_01860 gene oppD 12845 11808 CDS product oligopeptide ABC transporter ATP-binding protein OppD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886477.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence012 112 2727 gene locus_tag LOCUS_01870 gene alaS 112 2727 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016588.1 protein_id gnl|my_center|LOCUS_01870 2825 3241 gene locus_tag LOCUS_01880 gene ruvX 2825 3241 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902478.1 protein_id gnl|my_center|LOCUS_01880 3279 4493 gene locus_tag LOCUS_01890 gene secD 3279 4493 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902477.1 protein_id gnl|my_center|LOCUS_01890 4483 5454 gene locus_tag LOCUS_01900 gene secF 4483 5454 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016589.1 protein_id gnl|my_center|LOCUS_01900 5494 6591 gene locus_tag LOCUS_01910 gene alr 5494 6591 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817433.1 protein_id gnl|my_center|LOCUS_01910 6603 7184 gene locus_tag LOCUS_01920 6603 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 7245 8351 gene locus_tag LOCUS_01930 7245 8351 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_01930 8365 9441 gene locus_tag LOCUS_01940 8365 9441 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016847.1 protein_id gnl|my_center|LOCUS_01940 9486 10706 gene locus_tag LOCUS_01950 9486 10706 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016846.1 protein_id gnl|my_center|LOCUS_01950 10855 11958 gene locus_tag LOCUS_01960 gene rodA 10855 11958 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016844.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence013 157 987 gene locus_tag LOCUS_01970 157 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01970 1010 1963 gene locus_tag LOCUS_01980 1010 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01980 2030 2653 gene locus_tag LOCUS_01990 2030 2653 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903383.1 protein_id gnl|my_center|LOCUS_01990 2678 3049 gene locus_tag LOCUS_02000 2678 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 4167 3361 gene locus_tag LOCUS_02010 4167 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4644 4180 gene locus_tag LOCUS_02020 4644 4180 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280500.1 protein_id gnl|my_center|LOCUS_02020 6129 4687 gene locus_tag LOCUS_02030 gene purB 6129 4687 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016341.1 protein_id gnl|my_center|LOCUS_02030 6863 6387 gene locus_tag LOCUS_02040 6863 6387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 7377 6940 gene locus_tag LOCUS_02050 7377 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 7549 7379 gene locus_tag LOCUS_02060 7549 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 8851 7553 gene locus_tag LOCUS_02070 8851 7553 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015701.1 protein_id gnl|my_center|LOCUS_02070 9759 9088 gene locus_tag LOCUS_02080 9759 9088 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582846.1 protein_id gnl|my_center|LOCUS_02080 10213 9779 gene locus_tag LOCUS_02090 10213 9779 CDS product HutP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356304.1 protein_id gnl|my_center|LOCUS_02090 10665 10234 gene locus_tag LOCUS_02100 gene aroQ 10665 10234 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_02100 11185 10688 gene locus_tag LOCUS_02110 11185 10688 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964216.1 protein_id gnl|my_center|LOCUS_02110 11422 11234 gene locus_tag LOCUS_02120 11422 11234 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261391.1 protein_id gnl|my_center|LOCUS_02120 12304 11438 gene locus_tag LOCUS_02130 12304 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence014 4348 2234 gene locus_tag LOCUS_02140 4348 2234 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480034.1 protein_id gnl|my_center|LOCUS_02140 5807 4371 gene locus_tag LOCUS_02150 gene gatB 5807 4371 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016630.1 protein_id gnl|my_center|LOCUS_02150 6951 5878 gene locus_tag LOCUS_02160 6951 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8073 6979 gene locus_tag LOCUS_02170 8073 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 9552 8089 gene locus_tag LOCUS_02180 gene gatA 9552 8089 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903492.1 protein_id gnl|my_center|LOCUS_02180 9873 9574 gene locus_tag LOCUS_02190 gene gatC 9873 9574 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903491.1 protein_id gnl|my_center|LOCUS_02190 11130 9898 gene locus_tag LOCUS_02200 gene dcm 11130 9898 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962895.1 protein_id gnl|my_center|LOCUS_02200 <12164 11130 gene locus_tag LOCUS_02210 <12164 11130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068548.1:Sau3AI family type II restriction endonuclease >Feature sequence015 1435 740 gene locus_tag LOCUS_02220 1435 740 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763226.1 protein_id gnl|my_center|LOCUS_02220 2357 1671 gene locus_tag LOCUS_02230 2357 1671 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964606.1 protein_id gnl|my_center|LOCUS_02230 3004 2543 gene locus_tag LOCUS_02240 gene ybeY 3004 2543 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016624.1 protein_id gnl|my_center|LOCUS_02240 5080 3026 gene locus_tag LOCUS_02250 5080 3026 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626410.1 protein_id gnl|my_center|LOCUS_02250 7606 5138 gene locus_tag LOCUS_02260 7606 5138 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480299.1 protein_id gnl|my_center|LOCUS_02260 8385 7762 gene locus_tag LOCUS_02270 8385 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 9333 8650 gene locus_tag LOCUS_02280 9333 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 10846 9437 gene locus_tag LOCUS_02290 10846 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 11827 10976 gene locus_tag LOCUS_02300 11827 10976 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892675.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence016 3021 2791 gene locus_tag LOCUS_02310 3021 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3070 4197 gene locus_tag LOCUS_02320 3070 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4312 5373 gene locus_tag LOCUS_02330 4312 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 5592 6986 gene locus_tag LOCUS_02340 5592 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 7047 8663 gene locus_tag LOCUS_02350 7047 8663 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266940.1 protein_id gnl|my_center|LOCUS_02350 8826 10244 gene locus_tag LOCUS_02360 8826 10244 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897917.1 protein_id gnl|my_center|LOCUS_02360 10328 10486 gene locus_tag LOCUS_02370 10328 10486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 10531 11253 gene locus_tag LOCUS_02380 gene aphA 10531 11253 CDS product acid phosphatase AphA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757296.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence017 <1 1554 gene locus_tag LOCUS_02390 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1759 4338 gene locus_tag LOCUS_02400 1759 4338 CDS product DUF2339 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963253.1 protein_id gnl|my_center|LOCUS_02400 4335 4826 gene locus_tag LOCUS_02410 4335 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4830 6002 gene locus_tag LOCUS_02420 4830 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 6019 6585 gene locus_tag LOCUS_02430 6019 6585 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_02430 6619 8571 gene locus_tag LOCUS_02440 6619 8571 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392706.1 protein_id gnl|my_center|LOCUS_02440 8700 10346 gene locus_tag LOCUS_02450 8700 10346 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_02450 10363 11412 gene locus_tag LOCUS_02460 10363 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 >Feature sequence018 185 634 gene locus_tag LOCUS_02470 185 634 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225738.1 protein_id gnl|my_center|LOCUS_02470 718 1275 gene locus_tag LOCUS_02480 718 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 1518 1829 gene locus_tag LOCUS_02490 1518 1829 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461833.1 protein_id gnl|my_center|LOCUS_02490 1798 2556 gene locus_tag LOCUS_02500 1798 2556 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_02500 2604 3578 gene locus_tag LOCUS_02510 2604 3578 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461831.1 protein_id gnl|my_center|LOCUS_02510 3609 4367 gene locus_tag LOCUS_02520 3609 4367 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184185.1 protein_id gnl|my_center|LOCUS_02520 4439 4708 gene locus_tag LOCUS_02530 4439 4708 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017121.1 protein_id gnl|my_center|LOCUS_02530 4820 5800 gene locus_tag LOCUS_02540 4820 5800 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101851.1 protein_id gnl|my_center|LOCUS_02540 5940 6599 gene locus_tag LOCUS_02550 5940 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 6603 7136 gene locus_tag LOCUS_02560 6603 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7290 8039 gene locus_tag LOCUS_02570 7290 8039 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422862.1 protein_id gnl|my_center|LOCUS_02570 8552 9895 gene locus_tag LOCUS_02580 8552 9895 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899369.1 protein_id gnl|my_center|LOCUS_02580 10860 10066 gene locus_tag LOCUS_02590 10860 10066 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494981.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence019 51 422 gene locus_tag LOCUS_02600 gene rplL 51 422 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005889295.1 protein_id gnl|my_center|LOCUS_02600 899 4345 gene locus_tag LOCUS_02610 gene rpoB 899 4345 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015993.1 protein_id gnl|my_center|LOCUS_02610 4459 8532 gene locus_tag LOCUS_02620 gene rpoC 4459 8532 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904068.1 protein_id gnl|my_center|LOCUS_02620 8688 9239 gene locus_tag LOCUS_02630 gene gmk 8688 9239 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904066.1 protein_id gnl|my_center|LOCUS_02630 9276 9473 gene locus_tag LOCUS_02640 9276 9473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence020 <1 558 gene locus_tag LOCUS_02650 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286575.1:phage antirepressor 632 1009 gene locus_tag LOCUS_02660 632 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 1023 2204 gene locus_tag LOCUS_02670 1023 2204 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390596.1 protein_id gnl|my_center|LOCUS_02670 2197 2937 gene locus_tag LOCUS_02680 2197 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 2938 3891 gene locus_tag LOCUS_02690 2938 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3921 4712 gene locus_tag LOCUS_02700 3921 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 4722 5198 gene locus_tag LOCUS_02710 4722 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 5201 5353 gene locus_tag LOCUS_02720 5201 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 5355 6344 gene locus_tag LOCUS_02730 5355 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 6493 6816 gene locus_tag LOCUS_02740 6493 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 6836 7186 gene locus_tag LOCUS_02750 6836 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 7155 7505 gene locus_tag LOCUS_02760 7155 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7629 7784 gene locus_tag LOCUS_02770 7629 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7988 8200 gene locus_tag LOCUS_02780 7988 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 8286 8480 gene locus_tag LOCUS_02790 8286 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 8482 8934 gene locus_tag LOCUS_02800 8482 8934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 9259 9978 gene locus_tag LOCUS_02810 9259 9978 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence021 149 10765 gene locus_tag LOCUS_02820 149 10765 CDS product autotransporter-associated N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898194.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence022 1073 159 gene locus_tag LOCUS_02830 1073 159 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015666.1 protein_id gnl|my_center|LOCUS_02830 1534 1109 gene locus_tag LOCUS_02840 1534 1109 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015665.1 protein_id gnl|my_center|LOCUS_02840 4602 1957 gene locus_tag LOCUS_02850 4602 1957 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015981.1 protein_id gnl|my_center|LOCUS_02850 5148 4891 gene locus_tag LOCUS_02860 5148 4891 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 protein_id gnl|my_center|LOCUS_02860 5298 5373 gene locus_tag LOCUS_t00030 5298 5373 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5397 5481 gene locus_tag LOCUS_t00040 5397 5481 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 5549 5908 gene locus_tag LOCUS_02870 5549 5908 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008797059.1 protein_id gnl|my_center|LOCUS_02870 6333 7580 gene locus_tag LOCUS_02880 6333 7580 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_02880 8473 7832 gene locus_tag LOCUS_02890 gene ruvA 8473 7832 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_02890 9287 8502 gene locus_tag LOCUS_02900 gene murI 9287 8502 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_02900 10612 9359 gene locus_tag LOCUS_02910 10612 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence023 743 333 gene locus_tag LOCUS_02920 743 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1415 909 gene locus_tag LOCUS_02930 1415 909 CDS product DUF4865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571907.1 protein_id gnl|my_center|LOCUS_02930 2953 1442 gene locus_tag LOCUS_02940 gene leuA 2953 1442 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930807.1 protein_id gnl|my_center|LOCUS_02940 3674 2985 gene locus_tag LOCUS_02950 3674 2985 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003440228.1 protein_id gnl|my_center|LOCUS_02950 4453 3704 gene locus_tag LOCUS_02960 4453 3704 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_02960 4981 4493 gene locus_tag LOCUS_02970 gene ilvN 4981 4493 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583549.1 protein_id gnl|my_center|LOCUS_02970 6692 4974 gene locus_tag LOCUS_02980 6692 4974 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_02980 8058 6841 gene locus_tag LOCUS_02990 gene ilvA 8058 6841 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017132.1 protein_id gnl|my_center|LOCUS_02990 8624 8073 gene locus_tag LOCUS_03000 8624 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 9497 8763 gene locus_tag LOCUS_03010 9497 8763 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096975.1 protein_id gnl|my_center|LOCUS_03010 10315 9671 gene locus_tag LOCUS_03020 10315 9671 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016305.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence024 1546 53 gene locus_tag LOCUS_03030 gene thrC 1546 53 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434031.1 protein_id gnl|my_center|LOCUS_03030 1737 2204 gene locus_tag LOCUS_03040 1737 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015824.1 protein_id gnl|my_center|LOCUS_03040 2445 3095 gene locus_tag LOCUS_03050 2445 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3125 3484 gene locus_tag LOCUS_03060 3125 3484 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707692.1 protein_id gnl|my_center|LOCUS_03060 3516 4355 gene locus_tag LOCUS_03070 3516 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 4743 5285 gene locus_tag LOCUS_03080 4743 5285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 5319 6281 gene locus_tag LOCUS_03090 5319 6281 CDS product DUF4300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860938.1 protein_id gnl|my_center|LOCUS_03090 8108 6339 gene locus_tag LOCUS_03100 8108 6339 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_03100 8116 9387 gene locus_tag LOCUS_03110 8116 9387 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530044.1 protein_id gnl|my_center|LOCUS_03110 >Feature sequence025 1212 220 gene locus_tag LOCUS_03120 1212 220 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895497.1 protein_id gnl|my_center|LOCUS_03120 2991 1258 gene locus_tag LOCUS_03130 gene lpdA 2991 1258 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836965.1 protein_id gnl|my_center|LOCUS_03130 4081 3047 gene locus_tag LOCUS_03140 4081 3047 CDS product dihydrolipoamide acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000752705.1 protein_id gnl|my_center|LOCUS_03140 5113 4121 gene locus_tag LOCUS_03150 5113 4121 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448721.1 protein_id gnl|my_center|LOCUS_03150 6094 5129 gene locus_tag LOCUS_03160 6094 5129 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105362.1 protein_id gnl|my_center|LOCUS_03160 6792 6394 gene locus_tag LOCUS_03170 gene rpsI 6792 6394 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901602.1 protein_id gnl|my_center|LOCUS_03170 7240 6806 gene locus_tag LOCUS_03180 gene rplM 7240 6806 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901604.1 protein_id gnl|my_center|LOCUS_03180 7744 7436 gene locus_tag LOCUS_03190 7744 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 8072 10129 gene locus_tag LOCUS_03200 8072 10129 CDS product BglG family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986653.1 protein_id gnl|my_center|LOCUS_03200 10123 10554 gene locus_tag LOCUS_03210 10123 10554 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000901818.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence026 782 21 gene locus_tag LOCUS_03220 782 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 3385 821 gene locus_tag LOCUS_03230 gene gyrA 3385 821 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903616.1 protein_id gnl|my_center|LOCUS_03230 5799 3817 gene locus_tag LOCUS_03240 gene gyrB 5799 3817 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895130.1 protein_id gnl|my_center|LOCUS_03240 7226 5859 gene locus_tag LOCUS_03250 gene mnmE 7226 5859 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016067.1 protein_id gnl|my_center|LOCUS_03250 8180 7296 gene locus_tag LOCUS_03260 8180 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 9640 9128 gene locus_tag LOCUS_03270 9640 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 9767 10069 gene locus_tag LOCUS_03280 9767 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 10388 10164 gene locus_tag LOCUS_03290 10388 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence027 2839 1283 gene locus_tag LOCUS_03300 2839 1283 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016996.1 protein_id gnl|my_center|LOCUS_03300 3003 3090 gene locus_tag LOCUS_t00050 3003 3090 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3113 3189 gene locus_tag LOCUS_t00060 3113 3189 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3193 3269 gene locus_tag LOCUS_t00070 3193 3269 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3347 3634 gene locus_tag LOCUS_03310 3347 3634 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966664.1 protein_id gnl|my_center|LOCUS_03310 3910 4953 gene locus_tag LOCUS_03320 3910 4953 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016469.1 protein_id gnl|my_center|LOCUS_03320 5001 6023 gene locus_tag LOCUS_03330 gene tsaD 5001 6023 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016472.1 protein_id gnl|my_center|LOCUS_03330 7016 6192 gene locus_tag LOCUS_03340 7016 6192 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704075.1 protein_id gnl|my_center|LOCUS_03340 7852 7040 gene locus_tag LOCUS_03350 7852 7040 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704075.1 protein_id gnl|my_center|LOCUS_03350 8332 7970 gene locus_tag LOCUS_03360 8332 7970 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_03360 9179 8373 gene locus_tag LOCUS_03370 9179 8373 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016356.1 protein_id gnl|my_center|LOCUS_03370 9315 9791 gene locus_tag LOCUS_03380 9315 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 10139 9996 gene locus_tag LOCUS_03390 10139 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence028 169 2538 gene locus_tag LOCUS_03400 169 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2554 3969 gene locus_tag LOCUS_03410 2554 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 3926 4825 gene locus_tag LOCUS_03420 3926 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 4989 7652 gene locus_tag LOCUS_03430 4989 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7669 8928 gene locus_tag LOCUS_03440 7669 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 <10118 8997 gene locus_tag LOCUS_03450 <10118 8997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003695185.1:CapA family protein >Feature sequence029 315 1592 gene locus_tag LOCUS_03460 315 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 1643 2998 gene locus_tag LOCUS_03470 1643 2998 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898025.1 protein_id gnl|my_center|LOCUS_03470 3026 3718 gene locus_tag LOCUS_03480 3026 3718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_03480 3724 4935 gene locus_tag LOCUS_03490 3724 4935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914987.1 protein_id gnl|my_center|LOCUS_03490 5102 6289 gene locus_tag LOCUS_03500 gene nspC 5102 6289 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_03500 7270 6497 gene locus_tag LOCUS_03510 gene trpA 7270 6497 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854645.1 protein_id gnl|my_center|LOCUS_03510 8510 7263 gene locus_tag LOCUS_03520 gene trpB 8510 7263 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854204.1 protein_id gnl|my_center|LOCUS_03520 9258 8548 gene locus_tag LOCUS_03530 9258 8548 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858740.1 protein_id gnl|my_center|LOCUS_03530 <10062 9375 gene locus_tag LOCUS_03540 <10062 9375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966437.1:indole-3-glycerol phosphate synthase TrpC >Feature sequence030 145 2100 gene locus_tag LOCUS_03550 gene betT 145 2100 CDS product choline transporter BetT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010211761.1 protein_id gnl|my_center|LOCUS_03550 2084 4159 gene locus_tag LOCUS_03560 2084 4159 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895431.1 protein_id gnl|my_center|LOCUS_03560 4344 5921 gene locus_tag LOCUS_03570 4344 5921 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 protein_id gnl|my_center|LOCUS_03570 6139 8931 gene locus_tag LOCUS_03580 gene ileS 6139 8931 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903528.1 protein_id gnl|my_center|LOCUS_03580 9038 9505 gene locus_tag LOCUS_03590 gene lspA 9038 9505 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895436.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence031 261 187 gene locus_tag LOCUS_t00080 261 187 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1388 282 gene locus_tag LOCUS_03600 gene mnmA 1388 282 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627079.1 protein_id gnl|my_center|LOCUS_03600 2324 1446 gene locus_tag LOCUS_03610 2324 1446 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454111.1 protein_id gnl|my_center|LOCUS_03610 3820 2360 gene locus_tag LOCUS_03620 3820 2360 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870353.1 protein_id gnl|my_center|LOCUS_03620 4815 3835 gene locus_tag LOCUS_03630 4815 3835 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016738.1 protein_id gnl|my_center|LOCUS_03630 6070 4949 gene locus_tag LOCUS_03640 6070 4949 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966353.1 protein_id gnl|my_center|LOCUS_03640 6260 7099 gene locus_tag LOCUS_03650 gene kdsA 6260 7099 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_03650 7137 8222 gene locus_tag LOCUS_03660 7137 8222 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_03660 8292 9200 gene locus_tag LOCUS_03670 gene lgt 8292 9200 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016426.1 protein_id gnl|my_center|LOCUS_03670 9826 9269 gene locus_tag LOCUS_03680 9826 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence032 278 141 gene locus_tag LOCUS_03690 278 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2574 346 gene locus_tag LOCUS_03700 2574 346 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461874.1 protein_id gnl|my_center|LOCUS_03700 3076 2609 gene locus_tag LOCUS_03710 3076 2609 CDS product CopY/TcrY family copper transport repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103844.1 protein_id gnl|my_center|LOCUS_03710 4661 3258 gene locus_tag LOCUS_03720 gene lacG 4661 3258 CDS product 6-phospho-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775549.1 protein_id gnl|my_center|LOCUS_03720 6383 4695 gene locus_tag LOCUS_03730 6383 4695 CDS product lactose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037363.1 protein_id gnl|my_center|LOCUS_03730 6701 6384 gene locus_tag LOCUS_03740 gene lacF 6701 6384 CDS product PTS lactose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263056.1 protein_id gnl|my_center|LOCUS_03740 7763 6786 gene locus_tag LOCUS_03750 gene lacD 7763 6786 CDS product tagatose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002905075.1 protein_id gnl|my_center|LOCUS_03750 8722 7790 gene locus_tag LOCUS_03760 gene lacC 8722 7790 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775547.1 protein_id gnl|my_center|LOCUS_03760 9252 8737 gene locus_tag LOCUS_03770 gene lacB 9252 8737 CDS product galactose-6-phosphate isomerase subunit LacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837291.1 protein_id gnl|my_center|LOCUS_03770 9745 9323 gene locus_tag LOCUS_03780 gene lacA 9745 9323 CDS product galactose-6-phosphate isomerase subunit LacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829760.1 protein_id gnl|my_center|LOCUS_03780 >Feature sequence033 2515 50 gene locus_tag LOCUS_03790 2515 50 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680347.1 protein_id gnl|my_center|LOCUS_03790 4981 2822 gene locus_tag LOCUS_03800 4981 2822 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837549.1 protein_id gnl|my_center|LOCUS_03800 6903 5122 gene locus_tag LOCUS_03810 gene opp2A 6903 5122 CDS product oligopeptide ABC transporter substrate-binding protein Opp2A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378964.1 protein_id gnl|my_center|LOCUS_03810 7856 6924 gene locus_tag LOCUS_03820 7856 6924 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002938141.1 protein_id gnl|my_center|LOCUS_03820 8830 7868 gene locus_tag LOCUS_03830 8830 7868 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287892.1 protein_id gnl|my_center|LOCUS_03830 9796 8834 gene locus_tag LOCUS_03840 9796 8834 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027759.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence034 <1 1177 gene locus_tag LOCUS_03850 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902638.1:SH3 domain-containing protein 1215 2996 gene locus_tag LOCUS_03860 1215 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 4170 3121 gene locus_tag LOCUS_03870 4170 3121 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047593.1 protein_id gnl|my_center|LOCUS_03870 4361 4182 gene locus_tag LOCUS_03880 4361 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 4552 4361 gene locus_tag LOCUS_03890 4552 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 4944 4549 gene locus_tag LOCUS_03900 4944 4549 CDS product YopX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047817.1 protein_id gnl|my_center|LOCUS_03900 5155 4937 gene locus_tag LOCUS_03910 5155 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 5365 5171 gene locus_tag LOCUS_03920 5365 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 6014 5415 gene locus_tag LOCUS_03930 6014 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 6442 6077 gene locus_tag LOCUS_03940 6442 6077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7099 6446 gene locus_tag LOCUS_03950 7099 6446 CDS product ERF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047604.1 protein_id gnl|my_center|LOCUS_03950 7202 7050 gene locus_tag LOCUS_03960 7202 7050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 7482 7348 gene locus_tag LOCUS_03970 7482 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 8180 7491 gene locus_tag LOCUS_03980 8180 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 8461 8865 gene locus_tag LOCUS_03990 8461 8865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9037 8849 gene locus_tag LOCUS_04000 9037 8849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9574 9170 gene locus_tag LOCUS_04010 9574 9170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence035 174 1976 gene locus_tag LOCUS_04020 174 1976 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074016100.