>Feature sequence001 2391 1594 gene locus_tag LOCUS_0010 2391 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 3259 2600 gene locus_tag LOCUS_0020 3259 2600 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545727.1 protein_id gnl|my_center|LOCUS_0020 3911 5587 gene locus_tag LOCUS_0030 3911 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 5682 6197 gene locus_tag LOCUS_0040 5682 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 6187 7143 gene locus_tag LOCUS_0050 6187 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 7208 7879 gene locus_tag LOCUS_0060 7208 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 10402 7922 gene locus_tag LOCUS_0070 10402 7922 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836822.1 protein_id gnl|my_center|LOCUS_0070 10426 11700 gene locus_tag LOCUS_0080 10426 11700 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289189.1 protein_id gnl|my_center|LOCUS_0080 11795 12835 gene locus_tag LOCUS_0090 11795 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 12885 15371 gene locus_tag LOCUS_0100 12885 15371 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_0100 15382 16728 gene locus_tag LOCUS_0110 gene radA 15382 16728 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_0110 >Feature sequence002 1597 413 gene locus_tag LOCUS_0120 gene tgt 1597 413 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897733.1 protein_id gnl|my_center|LOCUS_0120 1944 2678 gene locus_tag LOCUS_0130 1944 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900859.1 protein_id gnl|my_center|LOCUS_0130 2675 3424 gene locus_tag LOCUS_0140 2675 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 3433 3927 gene locus_tag LOCUS_0150 3433 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 3917 4399 gene locus_tag LOCUS_0160 3917 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 4559 5848 gene locus_tag LOCUS_0170 4559 5848 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889226.1 protein_id gnl|my_center|LOCUS_0170 6775 5939 gene locus_tag LOCUS_0180 6775 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 6894 6820 gene locus_tag LOCUS_t0010 6894 6820 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7391 7038 gene locus_tag LOCUS_0190 7391 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 7827 7678 gene locus_tag LOCUS_0200 7827 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 8074 8613 gene locus_tag LOCUS_0210 8074 8613 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723817.1 protein_id gnl|my_center|LOCUS_0210 8606 10654 gene locus_tag LOCUS_0220 8606 10654 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676329.1 protein_id gnl|my_center|LOCUS_0220 10752 12008 gene locus_tag LOCUS_0230 10752 12008 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_0230 12071 13849 gene locus_tag LOCUS_0240 12071 13849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 15275 13971 gene locus_tag LOCUS_0250 15275 13971 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357458.1 protein_id gnl|my_center|LOCUS_0250 15985 15272 gene locus_tag LOCUS_0260 15985 15272 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357457.1 protein_id gnl|my_center|LOCUS_0260 16039 17976 gene locus_tag LOCUS_0270 gene pulA 16039 17976 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994410.1 protein_id gnl|my_center|LOCUS_0270 17960 19138 gene locus_tag LOCUS_0280 gene rlmD 17960 19138 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_0280 >Feature sequence003 <1 956 gene locus_tag LOCUS_0290 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005693372.1:ATP-binding protein 1411 1037 gene locus_tag LOCUS_0300 1411 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 1726 1493 gene locus_tag LOCUS_0310 1726 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 1849 1925 gene locus_tag LOCUS_t0020 1849 1925 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1945 2022 gene locus_tag LOCUS_t0030 1945 2022 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2337 3251 gene locus_tag LOCUS_0320 2337 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 3332 4537 gene locus_tag LOCUS_0330 3332 4537 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_0330 4626 5318 gene locus_tag LOCUS_0340 4626 5318 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461247.1 protein_id gnl|my_center|LOCUS_0340 5315 7270 gene locus_tag LOCUS_0350 5315 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 7301 9199 gene locus_tag LOCUS_0360 gene ftsH 7301 9199 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733155.1 protein_id gnl|my_center|LOCUS_0360 9210 10910 gene locus_tag LOCUS_0370 gene murJ 9210 10910 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544918.1 protein_id gnl|my_center|LOCUS_0370 10907 12157 gene locus_tag LOCUS_0380 10907 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 12399 13727 gene locus_tag LOCUS_0390 12399 13727 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804962.1 protein_id gnl|my_center|LOCUS_0390 14707 14066 gene locus_tag LOCUS_0400 14707 14066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 15138 14719 gene locus_tag LOCUS_0410 15138 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 15823 15182 gene locus_tag LOCUS_0420 15823 15182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 18129 15865 gene locus_tag LOCUS_0430 18129 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 >Feature sequence004 5413 98 gene locus_tag LOCUS_0440 5413 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 7498 5507 gene locus_tag LOCUS_0450 gene uvrB 7498 5507 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_0450 7542 8081 gene locus_tag LOCUS_0460 7542 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 9068 8067 gene locus_tag LOCUS_0470 9068 8067 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020716.1 protein_id gnl|my_center|LOCUS_0470 10068 9088 gene locus_tag LOCUS_0480 10068 9088 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_0480 10913 10065 gene locus_tag LOCUS_0490 10913 10065 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_0490 11038 11427 gene locus_tag LOCUS_0500 11038 11427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0500 11473 13005 gene locus_tag LOCUS_0510 11473 13005 