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence036 63 557 gene locus_tag LOCUS_04030 63 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 694 957 gene locus_tag LOCUS_04040 gene rpsO 694 957 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409373.1 protein_id gnl|my_center|LOCUS_04040 1033 1896 gene locus_tag LOCUS_04050 1033 1896 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021787.1 protein_id gnl|my_center|LOCUS_04050 1986 2387 gene locus_tag LOCUS_04060 1986 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2400 3974 gene locus_tag LOCUS_04070 gene rny 2400 3974 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627077.1 protein_id gnl|my_center|LOCUS_04070 4177 4956 gene locus_tag LOCUS_04080 4177 4956 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 protein_id gnl|my_center|LOCUS_04080 4974 5897 gene locus_tag LOCUS_04090 gene prmA 4974 5897 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029493681.1 protein_id gnl|my_center|LOCUS_04090 6040 6690 gene locus_tag LOCUS_04100 gene cmk 6040 6690 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015703.1 protein_id gnl|my_center|LOCUS_04100 6894 7175 gene locus_tag LOCUS_04110 6894 7175 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901839.1 protein_id gnl|my_center|LOCUS_04110 7239 8510 gene locus_tag LOCUS_04120 7239 8510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence037 3587 888 gene locus_tag LOCUS_04130 gene pelG 3587 888 CDS product exopolysaccharide Pel transporter PelG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902578.1 protein_id gnl|my_center|LOCUS_04130 5008 3587 gene locus_tag LOCUS_04140 gene pelF 5008 3587 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016350.1 protein_id gnl|my_center|LOCUS_04140 6060 5059 gene locus_tag LOCUS_04150 6060 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155282996.1 protein_id gnl|my_center|LOCUS_04150 7900 6065 gene locus_tag LOCUS_04160 7900 6065 CDS product DUF2194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964051.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence038 77 2146 gene locus_tag LOCUS_04170 gene recG 77 2146 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015732.1 protein_id gnl|my_center|LOCUS_04170 2173 3057 gene locus_tag LOCUS_04180 2173 3057 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004121002.1 protein_id gnl|my_center|LOCUS_04180 3578 4096 gene locus_tag LOCUS_04190 gene def 3578 4096 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016949.1 protein_id gnl|my_center|LOCUS_04190 4119 5078 gene locus_tag LOCUS_04200 gene fmt 4119 5078 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373209.1 protein_id gnl|my_center|LOCUS_04200 5125 5790 gene locus_tag LOCUS_04210 5125 5790 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082798.1 protein_id gnl|my_center|LOCUS_04210 5834 6691 gene locus_tag LOCUS_04220 gene folD 5834 6691 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_04220 6711 7190 gene locus_tag LOCUS_04230 gene accB 6711 7190 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020267.1 protein_id gnl|my_center|LOCUS_04230 7227 8516 gene locus_tag LOCUS_04240 7227 8516 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_04240 8526 8978 gene locus_tag LOCUS_04250 8526 8978 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082285506.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence039 180 1559 gene locus_tag LOCUS_04260 gene murD 180 1559 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029597345.1 protein_id gnl|my_center|LOCUS_04260 1600 2739 gene locus_tag LOCUS_04270 gene spoVE 1600 2739 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_04270 2769 3821 gene locus_tag LOCUS_04280 gene murG 2769 3821 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626926.1 protein_id gnl|my_center|LOCUS_04280 3851 5212 gene locus_tag LOCUS_04290 gene murC 3851 5212 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626924.1 protein_id gnl|my_center|LOCUS_04290 5282 6136 gene locus_tag LOCUS_04300 gene murB 5282 6136 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898186.1 protein_id gnl|my_center|LOCUS_04300 6236 6904 gene locus_tag LOCUS_04310 6236 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 6966 8072 gene locus_tag LOCUS_04320 gene ftsZ 6966 8072 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902285.1 protein_id gnl|my_center|LOCUS_04320 8228 8512 gene locus_tag LOCUS_04330 gene rpsF 8228 8512 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023040534.1 protein_id gnl|my_center|LOCUS_04330 >Feature sequence040 <1 706 gene locus_tag LOCUS_04340 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680703.1:sirohydrochlorin cobaltochelatase 1106 1813 gene locus_tag LOCUS_04350 1106 1813 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895388.1 protein_id gnl|my_center|LOCUS_04350 1813 2115 gene locus_tag LOCUS_04360 1813 2115 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812269.1 protein_id gnl|my_center|LOCUS_04360 2102 2794 gene locus_tag LOCUS_04370 gene cbiQ 2102 2794 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496721.1 protein_id gnl|my_center|LOCUS_04370 2787 3593 gene locus_tag LOCUS_04380 2787 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3590 4933 gene locus_tag LOCUS_04390 3590 4933 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901682.1 protein_id gnl|my_center|LOCUS_04390 5073 5729 gene locus_tag LOCUS_04400 5073 5729 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626283.1 protein_id gnl|my_center|LOCUS_04400 5864 6970 gene locus_tag LOCUS_04410 gene cbiD 5864 6970 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016792.1 protein_id gnl|my_center|LOCUS_04410 7260 7457 gene locus_tag LOCUS_04420 7260 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 7468 8196 gene locus_tag LOCUS_04430 gene cobI 7468 8196 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626293.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence041 30 4427 gene locus_tag LOCUS_04440 30 4427 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627746.1 protein_id gnl|my_center|LOCUS_04440 4790 6460 gene locus_tag LOCUS_04450 4790 6460 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903107.1 protein_id gnl|my_center|LOCUS_04450 6500 6994 gene locus_tag LOCUS_04460 6500 6994 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903575.1 protein_id gnl|my_center|LOCUS_04460 7019 8239 gene locus_tag LOCUS_04470 7019 8239 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679364.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence042 219 905 gene locus_tag LOCUS_04480 219 905 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_04480 898 2337 gene locus_tag LOCUS_04490 898 2337 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_04490 2394 2714 gene locus_tag LOCUS_04500 2394 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2858 3142 gene locus_tag LOCUS_04510 2858 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3283 4467 gene locus_tag LOCUS_04520 3283 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4583 5794 gene locus_tag LOCUS_04530 4583 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5833 6210 gene locus_tag LOCUS_04540 5833 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 6259 6804 gene locus_tag LOCUS_04550 6259 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6854 7471 gene locus_tag LOCUS_04560 6854 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 7499 7981 gene locus_tag LOCUS_04570 7499 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8010 8591 gene locus_tag LOCUS_04580 8010 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence043 184 3060 gene locus_tag LOCUS_04590 184 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3044 6325 gene locus_tag LOCUS_04600 3044 6325 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016941.1 protein_id gnl|my_center|LOCUS_04600 6418 7338 gene locus_tag LOCUS_04610 gene ppaC 6418 7338 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416849.1 protein_id gnl|my_center|LOCUS_04610 7371 7724 gene locus_tag LOCUS_04620 7371 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7762 8406 gene locus_tag LOCUS_04630 7762 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 8641 8717 gene locus_tag LOCUS_t00090 8641 8717 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 1901 534 gene locus_tag LOCUS_04640 1901 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3914 2013 gene locus_tag LOCUS_04650 gene metG 3914 2013 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017027.1 protein_id gnl|my_center|LOCUS_04650 4641 3967 gene locus_tag LOCUS_04660 4641 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 5317 4757 gene locus_tag LOCUS_04670 5317 4757 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016825.1 protein_id gnl|my_center|LOCUS_04670 5869 5348 gene locus_tag LOCUS_04680 5869 5348 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962499.1 protein_id gnl|my_center|LOCUS_04680 6857 5988 gene locus_tag LOCUS_04690 6857 5988 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_04690 7342 6881 gene locus_tag LOCUS_04700 gene trmL 7342 6881 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016664.1 protein_id gnl|my_center|LOCUS_04700 7961 7392 gene locus_tag LOCUS_04710 gene ruvC 7961 7392 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902123.1 protein_id gnl|my_center|LOCUS_04710 8665 8081 gene locus_tag LOCUS_04720 8665 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence045 341 724 gene locus_tag LOCUS_04730 341 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 762 1832 gene locus_tag LOCUS_04740 762 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2087 3001 gene locus_tag LOCUS_04750 gene murQ 2087 3001 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431390.1 protein_id gnl|my_center|LOCUS_04750 3023 3238 gene locus_tag LOCUS_04760 3023 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04760 3235 3444 gene locus_tag LOCUS_04770 3235 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04770 3535 3386 gene locus_tag LOCUS_04780 3535 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3546 3755 gene locus_tag LOCUS_04790 3546 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 3786 4877 gene locus_tag LOCUS_04800 3786 4877 CDS product MupG family TIM beta-alpha barrel fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861793.1 protein_id gnl|my_center|LOCUS_04800 4960 6372 gene locus_tag LOCUS_04810 4960 6372 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775345.1 protein_id gnl|my_center|LOCUS_04810 7046 6567 gene locus_tag LOCUS_04820 7046 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 7351 7073 gene locus_tag LOCUS_04830 gene rpsQ 7351 7073 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215433.1 protein_id gnl|my_center|LOCUS_04830 7542 7351 gene locus_tag LOCUS_04840 gene rpmC 7542 7351 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215432.1 protein_id gnl|my_center|LOCUS_04840 7958 7542 gene locus_tag LOCUS_04850 gene rplP 7958 7542 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215430.1 protein_id gnl|my_center|LOCUS_04850 8637 7942 gene locus_tag LOCUS_04860 gene rpsC 8637 7942 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215427.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence046 1551 46 gene locus_tag LOCUS_04870 gene gltX 1551 46 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373220.1 protein_id gnl|my_center|LOCUS_04870 1829 1638 gene locus_tag LOCUS_04880 1829 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2343 1927 gene locus_tag LOCUS_04890 2343 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3305 2646 gene locus_tag LOCUS_04900 3305 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 3803 3366 gene locus_tag LOCUS_04910 3803 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04910 4040 3816 gene locus_tag LOCUS_04920 4040 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04920 4987 4064 gene locus_tag LOCUS_04930 4987 4064 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912466.1 protein_id gnl|my_center|LOCUS_04930 5330 5073 gene locus_tag LOCUS_04940 5330 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6210 5626 gene locus_tag LOCUS_04950 6210 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 7078 6308 gene locus_tag LOCUS_04960 7078 6308 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898090.1 protein_id gnl|my_center|LOCUS_04960 7624 8571 gene locus_tag LOCUS_04970 7624 8571 CDS product IS30-like element IS1655 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217985.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence047 101 1159 gene locus_tag LOCUS_04980 gene prfB 101 1159 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197551829.1 protein_id gnl|my_center|LOCUS_04980 1224 1787 gene locus_tag LOCUS_04990 1224 1787 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_04990 2783 2202 gene locus_tag LOCUS_05000 gene rnmV 2783 2202 CDS product ribonuclease M5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966269.1 protein_id gnl|my_center|LOCUS_05000 4293 2809 gene locus_tag LOCUS_05010 4293 2809 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033065833.1 protein_id gnl|my_center|LOCUS_05010 4528 4379 gene locus_tag LOCUS_05020 4528 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 5276 4566 gene locus_tag LOCUS_05030 gene deoD 5276 4566 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898215.1 protein_id gnl|my_center|LOCUS_05030 7472 5436 gene locus_tag LOCUS_05040 gene glyS 7472 5436 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016119.1 protein_id gnl|my_center|LOCUS_05040 8480 7608 gene locus_tag LOCUS_05050 gene glyQ 8480 7608 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903526.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence048 28 393 gene locus_tag LOCUS_05060 gene rsfS 28 393 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027523570.1 protein_id gnl|my_center|LOCUS_05060 471 2438 gene locus_tag LOCUS_05070 gene mrdA 471 2438 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903183.1 protein_id gnl|my_center|LOCUS_05070 2459 4330 gene locus_tag LOCUS_05080 2459 4330 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896361.1 protein_id gnl|my_center|LOCUS_05080 4332 4667 gene locus_tag LOCUS_05090 gene yhbY 4332 4667 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016989.1 protein_id gnl|my_center|LOCUS_05090 4692 5153 gene locus_tag LOCUS_05100 4692 5153 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_05100 5476 6213 gene locus_tag LOCUS_05110 5476 6213 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_05110 6322 7638 gene locus_tag LOCUS_05120 6322 7638 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494947.1 protein_id gnl|my_center|LOCUS_05120 7683 8213 gene locus_tag LOCUS_05130 7683 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence049 168 920 gene locus_tag LOCUS_05140 gene truA 168 920 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627073.1 protein_id gnl|my_center|LOCUS_05140 1144 1614 gene locus_tag LOCUS_05150 1144 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4234 1832 gene locus_tag LOCUS_05160 4234 1832 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101845.1 protein_id gnl|my_center|LOCUS_05160 5099 4281 gene locus_tag LOCUS_05170 5099 4281 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870179.1 protein_id gnl|my_center|LOCUS_05170 5585 6310 gene locus_tag LOCUS_05180 5585 6310 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048325.1 protein_id gnl|my_center|LOCUS_05180 6387 7157 gene locus_tag LOCUS_05190 6387 7157 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963440.1 protein_id gnl|my_center|LOCUS_05190 7582 7322 gene locus_tag LOCUS_05200 7582 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8300 7617 gene locus_tag LOCUS_05210 8300 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence050 29 442 gene locus_tag LOCUS_05220 29 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 495 3155 gene locus_tag LOCUS_05230 gene secA 495 3155 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015785.1 protein_id gnl|my_center|LOCUS_05230 3892 3254 gene locus_tag LOCUS_05240 3892 3254 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_05240 5275 3896 gene locus_tag LOCUS_05250 5275 3896 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986932.1 protein_id gnl|my_center|LOCUS_05250 7040 5268 gene locus_tag LOCUS_05260 7040 5268 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_05260 7366 7058 gene locus_tag LOCUS_05270 7366 7058 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986934.1 protein_id gnl|my_center|LOCUS_05270 8357 7359 gene locus_tag LOCUS_05280 8357 7359 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986935.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence051 939 184 gene locus_tag LOCUS_05290 939 184 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895688.1 protein_id gnl|my_center|LOCUS_05290 1633 932 gene locus_tag LOCUS_05300 1633 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 7365 1861 gene locus_tag LOCUS_05310 7365 1861 CDS product autotransporter-associated N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081038422.1 protein_id gnl|my_center|LOCUS_05310 7740 7531 gene locus_tag LOCUS_05320 7740 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 7723 8124 gene locus_tag LOCUS_05330 7723 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence052 788 45 gene locus_tag LOCUS_05340 788 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1672 791 gene locus_tag LOCUS_05350 1672 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2303 1656 gene locus_tag LOCUS_05360 2303 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3542 2385 gene locus_tag LOCUS_05370 3542 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 5152 3608 gene locus_tag LOCUS_05380 gene guaA 5152 3608 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017155.1 protein_id gnl|my_center|LOCUS_05380 5804 5274 gene locus_tag LOCUS_05390 gene nrdG 5804 5274 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203409.1 protein_id gnl|my_center|LOCUS_05390 8020 5828 gene locus_tag LOCUS_05400 8020 5828 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766366.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence053 65 1357 gene locus_tag LOCUS_05410 gene aroA 65 1357 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_05410 1494 2114 gene locus_tag LOCUS_05420 1494 2114 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016912.1 protein_id gnl|my_center|LOCUS_05420 2142 3239 gene locus_tag LOCUS_05430 gene aroC 2142 3239 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_05430 4262 3327 gene locus_tag LOCUS_05440 4262 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 4769 4299 gene locus_tag LOCUS_05450 4769 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5015 4782 gene locus_tag LOCUS_05460 5015 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6289 5084 gene locus_tag LOCUS_05470 gene coaBC 6289 5084 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016598.1 protein_id gnl|my_center|LOCUS_05470 7765 6314 gene locus_tag LOCUS_05480 gene cysS 7765 6314 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015680.1 protein_id gnl|my_center|LOCUS_05480 8092 7823 gene locus_tag LOCUS_05490 8092 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence054 1113 541 gene locus_tag LOCUS_05500 1113 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1962 1159 gene locus_tag LOCUS_05510 1962 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3083 2004 gene locus_tag LOCUS_05520 3083 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5729 3150 gene locus_tag LOCUS_05530 5729 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 6421 5726 gene locus_tag LOCUS_05540 6421 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6608 6408 gene locus_tag LOCUS_05550 6608 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 6965 6618 gene locus_tag LOCUS_05560 6965 6618 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479720.1 protein_id gnl|my_center|LOCUS_05560 7829 7203 gene locus_tag LOCUS_05570 7829 7203 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626801.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence055 405 1847 gene locus_tag LOCUS_05580 405 1847 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222388.1 protein_id gnl|my_center|LOCUS_05580 3150 1912 gene locus_tag LOCUS_05590 gene gltS 3150 1912 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903453.1 protein_id gnl|my_center|LOCUS_05590 4463 3375 gene locus_tag LOCUS_05600 4463 3375 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005392234.1 protein_id gnl|my_center|LOCUS_05600 5233 4607 gene locus_tag LOCUS_05610 5233 4607 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081157.1 protein_id gnl|my_center|LOCUS_05610 7141 5429 gene locus_tag LOCUS_05620 7141 5429 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015730.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence056 24 1646 gene locus_tag LOCUS_05630 gene nikA 24 1646 CDS product nickel ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901093.1 protein_id gnl|my_center|LOCUS_05630 1775 2719 gene locus_tag LOCUS_05640 1775 2719 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022819132.1 protein_id gnl|my_center|LOCUS_05640 2722 3534 gene locus_tag LOCUS_05650 2722 3534 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960273.1 protein_id gnl|my_center|LOCUS_05650 3522 4307 gene locus_tag LOCUS_05660 3522 4307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836556.1 protein_id gnl|my_center|LOCUS_05660 4309 5079 gene locus_tag LOCUS_05670 4309 5079 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836557.1 protein_id gnl|my_center|LOCUS_05670 5639 5178 gene locus_tag LOCUS_05680 5639 5178 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893336.1 protein_id gnl|my_center|LOCUS_05680 6810 5665 gene locus_tag LOCUS_05690 6810 5665 CDS product haloacid dehalogenase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016134.1 protein_id gnl|my_center|LOCUS_05690 7942 6845 gene locus_tag LOCUS_05700 gene eutH 7942 6845 CDS product ethanolamine utilization protein EutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016133.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence057 1674 313 gene locus_tag LOCUS_05710 1674 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 2560 1706 gene locus_tag LOCUS_05720 2560 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 3681 2830 gene locus_tag LOCUS_05730 3681 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 4388 3897 gene locus_tag LOCUS_05740 4388 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 5786 4449 gene locus_tag LOCUS_05750 gene ffh 5786 4449 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903281.1 protein_id gnl|my_center|LOCUS_05750 6084 7298 gene locus_tag LOCUS_05760 6084 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 7743 7411 gene locus_tag LOCUS_05770 7743 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence058 716 111 gene locus_tag LOCUS_05780 716 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2065 893 gene locus_tag LOCUS_05790 gene alr 2065 893 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016367.1 protein_id gnl|my_center|LOCUS_05790 2617 2096 gene locus_tag LOCUS_05800 2617 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3322 2729 gene locus_tag LOCUS_05810 3322 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 4117 3371 gene locus_tag LOCUS_05820 4117 3371 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616577.1 protein_id gnl|my_center|LOCUS_05820 4746 4138 gene locus_tag LOCUS_05830 4746 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 5857 4736 gene locus_tag LOCUS_05840 gene recA 5857 4736 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373114.1 protein_id gnl|my_center|LOCUS_05840 6679 6002 gene locus_tag LOCUS_05850 6679 6002 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947925.1 protein_id gnl|my_center|LOCUS_05850 7892 6882 gene locus_tag LOCUS_05860 gene ilvC 7892 6882 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185539.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence059 1105 62 gene locus_tag LOCUS_05870 1105 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2208 1120 gene locus_tag LOCUS_05880 2208 1120 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016062.1 protein_id gnl|my_center|LOCUS_05880 3873 2236 gene locus_tag LOCUS_05890 3873 2236 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_05890 4830 3979 gene locus_tag LOCUS_05900 gene speB 4830 3979 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_05900 5703 4861 gene locus_tag LOCUS_05910 gene speE 5703 4861 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_05910 6374 5844 gene locus_tag LOCUS_05920 6374 5844 CDS product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368347.1 protein_id gnl|my_center|LOCUS_05920 <7826 6441 gene locus_tag LOCUS_05930 <7826 6441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808143.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence060 153 416 gene locus_tag LOCUS_05940 153 416 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563849.1 protein_id gnl|my_center|LOCUS_05940 537 1178 gene locus_tag LOCUS_05950 gene cbiE 537 1178 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016791.1 protein_id gnl|my_center|LOCUS_05950 1450 4128 gene locus_tag LOCUS_05960 gene leuS 1450 4128 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015646.1 protein_id gnl|my_center|LOCUS_05960 4152 4988 gene locus_tag LOCUS_05970 4152 4988 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002261950.1 protein_id gnl|my_center|LOCUS_05970 5283 5825 gene locus_tag LOCUS_05980 5283 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05980 5749 7335 gene locus_tag LOCUS_05990 5749 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05990 >Feature sequence061 154 1137 gene locus_tag LOCUS_06000 154 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1840 1310 gene locus_tag LOCUS_06010 1840 1310 CDS product DUF5105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029598027.1 protein_id gnl|my_center|LOCUS_06010 3262 1916 gene locus_tag LOCUS_06020 gene mgtE 3262 1916 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_06020 4655 3309 gene locus_tag LOCUS_06030 gene mgtE 4655 3309 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_06030 5498 4995 gene locus_tag LOCUS_06040 5498 4995 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272310.1 protein_id gnl|my_center|LOCUS_06040 5680 7671 gene locus_tag LOCUS_06050 5680 7671 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851294.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence062 231 1940 gene locus_tag LOCUS_06060 231 1940 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_06060 2092 2577 gene locus_tag LOCUS_06070 2092 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016974.1 protein_id gnl|my_center|LOCUS_06070 2577 2948 gene locus_tag LOCUS_06080 2577 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896389.1 protein_id gnl|my_center|LOCUS_06080 2982 5162 gene locus_tag LOCUS_06090 2982 5162 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016976.1 protein_id gnl|my_center|LOCUS_06090 5199 5945 gene locus_tag LOCUS_06100 5199 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918333.1 protein_id gnl|my_center|LOCUS_06100 5996 6283 gene locus_tag LOCUS_06110 5996 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903162.1 protein_id gnl|my_center|LOCUS_06110 6347 7033 gene locus_tag LOCUS_06120 gene gpmA 6347 7033 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902448.1 protein_id gnl|my_center|LOCUS_06120 7191 7598 gene locus_tag LOCUS_06130 7191 7598 CDS product DUF2721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071530.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence063 139 1344 gene locus_tag LOCUS_06140 139 1344 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_06140 1372 2109 gene locus_tag LOCUS_06150 1372 2109 CDS product esterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019252.1 protein_id gnl|my_center|LOCUS_06150 2264 4003 gene locus_tag LOCUS_06160 2264 4003 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966684.1 protein_id gnl|my_center|LOCUS_06160 4003 5898 gene locus_tag LOCUS_06170 4003 5898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_06170 6228 5974 gene locus_tag LOCUS_06180 6228 5974 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812263.1 protein_id gnl|my_center|LOCUS_06180 6475 6221 gene locus_tag LOCUS_06190 6475 6221 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388479.1 protein_id gnl|my_center|LOCUS_06190 6622 6906 gene locus_tag LOCUS_06200 gene vapD 6622 6906 CDS product endoribonuclease VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271050.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence064 114 1250 gene locus_tag LOCUS_06210 gene nifS 114 1250 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_06210 1338 2129 gene locus_tag LOCUS_06220 1338 2129 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016356.1 protein_id gnl|my_center|LOCUS_06220 2164 5721 gene locus_tag LOCUS_06230 gene dnaE 2164 5721 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017116.1 protein_id gnl|my_center|LOCUS_06230 5746 6516 gene locus_tag LOCUS_06240 5746 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 6610 7164 gene locus_tag LOCUS_06250 gene rsmD 6610 7164 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017073.1 protein_id gnl|my_center|LOCUS_06250 7196 7417 gene locus_tag LOCUS_06260 gene xseB 7196 7417 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899316.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence065 230 1504 gene locus_tag LOCUS_06270 230 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 1564 2676 gene locus_tag LOCUS_06280 1564 2676 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839428.1 protein_id gnl|my_center|LOCUS_06280 2828 5893 gene locus_tag LOCUS_06290 2828 5893 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017033.1 protein_id gnl|my_center|LOCUS_06290 5925 6221 gene locus_tag LOCUS_06300 5925 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 6275 6898 gene locus_tag LOCUS_06310 gene upp 6275 6898 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032884835.1 protein_id gnl|my_center|LOCUS_06310 6885 7115 gene locus_tag LOCUS_06320 6885 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence066 822 55 gene locus_tag LOCUS_06330 822 55 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015830.1 protein_id gnl|my_center|LOCUS_06330 1200 838 gene locus_tag LOCUS_06340 1200 838 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681167.1 protein_id gnl|my_center|LOCUS_06340 1427 1245 gene locus_tag LOCUS_06350 1427 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 2980 1535 gene locus_tag LOCUS_06360 2980 1535 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 protein_id gnl|my_center|LOCUS_06360 4424 3072 gene locus_tag LOCUS_06370 gene trkA 4424 3072 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016254.1 protein_id gnl|my_center|LOCUS_06370 5420 4449 gene locus_tag LOCUS_06380 gene hemB 5420 4449 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016407.1 protein_id gnl|my_center|LOCUS_06380 5935 5465 gene locus_tag LOCUS_06390 5935 5465 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016462.1 protein_id gnl|my_center|LOCUS_06390 6116 6883 gene locus_tag LOCUS_06400 gene cobS 6116 6883 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016745.