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972925.1 protein_id gnl|my_center|LOCUS_0510 13025 13101 gene locus_tag LOCUS_t0040 13025 13101 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 13773 13237 gene locus_tag LOCUS_0520 13773 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0520 14034 14255 gene locus_tag LOCUS_0530 14034 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 14300 14641 gene locus_tag LOCUS_0540 14300 14641 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476321.1 protein_id gnl|my_center|LOCUS_0540 17112 14677 gene locus_tag LOCUS_0550 17112 14677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 17483 17097 gene locus_tag LOCUS_0560 17483 17097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 18195 17560 gene locus_tag LOCUS_0570 18195 17560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 >Feature sequence005 481 1317 gene locus_tag LOCUS_0580 481 1317 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025301480.1 protein_id gnl|my_center|LOCUS_0580 1321 2064 gene locus_tag LOCUS_0590 1321 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 3300 5612 gene locus_tag LOCUS_0600 3300 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 5629 7131 gene locus_tag LOCUS_0610 5629 7131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 7134 8351 gene locus_tag LOCUS_0620 gene glf 7134 8351 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776101.1 protein_id gnl|my_center|LOCUS_0620 8412 9002 gene locus_tag LOCUS_0630 8412 9002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 8999 10801 gene locus_tag LOCUS_0640 8999 10801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 10819 13092 gene locus_tag LOCUS_0650 10819 13092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 13085 14245 gene locus_tag LOCUS_0660 13085 14245 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966352.1 protein_id gnl|my_center|LOCUS_0660 14242 15672 gene locus_tag LOCUS_0670 14242 15672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 17040 15625 gene locus_tag LOCUS_0680 17040 15625 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_0680 >Feature sequence006 <1 1907 gene locus_tag LOCUS_0690 <1 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436320.1:anaerobic ribonucleoside triphosphate reductase 1909 2421 gene locus_tag LOCUS_0700 gene nrdG 1909 2421 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_0700 2445 3845 gene locus_tag LOCUS_0710 2445 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 3845 4777 gene locus_tag LOCUS_0720 3845 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 4779 5801 gene locus_tag LOCUS_0730 4779 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0730 6177 6037 gene locus_tag LOCUS_0740 6177 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 6372 6530 gene locus_tag LOCUS_0750 6372 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 6615 7541 gene locus_tag LOCUS_0760 6615 7541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 7534 8550 gene locus_tag LOCUS_0770 7534 8550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 8610 9863 gene locus_tag LOCUS_0780 8610 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 9865 11634 gene locus_tag LOCUS_0790 9865 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 11631 12074 gene locus_tag LOCUS_0800 gene ruvX 11631 12074 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_0800 12078 13289 gene locus_tag LOCUS_0810 12078 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 13393 14646 gene locus_tag LOCUS_0820 13393 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 14653 16077 gene locus_tag LOCUS_0830 gene sbcB 14653 16077 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454911.1 protein_id gnl|my_center|LOCUS_0830 >Feature sequence007 1562 342 gene locus_tag LOCUS_0840 gene tyrS 1562 342 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964098.1 protein_id gnl|my_center|LOCUS_0840 1740 1931 gene locus_tag LOCUS_0850 1740 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 2048 3208 gene locus_tag LOCUS_0860 2048 3208 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940843.1 protein_id gnl|my_center|LOCUS_0860 3250 3729 gene locus_tag LOCUS_0870 3250 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 3757 4329 gene locus_tag LOCUS_0880 3757 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 4689 4348 gene locus_tag LOCUS_0890 4689 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 4783 5160 gene locus_tag LOCUS_0900 gene rpsF 4783 5160 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338020.1 protein_id gnl|my_center|LOCUS_0900 5183 5629 gene locus_tag LOCUS_0910 5183 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 5640 5834 gene locus_tag LOCUS_0920 gene rpsR 5640 5834 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143052.1 protein_id gnl|my_center|LOCUS_0920 5908 6471 gene locus_tag LOCUS_0930 gene efp 5908 6471 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880878.1 protein_id gnl|my_center|LOCUS_0930 6478 7203 gene locus_tag LOCUS_0940 6478 7203 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228016.1 protein_id gnl|my_center|LOCUS_0940 8326 7205 gene locus_tag LOCUS_0950 gene ychF 8326 7205 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730394.1 protein_id gnl|my_center|LOCUS_0950 8506 9549 gene locus_tag LOCUS_0960 gene pilM 8506 9549 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228636.1 protein_id gnl|my_center|LOCUS_0960 9551 10477 gene locus_tag LOCUS_0970 9551 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 10474 11244 gene locus_tag LOCUS_0980 10474 11244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 11231 11482 gene locus_tag LOCUS_0990 11231 11482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 11488 13254 gene locus_tag LOCUS_1000 11488 13254 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_1000 13296 14360 gene locus_tag LOCUS_1010 13296 14360 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583239.1 protein_id gnl|my_center|LOCUS_1010 14367 15575 gene locus_tag LOCUS_1020 14367 15575 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888498.1 protein_id gnl|my_center|LOCUS_1020 15668 16156 gene locus_tag LOCUS_1030 15668 16156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 