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence067 85 831 gene locus_tag LOCUS_06410 gene sufC 85 831 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672329.1 protein_id gnl|my_center|LOCUS_06410 860 2272 gene locus_tag LOCUS_06420 gene sufB 860 2272 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669913.1 protein_id gnl|my_center|LOCUS_06420 2314 3441 gene locus_tag LOCUS_06430 gene sufD 2314 3441 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966564.1 protein_id gnl|my_center|LOCUS_06430 3532 4023 gene locus_tag LOCUS_06440 3532 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 4051 5256 gene locus_tag LOCUS_06450 4051 5256 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679842.1 protein_id gnl|my_center|LOCUS_06450 5300 5740 gene locus_tag LOCUS_06460 5300 5740 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668316.1 protein_id gnl|my_center|LOCUS_06460 7148 5796 gene locus_tag LOCUS_06470 7148 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 >Feature sequence068 544 1005 gene locus_tag LOCUS_06480 544 1005 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492147.1 protein_id gnl|my_center|LOCUS_06480 1247 2269 gene locus_tag LOCUS_06490 1247 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700534.1 protein_id gnl|my_center|LOCUS_06490 2306 3259 gene locus_tag LOCUS_06500 2306 3259 CDS product 2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193507.1 protein_id gnl|my_center|LOCUS_06500 3292 4737 gene locus_tag LOCUS_06510 3292 4737 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837544.1 protein_id gnl|my_center|LOCUS_06510 4790 5779 gene locus_tag LOCUS_06520 4790 5779 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209628184.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence069 <1 1204 gene locus_tag LOCUS_06530 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005901943.1:lipid-A-disaccharide synthase 1225 2676 gene locus_tag LOCUS_06540 1225 2676 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436703.1 protein_id gnl|my_center|LOCUS_06540 2708 3331 gene locus_tag LOCUS_06550 gene plsY 2708 3331 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016461.1 protein_id gnl|my_center|LOCUS_06550 3349 4371 gene locus_tag LOCUS_06560 3349 4371 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_06560 4405 5226 gene locus_tag LOCUS_06570 4405 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 5242 6369 gene locus_tag LOCUS_06580 gene dnaN 5242 6369 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904330.1 protein_id gnl|my_center|LOCUS_06580 6414 7352 gene locus_tag LOCUS_06590 gene metA 6414 7352 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence070 747 13 gene locus_tag LOCUS_06600 747 13 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266471.1 protein_id gnl|my_center|LOCUS_06600 2275 719 gene locus_tag LOCUS_06610 2275 719 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858148.1 protein_id gnl|my_center|LOCUS_06610 3401 2307 gene locus_tag LOCUS_06620 3401 2307 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 protein_id gnl|my_center|LOCUS_06620 4566 3466 gene locus_tag LOCUS_06630 4566 3466 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 protein_id gnl|my_center|LOCUS_06630 5751 4612 gene locus_tag LOCUS_06640 5751 4612 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074270.1 protein_id gnl|my_center|LOCUS_06640 6419 5760 gene locus_tag LOCUS_06650 6419 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 7210 6569 gene locus_tag LOCUS_06660 7210 6569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence071 276 1766 gene locus_tag LOCUS_06670 gene malQ 276 1766 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_06670 2453 1851 gene locus_tag LOCUS_06680 2453 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3023 2478 gene locus_tag LOCUS_06690 3023 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3637 3089 gene locus_tag LOCUS_06700 3637 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3939 3787 gene locus_tag LOCUS_06710 3939 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 4590 3967 gene locus_tag LOCUS_06720 gene purN 4590 3967 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047940.1 protein_id gnl|my_center|LOCUS_06720 5576 4578 gene locus_tag LOCUS_06730 gene purM 5576 4578 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016807.1 protein_id gnl|my_center|LOCUS_06730 5885 5598 gene locus_tag LOCUS_06740 5885 5598 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890723.1 protein_id gnl|my_center|LOCUS_06740 <7310 5895 gene locus_tag LOCUS_06750 <7310 5895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007051228.1:amidophosphoribosyltransferase >Feature sequence072 444 938 gene locus_tag LOCUS_06760 444 938 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_06760 985 3489 gene locus_tag LOCUS_06770 985 3489 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015924.1 protein_id gnl|my_center|LOCUS_06770 3540 4247 gene locus_tag LOCUS_06780 3540 4247 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015921.1 protein_id gnl|my_center|LOCUS_06780 4882 4301 gene locus_tag LOCUS_06790 4882 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence073 20 232 gene locus_tag LOCUS_06800 20 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 265 600 gene locus_tag LOCUS_06810 265 600 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425440.1 protein_id gnl|my_center|LOCUS_06810 593 1942 gene locus_tag LOCUS_06820 gene celB 593 1942 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009901597.1 protein_id gnl|my_center|LOCUS_06820 2207 2728 gene locus_tag LOCUS_06830 2207 2728 CDS product GrdB-related putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860643.1 protein_id gnl|my_center|LOCUS_06830 2861 3850 gene locus_tag LOCUS_06840 2861 3850 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076673.1 protein_id gnl|my_center|LOCUS_06840 3856 4935 gene locus_tag LOCUS_06850 3856 4935 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002456664.1 protein_id gnl|my_center|LOCUS_06850 4963 5928 gene locus_tag LOCUS_06860 4963 5928 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895213.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence074 2307 1105 gene locus_tag LOCUS_06870 2307 1105 CDS product PBSX family phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674653.1 protein_id gnl|my_center|LOCUS_06870 3031 2300 gene locus_tag LOCUS_06880 3031 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 3342 3184 gene locus_tag LOCUS_06890 3342 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 4103 3423 gene locus_tag LOCUS_06900 4103 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4518 4087 gene locus_tag LOCUS_06910 4518 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4787 4566 gene locus_tag LOCUS_06920 4787 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5183 4803 gene locus_tag LOCUS_06930 5183 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5330 5193 gene locus_tag LOCUS_06940 5330 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 5630 5436 gene locus_tag LOCUS_06950 5630 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 5910 5680 gene locus_tag LOCUS_06960 5910 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6717 5914 gene locus_tag LOCUS_06970 6717 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 6866 6681 gene locus_tag LOCUS_06980 6866 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence075 259 1359 gene locus_tag LOCUS_06990 259 1359 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000245682.1 protein_id gnl|my_center|LOCUS_06990 2310 1462 gene locus_tag LOCUS_07000 2310 1462 CDS product cysteine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206472.1 protein_id gnl|my_center|LOCUS_07000 3295 2348 gene locus_tag LOCUS_07010 3295 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184231.1 protein_id gnl|my_center|LOCUS_07010 4593 3328 gene locus_tag LOCUS_07020 gene gltP 4593 3328 CDS product glutamate-aspartate/proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234847.1 protein_id gnl|my_center|LOCUS_07020 5434 4652 gene locus_tag LOCUS_07030 5434 4652 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815845.1 protein_id gnl|my_center|LOCUS_07030 6139 5462 gene locus_tag LOCUS_07040 6139 5462 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462042.1 protein_id gnl|my_center|LOCUS_07040 6779 6120 gene locus_tag LOCUS_07050 6779 6120 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272759.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence076 <1 694 gene locus_tag LOCUS_07060 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015918.1:GTPase ObgE 829 1866 gene locus_tag LOCUS_07070 829 1866 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_07070 2026 5049 gene locus_tag LOCUS_07080 2026 5049 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016080.1 protein_id gnl|my_center|LOCUS_07080 5054 5503 gene locus_tag LOCUS_07090 5054 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 5554 5712 gene locus_tag LOCUS_07100 5554 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5705 5866 gene locus_tag LOCUS_07110 5705 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 6998 6564 gene locus_tag LOCUS_07120 6998 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence077 >Feature sequence078 6841 17 gene locus_tag LOCUS_07130 6841 17 CDS product autotransporter-associated N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627026.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence079 591 10 gene locus_tag LOCUS_07140 591 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1652 618 gene locus_tag LOCUS_07150 1652 618 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_07150 2362 1673 gene locus_tag LOCUS_07160 2362 1673 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436876.1 protein_id gnl|my_center|LOCUS_07160 3121 2432 gene locus_tag LOCUS_07170 3121 2432 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_07170 3483 4718 gene locus_tag LOCUS_07180 gene hisS 3483 4718 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016292.1 protein_id gnl|my_center|LOCUS_07180 4746 6527 gene locus_tag LOCUS_07190 gene aspS 4746 6527 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016293.1 protein_id gnl|my_center|LOCUS_07190 6552 6764 gene locus_tag LOCUS_07200 6552 6764 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897142.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence080 <1 1321 gene locus_tag LOCUS_07210 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963782.1:hemolysin family protein 1371 2753 gene locus_tag LOCUS_07220 1371 2753 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897252.1 protein_id gnl|my_center|LOCUS_07220 3093 2836 gene locus_tag LOCUS_07230 3093 2836 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387490.1 protein_id gnl|my_center|LOCUS_07230 5157 3112 gene locus_tag LOCUS_07240 5157 3112 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898410.1 protein_id gnl|my_center|LOCUS_07240 6289 5192 gene locus_tag LOCUS_07250 gene rlmN 6289 5192 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016454.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence081 3721 92 gene locus_tag LOCUS_07260 gene smc 3721 92 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147373219.1 protein_id gnl|my_center|LOCUS_07260 5031 3748 gene locus_tag LOCUS_07270 5031 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 6799 5168 gene locus_tag LOCUS_07280 6799 5168 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence082 1190 132 gene locus_tag LOCUS_07290 gene nadR 1190 132 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005666220.1 protein_id gnl|my_center|LOCUS_07290 2753 1311 gene locus_tag LOCUS_07300 2753 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3478 2792 gene locus_tag LOCUS_07310 3478 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 4344 3697 gene locus_tag LOCUS_07320 4344 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5570 4380 gene locus_tag LOCUS_07330 gene thiI 5570 4380 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 protein_id gnl|my_center|LOCUS_07330 6752 5604 gene locus_tag LOCUS_07340 6752 5604 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence083 3151 23 gene locus_tag LOCUS_07350 3151 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 4964 3225 gene locus_tag LOCUS_07360 4964 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5330 6697 gene locus_tag LOCUS_07370 5330 6697 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence084 1135 653 gene locus_tag LOCUS_07380 1135 653 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576872.1 protein_id gnl|my_center|LOCUS_07380 2185 1166 gene locus_tag LOCUS_07390 gene pheS 2185 1166 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895121.1 protein_id gnl|my_center|LOCUS_07390 2760 2371 gene locus_tag LOCUS_07400 2760 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3597 2761 gene locus_tag LOCUS_07410 3597 2761 CDS product PTS mannose transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005163650.1 protein_id gnl|my_center|LOCUS_07410 4422 3610 gene locus_tag LOCUS_07420 4422 3610 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721899.1 protein_id gnl|my_center|LOCUS_07420 4959 4468 gene locus_tag LOCUS_07430 4959 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 5527 5084 gene locus_tag LOCUS_07440 5527 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 6408 5956 gene locus_tag LOCUS_07450 6408 5956 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016060.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence085 541 197 gene locus_tag LOCUS_07460 gene rplT 541 197 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901611.1 protein_id gnl|my_center|LOCUS_07460 948 742 gene locus_tag LOCUS_07470 gene rpmI 948 742 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005893833.1 protein_id gnl|my_center|LOCUS_07470 1484 993 gene locus_tag LOCUS_07480 gene infC 1484 993 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901608.1 protein_id gnl|my_center|LOCUS_07480 1957 2628 gene locus_tag LOCUS_07490 1957 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2625 3281 gene locus_tag LOCUS_07500 2625 3281 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354825.1 protein_id gnl|my_center|LOCUS_07500 3281 4075 gene locus_tag LOCUS_07510 3281 4075 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387408.1 protein_id gnl|my_center|LOCUS_07510 4247 6541 gene locus_tag LOCUS_07520 4247 6541 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015927.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence086 187 1248 gene locus_tag LOCUS_07530 gene ulaG 187 1248 CDS product L-ascorbate 6-phosphate lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368618.1 protein_id gnl|my_center|LOCUS_07530 1313 2836 gene locus_tag LOCUS_07540 1313 2836 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262727.1 protein_id gnl|my_center|LOCUS_07540 2881 3162 gene locus_tag LOCUS_07550 2881 3162 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899074.1 protein_id gnl|my_center|LOCUS_07550 3189 3638 gene locus_tag LOCUS_07560 3189 3638 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049932.1 protein_id gnl|my_center|LOCUS_07560 3745 4404 gene locus_tag LOCUS_07570 3745 4404 CDS product 3-keto-L-gulonate-6-phosphate decarboxylase UlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837547.1 protein_id gnl|my_center|LOCUS_07570 4414 5289 gene locus_tag LOCUS_07580 4414 5289 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693360.1 protein_id gnl|my_center|LOCUS_07580 5289 5990 gene locus_tag LOCUS_07590 gene araD 5289 5990 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897453.1 protein_id gnl|my_center|LOCUS_07590 6094 6501 gene locus_tag LOCUS_07600 6094 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence087 930 220 gene locus_tag LOCUS_07610 930 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07610 1147 920 gene locus_tag LOCUS_07620 1147 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1603 1205 gene locus_tag LOCUS_07630 1603 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07630 2075 1497 gene locus_tag LOCUS_07640 2075 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07640 2916 2266 gene locus_tag LOCUS_07650 2916 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4448 3018 gene locus_tag LOCUS_07660 4448 3018 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003018116.1 protein_id gnl|my_center|LOCUS_07660 6622 4616 gene locus_tag LOCUS_07670 6622 4616 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898558.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence088 119 1060 gene locus_tag LOCUS_07680 119 1060 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015650.1 protein_id gnl|my_center|LOCUS_07680 1063 1893 gene locus_tag LOCUS_07690 1063 1893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903784.1 protein_id gnl|my_center|LOCUS_07690 1942 3507 gene locus_tag LOCUS_07700 1942 3507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903785.1 protein_id gnl|my_center|LOCUS_07700 3517 4302 gene locus_tag LOCUS_07710 3517 4302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903786.1 protein_id gnl|my_center|LOCUS_07710 4295 5098 gene locus_tag LOCUS_07720 4295 5098 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975400.1 protein_id gnl|my_center|LOCUS_07720 5188 5442 gene locus_tag LOCUS_07730 5188 5442 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113434.1 protein_id gnl|my_center|LOCUS_07730 5442 5705 gene locus_tag LOCUS_07740 5442 5705 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113436.1 protein_id gnl|my_center|LOCUS_07740 5917 6471 gene locus_tag LOCUS_07750 5917 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence089 <1 700 gene locus_tag LOCUS_07760 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943721.1:histidinol dehydrogenase 795 1475 gene locus_tag LOCUS_07770 795 1475 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272297.1 protein_id gnl|my_center|LOCUS_07770 1486 3087 gene locus_tag LOCUS_07780 1486 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3087 4448 gene locus_tag LOCUS_07790 gene glmM 3087 4448 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902604.1 protein_id gnl|my_center|LOCUS_07790 5254 4511 gene locus_tag LOCUS_07800 5254 4511 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861815.1 protein_id gnl|my_center|LOCUS_07800 6103 5306 gene locus_tag LOCUS_07810 6103 5306 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836388.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence090 1310 564 gene locus_tag LOCUS_07820 1310 564 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189145.1 protein_id gnl|my_center|LOCUS_07820 2247 1444 gene locus_tag LOCUS_07830 2247 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3024 2281 gene locus_tag LOCUS_07840 3024 2281 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776584.1 protein_id gnl|my_center|LOCUS_07840 3810 3082 gene locus_tag LOCUS_07850 3810 3082 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724779.1 protein_id gnl|my_center|LOCUS_07850 4540 3803 gene locus_tag LOCUS_07860 4540 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 4819 5328 gene locus_tag LOCUS_07870 4819 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 5721 5350 gene locus_tag LOCUS_07880 5721 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 6448 5678 gene locus_tag LOCUS_07890 6448 5678 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470522.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence091 486 1118 gene locus_tag LOCUS_07900 486 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1121 1636 gene locus_tag LOCUS_07910 1121 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1636 2385 gene locus_tag LOCUS_07920 1636 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2450 2689 gene locus_tag LOCUS_07930 2450 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 2691 2918 gene locus_tag LOCUS_07940 2691 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2899 3051 gene locus_tag LOCUS_07950 2899 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3094 3459 gene locus_tag LOCUS_07960 gene ssb 3094 3459 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368292.1 protein_id gnl|my_center|LOCUS_07960 3440 3622 gene locus_tag LOCUS_07970 3440 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3631 3795 gene locus_tag LOCUS_07980 3631 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3797 4198 gene locus_tag LOCUS_07990 3797 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4272 4751 gene locus_tag LOCUS_08000 4272 4751 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_08000 4773 5018 gene locus_tag LOCUS_08010 4773 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 5043 5279 gene locus_tag LOCUS_08020 5043 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5321 5845 gene locus_tag LOCUS_08030 5321 5845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 5835 6155 gene locus_tag LOCUS_08040 5835 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence092 257 1369 gene locus_tag LOCUS_08050 257 1369 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_08050 1416 2531 gene locus_tag LOCUS_08060 1416 2531 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_08060 2770 3666 gene locus_tag LOCUS_08070 2770 3666 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_08070 3682 4776 gene locus_tag LOCUS_08080 3682 4776 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797307.1 protein_id gnl|my_center|LOCUS_08080 4844 5602 gene locus_tag LOCUS_08090 4844 5602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017145.1 protein_id gnl|my_center|LOCUS_08090 5646 6359 gene locus_tag LOCUS_08100 5646 6359 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence093 189 896 gene locus_tag LOCUS_08110 189 896 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194205.1 protein_id gnl|my_center|LOCUS_08110 1108 2352 gene locus_tag LOCUS_08120 1108 2352 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244025.1 protein_id gnl|my_center|LOCUS_08120 2498 3163 gene locus_tag LOCUS_08130 gene deoC 2498 3163 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836882.1 protein_id gnl|my_center|LOCUS_08130 3534 4256 gene locus_tag LOCUS_08140 3534 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 5366 4566 gene locus_tag LOCUS_08150 5366 4566 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263207.1 protein_id gnl|my_center|LOCUS_08150 5499 5849 gene locus_tag LOCUS_08160 5499 5849 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence094 1654 128 gene locus_tag LOCUS_08170 1654 128 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015707.1 protein_id gnl|my_center|LOCUS_08170 2479 1655 gene locus_tag LOCUS_08180 2479 1655 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_08180 2633 3373 gene locus_tag LOCUS_08190 gene sfsA 2633 3373 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877131.1 protein_id gnl|my_center|LOCUS_08190 4260 3475 gene locus_tag LOCUS_08200 4260 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 6225 4363 gene locus_tag LOCUS_08210 6225 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence095 174 1529 gene locus_tag LOCUS_08220 174 1529 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_08220 1653 3026 gene locus_tag LOCUS_08230 1653 3026 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657823.1 protein_id gnl|my_center|LOCUS_08230 3052 6105 gene locus_tag LOCUS_08240 3052 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence096 928 71 gene locus_tag LOCUS_08250 928 71 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082812.1 protein_id gnl|my_center|LOCUS_08250 2855 1068 gene locus_tag LOCUS_08260 gene sppA 2855 1068 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492321.1 protein_id gnl|my_center|LOCUS_08260 3021 3296 gene locus_tag LOCUS_08270 3021 3296 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_08270 3348 4712 gene locus_tag LOCUS_08280 3348 4712 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_08280 4905 5474 gene locus_tag LOCUS_08290 gene cbiT 4905 5474 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948622.1 protein_id gnl|my_center|LOCUS_08290 6191 5565 gene locus_tag LOCUS_08300 6191 5565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence097 57 1289 gene locus_tag LOCUS_08310 gene fabF 57 1289 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244890.1 protein_id gnl|my_center|LOCUS_08310 1391 2104 gene locus_tag LOCUS_08320 gene rnc 1391 2104 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797266.1 protein_id gnl|my_center|LOCUS_08320 2135 2638 gene locus_tag LOCUS_08330 gene coaD 2135 2638 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_08330 2735 4093 gene locus_tag LOCUS_08340 gene radA 2735 4093 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016188.1 protein_id gnl|my_center|LOCUS_08340 4129 5202 gene locus_tag LOCUS_08350 gene disA 4129 5202 CDS product DNA integrity scanning diadenylate cyclase DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966464.1 protein_id gnl|my_center|LOCUS_08350 5264 6172 gene locus_tag LOCUS_08360 5264 6172 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480077.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence098 696 2291 gene locus_tag LOCUS_08370 gene pckA 696 2291 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626187.1 protein_id gnl|my_center|LOCUS_08370 2433 3824 gene locus_tag LOCUS_08380 2433 3824 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017109.1 protein_id gnl|my_center|LOCUS_08380 3889 4155 gene locus_tag LOCUS_08390 3889 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 4213 4563 gene locus_tag LOCUS_08400 4213 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 4593 4967 gene locus_tag LOCUS_08410 4593 4967 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_08410 5022 6146 gene locus_tag LOCUS_08420 5022 6146 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922322.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence099 116 754 gene locus_tag LOCUS_08430 116 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 770 1630 gene locus_tag LOCUS_08440 gene atpG 770 1630 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016336.1 protein_id gnl|my_center|LOCUS_08440 1689 3086 gene locus_tag LOCUS_08450 gene atpD 1689 3086 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016335.1 protein_id gnl|my_center|LOCUS_08450 3186 3575 gene locus_tag LOCUS_08460 3186 3575 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227688.1 protein_id gnl|my_center|LOCUS_08460 3668 4666 gene locus_tag LOCUS_08470 3668 4666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 4717 5100 gene locus_tag LOCUS_08480 4717 5100 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027559.1 protein_id gnl|my_center|LOCUS_08480 5221 5955 gene locus_tag LOCUS_08490 gene dapB 5221 5955 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence100 22 2145 gene locus_tag LOCUS_08500 22 2145 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_08500 2310 3206 gene locus_tag LOCUS_08510 gene atpB 2310 3206 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796847.1 protein_id gnl|my_center|LOCUS_08510 3345 3581 gene locus_tag LOCUS_08520 3345 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3642 4136 gene locus_tag LOCUS_08530 gene atpF 3642 4136 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902611.1 protein_id gnl|my_center|LOCUS_08530 4138 4665 gene locus_tag LOCUS_08540 gene atpH 4138 4665 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016338.1 protein_id gnl|my_center|LOCUS_08540 4684 6189 gene locus_tag LOCUS_08550 gene atpA 4684 6189 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016337.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence101 70 1692 gene locus_tag LOCUS_08560 gene groL 70 1692 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016573.1 protein_id gnl|my_center|LOCUS_08560 3046 1754 gene locus_tag LOCUS_08570 3046 1754 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074567.1 protein_id gnl|my_center|LOCUS_08570 3736 3146 gene locus_tag LOCUS_08580 3736 3146 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837539.1 protein_id gnl|my_center|LOCUS_08580 4973 3762 gene locus_tag LOCUS_08590 4973 3762 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775288.1 protein_id gnl|my_center|LOCUS_08590 5957 5136 gene locus_tag LOCUS_08600 5957 5136 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593585.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence102 1163 81 gene locus_tag LOCUS_08610 1163 81 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262467.1 protein_id gnl|my_center|LOCUS_08610 2165 1443 gene locus_tag LOCUS_08620 gene rsmG 2165 1443 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015789.1 protein_id gnl|my_center|LOCUS_08620 4139 2217 gene locus_tag LOCUS_08630 gene mnmG 4139 2217 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015790.1 protein_id gnl|my_center|LOCUS_08630 4679 4341 gene locus_tag LOCUS_tm00010 4679 4341 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5249 4746 gene locus_tag LOCUS_08640 5249 4746 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_08640 6143 5412 gene locus_tag LOCUS_08650 6143 5412 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679291.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence103 135 806 gene locus_tag LOCUS_08660 135 806 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901930.1 protein_id gnl|my_center|LOCUS_08660 860 2212 gene locus_tag LOCUS_08670 860 2212 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901931.1 protein_id gnl|my_center|LOCUS_08670 4911 2284 gene locus_tag LOCUS_08680 gene adhE 4911 2284 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948126.1 protein_id gnl|my_center|LOCUS_08680 5989 4949 gene locus_tag LOCUS_08690 5989 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence104 1368 112 gene locus_tag LOCUS_08700 1368 112 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_08700 1989 1399 gene locus_tag LOCUS_08710 1989 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016816.1 protein_id gnl|my_center|LOCUS_08710 3503 2361 gene locus_tag LOCUS_08720 gene proB 3503 2361 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392099.1 protein_id gnl|my_center|LOCUS_08720 3736 3593 gene locus_tag LOCUS_08730 3736 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 5283 3841 gene locus_tag LOCUS_08740 5283 3841 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109383.1 protein_id gnl|my_center|LOCUS_08740 6079 5327 gene locus_tag LOCUS_08750 gene kdsB 6079 5327 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence105 <1 2780 gene locus_tag LOCUS_08760 <1 2780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272299.1:cation-translocating P-type ATPase 3861 2899 gene locus_tag LOCUS_08770 3861 2899 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098117.1 protein_id gnl|my_center|LOCUS_08770 4710 3862 gene locus_tag LOCUS_08780 4710 3862 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103260.1 protein_id gnl|my_center|LOCUS_08780 6102 4753 gene locus_tag LOCUS_08790 6102 4753 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681684.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence106 709 83 gene locus_tag LOCUS_08800 709 83 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903191.1 protein_id gnl|my_center|LOCUS_08800 1262 840 gene locus_tag LOCUS_08810 1262 840 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459277.1 protein_id gnl|my_center|LOCUS_08810 2524 1328 gene locus_tag LOCUS_08820 2524 1328 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016959.1 protein_id gnl|my_center|LOCUS_08820 3571 2567 gene locus_tag LOCUS_08830 gene pta 3571 2567 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627902.1 protein_id gnl|my_center|LOCUS_08830 4790 3600 gene locus_tag LOCUS_08840 gene ftsY 4790 3600 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016881.1 protein_id gnl|my_center|LOCUS_08840 5530 4790 gene locus_tag LOCUS_08850 gene tsaB 5530 4790 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016759.1 protein_id gnl|my_center|LOCUS_08850 6055 5603 gene locus_tag LOCUS_08860 gene tsaE 6055 5603 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903737.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence107 63 227 gene locus_tag LOCUS_08870 63 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 227 814 gene locus_tag LOCUS_08880 227 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894741.1 protein_id gnl|my_center|LOCUS_08880 1042 1980 gene locus_tag LOCUS_08890 1042 1980 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015705.1 protein_id gnl|my_center|LOCUS_08890 2235 3161 gene locus_tag LOCUS_08900 gene ddlB 2235 3161 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181680.1 protein_id gnl|my_center|LOCUS_08900 3211 3690 gene locus_tag LOCUS_08910 3211 3690 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_08910 3742 3987 gene locus_tag LOCUS_08920 3742 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 4088 4777 gene locus_tag LOCUS_08930 4088 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4807 5433 gene locus_tag LOCUS_08940 4807 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005975524.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence108 394 2469 gene locus_tag LOCUS_08950 gene mutL 394 2469 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495553.1 protein_id gnl|my_center|LOCUS_08950 2530 3000 gene locus_tag LOCUS_08960 2530 3000 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016410.1 protein_id gnl|my_center|LOCUS_08960 3013 3441 gene locus_tag LOCUS_08970 3013 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3443 3844 gene locus_tag LOCUS_08980 3443 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3865 5349 gene locus_tag LOCUS_08990 gene lysS 3865 5349 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833056.1 protein_id gnl|my_center|LOCUS_08990 5720 5430 gene locus_tag LOCUS_09000 5720 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence109 172 1143 gene locus_tag LOCUS_09010 172 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1350 2099 gene locus_tag LOCUS_09020 gene cobJ 1350 2099 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016778.1 protein_id gnl|my_center|LOCUS_09020 2277 2804 gene locus_tag LOCUS_09030 2277 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 3259 4506 gene locus_tag LOCUS_09040 3259 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4570 5868 gene locus_tag LOCUS_09050 4570 5868 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001812710.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence110 1084 452 gene locus_tag LOCUS_09060 1084 452 CDS product viroplasmin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016818.1 protein_id gnl|my_center|LOCUS_09060 1815 1105 gene locus_tag LOCUS_09070 gene fabG 1815 1105 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898376.1 protein_id gnl|my_center|LOCUS_09070 2369 1881 gene locus_tag LOCUS_09080 2369 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 3378 2524 gene locus_tag LOCUS_09090 3378 2524 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987059.1 protein_id gnl|my_center|LOCUS_09090 4070 3441 gene locus_tag LOCUS_09100 gene pyrE 4070 3441 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989825.1 protein_id gnl|my_center|LOCUS_09100 5420 4149 gene locus_tag LOCUS_09110 5420 4149 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929354.1 protein_id gnl|my_center|LOCUS_09110 5957 5520 gene locus_tag LOCUS_09120 5957 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence111 75 689 gene locus_tag LOCUS_09130 75 689 CDS product type 1 glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107746.1 protein_id gnl|my_center|LOCUS_09130 1884 730 gene locus_tag LOCUS_09140 gene metK 1884 730 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016332.1 protein_id gnl|my_center|LOCUS_09140 3432 2230 gene locus_tag LOCUS_09150 3432 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5162 3513 gene locus_tag LOCUS_09160 5162 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence112 68 1336 gene locus_tag LOCUS_09170 68 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3393 1438 gene locus_tag LOCUS_09180 3393 1438 CDS product fructose-specific PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002366176.1 protein_id gnl|my_center|LOCUS_09180 4412 3495 gene locus_tag LOCUS_09190 gene pfkB 4412 3495 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836910.1 protein_id gnl|my_center|LOCUS_09190 5642 4599 gene locus_tag LOCUS_09200 gene adhP 5642 4599 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649161.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence113 214 1155 gene locus_tag LOCUS_09210 214 1155 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 protein_id gnl|my_center|LOCUS_09210 1207 1905 gene locus_tag LOCUS_09220 1207 1905 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797003.1 protein_id gnl|my_center|LOCUS_09220 2643 2497 gene locus_tag LOCUS_09230 2643 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 4110 2884 gene locus_tag LOCUS_09240 4110 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 4776 4153 gene locus_tag LOCUS_09250 4776 4153 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215631.1 protein_id gnl|my_center|LOCUS_09250 5708 4800 gene locus_tag LOCUS_09260 5708 4800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence114 <1 550 gene locus_tag LOCUS_09270 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289277.1:MATE family efflux transporter 633 1967 gene locus_tag LOCUS_09280 gene glmU 633 1967 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_09280 2100 3092 gene locus_tag LOCUS_09290 2100 3092 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903312.1 protein_id gnl|my_center|LOCUS_09290 3085 3687 gene locus_tag LOCUS_09300 3085 3687 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_09300 3725 4198 gene locus_tag LOCUS_09310 3725 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903314.1 protein_id gnl|my_center|LOCUS_09310 4243 5451 gene locus_tag LOCUS_09320 4243 5451 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence115 627 250 gene locus_tag LOCUS_09330 627 250 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727296.1 protein_id gnl|my_center|LOCUS_09330 1447 674 gene locus_tag LOCUS_09340 gene map 1447 674 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017049.1 protein_id gnl|my_center|LOCUS_09340 2145 1516 gene locus_tag LOCUS_09350 2145 1516 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017050.1 protein_id gnl|my_center|LOCUS_09350 3943 2420 gene locus_tag LOCUS_09360 3943 2420 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_09360 4932 4003 gene locus_tag LOCUS_09370 4932 4003 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016289.1 protein_id gnl|my_center|LOCUS_09370 <5759 5111 gene locus_tag LOCUS_09380 <5759 5111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003430704.1:transketolase >Feature sequence116 46 591 gene locus_tag LOCUS_09390 46 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 593 2200 gene locus_tag LOCUS_09400 593 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2341 2676 gene locus_tag LOCUS_09410 2341 2676 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300891.1 protein_id gnl|my_center|LOCUS_09410 2697 3581 gene locus_tag LOCUS_09420 gene era 2697 3581 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016271.1 protein_id gnl|my_center|LOCUS_09420 3742 5715 gene locus_tag LOCUS_09430 gene uvrB 3742 5715 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016236.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence117 3847 161 gene locus_tag LOCUS_09440 3847 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 4611 3949 gene locus_tag LOCUS_09450 4611 3949 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904246.1 protein_id gnl|my_center|LOCUS_09450 <5718 4626 gene locus_tag LOCUS_09460 <5718 4626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015791.1:TrkH family potassium uptake protein >Feature sequence118 1135 89 gene locus_tag LOCUS_09470 1135 89 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241524.1 protein_id gnl|my_center|LOCUS_09470 1390 1791 gene locus_tag LOCUS_09480 1390 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09480 1700 2137 gene locus_tag LOCUS_09490 1700 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09490 2401 3006 gene locus_tag LOCUS_09500 2401 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3128 3700 gene locus_tag LOCUS_09510 3128 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence119 138 1163 gene locus_tag LOCUS_09520 138 1163 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_09520 1455 2021 gene locus_tag LOCUS_09530 1455 2021 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399299.1 protein_id gnl|my_center|LOCUS_09530 2036 2398 gene locus_tag LOCUS_09540 2036 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2425 2616 gene locus_tag LOCUS_09550 2425 2616 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_09550 2670 3128 gene locus_tag LOCUS_09560 2670 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3109 3555 gene locus_tag LOCUS_09570 3109 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3530 4372 gene locus_tag LOCUS_09580 3530 4372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4384 4932 gene locus_tag LOCUS_09590 4384 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence120 55 3564 gene locus_tag LOCUS_09600 gene metH 55 3564 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271582.1 protein_id gnl|my_center|LOCUS_09600 3641 4180 gene locus_tag LOCUS_09610 3641 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4168 4545 gene locus_tag LOCUS_09620 4168 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4571 4978 gene locus_tag LOCUS_09630 4571 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5342 4971 gene locus_tag LOCUS_09640 5342 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence121 221 433 gene locus_tag LOCUS_09650 221 433 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889816.1 protein_id gnl|my_center|LOCUS_09650 470 1285 gene locus_tag LOCUS_09660 470 1285 CDS product abortive infection family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422392.1 protein_id gnl|my_center|LOCUS_09660 1316 3859 gene locus_tag LOCUS_09670 1316 3859 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968158.1 protein_id gnl|my_center|LOCUS_09670 5228 3885 gene locus_tag LOCUS_09680 5228 3885 CDS product relaxase/mobilization nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861371.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence122 131 574 gene locus_tag LOCUS_09690 131 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 630 1262 gene locus_tag LOCUS_09700 630 1262 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262703.1 protein_id gnl|my_center|LOCUS_09700 1474 2688 gene locus_tag LOCUS_09710 1474 2688 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461406.1 protein_id gnl|my_center|LOCUS_09710 2878 3918 gene locus_tag LOCUS_09720 2878 3918 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583513.1 protein_id gnl|my_center|LOCUS_09720 4117 5421 gene locus_tag LOCUS_09730 4117 5421 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896135.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence123 635 141 gene locus_tag LOCUS_09740 635 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3057 661 gene locus_tag LOCUS_09750 gene pheT 3057 661 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_09750 4921 3461 gene locus_tag LOCUS_09760 4921 3461 CDS product sucrose-6-phosphate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963747.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence124 64 1371 gene locus_tag LOCUS_09770 64 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1492 5499 gene locus_tag LOCUS_09780 1492 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence125 158 2377 gene locus_tag LOCUS_09790 158 2377 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_09790 2531 3682 gene locus_tag LOCUS_09800 gene pyrB 2531 3682 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871106.1 protein_id gnl|my_center|LOCUS_09800 3720 4121 gene locus_tag LOCUS_09810 3720 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4123 4863 gene locus_tag LOCUS_09820 gene pyrF 4123 4863 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435818.1 protein_id gnl|my_center|LOCUS_09820 4995 5393 gene locus_tag LOCUS_09830 4995 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence126 996 1463 gene locus_tag LOCUS_09840 996 1463 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_09840 1506 2252 gene locus_tag LOCUS_09850 1506 2252 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_09850 2289 3170 gene locus_tag LOCUS_09860 2289 3170 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_09860 3154 3801 gene locus_tag LOCUS_09870 3154 3801 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050488755.1 protein_id gnl|my_center|LOCUS_09870 3866 4831 gene locus_tag LOCUS_09880 3866 4831 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705389.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence127 1833 1483 gene locus_tag LOCUS_09890 1833 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 3096 1921 gene locus_tag LOCUS_09900 3096 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09900 3734 3093 gene locus_tag LOCUS_09910 3734 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09910 5377 3863 gene locus_tag LOCUS_09920 5377 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence128 2432 3139 gene locus_tag LOCUS_09930 2432 3139 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862846.1 protein_id gnl|my_center|LOCUS_09930 3262 3915 gene locus_tag LOCUS_09940 3262 3915 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021025.1 protein_id gnl|my_center|LOCUS_09940 3931 4248 gene locus_tag LOCUS_09950 3931 4248 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355583.1 protein_id gnl|my_center|LOCUS_09950 5031 4297 gene locus_tag LOCUS_09960 gene pflA 5031 4297 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903514.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence129 81 992 gene locus_tag LOCUS_09970 gene mreC 81 992 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796804.1 protein_id gnl|my_center|LOCUS_09970 1376 1137 gene locus_tag LOCUS_09980 1376 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1467 1769 gene locus_tag LOCUS_09990 1467 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 1921 2175 gene locus_tag LOCUS_10000 1921 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2512 2652 gene locus_tag LOCUS_10010 2512 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2669 2965 gene locus_tag LOCUS_10020 2669 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2998 3318 gene locus_tag LOCUS_10030 2998 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3408 3701 gene locus_tag LOCUS_10040 3408 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3725 3847 gene locus_tag LOCUS_10050 3725 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3844 3987 gene locus_tag LOCUS_10060 3844 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4099 4434 gene locus_tag LOCUS_10070 4099 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 4521 4709 gene locus_tag LOCUS_10080 4521 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence130 958 161 gene locus_tag LOCUS_10090 958 161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922273.1 protein_id gnl|my_center|LOCUS_10090 1537 1010 gene locus_tag LOCUS_10100 1537 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2389 1577 gene locus_tag LOCUS_10110 2389 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2939 2478 gene locus_tag LOCUS_10120 2939 2478 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060300.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10120 3825 2986 gene locus_tag LOCUS_10130 3825 2986 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922272.1 protein_id gnl|my_center|LOCUS_10130 4562 3807 gene locus_tag LOCUS_10140 4562 3807 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014635952.1 protein_id gnl|my_center|LOCUS_10140 5171 4578 gene locus_tag LOCUS_10150 5171 4578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399619.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence131 21 521 gene locus_tag LOCUS_10160 21 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1622 600 gene locus_tag LOCUS_10170 gene queA 1622 600 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627822.1 protein_id gnl|my_center|LOCUS_10170 2793 1717 gene locus_tag LOCUS_10180 2793 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4020 2878 gene locus_tag LOCUS_10190 gene prmC 4020 2878 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495074.1 protein_id gnl|my_center|LOCUS_10190 5095 4013 gene locus_tag LOCUS_10200 gene prfA 5095 4013 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796873.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence132 1759 1562 gene locus_tag LOCUS_10210 1759 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2043 1792 gene locus_tag LOCUS_10220 2043 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 2937 2059 gene locus_tag LOCUS_10230 2937 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 4647 2992 gene locus_tag LOCUS_10240 4647 2992 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000751249.1 protein_id gnl|my_center|LOCUS_10240 5160 4759 gene locus_tag LOCUS_10250 5160 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence133 135 626 gene locus_tag LOCUS_10260 135 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 1499 831 gene locus_tag LOCUS_10270 1499 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1621 1848 gene locus_tag LOCUS_10280 1621 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1848 2171 gene locus_tag LOCUS_10290 1848 2171 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016431.1 protein_id gnl|my_center|LOCUS_10290 4361 2238 gene locus_tag LOCUS_10300 4361 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 >Feature sequence134 57 938 gene locus_tag LOCUS_10310 57 938 CDS product EfeM/EfeO family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836939.1 protein_id gnl|my_center|LOCUS_10310 1065 2303 gene locus_tag LOCUS_10320 gene efeB 1065 2303 CDS product iron uptake transporter deferrochelatase/peroxidase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836940.1 protein_id gnl|my_center|LOCUS_10320 2281 3972 gene locus_tag LOCUS_10330 2281 3972 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900389.1 protein_id gnl|my_center|LOCUS_10330 4010 4723 gene locus_tag LOCUS_10340 gene tatC 4010 4723 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895543.1 protein_id gnl|my_center|LOCUS_10340 4726 4923 gene locus_tag LOCUS_10350 4726 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence135 >Feature sequence136 257 991 gene locus_tag LOCUS_10360 257 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 992 2179 gene locus_tag LOCUS_10370 gene dcm 992 2179 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399270.1 protein_id gnl|my_center|LOCUS_10370 2188 2361 gene locus_tag LOCUS_10380 2188 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2358 2579 gene locus_tag LOCUS_10390 2358 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2576 2938 gene locus_tag LOCUS_10400 2576 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2952 3425 gene locus_tag LOCUS_10410 2952 3425 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_10410 3445 4059 gene locus_tag LOCUS_10420 3445 4059 CDS product phage regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047597.1 protein_id gnl|my_center|LOCUS_10420 4173 5018 gene locus_tag LOCUS_10430 4173 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence137 528 1829 gene locus_tag LOCUS_10440 528 1829 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211654.1 protein_id gnl|my_center|LOCUS_10440 1878 2606 gene locus_tag LOCUS_10450 1878 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 2638 3306 gene locus_tag LOCUS_10460 2638 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 3707 3423 gene locus_tag LOCUS_10470 3707 3423 CDS product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016082.1 protein_id gnl|my_center|LOCUS_10470 4046 3801 gene locus_tag LOCUS_10480 4046 3801 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287407.1 protein_id gnl|my_center|LOCUS_10480 5057 4065 gene locus_tag LOCUS_10490 5057 4065 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678920.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence138 97 1278 gene locus_tag LOCUS_10500 97 1278 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861145.1 protein_id gnl|my_center|LOCUS_10500 1334 1837 gene locus_tag LOCUS_10510 1334 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1825 2226 gene locus_tag LOCUS_10520 1825 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2251 2901 gene locus_tag LOCUS_10530 2251 2901 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895475.1 protein_id gnl|my_center|LOCUS_10530 2939 3259 gene locus_tag LOCUS_10540 2939 3259 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_10540 3252 3626 gene locus_tag LOCUS_10550 3252 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4049 3729 gene locus_tag LOCUS_10560 4049 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4208 4900 gene locus_tag LOCUS_10570 4208 4900 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348300.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence139 1367 159 gene locus_tag LOCUS_10580 1367 159 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964319.1 protein_id gnl|my_center|LOCUS_10580 2365 1397 gene locus_tag LOCUS_10590 2365 1397 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895540.1 protein_id gnl|my_center|LOCUS_10590 3036 2407 gene locus_tag LOCUS_10600 3036 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 5025 3040 gene locus_tag LOCUS_10610 5025 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence140 <1 593 gene locus_tag LOCUS_10620 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146966558.1:autotransporter-associated N-terminal domain-containing protein note possible pseudo, internal stop codon 633 4946 gene locus_tag LOCUS_10630 633 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10630 >Feature sequence141 344 21 gene locus_tag LOCUS_10640 344 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 613 1623 gene locus_tag LOCUS_10650 gene hrcA 613 1623 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480919.1 protein_id gnl|my_center|LOCUS_10650 1648 2235 gene locus_tag LOCUS_10660 gene grpE 1648 2235 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016151.1 protein_id gnl|my_center|LOCUS_10660 2302 2613 gene locus_tag LOCUS_10670 2302 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2790 3140 gene locus_tag LOCUS_10680 gene rplS 2790 3140 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898626.1 protein_id gnl|my_center|LOCUS_10680 3223 4893 gene locus_tag LOCUS_10690 3223 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence142 146 1486 gene locus_tag LOCUS_10700 gene xseA 146 1486 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902942.1 protein_id gnl|my_center|LOCUS_10700 1527 2012 gene locus_tag LOCUS_10710 1527 2012 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_10710 2124 2666 gene locus_tag LOCUS_10720 2124 2666 CDS product ECF-type riboflavin transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547026.1 protein_id gnl|my_center|LOCUS_10720 2814 4526 gene locus_tag LOCUS_10730 2814 4526 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921978.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence143 99 1550 gene locus_tag LOCUS_10740 99 1550 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_10740 1583 2746 gene locus_tag LOCUS_10750 1583 2746 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016502.1 protein_id gnl|my_center|LOCUS_10750 2739 3437 gene locus_tag LOCUS_10760 2739 3437 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495145.1 protein_id gnl|my_center|LOCUS_10760 3450 4541 gene locus_tag LOCUS_10770 gene dinB 3450 4541 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016984.1 protein_id gnl|my_center|LOCUS_10770 4591 4998 gene locus_tag LOCUS_10780 4591 4998 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000358536.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence144 1629 3734 gene locus_tag LOCUS_10790 1629 3734 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_10790 3893 4855 gene locus_tag LOCUS_10800 3893 4855 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049518049.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence145 1076 603 gene locus_tag LOCUS_10810 1076 603 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986937.1 protein_id gnl|my_center|LOCUS_10810 3153 1180 gene locus_tag LOCUS_10820 3153 1180 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_10820 3464 3153 gene locus_tag LOCUS_10830 3464 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4096 3677 gene locus_tag LOCUS_10840 4096 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4734 4102 gene locus_tag LOCUS_10850 4734 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence146 116 967 gene locus_tag LOCUS_10860 116 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1203 2105 gene locus_tag LOCUS_10870 1203 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 2130 2924 gene locus_tag LOCUS_10880 2130 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2954 3817 gene locus_tag LOCUS_10890 2954 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 3899 4786 gene locus_tag LOCUS_10900 3899 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 >Feature sequence147 1347 145 gene locus_tag LOCUS_10910 1347 145 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989997.1 protein_id gnl|my_center|LOCUS_10910 2123 1533 gene locus_tag LOCUS_10920 2123 1533 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964176.1 protein_id gnl|my_center|LOCUS_10920 2287 3033 gene locus_tag LOCUS_10930 2287 3033 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705781.1 protein_id gnl|my_center|LOCUS_10930 3367 3291 gene locus_tag LOCUS_t00100 3367 3291 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3650 3393 gene locus_tag LOCUS_10940 gene rpmB 3650 3393 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898205.1 protein_id gnl|my_center|LOCUS_10940 4833 3871 gene locus_tag LOCUS_10950 4833 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 >Feature sequence148 285 127 gene locus_tag LOCUS_10960 285 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1580 525 gene locus_tag LOCUS_10970 1580 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1878 1603 gene locus_tag LOCUS_10980 1878 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2692 2117 gene locus_tag LOCUS_10990 gene leuD 2692 2117 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433189.1 protein_id gnl|my_center|LOCUS_10990 3349 2720 gene locus_tag LOCUS_11000 3349 2720 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023003717.1 protein_id gnl|my_center|LOCUS_11000 4831 3413 gene locus_tag LOCUS_11010 gene leuC 4831 3413 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989859.