16237 17121 gene locus_tag LOCUS_1040 16237 17121 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_1040 >Feature sequence008 1230 286 gene locus_tag LOCUS_1050 1230 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 1623 1279 gene locus_tag LOCUS_1060 1623 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 2015 3409 gene locus_tag LOCUS_1070 gene dnaA 2015 3409 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_1070 3671 4768 gene locus_tag LOCUS_1080 gene dnaN 3671 4768 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_1080 4769 5788 gene locus_tag LOCUS_1090 4769 5788 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016062.1 protein_id gnl|my_center|LOCUS_1090 6970 5780 gene locus_tag LOCUS_1100 6970 5780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_1100 7821 6967 gene locus_tag LOCUS_1110 7821 6967 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141273.1 protein_id gnl|my_center|LOCUS_1110 7934 9112 gene locus_tag LOCUS_1120 7934 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 9124 9957 gene locus_tag LOCUS_1130 9124 9957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 9938 11782 gene locus_tag LOCUS_1140 9938 11782 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965347.1 protein_id gnl|my_center|LOCUS_1140 11786 12715 gene locus_tag LOCUS_1150 11786 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 13756 12704 gene locus_tag LOCUS_1160 13756 12704 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_1160 13831 14373 gene locus_tag LOCUS_1170 13831 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 16088 14463 gene locus_tag LOCUS_1180 gene groL 16088 14463 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476222.1 protein_id gnl|my_center|LOCUS_1180 16364 16089 gene locus_tag LOCUS_1190 16364 16089 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546861.1 protein_id gnl|my_center|LOCUS_1190 >Feature sequence009 156 746 gene locus_tag LOCUS_1200 156 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 1124 876 gene locus_tag LOCUS_1210 1124 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 2736 1294 gene locus_tag LOCUS_1220 2736 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 7030 2741 gene locus_tag LOCUS_1230 7030 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 7854 7027 gene locus_tag LOCUS_1240 7854 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 8756 8151 gene locus_tag LOCUS_1250 8756 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 8852 9493 gene locus_tag LOCUS_1260 8852 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 9520 9975 gene locus_tag LOCUS_1270 9520 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1270 10069 10758 gene locus_tag LOCUS_1280 10069 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1280 10716 11864 gene locus_tag LOCUS_1290 10716 11864 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905442.1 protein_id gnl|my_center|LOCUS_1290 11941 12291 gene locus_tag LOCUS_1300 11941 12291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 12304 12540 gene locus_tag LOCUS_1310 12304 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 13199 12537 gene locus_tag LOCUS_1320 gene tmk 13199 12537 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_1320 13359 13964 gene locus_tag LOCUS_1330 13359 13964 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_1330 13995 14747 gene locus_tag LOCUS_1340 13995 14747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 15439 14834 gene locus_tag LOCUS_1350 15439 14834 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475516.1 protein_id gnl|my_center|LOCUS_1350 <16183 15461 gene locus_tag LOCUS_1360 <16183 15461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454079.1:putative ABC transporter permease >Feature sequence010 924 2693 gene locus_tag LOCUS_1370 924 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 2701 3465 gene locus_tag LOCUS_1380 gene ftsE 2701 3465 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000022265.1 protein_id gnl|my_center|LOCUS_1380 3462 4442 gene locus_tag LOCUS_1390 gene ftsX 3462 4442 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236202.1 protein_id gnl|my_center|LOCUS_1390 4508 5683 gene locus_tag LOCUS_1400 4508 5683 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906400.1 protein_id gnl|my_center|LOCUS_1400 5765 7141 gene locus_tag LOCUS_1410 5765 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 7588 8013 gene locus_tag LOCUS_1420 7588 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 8116 8631 gene locus_tag LOCUS_1430 8116 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 8789 9175 gene locus_tag LOCUS_1440 8789 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 9548 9276 gene locus_tag LOCUS_1450 gene rpmA 9548 9276 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948350.1 protein_id gnl|my_center|LOCUS_1450 10773 9595 gene locus_tag LOCUS_1460 10773 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 11114 10806 gene locus_tag LOCUS_1470 11114 10806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 11138 12271 gene locus_tag LOCUS_1480 11138 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 12255 13394 gene locus_tag LOCUS_1490 gene xseA 12255 13394 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958100.1 protein_id gnl|my_center|LOCUS_1490 13378 13617 gene locus_tag LOCUS_1500 13378 13617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1500 13637 14527 gene locus_tag LOCUS_1510 13637 14527 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058115.1 protein_id gnl|my_center|LOCUS_1510 14540 15775 gene locus_tag LOCUS_1520 14540 15775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_1520 >Feature sequence011 219 3356 gene locus_tag LOCUS_1530 219 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 3418 4935 gene locus_tag LOCUS_1540 3418 4935 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121201.1 protein_id gnl|my_center|LOCUS_1540 4948 5328 gene locus_tag LOCUS_1550 4948 5328 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887808.1 protein_id gnl|my_center|LOCUS_1550 5325 5546 gene locus_tag LOCUS_1560 5325 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 5558 7345 gene locus_tag LOCUS_1570 5558 7345 