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence149 85 1218 gene locus_tag LOCUS_11020 85 1218 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391447.1 protein_id gnl|my_center|LOCUS_11020 1237 1923 gene locus_tag LOCUS_11030 1237 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1984 3267 gene locus_tag LOCUS_11040 gene obgE 1984 3267 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015918.1 protein_id gnl|my_center|LOCUS_11040 3392 4249 gene locus_tag LOCUS_11050 gene miaA 3392 4249 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903969.1 protein_id gnl|my_center|LOCUS_11050 4283 4738 gene locus_tag LOCUS_11060 4283 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence150 2539 716 gene locus_tag LOCUS_11070 2539 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3306 2761 gene locus_tag LOCUS_11080 3306 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4479 3337 gene locus_tag LOCUS_11090 4479 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4743 4522 gene locus_tag LOCUS_11100 4743 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence151 445 657 gene locus_tag LOCUS_11110 445 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 786 1217 gene locus_tag LOCUS_11120 786 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1388 1888 gene locus_tag LOCUS_11130 gene ybaK 1388 1888 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288577.1 protein_id gnl|my_center|LOCUS_11130 1938 2735 gene locus_tag LOCUS_11140 1938 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2849 3154 gene locus_tag LOCUS_11150 2849 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3454 3131 gene locus_tag LOCUS_11160 3454 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 4641 3529 gene locus_tag LOCUS_11170 4641 3529 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101366.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence152 2128 371 gene locus_tag LOCUS_11180 2128 371 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_11180 3510 2143 gene locus_tag LOCUS_11190 3510 2143 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964165.1 protein_id gnl|my_center|LOCUS_11190 4504 3620 gene locus_tag LOCUS_11200 4504 3620 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903695.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence153 533 850 gene locus_tag LOCUS_11210 533 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 990 1150 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gatatagaccaccccaatatcgaa 1382 3292 gene locus_tag LOCUS_11220 gene thrS 1382 3292 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626551.1 protein_id gnl|my_center|LOCUS_11220 3459 4202 gene locus_tag LOCUS_11230 3459 4202 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626351.1 protein_id gnl|my_center|LOCUS_11230 4427 4705 gene locus_tag LOCUS_11240 4427 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence154 513 64 gene locus_tag LOCUS_11250 gene smpB 513 64 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016522.1 protein_id gnl|my_center|LOCUS_11250 2811 538 gene locus_tag LOCUS_11260 gene rnr 2811 538 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016521.1 protein_id gnl|my_center|LOCUS_11260 3409 2834 gene locus_tag LOCUS_11270 gene yqeK 3409 2834 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016520.1 protein_id gnl|my_center|LOCUS_11270 4594 3800 gene locus_tag LOCUS_11280 gene cobK 4594 3800 CDS product precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005915112.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence155 1464 565 gene locus_tag LOCUS_11290 1464 565 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963998.1 protein_id gnl|my_center|LOCUS_11290 4642 1652 gene locus_tag LOCUS_11300 gene recJ 4642 1652 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016344.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence156 2144 1071 gene locus_tag LOCUS_11310 gene truB 2144 1071 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016546.1 protein_id gnl|my_center|LOCUS_11310 3784 2174 gene locus_tag LOCUS_11320 gene cls 3784 2174 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024268244.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence157 64 1065 gene locus_tag LOCUS_11330 64 1065 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_11330 1073 1807 gene locus_tag LOCUS_11340 1073 1807 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902469.1 protein_id gnl|my_center|LOCUS_11340 1807 3321 gene locus_tag LOCUS_11350 gene murJ 1807 3321 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016596.1 protein_id gnl|my_center|LOCUS_11350 3324 3581 gene locus_tag LOCUS_11360 3324 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 3644 4072 gene locus_tag LOCUS_11370 3644 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence158 54 1571 gene locus_tag LOCUS_11380 54 1571 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732280.1 protein_id gnl|my_center|LOCUS_11380 1564 2631 gene locus_tag LOCUS_11390 1564 2631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082660.1 protein_id gnl|my_center|LOCUS_11390 2678 3547 gene locus_tag LOCUS_11400 2678 3547 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356209.1 protein_id gnl|my_center|LOCUS_11400 3575 4330 gene locus_tag LOCUS_11410 3575 4330 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015919.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence159 564 340 gene locus_tag LOCUS_11420 564 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2183 753 gene locus_tag LOCUS_11430 gene rlmD 2183 753 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964744.1 protein_id gnl|my_center|LOCUS_11430 3362 2214 gene locus_tag LOCUS_11440 3362 2214 CDS product aminotransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434582.1 protein_id gnl|my_center|LOCUS_11440 3778 3572 gene locus_tag LOCUS_11450 3778 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence160 1417 143 gene locus_tag LOCUS_11460 1417 143 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_11460 2400 1588 gene locus_tag LOCUS_11470 2400 1588 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_11470 3378 2428 gene locus_tag LOCUS_11480 3378 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 4633 3455 gene locus_tag LOCUS_11490 gene rpoD 4633 3455 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124796886.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence161 138 779 gene locus_tag LOCUS_11500 gene udk 138 779 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546365.1 protein_id gnl|my_center|LOCUS_11500 834 2171 gene locus_tag LOCUS_11510 834 2171 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_11510 2185 2967 gene locus_tag LOCUS_11520 2185 2967 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385631.1 protein_id gnl|my_center|LOCUS_11520 4585 3053 gene locus_tag LOCUS_11530 4585 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence162 4396 3314 gene locus_tag LOCUS_11540 gene carA 4396 3314 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016378.1 protein_id gnl|my_center|LOCUS_11540 >Feature sequence163 506 1054 gene locus_tag LOCUS_11550 506 1054 CDS product DUF1851 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837028.1 protein_id gnl|my_center|LOCUS_11550 1121 2500 gene locus_tag LOCUS_11560 1121 2500 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903674.1 protein_id gnl|my_center|LOCUS_11560 2569 3651 gene locus_tag LOCUS_11570 gene folP 2569 3651 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132109.1 protein_id gnl|my_center|LOCUS_11570 3792 4328 gene locus_tag LOCUS_11580 3792 4328 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132112.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence164 1569 2135 gene locus_tag LOCUS_11590 1569 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2166 3353 gene locus_tag LOCUS_11600 2166 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3515 4516 gene locus_tag LOCUS_11610 gene rfaE1 3515 4516 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627445.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence165 1035 874 gene locus_tag LOCUS_11620 1035 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1363 1287 gene locus_tag LOCUS_t00110 1363 1287 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1484 1391 gene locus_tag LOCUS_t00120 1484 1391 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1589 1503 gene locus_tag LOCUS_t00130 1589 1503 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2137 1760 gene locus_tag LOCUS_11630 2137 1760 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721437.1 protein_id gnl|my_center|LOCUS_11630 2308 2862 gene locus_tag LOCUS_11640 2308 2862 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207877.1 protein_id gnl|my_center|LOCUS_11640 2862 3158 gene locus_tag LOCUS_11650 2862 3158 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790301.1 protein_id gnl|my_center|LOCUS_11650 4555 3239 gene locus_tag LOCUS_11660 4555 3239 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206971.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence166 1367 321 gene locus_tag LOCUS_11670 1367 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 4467 1357 gene locus_tag LOCUS_11680 4467 1357 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence167 170 691 gene locus_tag LOCUS_11690 170 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 695 1924 gene locus_tag LOCUS_11700 695 1924 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016291.1 protein_id gnl|my_center|LOCUS_11700 2687 2010 gene locus_tag LOCUS_11710 2687 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3520 2729 gene locus_tag LOCUS_11720 3520 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 4568 3552 gene locus_tag LOCUS_11730 4568 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence168 606 1568 gene locus_tag LOCUS_11740 606 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1601 2146 gene locus_tag LOCUS_11750 1601 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2228 2386 gene locus_tag LOCUS_11760 2228 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2370 2591 gene locus_tag LOCUS_11770 2370 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2863 3579 gene locus_tag LOCUS_11780 2863 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3706 3996 gene locus_tag LOCUS_11790 3706 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3953 4099 gene locus_tag LOCUS_11800 3953 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4224 4403 gene locus_tag LOCUS_11810 4224 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence169 <1 943 gene locus_tag LOCUS_11820 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948131.1:phosphatase PAP2 family protein 2640 985 gene locus_tag LOCUS_11830 2640 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3150 2755 gene locus_tag LOCUS_11840 3150 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3518 3270 gene locus_tag LOCUS_11850 3518 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence170 <1 1282 gene locus_tag LOCUS_11860 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase 1401 1760 gene locus_tag LOCUS_11870 1401 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1818 2066 gene locus_tag LOCUS_11880 1818 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2101 2862 gene locus_tag LOCUS_11890 gene cobM 2101 2862 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_11890 2862 3488 gene locus_tag LOCUS_11900 2862 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence171 162 1142 gene locus_tag LOCUS_11910 162 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1201 2445 gene locus_tag LOCUS_11920 1201 2445 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081014.1 protein_id gnl|my_center|LOCUS_11920 2473 3168 gene locus_tag LOCUS_11930 2473 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3205 3804 gene locus_tag LOCUS_11940 3205 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3917 4435 gene locus_tag LOCUS_11950 gene crr 3917 4435 CDS product PTS glucose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382041.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence172 1647 985 gene locus_tag LOCUS_11960 1647 985 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902078.1 protein_id gnl|my_center|LOCUS_11960 2441 1809 gene locus_tag LOCUS_11970 gene rpe 2441 1809 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902077.1 protein_id gnl|my_center|LOCUS_11970 3355 2501 gene locus_tag LOCUS_11980 gene rsgA 3355 2501 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627939.1 protein_id gnl|my_center|LOCUS_11980 4427 3477 gene locus_tag LOCUS_11990 4427 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence173 103 1476 gene locus_tag LOCUS_12000 103 1476 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861591.1 protein_id gnl|my_center|LOCUS_12000 1729 2904 gene locus_tag LOCUS_12010 1729 2904 CDS product YARHG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627158.1 protein_id gnl|my_center|LOCUS_12010 3006 3140 gene locus_tag LOCUS_12020 3006 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3164 4270 gene locus_tag LOCUS_12030 3164 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence174 371 802 gene locus_tag LOCUS_12040 371 802 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936200.1 protein_id gnl|my_center|LOCUS_12040 1888 854 gene locus_tag LOCUS_12050 1888 854 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287604.1 protein_id gnl|my_center|LOCUS_12050 3047 1791 gene locus_tag LOCUS_12060 3047 1791 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675474.1 protein_id gnl|my_center|LOCUS_12060 4093 3218 gene locus_tag LOCUS_12070 gene ylqF 4093 3218 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016986.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence175 2699 1998 gene locus_tag LOCUS_12080 2699 1998 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_12080 3505 2732 gene locus_tag LOCUS_12090 3505 2732 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989577.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence176 <1 628 gene locus_tag LOCUS_12100 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000140408.1:sulfate adenylyltransferase subunit CysD 628 2313 gene locus_tag LOCUS_12110 628 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 2473 3396 gene locus_tag LOCUS_12120 2473 3396 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016560778.1 protein_id gnl|my_center|LOCUS_12120 3535 4383 gene locus_tag LOCUS_12130 gene cysT 3535 4383 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971172.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence177 260 1588 gene locus_tag LOCUS_12140 gene miaB 260 1588 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016418.1 protein_id gnl|my_center|LOCUS_12140 1589 2935 gene locus_tag LOCUS_12150 gene rho 1589 2935 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016419.1 protein_id gnl|my_center|LOCUS_12150 2960 3241 gene locus_tag LOCUS_12160 2960 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 <4454 3270 gene locus_tag LOCUS_12170 <4454 3270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015691.1:RnfABCDGE type electron transport complex subunit D >Feature sequence178 1303 125 gene locus_tag LOCUS_12180 1303 125 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897105.1 protein_id gnl|my_center|LOCUS_12180 2073 1300 gene locus_tag LOCUS_12190 2073 1300 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903010.1 protein_id gnl|my_center|LOCUS_12190 3001 2159 gene locus_tag LOCUS_12200 3001 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3450 3070 gene locus_tag LOCUS_12210 3450 3070 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_12210 <4452 3542 gene locus_tag LOCUS_12220 <4452 3542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681656.1:DUF4272 domain-containing protein >Feature sequence179 384 1382 gene locus_tag LOCUS_12230 384 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1455 2213 gene locus_tag LOCUS_12240 gene fabG 1455 2213 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791492.1 protein_id gnl|my_center|LOCUS_12240 2389 3855 gene locus_tag LOCUS_12250 gene guaB 2389 3855 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017001.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence180 1771 152 gene locus_tag LOCUS_12260 1771 152 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902507.1 protein_id gnl|my_center|LOCUS_12260 1926 2702 gene locus_tag LOCUS_12270 1926 2702 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785236.1 protein_id gnl|my_center|LOCUS_12270 2734 3237 gene locus_tag LOCUS_12280 2734 3237 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016625.1 protein_id gnl|my_center|LOCUS_12280 3286 3711 gene locus_tag LOCUS_12290 3286 3711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3789 4097 gene locus_tag LOCUS_12300 3789 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 4094 4390 gene locus_tag LOCUS_12310 4094 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence181 <1 1187 gene locus_tag LOCUS_12320 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001090228.1:RIP metalloprotease RseP 1205 2848 gene locus_tag LOCUS_12330 1205 2848 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_12330 2919 3590 gene locus_tag LOCUS_12340 2919 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357436.1 protein_id gnl|my_center|LOCUS_12340 3983 4402 gene locus_tag LOCUS_12350 3983 4402 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459702.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence182 314 1282 gene locus_tag LOCUS_12360 314 1282 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_12360 1326 2297 gene locus_tag LOCUS_12370 1326 2297 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856994.1 protein_id gnl|my_center|LOCUS_12370 2347 3492 gene locus_tag LOCUS_12380 2347 3492 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_12380 3492 4277 gene locus_tag LOCUS_12390 3492 4277 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901801.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence183 <1 903 gene locus_tag LOCUS_12400 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000835615.1:O-antigen ligase 925 1488 gene locus_tag LOCUS_12410 925 1488 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904383.1 protein_id gnl|my_center|LOCUS_12410 1525 1944 gene locus_tag LOCUS_12420 gene dhaM 1525 1944 CDS product dihydroxyacetone kinase phosphoryl donor subunit DhaM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627629.1 protein_id gnl|my_center|LOCUS_12420 1979 2488 gene locus_tag LOCUS_12430 1979 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2522 3292 gene locus_tag LOCUS_12440 gene trmD 2522 3292 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_12440 3312 3836 gene locus_tag LOCUS_12450 3312 3836 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088329.1 protein_id gnl|my_center|LOCUS_12450 4327 4145 gene locus_tag LOCUS_12460 4327 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence184 524 4036 gene locus_tag LOCUS_12470 524 4036 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373559.1 protein_id gnl|my_center|LOCUS_12470 4136 4360 gene locus_tag LOCUS_12480 gene acpP 4136 4360 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902726.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence185 832 275 gene locus_tag LOCUS_12490 gene frr 832 275 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904126.1 protein_id gnl|my_center|LOCUS_12490 1598 888 gene locus_tag LOCUS_12500 gene pyrH 1598 888 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_12500 2570 1686 gene locus_tag LOCUS_12510 gene tsf 2570 1686 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015713.1 protein_id gnl|my_center|LOCUS_12510 3334 2639 gene locus_tag LOCUS_12520 3334 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4266 3481 gene locus_tag LOCUS_12530 gene rpsB 4266 3481 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904120.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence186 1035 304 gene locus_tag LOCUS_12540 1035 304 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015818.1 protein_id gnl|my_center|LOCUS_12540 2043 1039 gene locus_tag LOCUS_12550 gene nrdF 2043 1039 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203029.1 protein_id gnl|my_center|LOCUS_12550 2319 2125 gene locus_tag LOCUS_12560 2319 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12560 2684 2394 gene locus_tag LOCUS_12570 2684 2394 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_12570 3704 2760 gene locus_tag LOCUS_12580 3704 2760 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801979.1 protein_id gnl|my_center|LOCUS_12580 3849 3989 gene locus_tag LOCUS_12590 3849 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence187 1269 661 gene locus_tag LOCUS_12600 1269 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3098 1341 gene locus_tag LOCUS_12610 3098 1341 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016512.1 protein_id gnl|my_center|LOCUS_12610 4329 3259 gene locus_tag LOCUS_12620 4329 3259 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491176.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence188 20 748 gene locus_tag LOCUS_12630 20 748 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963586.1 protein_id gnl|my_center|LOCUS_12630 852 1832 gene locus_tag LOCUS_12640 852 1832 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901670.1 protein_id gnl|my_center|LOCUS_12640 1938 2582 gene locus_tag LOCUS_12650 1938 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 2717 3154 gene locus_tag LOCUS_12660 2717 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 3223 3429 gene locus_tag LOCUS_12670 3223 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 3439 4005 gene locus_tag LOCUS_12680 3439 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence189 693 778 gene locus_tag LOCUS_t00140 693 778 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 810 894 gene locus_tag LOCUS_t00150 810 894 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2692 1088 gene locus_tag LOCUS_12690 2692 1088 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005916172.1 protein_id gnl|my_center|LOCUS_12690 4130 2985 gene locus_tag LOCUS_12700 4130 2985 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812397.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence190 797 312 gene locus_tag LOCUS_12710 797 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2022 820 gene locus_tag LOCUS_12720 2022 820 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411472.1 protein_id gnl|my_center|LOCUS_12720 3375 2050 gene locus_tag LOCUS_12730 gene der 3375 2050 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 protein_id gnl|my_center|LOCUS_12730 4219 3758 gene locus_tag LOCUS_12740 4219 3758 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence191 618 208 gene locus_tag LOCUS_12750 618 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1126 788 gene locus_tag LOCUS_12760 1126 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2610 1267 gene locus_tag LOCUS_12770 2610 1267 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_12770 3230 2646 gene locus_tag LOCUS_12780 gene gmhA 3230 2646 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_12780 4172 3282 gene locus_tag LOCUS_12790 4172 3282 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903649.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence192 924 409 gene locus_tag LOCUS_12800 924 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 1667 939 gene locus_tag LOCUS_12810 1667 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 2092 1703 gene locus_tag LOCUS_12820 2092 1703 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966773.1 protein_id gnl|my_center|LOCUS_12820 2180 2959 gene locus_tag LOCUS_12830 2180 2959 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890687.1 protein_id gnl|my_center|LOCUS_12830 3067 3693 gene locus_tag LOCUS_12840 3067 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12840 3672 4091 gene locus_tag LOCUS_12850 3672 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12850 >Feature sequence193 86 904 gene locus_tag LOCUS_12860 86 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1953 1150 gene locus_tag LOCUS_12870 gene proC 1953 1150 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048171.1 protein_id gnl|my_center|LOCUS_12870 2612 2025 gene locus_tag LOCUS_12880 2612 2025 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836537.1 protein_id gnl|my_center|LOCUS_12880 4144 2726 gene locus_tag LOCUS_12890 gene rlmD 4144 2726 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495280.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence194 179 1612 gene locus_tag LOCUS_12900 179 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1747 3978 gene locus_tag LOCUS_12910 gene pflB 1747 3978 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903513.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence195 207 785 gene locus_tag LOCUS_12920 207 785 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_12920 902 1261 gene locus_tag LOCUS_12930 gene crcB 902 1261 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387989.1 protein_id gnl|my_center|LOCUS_12930 1340 2746 gene locus_tag LOCUS_12940 1340 2746 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257067.1 protein_id gnl|my_center|LOCUS_12940 2928 3899 gene locus_tag LOCUS_12950 2928 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 4128 3970 gene locus_tag LOCUS_12960 4128 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence196 873 325 gene locus_tag LOCUS_12970 gene cysE 873 325 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948016.1 protein_id gnl|my_center|LOCUS_12970 1942 1025 gene locus_tag LOCUS_12980 gene cysK 1942 1025 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948015.1 protein_id gnl|my_center|LOCUS_12980 3767 2073 gene locus_tag LOCUS_12990 3767 2073 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence197 597 998 gene locus_tag LOCUS_13000 597 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1062 1688 gene locus_tag LOCUS_13010 1062 1688 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494716.1 protein_id gnl|my_center|LOCUS_13010 1872 2090 gene locus_tag LOCUS_13020 gene infA 1872 2090 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899265.1 protein_id gnl|my_center|LOCUS_13020 2094 2225 gene locus_tag LOCUS_13030 gene rpmJ 2094 2225 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393912.1 protein_id gnl|my_center|LOCUS_13030 2724 2200 gene locus_tag LOCUS_13040 2724 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 4025 2721 gene locus_tag LOCUS_13050 4025 2721 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence198 618 88 gene locus_tag LOCUS_13060 618 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 811 1434 gene locus_tag LOCUS_13070 811 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 2210 1503 gene locus_tag LOCUS_13080 2210 1503 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194205.1 protein_id gnl|my_center|LOCUS_13080 2606 3928 gene locus_tag LOCUS_13090 2606 3928 CDS product 6-phospho-alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948070.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence199 248 712 gene locus_tag LOCUS_13100 gene ribE 248 712 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902111.1 protein_id gnl|my_center|LOCUS_13100 800 1915 gene locus_tag LOCUS_13110 gene ribD 800 1915 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902112.1 protein_id gnl|my_center|LOCUS_13110 2011 2688 gene locus_tag LOCUS_13120 gene ribE 2011 2688 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015638.1 protein_id gnl|my_center|LOCUS_13120 2723 3943 gene locus_tag LOCUS_13130 2723 3943 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987154.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence200 3089 2460 gene locus_tag LOCUS_13140 3089 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence201 278 126 gene locus_tag LOCUS_13150 278 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1436 453 gene locus_tag LOCUS_13160 1436 453 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626320.1 protein_id gnl|my_center|LOCUS_13160 3109 1541 gene locus_tag LOCUS_13170 3109 1541 CDS product PTS transporter subunit EIIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263611.1 protein_id gnl|my_center|LOCUS_13170 3972 3277 gene locus_tag LOCUS_13180 3972 3277 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130140.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence202 775 77 gene locus_tag LOCUS_13190 775 77 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016544.1 protein_id gnl|my_center|LOCUS_13190 2573 816 gene locus_tag LOCUS_13200 2573 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 <3989 2704 gene locus_tag LOCUS_13210 <3989 2704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016304.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB >Feature sequence203 1729 92 gene locus_tag LOCUS_13220 gene trpD 1729 92 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858662.1 protein_id gnl|my_center|LOCUS_13220 3064 1730 gene locus_tag LOCUS_13230 3064 1730 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858746.1 protein_id gnl|my_center|LOCUS_13230 3793 3488 gene locus_tag LOCUS_13240 3793 3488 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001023567.1 protein_id gnl|my_center|LOCUS_13240 3884 3750 gene locus_tag LOCUS_13250 3884 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence204 1090 83 gene locus_tag LOCUS_13260 gene mraY 1090 83 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902299.1 protein_id gnl|my_center|LOCUS_13260 2641 1262 gene locus_tag LOCUS_13270 2641 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 3268 3807 gene locus_tag LOCUS_13280 3268 3807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence205 849 505 gene locus_tag LOCUS_13290 849 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1057 1761 gene locus_tag LOCUS_13300 1057 1761 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012994104.1 protein_id gnl|my_center|LOCUS_13300 1892 3151 gene locus_tag LOCUS_13310 1892 3151 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399787.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence206 1673 858 gene locus_tag LOCUS_13320 gene aroE 1673 858 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439416.1 protein_id gnl|my_center|LOCUS_13320 2415 1699 gene locus_tag LOCUS_13330 2415 1699 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234935.1 protein_id gnl|my_center|LOCUS_13330 3649 2474 gene locus_tag LOCUS_13340 gene pheA 3649 2474 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_13340 3794 3636 gene locus_tag LOCUS_13350 3794 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence207 1519 92 gene locus_tag LOCUS_13360 gene pykF 1519 92 CDS product pyruvate kinase PykF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453794.1 protein_id gnl|my_center|LOCUS_13360 2602 1640 gene locus_tag LOCUS_13370 gene pfkA 2602 1640 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041561.1 protein_id gnl|my_center|LOCUS_13370 3191 2733 gene locus_tag LOCUS_13380 3191 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence208 1516 470 gene locus_tag LOCUS_13390 1516 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 1915 1556 gene locus_tag LOCUS_13400 1915 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 3863 1929 gene locus_tag LOCUS_13410 3863 1929 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903085.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence209 423 572 gene locus_tag LOCUS_13420 gene rpmG 423 572 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904076.1 protein_id gnl|my_center|LOCUS_13420 589 664 gene locus_tag LOCUS_t00160 589 664 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 797 1012 gene locus_tag LOCUS_13430 797 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1014 1640 gene locus_tag LOCUS_13440 gene nusG 1014 1640 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904074.1 protein_id gnl|my_center|LOCUS_13440 1758 2183 gene locus_tag LOCUS_13450 gene rplK 1758 2183 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894933.1 protein_id gnl|my_center|LOCUS_13450 2298 3005 gene locus_tag LOCUS_13460 gene rplA 2298 3005 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015994.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence210 1020 31 gene locus_tag LOCUS_13470 1020 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2054 1110 gene locus_tag LOCUS_13480 2054 1110 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861865.1 protein_id gnl|my_center|LOCUS_13480 2509 2063 gene locus_tag LOCUS_13490 2509 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3640 2555 gene locus_tag LOCUS_13500 gene mnmA 3640 2555 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830892.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence211 1071 82 gene locus_tag LOCUS_13510 1071 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1535 1119 gene locus_tag LOCUS_13520 1535 1119 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779456.1 protein_id gnl|my_center|LOCUS_13520 2283 1657 gene locus_tag LOCUS_13530 2283 1657 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894436.1 protein_id gnl|my_center|LOCUS_13530 3860 2568 gene locus_tag LOCUS_13540 3860 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence212 191 805 gene locus_tag LOCUS_13550 191 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 902 1729 gene locus_tag LOCUS_13560 902 1729 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903362.1 protein_id gnl|my_center|LOCUS_13560 1947 3641 gene locus_tag LOCUS_13570 gene treC 1947 3641 CDS product alpha,alpha-phosphotrehalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656120.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence213 1 2268 gene locus_tag LOCUS_13580 1 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence214 <1 717 gene locus_tag LOCUS_13590 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963675.1:ATP-dependent endonuclease 647 880 gene locus_tag LOCUS_13600 647 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 882 2663 gene locus_tag LOCUS_13610 882 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2854 3270 gene locus_tag LOCUS_13620 2854 3270 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence215 1770 82 gene locus_tag LOCUS_13630 1770 82 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015793.1 protein_id gnl|my_center|LOCUS_13630 2768 1791 gene locus_tag LOCUS_13640 2768 1791 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583459.1 protein_id gnl|my_center|LOCUS_13640 3337 2777 gene locus_tag LOCUS_13650 3337 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence216 2358 7 gene locus_tag LOCUS_13660 gene lon 2358 7 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015983.1 protein_id gnl|my_center|LOCUS_13660 3718 2489 gene locus_tag LOCUS_13670 gene clpX 3718 2489 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015984.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence217 143 292 gene locus_tag LOCUS_13680 143 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 384 941 gene locus_tag LOCUS_13690 384 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1102 1659 gene locus_tag LOCUS_13700 1102 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1656 2231 gene locus_tag LOCUS_13710 1656 2231 CDS product DUF4291 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705801.1 protein_id gnl|my_center|LOCUS_13710 3518 2508 gene locus_tag LOCUS_13720 3518 2508 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779459.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence218 966 727 gene locus_tag LOCUS_13730 966 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1117 1263 gene locus_tag LOCUS_13740 1117 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1537 1250 gene locus_tag LOCUS_13750 1537 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1816 1568 gene locus_tag LOCUS_13760 1816 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2070 1867 gene locus_tag LOCUS_13770 2070 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2777 2223 gene locus_tag LOCUS_13780 2777 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3726 2770 gene locus_tag LOCUS_13790 3726 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence219 1449 94 gene locus_tag LOCUS_13800 1449 94 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_13800 2170 1487 gene locus_tag LOCUS_13810 2170 1487 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_13810 2890 2186 gene locus_tag LOCUS_13820 2890 2186 CDS product UTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194205.1 protein_id gnl|my_center|LOCUS_13820 3392 3231 gene locus_tag LOCUS_13830 3392 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence220 524 940 gene locus_tag LOCUS_13840 gene nusB 524 940 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904113.1 protein_id gnl|my_center|LOCUS_13840 1097 2254 gene locus_tag LOCUS_13850 1097 2254 CDS product CynX/NimT family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858279.1 protein_id gnl|my_center|LOCUS_13850 2416 2547 gene locus_tag LOCUS_13860 2416 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2562 3674 gene locus_tag LOCUS_13870 gene nadR 2562 3674 CDS product multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001532645.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence221 266 1423 gene locus_tag LOCUS_13880 266 1423 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693828.1 protein_id gnl|my_center|LOCUS_13880 1438 2574 gene locus_tag LOCUS_13890 1438 2574 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966119.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence222 2824 1016 gene locus_tag LOCUS_13900 gene uvrC 2824 1016 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902903.1 protein_id gnl|my_center|LOCUS_13900 3703 2867 gene locus_tag LOCUS_13910 gene rapZ 3703 2867 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416961.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence223 871 14 gene locus_tag LOCUS_13920 871 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 1014 1412 gene locus_tag LOCUS_13930 1014 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 2077 1523 gene locus_tag LOCUS_13940 2077 1523 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400054.1 protein_id gnl|my_center|LOCUS_13940 2619 2074 gene locus_tag LOCUS_13950 2619 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2784 2963 gene locus_tag LOCUS_13960 2784 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2975 3577 gene locus_tag LOCUS_13970 2975 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003583336.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence224 317 502 gene locus_tag LOCUS_13980 317 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 755 1141 gene locus_tag LOCUS_13990 755 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1256 2269 gene locus_tag LOCUS_14000 1256 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2402 3430 gene locus_tag LOCUS_14010 2402 3430 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964483.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence225 3615 46 gene locus_tag LOCUS_14020 gene nifJ 3615 46 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016958.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence226 129 1127 gene locus_tag LOCUS_14030 129 1127 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422061.1 protein_id gnl|my_center|LOCUS_14030 1134 2699 gene locus_tag LOCUS_14040 1134 2699 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003568253.1 protein_id gnl|my_center|LOCUS_14040 2699 3439 gene locus_tag LOCUS_14050 2699 3439 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775335.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence227 2298 208 gene locus_tag LOCUS_14060 gene ligA 2298 208 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015784.1 protein_id gnl|my_center|LOCUS_14060 2515 3537 gene locus_tag LOCUS_14070 2515 3537 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence228 <1 621 gene locus_tag LOCUS_14080 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461000.1:ABC transporter ATP-binding protein 637 1470 gene locus_tag LOCUS_14090 637 1470 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112142.1 protein_id gnl|my_center|LOCUS_14090 1475 3364 gene locus_tag LOCUS_14100 1475 3364 CDS product rhamnan synthesis F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389355.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence229 755 45 gene locus_tag LOCUS_14110 755 45 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627625.1 protein_id gnl|my_center|LOCUS_14110 1701 718 gene locus_tag LOCUS_14120 1701 718 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198481065.1 protein_id gnl|my_center|LOCUS_14120 2975 1704 gene locus_tag LOCUS_14130 2975 1704 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837051.1 protein_id gnl|my_center|LOCUS_14130 3480 2950 gene locus_tag LOCUS_14140 3480 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015870.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence230 >Feature sequence231 37 1419 gene locus_tag LOCUS_14150 37 1419 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016326.1 protein_id gnl|my_center|LOCUS_14150 1594 2484 gene locus_tag LOCUS_14160 gene mvk 1594 2484 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659719.1 protein_id gnl|my_center|LOCUS_14160 2506 3489 gene locus_tag LOCUS_14170 gene mvaD 2506 3489 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348822.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence232 1230 139 gene locus_tag LOCUS_14180 gene dprA 1230 139 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795245.1 protein_id gnl|my_center|LOCUS_14180 1939 1250 gene locus_tag LOCUS_14190 1939 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3527 2139 gene locus_tag LOCUS_14200 gene asnS 3527 2139 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016098.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence233 159 1052 gene locus_tag LOCUS_14210 159 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1103 1426 gene locus_tag LOCUS_14220 1103 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903280.1 protein_id gnl|my_center|LOCUS_14220 1820 3241 gene locus_tag LOCUS_14230 1820 3241 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289178.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence234 2124 40 gene locus_tag LOCUS_14240 gene fusA 2124 40 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015672.1 protein_id gnl|my_center|LOCUS_14240 2751 2281 gene locus_tag LOCUS_14250 gene rpsG 2751 2281 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888149.1 protein_id gnl|my_center|LOCUS_14250 3152 2784 gene locus_tag LOCUS_14260 gene rpsL 3152 2784 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894529.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence235 62 1087 gene locus_tag LOCUS_14270 62 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1123 1293 gene locus_tag LOCUS_14280 1123 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1986 1414 gene locus_tag LOCUS_14290 gene rfbC 1986 1414 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965628.1 protein_id gnl|my_center|LOCUS_14290 3221 2016 gene locus_tag LOCUS_14300 3221 2016 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015738.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence236 974 171 gene locus_tag LOCUS_14310 974 171 CDS product LpxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016511.1 protein_id gnl|my_center|LOCUS_14310 1848 1072 gene locus_tag LOCUS_14320 gene lpxA 1848 1072 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016510.1 protein_id gnl|my_center|LOCUS_14320 2445 2011 gene locus_tag LOCUS_14330 gene fabZ 2445 2011 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723457.1 protein_id gnl|my_center|LOCUS_14330 3500 2652 gene locus_tag LOCUS_14340 gene lpxC 3500 2652 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058229301.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence237 272 1069 gene locus_tag LOCUS_14350 gene lytR 272 1069 CDS product transcription antiterminator LytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227949.1 protein_id gnl|my_center|LOCUS_14350 1092 1682 gene locus_tag LOCUS_14360 gene yihA 1092 1682 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894870.1 protein_id gnl|my_center|LOCUS_14360 3541 2021 gene locus_tag LOCUS_14370 3541 2021 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015709.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence238 183 647 gene locus_tag LOCUS_14380 183 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 760 987 gene locus_tag LOCUS_14390 760 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 988 1287 gene locus_tag LOCUS_14400 988 1287 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016227.1 protein_id gnl|my_center|LOCUS_14400 1324 2094 gene locus_tag LOCUS_14410 1324 2094 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002943202.1 protein_id gnl|my_center|LOCUS_14410 2204 2290 gene locus_tag LOCUS_t00170 2204 2290 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2405 2713 gene locus_tag LOCUS_14420 gene rplU 2405 2713 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896540.1 protein_id gnl|my_center|LOCUS_14420 2761 3099 gene locus_tag LOCUS_14430 2761 3099 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130645.1 protein_id gnl|my_center|LOCUS_14430 3178 3471 gene locus_tag LOCUS_14440 gene rpmA 3178 3471 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902873.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence239 378 121 gene locus_tag LOCUS_14450 378 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 457 678 gene locus_tag LOCUS_14460 457 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 901 710 gene locus_tag LOCUS_14470 901 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 990 1220 gene locus_tag LOCUS_14480 990 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1534 1226 gene locus_tag LOCUS_14490 1534 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 1778 1566 gene locus_tag LOCUS_14500 1778 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1945 2364 gene locus_tag LOCUS_14510 1945 2364 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016009.1 protein_id gnl|my_center|LOCUS_14510 2371 2703 gene locus_tag LOCUS_14520 2371 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2804 3508 gene locus_tag LOCUS_14530 2804 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence240 <1 757 gene locus_tag LOCUS_14540 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167121746.1:Fic family protein 2018 819 gene locus_tag LOCUS_14550 2018 819 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881180.1 protein_id gnl|my_center|LOCUS_14550 3329 2067 gene locus_tag LOCUS_14560 3329 2067 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence241 864 1562 gene locus_tag LOCUS_14570 gene rlmB 864 1562 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015648.1 protein_id gnl|my_center|LOCUS_14570 1765 2346 gene locus_tag LOCUS_14580 1765 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2349 2654 gene locus_tag LOCUS_14590 2349 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2803 3042 gene locus_tag LOCUS_14600 2803 3042 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902388.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence242 96 536 gene locus_tag LOCUS_14610 96 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 598 1371 gene locus_tag LOCUS_14620 598 1371 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016735.1 protein_id gnl|my_center|LOCUS_14620 1403 1936 gene locus_tag LOCUS_14630 1403 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1961 3064 gene locus_tag LOCUS_14640 gene ychF 1961 3064 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017102.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence243 470 147 gene locus_tag LOCUS_14650 470 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 819 448 gene locus_tag LOCUS_14660 819 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1149 832 gene locus_tag LOCUS_14670 1149 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2279 1290 gene locus_tag LOCUS_14680 2279 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2758 2282 gene locus_tag LOCUS_14690 2758 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence244 774 67 gene locus_tag LOCUS_14700 774 67 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476095.1 protein_id gnl|my_center|LOCUS_14700 1325 891 gene locus_tag LOCUS_14710 1325 891 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861681.1 protein_id gnl|my_center|LOCUS_14710 2244 1336 gene locus_tag LOCUS_14720 2244 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 3379 2258 gene locus_tag LOCUS_14730 3379 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence245 495 1520 gene locus_tag LOCUS_14740 495 1520 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_14740 1543 2361 gene locus_tag LOCUS_14750 1543 2361 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_14750 2441 3301 gene locus_tag LOCUS_14760 2441 3301 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016306.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence246 >Feature sequence247 1950 1324 gene locus_tag LOCUS_14770 1950 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2643 1987 gene locus_tag LOCUS_14780 2643 1987 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948207.1 protein_id gnl|my_center|LOCUS_14780 3434 2646 gene locus_tag LOCUS_14790 3434 2646 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811433.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence248 75 236 gene locus_tag LOCUS_14800 75 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 535 2214 gene locus_tag LOCUS_14810 gene ilvD 535 2214 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_14810 2242 3111 gene locus_tag LOCUS_14820 2242 3111 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000700204.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence249 30 1361 gene locus_tag LOCUS_14830 30 1361 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361833.1 protein_id gnl|my_center|LOCUS_14830 1387 1782 gene locus_tag LOCUS_14840 1387 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2262 1894 gene locus_tag LOCUS_14850 2262 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3273 2365 gene locus_tag LOCUS_14860 3273 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence250 113 565 gene locus_tag LOCUS_14870 gene rplI 113 565 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864305.1 protein_id gnl|my_center|LOCUS_14870 672 2108 gene locus_tag LOCUS_14880 672 2108 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048440.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence251 153 971 gene locus_tag LOCUS_14890 gene ispU 153 971 CDS product (2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368162.1 protein_id gnl|my_center|LOCUS_14890 961 1887 gene locus_tag LOCUS_14900 961 1887 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017070.1 protein_id gnl|my_center|LOCUS_14900 2060 3298 gene locus_tag LOCUS_14910 gene tyrS 2060 3298 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence252 1217 183 gene locus_tag LOCUS_14920 1217 183 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_14920 1477 3126 gene locus_tag LOCUS_14930 1477 3126 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026641.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence253 138 1364 gene locus_tag LOCUS_14940 138 1364 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681571.1 protein_id gnl|my_center|LOCUS_14940 1395 2087 gene locus_tag LOCUS_14950 1395 2087 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672626.1 protein_id gnl|my_center|LOCUS_14950 2122 3138 gene locus_tag LOCUS_14960 2122 3138 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681570.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence254 1639 971 gene locus_tag LOCUS_14970 1639 971 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068074.1 protein_id gnl|my_center|LOCUS_14970 2092 1676 gene locus_tag LOCUS_14980 2092 1676 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902354.1 protein_id gnl|my_center|LOCUS_14980 3286 2264 gene locus_tag LOCUS_14990 3286 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence255 1935 217 gene locus_tag LOCUS_15000 1935 217 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795646.1 protein_id gnl|my_center|LOCUS_15000 3273 2083 gene locus_tag LOCUS_15010 3273 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence256 1751 1158 gene locus_tag LOCUS_15020 1751 1158 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243530.1 protein_id gnl|my_center|LOCUS_15020 2232 1846 gene locus_tag LOCUS_15030 2232 1846 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016864.1 protein_id gnl|my_center|LOCUS_15030 2391 2272 gene locus_tag LOCUS_15040 2391 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3164 2424 gene locus_tag LOCUS_15050 3164 2424 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence257 1094 21 gene locus_tag LOCUS_15060 1094 21 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896305.1 protein_id gnl|my_center|LOCUS_15060 2362 1223 gene locus_tag LOCUS_15070 2362 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3216 2518 gene locus_tag LOCUS_15080 gene dapD 3216 2518 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722875.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence258 1292 162 gene locus_tag LOCUS_15090 1292 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1869 1282 gene locus_tag LOCUS_15100 1869 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence259 1592 204 gene locus_tag LOCUS_15110 gene glgA 1592 204 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_15110 2984 1731 gene locus_tag LOCUS_15120 2984 1731 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence260 >Feature sequence261 1123 170 gene locus_tag LOCUS_15130 1123 170 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015679.1 protein_id gnl|my_center|LOCUS_15130 2192 1161 gene locus_tag LOCUS_15140 2192 1161 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902246.1 protein_id gnl|my_center|LOCUS_15140 3178 2288 gene locus_tag LOCUS_15150 3178 2288 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence262 130 1179 gene locus_tag LOCUS_15160 130 1179 CDS product 2,3-butanediol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836597.1 protein_id gnl|my_center|LOCUS_15160 2122 1475 gene locus_tag LOCUS_15170 2122 1475 CDS product OmpA family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070886.1 protein_id gnl|my_center|LOCUS_15170 3208 2462 gene locus_tag LOCUS_15180 3208 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence263 138 2303 gene locus_tag LOCUS_15190 138 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2327 3208 gene locus_tag LOCUS_15200 2327 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence264 1620 1063 gene locus_tag LOCUS_15210 1620 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2420 1641 gene locus_tag LOCUS_15220 gene pgeF 2420 1641 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015675.1 protein_id gnl|my_center|LOCUS_15220 2665 2444 gene locus_tag LOCUS_15230 2665 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 3153 2770 gene locus_tag LOCUS_15240 3153 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence265 1788 814 gene locus_tag LOCUS_15250 gene trpS 1788 814 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016366.1 protein_id gnl|my_center|LOCUS_15250 2070 3014 gene locus_tag LOCUS_15260 2070 3014 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903111.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence266 1817 168 gene locus_tag LOCUS_15270 gene sppA 1817 168 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029492321.1 protein_id gnl|my_center|LOCUS_15270 2223 1843 gene locus_tag LOCUS_15280 2223 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2445 2975 gene locus_tag LOCUS_15290 2445 2975 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence267 2568 745 gene locus_tag LOCUS_15300 2568 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence268 >Feature sequence269 82 405 gene locus_tag LOCUS_15310 82 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 1430 714 gene locus_tag LOCUS_15320 1430 714 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420966.1 protein_id gnl|my_center|LOCUS_15320 2147 1452 gene locus_tag LOCUS_15330 2147 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2646 2167 gene locus_tag LOCUS_15340 gene purE 2646 2167 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964699.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence270 489 1688 gene locus_tag LOCUS_15350 489 1688 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_15350 1728 2450 gene locus_tag LOCUS_15360 1728 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 2626 2814 gene locus_tag LOCUS_15370 2626 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15370 2811 2960 gene locus_tag LOCUS_15380 2811 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2929 3060 gene locus_tag LOCUS_15390 2929 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15390 >Feature sequence271 196 954 gene locus_tag LOCUS_15400 196 954 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458882.1 protein_id gnl|my_center|LOCUS_15400 958 1914 gene locus_tag LOCUS_15410 958 1914 CDS product iron chelate uptake ABC transporter family permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458883.1 protein_id gnl|my_center|LOCUS_15410 1918 3012 gene locus_tag LOCUS_15420 1918 3012 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458884.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence272 545 171 gene locus_tag LOCUS_15430 545 171 CDS product DUF956 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263350.1 protein_id gnl|my_center|LOCUS_15430 1594 680 gene locus_tag LOCUS_15440 1594 680 CDS product PTS system mannose/fructose/sorbose family transporter subunit IID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130896.1 protein_id gnl|my_center|LOCUS_15440 2427 1612 gene locus_tag LOCUS_15450 2427 1612 CDS product PTS mannose/fructose/sorbose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130897.1 protein_id gnl|my_center|LOCUS_15450 <3146 2443 gene locus_tag LOCUS_15460 <3146 2443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002356030.1:mannose/fructose/sorbose PTS transporter subunit IIA >Feature sequence273 125 2227 gene locus_tag LOCUS_15470 gene pnp 125 2227 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627490.1 protein_id gnl|my_center|LOCUS_15470 2262 2816 gene locus_tag LOCUS_15480 gene pgsA 2262 2816 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904217.1 protein_id gnl|my_center|LOCUS_15480 2845 3114 gene locus_tag LOCUS_15490 2845 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence274 240 1745 gene locus_tag LOCUS_15500 240 1745 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016799.1 protein_id gnl|my_center|LOCUS_15500 1776 2882 gene locus_tag LOCUS_15510 1776 2882 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence275 958 509 gene locus_tag LOCUS_15520 958 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1097 912 gene locus_tag LOCUS_15530 1097 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1837 1376 gene locus_tag LOCUS_15540 1837 1376 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459155.1 protein_id gnl|my_center|LOCUS_15540 2136 1867 gene locus_tag LOCUS_15550 2136 1867 CDS product CD1845 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861351.1 protein_id gnl|my_center|LOCUS_15550 3019 2201 gene locus_tag LOCUS_15560 3019 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence276 146 511 gene locus_tag LOCUS_15570 gene rpsM 146 511 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090796.1 protein_id gnl|my_center|LOCUS_15570 542 931 gene locus_tag LOCUS_15580 gene rpsK 542 931 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903915.1 protein_id gnl|my_center|LOCUS_15580 960 1547 gene locus_tag LOCUS_15590 gene rpsD 960 1547 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903916.1 protein_id gnl|my_center|LOCUS_15590 1578 2552 gene locus_tag LOCUS_15600 1578 2552 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041516.1 protein_id gnl|my_center|LOCUS_15600 2605 2979 gene locus_tag LOCUS_15610 gene rplQ 2605 2979 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903918.