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454209.1 protein_id gnl|my_center|LOCUS_1570 7385 8029 gene locus_tag LOCUS_1580 7385 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 8484 8044 gene locus_tag LOCUS_1590 8484 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 8806 8498 gene locus_tag LOCUS_1600 8806 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 8941 9016 gene locus_tag LOCUS_t0050 8941 9016 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9308 9090 gene locus_tag LOCUS_1610 9308 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 9977 9363 gene locus_tag LOCUS_1620 9977 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 10672 10007 gene locus_tag LOCUS_1630 10672 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 10688 11140 gene locus_tag LOCUS_1640 10688 11140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 11773 11141 gene locus_tag LOCUS_1650 11773 11141 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872398.1 protein_id gnl|my_center|LOCUS_1650 13825 11816 gene locus_tag LOCUS_1660 13825 11816 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966555.1 protein_id gnl|my_center|LOCUS_1660 15572 13815 gene locus_tag LOCUS_1670 15572 13815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 >Feature sequence012 772 131 gene locus_tag LOCUS_1680 772 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 1385 897 gene locus_tag LOCUS_1690 1385 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 3552 1369 gene locus_tag LOCUS_1700 3552 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1700 5599 3539 gene locus_tag LOCUS_1710 5599 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 7010 5610 gene locus_tag LOCUS_1720 gene der 7010 5610 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_1720 8493 7072 gene locus_tag LOCUS_1730 8493 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 9280 8591 gene locus_tag LOCUS_1740 9280 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 9489 10907 gene locus_tag LOCUS_1750 9489 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 12211 10946 gene locus_tag LOCUS_1760 12211 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1760 12345 12431 gene locus_tag LOCUS_t0060 12345 12431 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12460 13722 gene locus_tag LOCUS_1770 12460 13722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 13750 14439 gene locus_tag LOCUS_1780 13750 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 15709 14633 gene locus_tag LOCUS_1790 15709 14633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 >Feature sequence013 517 209 gene locus_tag LOCUS_1800 517 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 665 2362 gene locus_tag LOCUS_1810 gene argS 665 2362 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991367.1 protein_id gnl|my_center|LOCUS_1810 2365 2922 gene locus_tag LOCUS_1820 gene orn 2365 2922 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021796.1 protein_id gnl|my_center|LOCUS_1820 2909 3244 gene locus_tag LOCUS_1830 2909 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 4372 3224 gene locus_tag LOCUS_1840 4372 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 4437 6290 gene locus_tag LOCUS_1850 4437 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 6731 6396 gene locus_tag LOCUS_1860 6731 6396 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257803.1 protein_id gnl|my_center|LOCUS_1860 7219 8112 gene locus_tag LOCUS_1870 7219 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 8369 10066 gene locus_tag LOCUS_1880 8369 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1880 10186 11889 gene locus_tag LOCUS_1890 10186 11889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 11891 12577 gene locus_tag LOCUS_1900 11891 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 12574 12840 gene locus_tag LOCUS_1910 gene rpsO 12574 12840 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_1910 13122 15248 gene locus_tag LOCUS_1920 gene pnp 13122 15248 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832554.1 protein_id gnl|my_center|LOCUS_1920 >Feature sequence014 37 309 gene locus_tag LOCUS_1930 37 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 608 1276 gene locus_tag LOCUS_1940 608 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 1475 2833 gene locus_tag LOCUS_1950 gene vmlR 1475 2833 CDS product ABC-F type ribosomal protection protein VmlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234144.1 protein_id gnl|my_center|LOCUS_1950 2966 4117 gene locus_tag LOCUS_1960 2966 4117 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257333.1 protein_id gnl|my_center|LOCUS_1960 4107 4709 gene locus_tag LOCUS_1970 4107 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1970 4706 5752 gene locus_tag LOCUS_1980 gene mnmA 4706 5752 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362075.1 protein_id gnl|my_center|LOCUS_1980 5804 5880 gene locus_tag LOCUS_t0070 5804 5880 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5884 5960 gene locus_tag LOCUS_t0080 5884 5960 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5972 6048 gene locus_tag LOCUS_t0090 5972 6048 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6173 6850 gene locus_tag LOCUS_1990 6173 6850 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_1990 6847 7821 gene locus_tag LOCUS_2000 6847 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 7848 7934 gene locus_tag LOCUS_t0100 7848 7934 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8014 9537 gene locus_tag LOCUS_2010 8014 9537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 10702 9584 gene locus_tag LOCUS_2020 10702 9584 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926922.1 protein_id gnl|my_center|LOCUS_2020 10926 11666 gene locus_tag LOCUS_2030 10926 11666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 11816 12550 gene locus_tag LOCUS_2040 11816 12550 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_2040 12791 12715 gene locus_tag LOCUS_t0110 12791 12715 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13090 13389 gene locus_tag LOCUS_2050 13090 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 15192 13456 gene locus_tag LOCUS_2060 15192 13456 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109303.1 protein_id gnl|my_center|LOCUS_2060 >Feature sequence015 <1 1114 gene locus_tag LOCUS_2070 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583734.1:serine--tRNA ligase 1156 1536 gene locus_tag LOCUS_2080 1156 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 1557 2453 gene locus_tag LOCUS_2090 1557 2453 CDS product fructose bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681313.1 protein_id gnl|my_center|LOCUS_2090 2473 2958 gene locus_tag LOCUS_2100 2473 2958 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294466.1 protein_id gnl|my_center|LOCUS_2100 3070 3756 gene locus_tag LOCUS_2110 3070 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 3864 4475 gene locus_tag LOCUS_2120 3864 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 5094 4489 gene locus_tag LOCUS_2130 5094 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 5228 8191 gene locus_tag LOCUS_2140 gene secA 5228 8191 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583762.1 protein_id gnl|my_center|LOCUS_2140 8224 9033 gene locus_tag LOCUS_2150 8224 9033 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223128.1 protein_id gnl|my_center|LOCUS_2150 10354 10091 gene locus_tag LOCUS_2160 10354 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 10962 10369 gene locus_tag LOCUS_2170 10962 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 11904 10981 gene locus_tag LOCUS_2180 11904 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 13261 11918 gene locus_tag LOCUS_2190 13261 11918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 >Feature sequence016 651 1313 gene locus_tag LOCUS_2200 gene sufC 651 1313 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113429.1 protein_id gnl|my_center|LOCUS_2200 1316 2644 gene locus_tag LOCUS_2210 gene sufB 1316 2644 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057833.1 protein_id gnl|my_center|LOCUS_2210 2641 3066 gene locus_tag LOCUS_2220 2641 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 3068 4234 gene locus_tag LOCUS_2230 3068 4234 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250940.1 protein_id gnl|my_center|LOCUS_2230 4706 4630 gene locus_tag LOCUS_t0120 4706 4630 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6117 4774 gene locus_tag LOCUS_2240 6117 4774 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_2240 8363 6114 gene locus_tag LOCUS_2250 8363 6114 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836919.1 protein_id gnl|my_center|LOCUS_2250 11607 8413 gene locus_tag LOCUS_2260 11607 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 12074 11598 gene locus_tag LOCUS_2270 12074 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 12737 12153 gene locus_tag LOCUS_2280 12737 12153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 >Feature sequence017 3943 524 gene locus_tag LOCUS_2290 3943 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 6586 3944 gene locus_tag LOCUS_2300 6586 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 8262 7108 gene locus_tag LOCUS_2310 8262 7108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 9016 8462 gene locus_tag LOCUS_2320 gene nusG 9016 8462 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_2320 9402 9016 gene locus_tag LOCUS_2330 9402 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 9502 9738 gene locus_tag LOCUS_2340 9502 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 11478 9823 gene locus_tag LOCUS_2350 11478 9823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 12259 11516 gene locus_tag LOCUS_2360 12259 11516 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796789.1 protein_id gnl|my_center|LOCUS_2360 12878 12240 gene locus_tag LOCUS_2370 12878 12240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 13039 12964 gene locus_tag LOCUS_t0130 13039 12964 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence018 692 492 gene locus_tag LOCUS_2380 692 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2380 1618 698 gene locus_tag LOCUS_2390 gene trxB 1618 698 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_2390 3373 1631 gene locus_tag LOCUS_2400 3373 1631 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921313.1 protein_id gnl|my_center|LOCUS_2400 3470 3543 gene locus_tag LOCUS_t0140 3470 3543 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3714 3890 gene locus_tag LOCUS_2410 3714 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 3841 4959 gene locus_tag LOCUS_2420 3841 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 6698 5058 gene locus_tag LOCUS_2430 6698 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 7972 6755 gene locus_tag LOCUS_2440 7972 6755 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_2440 8064 8336 gene locus_tag LOCUS_2450 8064 8336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2450 8333 9577 gene locus_tag LOCUS_2460 gene dinB 8333 9577 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_2460 9626 10306 gene locus_tag LOCUS_2470 9626 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 10308 11126 gene locus_tag LOCUS_2480 10308 11126 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009905410.1 protein_id gnl|my_center|LOCUS_2480 11147 13246 gene locus_tag LOCUS_2490 11147 13246 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549436.1 protein_id gnl|my_center|LOCUS_2490 >Feature sequence019 124 1326 gene locus_tag LOCUS_2500 124 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 4957 1454 gene locus_tag LOCUS_2510 4957 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 5449 4994 gene locus_tag LOCUS_2520 gene greA 5449 4994 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289156.1 protein_id gnl|my_center|LOCUS_2520 6794 5535 gene locus_tag LOCUS_2530 6794 5535 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389451.1 protein_id gnl|my_center|LOCUS_2530 7986 6826 gene locus_tag LOCUS_2540 7986 6826 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_2540 8792 8082 gene locus_tag LOCUS_2550 8792 8082 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_2550 9396 8845 gene locus_tag LOCUS_2560 gene frr 9396 8845 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893897.1 protein_id gnl|my_center|LOCUS_2560 10032 9421 gene locus_tag LOCUS_2570 gene tsf 10032 9421 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545220.1 protein_id gnl|my_center|LOCUS_2570 10816 10070 gene locus_tag LOCUS_2580 gene rpsB 10816 10070 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000268484.1 protein_id gnl|my_center|LOCUS_2580 11499 11038 gene locus_tag LOCUS_2590 11499 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 11654 12847 gene locus_tag LOCUS_2600 11654 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 >Feature sequence020 <1 628 gene locus_tag LOCUS_2610 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015776687.1:SDR family NAD(P)-dependent oxidoreductase 936 1850 gene locus_tag LOCUS_2620 936 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 1919 2500 gene locus_tag LOCUS_2630 gene udg 1919 2500 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_2630 4048 2528 gene locus_tag LOCUS_2640 4048 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 4377 6785 gene locus_tag LOCUS_2650 4377 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 6950 9187 gene locus_tag LOCUS_2660 6950 9187 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460381.1 protein_id gnl|my_center|LOCUS_2660 9225 11510 gene locus_tag LOCUS_2670 9225 11510 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438328.1 protein_id gnl|my_center|LOCUS_2670 >Feature sequence021 1156 1842 gene locus_tag LOCUS_2680 1156 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 1890 2648 gene locus_tag LOCUS_2690 1890 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 2648 3064 gene locus_tag LOCUS_2700 2648 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 3065 3361 gene locus_tag LOCUS_2710 3065 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 3361 3768 gene locus_tag LOCUS_2720 3361 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 3783 4172 gene locus_tag LOCUS_2730 3783 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2730 4249 4665 gene locus_tag LOCUS_2740 4249 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 4691 5131 gene locus_tag LOCUS_2750 4691 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 5721 5242 gene locus_tag LOCUS_2760 5721 5242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 5830 6531 gene locus_tag LOCUS_2770 5830 6531 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_2770 6663 6574 gene locus_tag LOCUS_t0150 6663 6574 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7056 6685 gene locus_tag LOCUS_2780 7056 6685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 7455 7363 gene locus_tag LOCUS_t0160 7455 7363 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9068 7485 gene locus_tag LOCUS_2790 gene pyrG 9068 7485 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320045.1 protein_id gnl|my_center|LOCUS_2790 9444 9160 gene locus_tag LOCUS_2800 9444 9160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 11217 9643 gene locus_tag LOCUS_2810 11217 9643 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001764195.1 protein_id gnl|my_center|LOCUS_2810 11300 11391 gene locus_tag LOCUS_t0170 11300 11391 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11400 11475 gene locus_tag LOCUS_t0180 11400 11475 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence022 2398 941 gene locus_tag LOCUS_2820 gene dnaB 2398 941 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_2820 3881 2385 gene locus_tag LOCUS_2830 gene dnaX 3881 2385 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567107.1 protein_id gnl|my_center|LOCUS_2830 4787 3915 gene locus_tag LOCUS_2840 4787 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 5317 4790 gene locus_tag LOCUS_2850 5317 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2850 5436 5774 gene locus_tag LOCUS_2860 5436 5774 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027987.1 protein_id gnl|my_center|LOCUS_2860 5857 6609 gene locus_tag LOCUS_2870 5857 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 7247 6873 gene locus_tag LOCUS_2880 gene rplL 7247 6873 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558082.1 protein_id gnl|my_center|LOCUS_2880 7807 7283 gene locus_tag LOCUS_2890 7807 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 8638 7994 gene locus_tag LOCUS_2900 8638 7994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426165.1 protein_id gnl|my_center|LOCUS_2900 9879 8647 gene locus_tag LOCUS_2910 9879 8647 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113586.1 protein_id gnl|my_center|LOCUS_2910 11273 9891 gene locus_tag LOCUS_2920 11273 9891 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994117.1 protein_id gnl|my_center|LOCUS_2920 >Feature sequence023 190 1143 gene locus_tag LOCUS_2930 gene xerD 190 1143 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_2930 2522 1227 gene locus_tag LOCUS_2940 2522 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 3244 2519 gene locus_tag LOCUS_2950 3244 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 3854 3264 gene locus_tag LOCUS_2960 3854 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 4795 3872 gene locus_tag LOCUS_2970 4795 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 7617 4795 gene locus_tag LOCUS_2980 7617 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 8444 7845 gene locus_tag LOCUS_2990 8444 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 8748 9422 gene locus_tag LOCUS_3000 8748 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 10436 9561 gene locus_tag LOCUS_3010 gene mutM 10436 9561 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594829.1 protein_id gnl|my_center|LOCUS_3010 10660 10436 gene locus_tag LOCUS_3020 10660 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 11330 10731 gene locus_tag LOCUS_3030 11330 10731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 >Feature sequence024 686 24 gene locus_tag LOCUS_3040 686 24 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016479.1 protein_id gnl|my_center|LOCUS_3040 1837 797 gene locus_tag LOCUS_3050 1837 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 2794 1913 gene locus_tag LOCUS_3060 2794 1913 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963352.1 protein_id gnl|my_center|LOCUS_3060 2949 3932 gene locus_tag LOCUS_3070 2949 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 4383 6383 gene locus_tag LOCUS_3080 gene gyrB 4383 6383 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288364.1 protein_id gnl|my_center|LOCUS_3080 6399 9011 gene locus_tag LOCUS_3090 gene gyrA 6399 9011 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723770.1 protein_id gnl|my_center|LOCUS_3090 9061 9636 gene locus_tag LOCUS_3100 9061 9636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 9626 10177 gene locus_tag LOCUS_3110 9626 10177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 >Feature sequence025 241 1698 gene locus_tag LOCUS_3120 gene gltX 241 1698 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_3120 1736 3280 gene locus_tag LOCUS_3130 1736 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 3332 3406 gene locus_tag LOCUS_t0190 3332 3406 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3431 4702 gene locus_tag LOCUS_3140 3431 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 4801 6111 gene locus_tag LOCUS_3150 4801 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 6111 6791 gene locus_tag LOCUS_3160 6111 6791 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227785.1 protein_id gnl|my_center|LOCUS_3160 7333 6842 gene locus_tag LOCUS_3170 gene rplO 7333 6842 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936637.1 protein_id gnl|my_center|LOCUS_3170 8010 7333 gene locus_tag LOCUS_3180 8010 7333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3180 8347 8012 gene locus_tag LOCUS_3190 gene rplR 8347 8012 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129924.1 protein_id gnl|my_center|LOCUS_3190 8736 8347 gene locus_tag LOCUS_3200 8736 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_3200 9317 8916 gene locus_tag LOCUS_3210 gene rpsH 9317 8916 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455656.1 protein_id gnl|my_center|LOCUS_3210 9603 9334 gene locus_tag LOCUS_3220 gene rpsN 9603 9334 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085703.1 protein_id gnl|my_center|LOCUS_3220 10187 9603 gene locus_tag LOCUS_3230 gene rplE 10187 9603 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021592.1 protein_id gnl|my_center|LOCUS_3230 10483 10187 gene locus_tag LOCUS_3240 gene rplX 10483 10187 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088142.1 protein_id gnl|my_center|LOCUS_3240 10851 10483 gene locus_tag LOCUS_3250 gene rplN 10851 10483 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421155.1 protein_id gnl|my_center|LOCUS_3250 >Feature sequence026 885 1256 gene locus_tag LOCUS_3260 885 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 2804 1386 gene locus_tag LOCUS_3270 2804 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 3129 3884 gene locus_tag LOCUS_3280 3129 3884 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_3280 3943 4164 gene locus_tag LOCUS_3290 3943 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 4882 4238 gene locus_tag LOCUS_3300 4882 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 6813 4879 gene locus_tag LOCUS_3310 6813 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 8043 6835 gene locus_tag LOCUS_3320 8043 6835 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_3320 9316 8036 gene locus_tag LOCUS_3330 9316 8036 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_3330 >Feature sequence027 <1 1619 gene locus_tag LOCUS_3340 <1 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002378970.1:primosomal protein N' 1694 2305 gene locus_tag LOCUS_3350 gene def 1694 2305 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310211.1 protein_id gnl|my_center|LOCUS_3350 2305 3204 gene locus_tag LOCUS_3360 gene fmt 2305 3204 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881395.1 protein_id gnl|my_center|LOCUS_3360 3384 4439 gene locus_tag LOCUS_3370 gene coxFIC1 3384 4439 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_3370 4775 4461 gene locus_tag LOCUS_3380 4775 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 7413 4756 gene locus_tag LOCUS_3390 7413 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 >Feature sequence028 8 1324 gene locus_tag LOCUS_3400 8 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 1434 2003 gene locus_tag LOCUS_3410 1434 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 2011 4386 gene locus_tag LOCUS_3420 2011 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 6131 4428 gene locus_tag LOCUS_3430 6131 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 6285 7289 gene locus_tag LOCUS_3440 6285 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 7409 8257 gene locus_tag LOCUS_3450 7409 8257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 8308 9450 gene locus_tag LOCUS_3460 8308 9450 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_3460 >Feature sequence029 193 3078 gene locus_tag LOCUS_3470 193 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 3617 3186 gene locus_tag LOCUS_3480 3617 3186 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582602.1 protein_id gnl|my_center|LOCUS_3480 4119 3769 gene locus_tag LOCUS_3490 4119 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 4506 8282 gene locus_tag LOCUS_3500 gene cas9 4506 8282 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_3500 8502 8383 gene locus_tag LOCUS_3510 8502 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 8563 9189 gene locus_tag LOCUS_3520 8563 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 9203 9532 gene locus_tag LOCUS_3530 gene cas2 9203 9532 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263547.1 protein_id gnl|my_center|LOCUS_3530 9573 9808 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attatacaactatctgaattgttagagaactataactc >Feature sequence030 136 2091 gene locus_tag LOCUS_3540 136 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_3540 3068 2115 gene locus_tag LOCUS_3550 3068 2115 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_3550 3169 3244 gene locus_tag LOCUS_t0200 3169 3244 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3389 4849 gene locus_tag LOCUS_3560 3389 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3560 4862 6127 gene locus_tag LOCUS_3570 4862 6127 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399351.1 protein_id gnl|my_center|LOCUS_3570 6124 6888 gene locus_tag LOCUS_3580 6124 6888 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114099.1 protein_id gnl|my_center|LOCUS_3580 8349 6898 gene locus_tag LOCUS_3590 8349 6898 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389574.1 protein_id gnl|my_center|LOCUS_3590 8446 8371 gene locus_tag LOCUS_t0210 8446 8371 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9217 8498 gene locus_tag LOCUS_3600 9217 8498 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256931.1 protein_id gnl|my_center|LOCUS_3600 >Feature sequence031 349 615 gene locus_tag LOCUS_3610 349 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 605 886 gene locus_tag LOCUS_3620 605 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 996 4829 gene locus_tag LOCUS_3630 gene dnaE 996 4829 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129735450.1 protein_id gnl|my_center|LOCUS_3630 4977 6044 gene locus_tag LOCUS_3640 4977 6044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 7546 6263 gene locus_tag LOCUS_3650 7546 6263 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_3650 7848 8399 gene locus_tag LOCUS_3660 7848 8399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 >Feature sequence032 152 228 gene locus_tag LOCUS_t0220 152 228 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 334 1608 gene locus_tag LOCUS_3670 gene eno 334 1608 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889260.1 protein_id gnl|my_center|LOCUS_3670 3465 1678 gene locus_tag LOCUS_3680 gene aspS 3465 1678 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932992.1 protein_id gnl|my_center|LOCUS_3680 4400 3522 gene locus_tag LOCUS_3690 4400 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 4454 5218 gene locus_tag LOCUS_3700 4454 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3700 7116 5293 gene locus_tag LOCUS_3710 gene typA 7116 5293 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887841.1 protein_id gnl|my_center|LOCUS_3710 7297 7220 gene locus_tag LOCUS_t0230 7297 7220 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8629 7412 gene locus_tag LOCUS_3720 8629 7412 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_3720 >Feature sequence033 <1 1174 gene locus_tag LOCUS_3730 <1 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869581.1:pyruvate kinase 1191 2417 gene locus_tag LOCUS_3740 1191 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_3740 2458 3234 gene locus_tag LOCUS_3750 gene tpiA 2458 3234 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_3750 3594 4379 gene locus_tag LOCUS_3760 3594 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 4429 6630 gene locus_tag LOCUS_3770 gene pcrA 4429 6630 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_3770 6688 7896 gene locus_tag LOCUS_3780 6688 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 >Feature sequence034 1291 116 gene locus_tag LOCUS_3790 1291 116 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_3790 2597 1206 gene locus_tag LOCUS_3800 gene spoVE 2597 1206 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426995.1 protein_id gnl|my_center|LOCUS_3800 3643 2606 gene locus_tag LOCUS_3810 gene mraY 3643 2606 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_3810 5400 3640 gene locus_tag LOCUS_3820 5400 3640 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811672.1 protein_id gnl|my_center|LOCUS_3820 5788 5420 gene locus_tag LOCUS_3830 5788 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3830 6969 6067 gene locus_tag LOCUS_3840 gene rsmH 6969 6067 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_3840 7651 7280 gene locus_tag LOCUS_3850 7651 7280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3850 8137 7886 gene locus_tag LOCUS_3860 8137 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 >Feature sequence035 151 366 gene locus_tag LOCUS_3870 gene rpmB 151 366 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216391.1 protein_id gnl|my_center|LOCUS_3870 1115 477 gene locus_tag LOCUS_3880 1115 477 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_3880 1746 1105 gene locus_tag LOCUS_3890 1746 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3890 2692 1769 gene locus_tag LOCUS_3900 gene miaA 2692 1769 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263069.1 protein_id gnl|my_center|LOCUS_3900 2843 4447 gene locus_tag LOCUS_3910 2843 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 4476 7364 gene locus_tag LOCUS_3920 4476 7364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 7612 7442 gene locus_tag LOCUS_3930 7612 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 >Feature sequence036 292 59 gene locus_tag LOCUS_3940 292 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 1380 370 gene locus_tag LOCUS_3950 1380 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3950 2509 1445 gene locus_tag LOCUS_3960 2509 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 3328 2522 gene locus_tag LOCUS_3970 3328 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 4144 3329 gene locus_tag LOCUS_3980 4144 3329 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_3980 4665 4150 gene locus_tag LOCUS_3990 gene smpB 4665 4150 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141494.1 protein_id gnl|my_center|LOCUS_3990 4687 5745 gene locus_tag LOCUS_4000 4687 5745 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584074.1 protein_id gnl|my_center|LOCUS_4000 5754 7052 gene locus_tag LOCUS_4010 5754 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 7371 7105 gene locus_tag LOCUS_4020 7371 7105 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_4020 7800 7429 gene locus_tag LOCUS_4030 7800 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 >Feature sequence037 667 110 gene locus_tag LOCUS_4040 667 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 751 927 gene locus_tag LOCUS_4050 751 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 1197 847 gene locus_tag LOCUS_4060 1197 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 1334 1483 gene locus_tag LOCUS_4070 1334 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 1516 2001 gene locus_tag LOCUS_4080 gene nusB 1516 2001 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_4080 1952 2689 gene locus_tag LOCUS_4090 1952 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