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence277 865 107 gene locus_tag LOCUS_15620 865 107 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092473236.1 protein_id gnl|my_center|LOCUS_15620 1745 882 gene locus_tag LOCUS_15630 gene rfbA 1745 882 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476438.1 protein_id gnl|my_center|LOCUS_15630 <3005 1783 gene locus_tag LOCUS_15640 <3005 1783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793001.1:sugar transferase >Feature sequence278 68 2167 gene locus_tag LOCUS_15650 gene nrdE 68 2167 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001215839.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence279 431 60 gene locus_tag LOCUS_15660 431 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1984 467 gene locus_tag LOCUS_15670 1984 467 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963812.1 protein_id gnl|my_center|LOCUS_15670 2655 2020 gene locus_tag LOCUS_15680 2655 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence280 1685 141 gene locus_tag LOCUS_15690 1685 141 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902683.1 protein_id gnl|my_center|LOCUS_15690 2590 1808 gene locus_tag LOCUS_15700 2590 1808 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016216.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence281 >Feature sequence282 868 293 gene locus_tag LOCUS_15710 868 293 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020582.1 protein_id gnl|my_center|LOCUS_15710 2894 1026 gene locus_tag LOCUS_15720 2894 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence283 462 97 gene locus_tag LOCUS_15730 462 97 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852401.1 protein_id gnl|my_center|LOCUS_15730 2887 572 gene locus_tag LOCUS_15740 2887 572 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203451.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence284 851 240 gene locus_tag LOCUS_15750 851 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2212 848 gene locus_tag LOCUS_15760 2212 848 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_15760 2882 2199 gene locus_tag LOCUS_15770 2882 2199 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence285 1126 32 gene locus_tag LOCUS_15780 gene yqeH 1126 32 CDS product ribosome biogenesis GTPase YqeH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016880.1 protein_id gnl|my_center|LOCUS_15780 <2973 1178 gene locus_tag LOCUS_15790 <2973 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003700300.1:site-specific tyrosine recombinase XerD >Feature sequence286 565 167 gene locus_tag LOCUS_15800 565 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1161 571 gene locus_tag LOCUS_15810 1161 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1826 1308 gene locus_tag LOCUS_15820 1826 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2197 1838 gene locus_tag LOCUS_15830 2197 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence287 36 956 gene locus_tag LOCUS_15840 36 956 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013485.1 protein_id gnl|my_center|LOCUS_15840 1764 1036 gene locus_tag LOCUS_15850 1764 1036 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016437.1 protein_id gnl|my_center|LOCUS_15850 2788 1805 gene locus_tag LOCUS_15860 2788 1805 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889546.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence288 198 1004 gene locus_tag LOCUS_15870 198 1004 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_15870 1083 1760 gene locus_tag LOCUS_15880 1083 1760 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_15880 1993 2628 gene locus_tag LOCUS_15890 1993 2628 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295401.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence289 48 191 gene locus_tag LOCUS_15900 48 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 521 721 gene locus_tag LOCUS_15910 521 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 834 1496 gene locus_tag LOCUS_15920 834 1496 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_15920 1643 2725 gene locus_tag LOCUS_15930 1643 2725 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902407.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence290 1265 264 gene locus_tag LOCUS_15940 1265 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 2310 1288 gene locus_tag LOCUS_15950 gene aroF 2310 1288 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_15950 2523 2404 gene locus_tag LOCUS_15960 2523 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence291 727 89 gene locus_tag LOCUS_15970 727 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 2566 770 gene locus_tag LOCUS_15980 gene lepA 2566 770 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897958.1 protein_id gnl|my_center|LOCUS_15980 >Feature sequence292 745 32 gene locus_tag LOCUS_15990 745 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1017 2492 gene locus_tag LOCUS_16000 1017 2492 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902130.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence293 1296 232 gene locus_tag LOCUS_16010 1296 232 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946961.1 protein_id gnl|my_center|LOCUS_16010 1601 1383 gene locus_tag LOCUS_16020 1601 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2584 1823 gene locus_tag LOCUS_16030 2584 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2736 2584 gene locus_tag LOCUS_16040 2736 2584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence294 672 244 gene locus_tag LOCUS_16050 gene rpiB 672 244 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947986.1 protein_id gnl|my_center|LOCUS_16050 1116 724 gene locus_tag LOCUS_16060 1116 724 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_16060 1358 1116 gene locus_tag LOCUS_16070 1358 1116 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_16070 1564 2496 gene locus_tag LOCUS_16080 1564 2496 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_16080 2518 2778 gene locus_tag LOCUS_16090 2518 2778 CDS product DUF4911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016281.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence295 2745 175 gene locus_tag LOCUS_16100 gene clpB 2745 175 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627102.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence296 23 1399 gene locus_tag LOCUS_16110 gene hemW 23 1399 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016482.1 protein_id gnl|my_center|LOCUS_16110 1456 2139 gene locus_tag LOCUS_16120 1456 2139 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016483.1 protein_id gnl|my_center|LOCUS_16120 2151 2690 gene locus_tag LOCUS_16130 2151 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence297 137 1489 gene locus_tag LOCUS_16140 137 1489 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963927.1 protein_id gnl|my_center|LOCUS_16140 1602 2141 gene locus_tag LOCUS_16150 1602 2141 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_16150 2138 2689 gene locus_tag LOCUS_16160 2138 2689 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761975.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence298 514 26 gene locus_tag LOCUS_16170 gene folK 514 26 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059445.1 protein_id gnl|my_center|LOCUS_16170 894 544 gene locus_tag LOCUS_16180 gene folB 894 544 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132106.1 protein_id gnl|my_center|LOCUS_16180 1925 1023 gene locus_tag LOCUS_16190 gene galU 1925 1023 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899251.1 protein_id gnl|my_center|LOCUS_16190 <2778 1974 gene locus_tag LOCUS_16200 <2778 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861367.1:DEAD/DEAH box helicase family protein >Feature sequence299 <1 2377 gene locus_tag LOCUS_16210 <1 2377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015682.1:endonuclease MutS2 >Feature sequence300 225 656 gene locus_tag LOCUS_16220 225 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 824 1165 gene locus_tag LOCUS_16230 824 1165 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902960.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence301 419 1516 gene locus_tag LOCUS_16240 419 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence302 <1 1302 gene locus_tag LOCUS_16250 <1 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048274.1:diaminopimelate decarboxylase 1328 2545 gene locus_tag LOCUS_16260 1328 2545 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048275.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence303 1902 847 gene locus_tag LOCUS_16270 1902 847 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681885.1 protein_id gnl|my_center|LOCUS_16270 2725 1940 gene locus_tag LOCUS_16280 2725 1940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232156.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence304 113 1186 gene locus_tag LOCUS_16290 113 1186 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016565.1 protein_id gnl|my_center|LOCUS_16290 1187 1864 gene locus_tag LOCUS_16300 1187 1864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016564.1 protein_id gnl|my_center|LOCUS_16300 1911 2726 gene locus_tag LOCUS_16310 1911 2726 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016563.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence305 104 1081 gene locus_tag LOCUS_16320 104 1081 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016583.1 protein_id gnl|my_center|LOCUS_16320 1170 1661 gene locus_tag LOCUS_16330 1170 1661 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890423.1 protein_id gnl|my_center|LOCUS_16330 1708 2670 gene locus_tag LOCUS_16340 1708 2670 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896305.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence306 <1 1261 gene locus_tag LOCUS_16350 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015873.1:coenzyme F390 synthetase 1258 2187 gene locus_tag LOCUS_16360 1258 2187 CDS product 3-oxoacyl-ACP synthase III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015874.1 protein_id gnl|my_center|LOCUS_16360 2347 2571 gene locus_tag LOCUS_16370 2347 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence307 2405 99 gene locus_tag LOCUS_16380 gene ftsH 2405 99 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015954.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence308 1534 161 gene locus_tag LOCUS_16390 1534 161 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659213.1 protein_id gnl|my_center|LOCUS_16390 1839 1624 gene locus_tag LOCUS_16400 1839 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence309 <2601 243 gene locus_tag LOCUS_16410 <2601 243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029494923.1:DNA mismatch repair protein MutS >Feature sequence310 170 574 gene locus_tag LOCUS_16420 gene accB 170 574 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853623.1 protein_id gnl|my_center|LOCUS_16420 620 1975 gene locus_tag LOCUS_16430 gene accC 620 1975 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_16430 2061 2456 gene locus_tag LOCUS_16440 2061 2456 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015712.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence311 2332 68 gene locus_tag LOCUS_16450 2332 68 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902331.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence312 2333 192 gene locus_tag LOCUS_16460 2333 192 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962266.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence313 77 1726 gene locus_tag LOCUS_16470 77 1726 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_16470 1845 2237 gene locus_tag LOCUS_16480 1845 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence314 675 76 gene locus_tag LOCUS_16490 675 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1150 692 gene locus_tag LOCUS_16500 1150 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 1635 1177 gene locus_tag LOCUS_16510 1635 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2096 1650 gene locus_tag LOCUS_16520 2096 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 2545 2096 gene locus_tag LOCUS_16530 2545 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence315 >Feature sequence316 1502 756 gene locus_tag LOCUS_16540 1502 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16540 1966 1634 gene locus_tag LOCUS_16550 1966 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16550 >Feature sequence317 <1 802 gene locus_tag LOCUS_16560 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000614096.1:ABC transporter ATP-binding protein 795 2315 gene locus_tag LOCUS_16570 795 2315 CDS product ABC transporter permease/substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990118.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence318 513 82 gene locus_tag LOCUS_16580 513 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943362.1 protein_id gnl|my_center|LOCUS_16580 2349 538 gene locus_tag LOCUS_16590 gene typA 2349 538 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016545.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence319 <1 663 gene locus_tag LOCUS_16600 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002115680.1:recombinase RecA 734 1051 gene locus_tag LOCUS_16610 gene trxA 734 1051 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830148.1 protein_id gnl|my_center|LOCUS_16610 1124 2143 gene locus_tag LOCUS_16620 gene galE 1124 2143 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861656.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence320 1925 123 gene locus_tag LOCUS_16630 1925 123 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940408.1 protein_id gnl|my_center|LOCUS_16630 2280 1987 gene locus_tag LOCUS_16640 2280 1987 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904300.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence321 1368 40 gene locus_tag LOCUS_16650 1368 40 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016234.1 protein_id gnl|my_center|LOCUS_16650 2353 1400 gene locus_tag LOCUS_16660 2353 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence322 1134 121 gene locus_tag LOCUS_16670 gene cbiG 1134 121 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016779.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence323 492 1325 gene locus_tag LOCUS_16680 gene nagB 492 1325 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556751.1 protein_id gnl|my_center|LOCUS_16680 1341 2492 gene locus_tag LOCUS_16690 gene nagA 1341 2492 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271133.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence324 1468 1184 gene locus_tag LOCUS_16700 1468 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2400 1669 gene locus_tag LOCUS_16710 2400 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence325 >Feature sequence326 1399 434 gene locus_tag LOCUS_16720 1399 434 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966900.1 protein_id gnl|my_center|LOCUS_16720 2376 1399 gene locus_tag LOCUS_16730 2376 1399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966906.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence327 >Feature sequence328 529 326 gene locus_tag LOCUS_16740 529 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 664 990 gene locus_tag LOCUS_16750 gene immR 664 990 CDS product helix-turn-helix transcriptional regulator ImmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003240393.1 protein_id gnl|my_center|LOCUS_16750 2290 1247 gene locus_tag LOCUS_16760 2290 1247 CDS product RelA/SpoT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence329 2342 912 gene locus_tag LOCUS_16770 gene nagE 2342 912 CDS product N-acetylglucosamine-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015664.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence330 2343 127 gene locus_tag LOCUS_16780 gene glgP 2343 127 CDS product glycogen/starch/alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774979.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence331 1493 216 gene locus_tag LOCUS_16790 1493 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 <2435 1539 gene locus_tag LOCUS_16800 <2435 1539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082593.1:ABC-ATPase domain-containing protein >Feature sequence332 801 169 gene locus_tag LOCUS_16810 801 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1421 855 gene locus_tag LOCUS_16820 gene ahpC 1421 855 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455901.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence333 230 1306 gene locus_tag LOCUS_16830 gene pepQ 230 1306 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411039.1 protein_id gnl|my_center|LOCUS_16830 2348 1695 gene locus_tag LOCUS_16840 2348 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence334 80 1057 gene locus_tag LOCUS_16850 gene manA 80 1057 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454782.1 protein_id gnl|my_center|LOCUS_16850 1287 1835 gene locus_tag LOCUS_16860 1287 1835 CDS product FxLYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023036846.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence335 806 48 gene locus_tag LOCUS_16870 806 48 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433939.1 protein_id gnl|my_center|LOCUS_16870 1521 808 gene locus_tag LOCUS_16880 1521 808 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255026.1 protein_id gnl|my_center|LOCUS_16880 2334 1543 gene locus_tag LOCUS_16890 gene tcyA 2334 1543 CDS product cystine ABC transporter substrate-binding lipoprotein TcyA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246699.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence336 288 1808 gene locus_tag LOCUS_16900 gene purH 288 1808 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385254.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence337 268 534 gene locus_tag LOCUS_16910 gene rpsT 268 534 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_16910 1260 631 gene locus_tag LOCUS_16920 1260 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494780.1 protein_id gnl|my_center|LOCUS_16920 1814 1275 gene locus_tag LOCUS_16930 1814 1275 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016850.1 protein_id gnl|my_center|LOCUS_16930 2375 2037 gene locus_tag LOCUS_16940 2375 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence338 1357 164 gene locus_tag LOCUS_16950 1357 164 CDS product trans-2-enoyl-CoA reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963784.1 protein_id gnl|my_center|LOCUS_16950 2276 1533 gene locus_tag LOCUS_16960 2276 1533 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644758.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence339 2207 615 gene locus_tag LOCUS_16970 2207 615 CDS product alpha-glucoside-specific PTS transporter subunit IIBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963853.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence340 <1 543 gene locus_tag LOCUS_16980 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903489.1:SMC-Scp complex subunit ScpB 563 1249 gene locus_tag LOCUS_16990 563 1249 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903490.1 protein_id gnl|my_center|LOCUS_16990 1272 1934 gene locus_tag LOCUS_17000 1272 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence341 >Feature sequence342 209 90 gene locus_tag LOCUS_17010 209 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 1116 304 gene locus_tag LOCUS_17020 1116 304 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_17020 1914 1138 gene locus_tag LOCUS_17030 1914 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2267 1989 gene locus_tag LOCUS_17040 2267 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence343 <2350 145 gene locus_tag LOCUS_17050 <2350 145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244661.1:PTS glucose transporter subunit IIABC >Feature sequence344 64 828 gene locus_tag LOCUS_17060 64 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence345 >Feature sequence346 434 1222 gene locus_tag LOCUS_17070 434 1222 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence347 >Feature sequence348 1158 67 gene locus_tag LOCUS_17080 gene aroB 1158 67 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_17080 1813 1262 gene locus_tag LOCUS_17090 1813 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence349 65 715 gene locus_tag LOCUS_17100 gene nth 65 715 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_17100 746 2203 gene locus_tag LOCUS_17110 746 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence350 <1 2255 gene locus_tag LOCUS_17120 <1 2255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_214628760.1:carbohydrate binding domain-containing protein >Feature sequence351 21 1352 gene locus_tag LOCUS_17130 gene tig 21 1352 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015985.1 protein_id gnl|my_center|LOCUS_17130 1534 2109 gene locus_tag LOCUS_17140 gene clpP 1534 2109 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence352 823 53 gene locus_tag LOCUS_17150 823 53 CDS product LamB/YcsF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851457.1 protein_id gnl|my_center|LOCUS_17150 2199 856 gene locus_tag LOCUS_17160 2199 856 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence353 566 24 gene locus_tag LOCUS_17170 566 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1045 593 gene locus_tag LOCUS_17180 1045 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 2164 1154 gene locus_tag LOCUS_17190 2164 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence354 1043 159 gene locus_tag LOCUS_17200 gene dapA 1043 159 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940835.1 protein_id gnl|my_center|LOCUS_17200 1941 1090 gene locus_tag LOCUS_17210 gene dapF 1941 1090 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897787.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence355 1012 1368 gene locus_tag LOCUS_17220 1012 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17220 >Feature sequence356 1590 229 gene locus_tag LOCUS_17230 1590 229 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016834.1 protein_id gnl|my_center|LOCUS_17230 2027 1758 gene locus_tag LOCUS_17240 gene rpsP 2027 1758 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903282.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence357 384 944 gene locus_tag LOCUS_17250 384 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 937 1746 gene locus_tag LOCUS_17260 937 1746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851136.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence358 <2210 1246 gene locus_tag LOCUS_17270 <2210 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705074.1:isocitrate dehydrogenase >Feature sequence359 1277 870 gene locus_tag LOCUS_17280 1277 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1506 2006 gene locus_tag LOCUS_17290 1506 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence360 187 1875 gene locus_tag LOCUS_17300 187 1875 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963431.1 protein_id gnl|my_center|LOCUS_17300 1859 2188 gene locus_tag LOCUS_17310 1859 2188 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963432.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence361 1337 156 gene locus_tag LOCUS_17320 1337 156 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861646.1 protein_id gnl|my_center|LOCUS_17320 2100 1642 gene locus_tag LOCUS_17330 2100 1642 CDS product DIP1984 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460334.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence362 <1 939 gene locus_tag LOCUS_17340 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000255162.1:dihydroorotate oxidase 1014 1748 gene locus_tag LOCUS_17350 1014 1748 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357686.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence363 113 466 gene locus_tag LOCUS_17360 113 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17360 491 793 gene locus_tag LOCUS_17370 491 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17370 793 1734 gene locus_tag LOCUS_17380 793 1734 CDS product DUF979 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681059.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence364 1862 228 gene locus_tag LOCUS_17390 1862 228 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296476.1 protein_id gnl|my_center|LOCUS_17390 >Feature sequence365 245 1135 gene locus_tag LOCUS_17400 245 1135 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017072.1 protein_id gnl|my_center|LOCUS_17400 1176 2108 gene locus_tag LOCUS_17410 1176 2108 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167512732.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence366 >Feature sequence367 1049 102 gene locus_tag LOCUS_17420 1049 102 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016368.1 protein_id gnl|my_center|LOCUS_17420 1933 1082 gene locus_tag LOCUS_17430 gene accD 1933 1082 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902759.1 protein_id gnl|my_center|LOCUS_17430 >Feature sequence368 816 37 gene locus_tag LOCUS_17440 816 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 <2148 1155 gene locus_tag LOCUS_17450 <2148 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964681.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase >Feature sequence369 985 101 gene locus_tag LOCUS_17460 985 101 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901613.1 protein_id gnl|my_center|LOCUS_17460 1811 1146 gene locus_tag LOCUS_17470 1811 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 1990 1799 gene locus_tag LOCUS_17480 1990 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence370 816 172 gene locus_tag LOCUS_17490 816 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1678 851 gene locus_tag LOCUS_17500 1678 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence371 1897 284 gene locus_tag LOCUS_17510 gene pyrG 1897 284 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170458.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence372 >Feature sequence373 <2108 8 gene locus_tag LOCUS_17520 <2108 8 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965118.1:DNA translocase FtsK >Feature sequence374 >Feature sequence375 2013 1651 gene locus_tag LOCUS_17530 2013 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence376 315 28 gene locus_tag LOCUS_17540 315 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1486 371 gene locus_tag LOCUS_17550 1486 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1998 1573 gene locus_tag LOCUS_17560 1998 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence377 2039 624 gene locus_tag LOCUS_17570 2039 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence378 162 281 gene locus_tag LOCUS_17580 162 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 312 941 gene locus_tag LOCUS_17590 gene hisH 312 941 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436678.1 protein_id gnl|my_center|LOCUS_17590 1022 1876 gene locus_tag LOCUS_17600 1022 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence379 <2066 717 gene locus_tag LOCUS_17610 <2066 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940132.1:phage portal protein >Feature sequence380 1580 237 gene locus_tag LOCUS_17620 1580 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 >Feature sequence381 >Feature sequence382 1835 87 gene locus_tag LOCUS_17630 1835 87 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860825.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence383 1820 72 gene locus_tag LOCUS_17640 1820 72 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890790.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence384 267 1118 gene locus_tag LOCUS_17650 267 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 1143 1379 gene locus_tag LOCUS_17660 gene yaaA 1143 1379 CDS product S4 domain-containing protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963332.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence385 716 180 gene locus_tag LOCUS_17670 716 180 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_17670 1530 859 gene locus_tag LOCUS_17680 1530 859 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016997.1 protein_id gnl|my_center|LOCUS_17680 1981 1586 gene locus_tag LOCUS_17690 1981 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence386 656 1891 gene locus_tag LOCUS_17700 656 1891 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728252.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence387 1861 1067 gene locus_tag LOCUS_17710 1861 1067 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence388 596 267 gene locus_tag LOCUS_17720 596 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 834 607 gene locus_tag LOCUS_17730 834 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 1857 844 gene locus_tag LOCUS_17740 1857 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence389 <1936 642 gene locus_tag LOCUS_17750 <1936 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016463.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence390 431 30 gene locus_tag LOCUS_17760 gene mscL 431 30 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658680.1 protein_id gnl|my_center|LOCUS_17760 976 620 gene locus_tag LOCUS_17770 976 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 1142 963 gene locus_tag LOCUS_17780 1142 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 1823 1164 gene locus_tag LOCUS_17790 1823 1164 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902260.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence391 24 761 gene locus_tag LOCUS_17800 gene mltG 24 761 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015952.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence392 52 1059 gene locus_tag LOCUS_17810 gene fni 52 1059 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263658.1 protein_id gnl|my_center|LOCUS_17810 1135 1797 gene locus_tag LOCUS_17820 1135 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence393 502 221 gene locus_tag LOCUS_17830 502 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 627 502 gene locus_tag LOCUS_17840 627 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1157 780 gene locus_tag LOCUS_17850 1157 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 1783 1193 gene locus_tag LOCUS_17860 1783 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence394 81 1871 gene locus_tag LOCUS_17870 gene nadN 81 1871 CDS product NAD nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868956.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence395 1079 1696 gene locus_tag LOCUS_17880 1079 1696 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188367817.1 protein_id gnl|my_center|LOCUS_17880 1725 1895 gene locus_tag LOCUS_17890 1725 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence396 1277 63 gene locus_tag LOCUS_17900 1277 63 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021373411.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence397 >Feature sequence398 285 1820 gene locus_tag LOCUS_17910 gene gpmI 285 1820 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861866.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence399 501 28 gene locus_tag LOCUS_17920 501 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence400 73 1083 gene locus_tag LOCUS_17930 gene ruvB 73 1083 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903189.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence401 102 1181 gene locus_tag LOCUS_17940 gene msrAB 102 1181 CDS product bifunctional peptide-methionine (S)-S-oxide reductase MsrA/peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006995985.1 protein_id gnl|my_center|LOCUS_17940 1206 1844 gene locus_tag LOCUS_17950 1206 1844 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005628783.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence402 208 891 gene locus_tag LOCUS_17960 208 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1592 1116 gene locus_tag LOCUS_17970 1592 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence403 71 958 gene locus_tag LOCUS_17980 71 958 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964831.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence404 1151 168 gene locus_tag LOCUS_17990 1151 168 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_17990 <1831 1279 gene locus_tag LOCUS_18000 <1831 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000727665.1:GH25 family lysozyme >Feature sequence405 486 40 gene locus_tag LOCUS_18010 486 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 801 532 gene locus_tag LOCUS_18020 801 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 1298 810 gene locus_tag LOCUS_18030 gene nrdR 1298 810 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723246.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence406 27 533 gene locus_tag LOCUS_18040 27 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 631 1821 gene locus_tag LOCUS_18050 631 1821 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965684.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence407 >Feature sequence408 80 155 gene locus_tag LOCUS_t00180 80 155 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 179 262 gene locus_tag LOCUS_t00190 179 262 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 369 1667 gene locus_tag LOCUS_18060 gene celB 369 1667 CDS product PTS cellobiose transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727104.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence409 312 518 gene locus_tag LOCUS_18070 312 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 534 731 gene locus_tag LOCUS_18080 534 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 768 896 gene locus_tag LOCUS_18090 768 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1171 1704 gene locus_tag LOCUS_18100 1171 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence410 >Feature sequence411 367 1716 gene locus_tag LOCUS_18110 367 1716 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673471.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence412 148 636 gene locus_tag LOCUS_18120 148 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18120 673 870 gene locus_tag LOCUS_18130 673 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18130 940 1128 gene locus_tag LOCUS_18140 940 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18140 1134 1685 gene locus_tag LOCUS_18150 1134 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18150 >Feature sequence413 >Feature sequence414 1493 141 gene locus_tag LOCUS_18160 gene dnaA 1493 141 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_18160 1619 1494 gene locus_tag LOCUS_18170 1619 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence415 1004 639 gene locus_tag LOCUS_18180 1004 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1670 1023 gene locus_tag LOCUS_18190 1670 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence416 71 790 gene locus_tag LOCUS_18200 71 790 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_18200 <1764 905 gene locus_tag LOCUS_18210 <1764 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392350.1:radical SAM protein >Feature sequence417 <1 1134 gene locus_tag LOCUS_18220 <1 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963680.1:Eco57I restriction-modification methylase domain-containing protein 1144 1350 gene locus_tag LOCUS_18230 1144 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1631 1377 gene locus_tag LOCUS_18240 1631 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence418 <1744 1072 gene locus_tag LOCUS_18250 <1744 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476565.1:DEAD/DEAH box helicase family protein >Feature sequence419 906 334 gene locus_tag LOCUS_18260 gene efp 906 334 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897833.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence420 730 2 gene locus_tag LOCUS_18270 730 2 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903463.1 protein_id gnl|my_center|LOCUS_18270 1614 895 gene locus_tag LOCUS_18280 1614 895 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437537.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence421 109 783 gene locus_tag LOCUS_18290 109 783 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358896.1 protein_id gnl|my_center|LOCUS_18290 776 1711 gene locus_tag LOCUS_18300 776 1711 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900598.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence422 72 1313 gene locus_tag LOCUS_18310 gene pepT 72 1313 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016614.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence423 1 723 gene locus_tag LOCUS_18320 1 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 733 903 gene locus_tag LOCUS_18330 733 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 827 1606 gene locus_tag LOCUS_18340 827 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 >Feature sequence424 >Feature sequence425 <1 1566 gene locus_tag LOCUS_18350 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546775.1:ferrous iron transport protein B >Feature sequence426 <1 1104 gene locus_tag LOCUS_18360 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046463528.1:GH3 auxin-responsive promoter family protein >Feature sequence427 18 911 gene locus_tag LOCUS_18370 18 911 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439096.1 protein_id gnl|my_center|LOCUS_18370 992 1663 gene locus_tag LOCUS_18380 992 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence428 402 923 gene locus_tag LOCUS_18390 402 923 CDS product FxLYD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023036846.1 protein_id gnl|my_center|LOCUS_18390 939 1613 gene locus_tag LOCUS_18400 939 1613 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900142.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence429 1625 66 gene locus_tag LOCUS_18410 1625 66 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948686.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence430 90 1679 gene locus_tag LOCUS_18420 90 1679 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_18420 >Feature sequence431 804 217 gene locus_tag LOCUS_18430 804 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 <1681 857 gene locus_tag LOCUS_18440 <1681 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017001.1:IMP dehydrogenase >Feature sequence432 80 406 gene locus_tag LOCUS_18450 80 406 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422696.1 protein_id gnl|my_center|LOCUS_18450 680 1120 gene locus_tag LOCUS_18460 680 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence433 <1650 125 gene locus_tag LOCUS_18470 <1650 125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002229415.1:class I SAM-dependent methyltransferase >Feature sequence434 1206 463 gene locus_tag LOCUS_18480 1206 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 1494 1243 gene locus_tag LOCUS_18490 1494 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 >Feature sequence435 655 1452 gene locus_tag LOCUS_18500 655 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence436 62 607 gene locus_tag LOCUS_18510 62 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 621 1493 gene locus_tag LOCUS_18520 621 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence437 469 1236 gene locus_tag LOCUS_18530 gene tpiA 469 1236 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902187.1 protein_id gnl|my_center|LOCUS_18530 1300 1506 gene locus_tag LOCUS_18540 1300 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence438 284 481 gene locus_tag LOCUS_18550 284 481 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356423.1 protein_id gnl|my_center|LOCUS_18550 686 1543 gene locus_tag LOCUS_18560 686 1543 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582599.1 protein_id gnl|my_center|LOCUS_18560 >Feature sequence439 694 1569 gene locus_tag LOCUS_18570 694 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence440 402 7 gene locus_tag LOCUS_18580 402 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 792 427 gene locus_tag LOCUS_18590 792 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1473 850 gene locus_tag LOCUS_18600 1473 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence441 1262 543 gene locus_tag LOCUS_18610 1262 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1455 1285 gene locus_tag LOCUS_18620 1455 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 >Feature sequence442 1541 846 gene locus_tag LOCUS_18630 1541 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence443 60 1271 gene locus_tag LOCUS_18640 gene tgt 60 1271 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902330.1 protein_id gnl|my_center|LOCUS_18640 1431 1192 gene locus_tag LOCUS_18650 1431 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence444 >Feature sequence445 >Feature sequence446 >Feature sequence447 1480 194 gene locus_tag LOCUS_18660 1480 194 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence448 662 60 gene locus_tag LOCUS_18670 662 60 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889920.1 protein_id gnl|my_center|LOCUS_18670 1552 689 gene locus_tag LOCUS_18680 1552 689 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_18680 >Feature sequence449 1245 142 gene locus_tag LOCUS_18690 1245 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 >Feature sequence450 836 537 gene locus_tag LOCUS_18700 836 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 <1545 811 gene locus_tag LOCUS_18710 <1545 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765271.1:capsular polysaccharide synthesis protein note possible pseudo, frameshifted >Feature sequence451 112 1245 gene locus_tag LOCUS_18720 112 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence452 1172 639 gene locus_tag LOCUS_18730 1172 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 1442 1278 gene locus_tag LOCUS_18740 1442 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence453 316 1251 gene locus_tag LOCUS_18750 gene trxB 316 1251 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence454 400 35 gene locus_tag LOCUS_18760 400 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1513 536 gene locus_tag LOCUS_18770 1513 536 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence455 >Feature sequence456 474 37 gene locus_tag LOCUS_18780 474 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1123 503 gene locus_tag LOCUS_18790 1123 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence457 696 139 gene locus_tag LOCUS_18800 696 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 <1505 703 gene locus_tag LOCUS_18810 <1505 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109295.1:class A beta-lactamase, subclass A2 >Feature sequence458 1348 95 gene locus_tag LOCUS_18820 1348 95 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225092.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence459 1047 118 gene locus_tag LOCUS_18830 1047 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1371 1141 gene locus_tag LOCUS_18840 1371 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence460 >Feature sequence461 60 1304 gene locus_tag LOCUS_18850 60 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence462 >Feature sequence463 >Feature sequence464 642 926 gene locus_tag LOCUS_18860 642 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence465 >Feature sequence466 888 34 gene locus_tag LOCUS_18870 888 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence467 <1 673 gene locus_tag LOCUS_18880 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009967072.1:LD-carboxypeptidase 1397 747 gene locus_tag LOCUS_18890 1397 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 >Feature sequence468 772 1194 gene locus_tag LOCUS_18900 772 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948562.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence469 275 382 gene locus_tag LOCUS_r00010 275 382 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 400 476 gene locus_tag LOCUS_t00200 400 476 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence470 547 74 gene locus_tag LOCUS_18910 547 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1138 653 gene locus_tag LOCUS_18920 1138 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 >Feature sequence471 >Feature sequence472 >Feature sequence473 >Feature sequence474 294 67 gene locus_tag LOCUS_18930 294 67 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922422.1 protein_id gnl|my_center|LOCUS_18930 <1432 398 gene locus_tag LOCUS_18940 <1432 398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_168549381.1:SAG1250 family conjugative relaxase >Feature sequence475 >Feature sequence476 <1 655 gene locus_tag LOCUS_18950 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986841.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence477 1337 840 gene locus_tag LOCUS_18960 1337 840 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_18960 >Feature sequence478 >Feature sequence479 3 476 gene locus_tag LOCUS_18970 3 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence480 1257 145 gene locus_tag LOCUS_18980 1257 145 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence481 741 469 gene locus_tag LOCUS_18990 741 469 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812628.1 protein_id gnl|my_center|LOCUS_18990 988 734 gene locus_tag LOCUS_19000 988 734 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812625.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence482 280 438 gene locus_tag LOCUS_19010 280 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 492 1304 gene locus_tag LOCUS_19020 492 1304 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence483 >Feature sequence484 <1 1048 gene locus_tag LOCUS_19030 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017015.1:glycosyltransferase family 9 protein >Feature sequence485 2 601 gene locus_tag LOCUS_19040 2 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 626 1048 gene locus_tag LOCUS_19050 626 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence486 <1378 382 gene locus_tag LOCUS_19060 <1378 382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096434.1:TIGR02594 family protein >Feature sequence487 591 1085 gene locus_tag LOCUS_19070 gene fldA 591 1085 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793355.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence488 448 188 gene locus_tag LOCUS_19080 448 188 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005888910.1 protein_id gnl|my_center|LOCUS_19080 <1363 570 gene locus_tag LOCUS_19090 <1363 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016576.1:NFACT family protein >Feature sequence489 1328 438 gene locus_tag LOCUS_19100 1328 438 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964193.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence490 >Feature sequence491 1358 483 gene locus_tag LOCUS_19110 gene metF 1358 483 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence492 79 276 gene locus_tag LOCUS_19120 79 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 320 814 gene locus_tag LOCUS_19130 320 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1358 879 gene locus_tag LOCUS_19140 1358 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence493 <1351 369 gene locus_tag LOCUS_19150 <1351 369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005902053.1:nitronate monooxygenase family protein >Feature sequence494 <1 935 gene locus_tag LOCUS_19160 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201626926.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase >Feature sequence495 685 80 gene locus_tag LOCUS_19170 685 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 <1348 675 gene locus_tag LOCUS_19180 <1348 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147373114.1:recombinase RecA >Feature sequence496 1166 432 gene locus_tag LOCUS_19190 1166 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence497 691 35 gene locus_tag LOCUS_19200 691 35 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549574.1 protein_id gnl|my_center|LOCUS_19200 992 1303 gene locus_tag LOCUS_19210 gene trxA 992 1303 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence498 265 504 gene locus_tag LOCUS_19220 gene rpsR 265 504 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005891822.1 protein_id gnl|my_center|LOCUS_19220 674 1333 gene locus_tag LOCUS_19230 674 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 >Feature sequence499 >Feature sequence500 767 982 gene locus_tag LOCUS_19240 767 982 CDS product DUF6290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775104.1 protein_id gnl|my_center|LOCUS_19240 967 1239 gene locus_tag LOCUS_19250 967 1239 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061866.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence501 489 370 gene locus_tag LOCUS_19260 489 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 625 491 gene locus_tag LOCUS_19270 625 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 <1335 639 gene locus_tag LOCUS_19280 <1335 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793656.1:site-specific DNA-methyltransferase >Feature sequence502 175 732 gene locus_tag LOCUS_19290 175 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262912.1 protein_id gnl|my_center|LOCUS_19290 >Feature sequence503 1269 403 gene locus_tag LOCUS_19300 gene htpX 1269 403 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189409.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence504 >Feature sequence505 >Feature sequence506 1152 244 gene locus_tag LOCUS_19310 1152 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence507 18 194 gene locus_tag LOCUS_19320 18 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1271 255 gene locus_tag LOCUS_19330 gene asnA 1271 255 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949062.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence508 >Feature sequence509 548 1270 gene locus_tag LOCUS_19340 548 1270 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015968.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence510 >Feature sequence511 92 1009 gene locus_tag LOCUS_19350 92 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence512 188 1102 gene locus_tag LOCUS_19360 gene ftsZ 188 1102 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902285.1 protein_id gnl|my_center|LOCUS_19360 >Feature sequence513 330 1070 gene locus_tag LOCUS_19370 330 1070 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680703.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence514 458 787 gene locus_tag LOCUS_19380 458 787 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901934.1 protein_id gnl|my_center|LOCUS_19380 1221 808 gene locus_tag LOCUS_19390 1221 808 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902570.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence515 188 1189 gene locus_tag LOCUS_19400 188 1189 CDS product CD0873 family tyrosine ABC transporter substrate-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860976.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence516 <1 976 gene locus_tag LOCUS_19410 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482477.1:small-conductance mechanosensitive channel MscS >Feature sequence517 >Feature sequence518 1191 103 gene locus_tag LOCUS_19420 gene fabD 1191 103 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016181.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence519 169 1188 gene locus_tag LOCUS_19430 169 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence520 70 456 gene locus_tag LOCUS_19440 70 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 903 616 gene locus_tag LOCUS_19450 903 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence521 >Feature sequence522 22 624 gene locus_tag LOCUS_19460 22 624 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243015.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence523 >Feature sequence524 <1222 169 gene locus_tag LOCUS_19470 <1222 169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000350101.1:class I SAM-dependent DNA methyltransferase >Feature sequence525 <1 1123 gene locus_tag LOCUS_19480 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence526 >Feature sequence527 43 1104 gene locus_tag LOCUS_19490 43 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 >Feature sequence528 807 40 gene locus_tag LOCUS_19500 807 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence529 1040 177 gene locus_tag LOCUS_19510 gene speD 1040 177 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965890.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence530 <1 615 gene locus_tag LOCUS_19520 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015659.1:electron transfer flavoprotein subunit beta/FixA family protein >Feature sequence531 <1204 602 gene locus_tag LOCUS_19530 <1204 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024268244.1:cardiolipin synthase >Feature sequence532 <1 1176 gene locus_tag LOCUS_19540 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898194.1:autotransporter-associated N-terminal domain-containing protein >Feature sequence533 >Feature sequence534 1184 336 gene locus_tag LOCUS_19550 gene nadC 1184 336 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence535 335 832 gene locus_tag LOCUS_19560 335 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence536 <1 544 gene locus_tag LOCUS_19570 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260988.1:DNA repair protein RadC 541 1047 gene locus_tag LOCUS_19580 541 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 >Feature sequence537 155 979 gene locus_tag LOCUS_19590 155 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence538 62 1063 gene locus_tag LOCUS_19600 62 1063 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475724.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence539 188 1021 gene locus_tag LOCUS_19610 188 1021 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence540 158 802 gene locus_tag LOCUS_19620 158 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence541 950 117 gene locus_tag LOCUS_19630 950 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 >Feature sequence542 1124 294 gene locus_tag LOCUS_19640 1124 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 >Feature sequence543 1015 347 gene locus_tag LOCUS_19650 1015 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000284162.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence544 37 816 gene locus_tag LOCUS_19660 37 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence545 <1156 88 gene locus_tag LOCUS_19670 <1156 88 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880105.1:3-isopropylmalate dehydrogenase >Feature sequence546 >Feature sequence547 75 371 gene locus_tag LOCUS_19680 75 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 434 850 gene locus_tag LOCUS_19690 434 850 CDS product DUF1311 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005899343.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence548 429 1025 gene locus_tag LOCUS_19700 429 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence549 1092 619 gene locus_tag LOCUS_19710 1092 619 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439097.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence550 >Feature sequence551 1060 122 gene locus_tag LOCUS_19720 1060 122 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841027.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence552 >Feature sequence553 >Feature sequence554 996 103 gene locus_tag LOCUS_19730 996 103 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867340.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence555 143 1048 gene locus_tag LOCUS_19740 143 1048 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722692.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence556 277 203 gene locus_tag LOCUS_t00210 277 203 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 967 581 gene locus_tag LOCUS_19750 967 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 1091 951 gene locus_tag LOCUS_19760 1091 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence557 >Feature sequence558 201 608 gene locus_tag LOCUS_19770 201 608 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836459.1 protein_id gnl|my_center|LOCUS_19770 621 1064 gene locus_tag LOCUS_19780 621 1064 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262079.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence559 <1 892 gene locus_tag LOCUS_19790 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016544.1:replication initiation protein >Feature sequence560 >Feature sequence561 <1 761 gene locus_tag LOCUS_19800 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963421.1:nitrite/sulfite reductase >Feature sequence562 2 169 gene locus_tag LOCUS_19810 2 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 169 939 gene locus_tag LOCUS_19820 169 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence563 >Feature sequence564 >Feature sequence565 <1 809 gene locus_tag LOCUS_19830 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964716.1:beta-glucoside-specific PTS transporter subunit IIABC >Feature sequence566 >Feature sequence567 881 348 gene locus_tag LOCUS_19840 881 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence568 >Feature sequence569 >Feature sequence570 >Feature sequence571 887 189 gene locus_tag LOCUS_19850 887 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence572 440 1012 gene locus_tag LOCUS_19860 440 1012 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167469637.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence573 >Feature sequence574 >Feature sequence575 <1 501 gene locus_tag LOCUS_19870 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476431.1:ATP-dependent endonuclease >Feature sequence576 <1 739 gene locus_tag LOCUS_19880 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964119.1:phosphoenolpyruvate synthase >Feature sequence577 >Feature sequence578 >Feature sequence579 >Feature sequence580 >Feature sequence581 >Feature sequence582 >Feature sequence583 >Feature sequence584 >Feature sequence585 >Feature sequence586 256 768 gene locus_tag LOCUS_19890 256 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence587 250 906 gene locus_tag LOCUS_19900 250 906 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834349.1 protein_id gnl|my_center|LOCUS_19900 >Feature sequence588 123 902 gene locus_tag LOCUS_19910 123 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence589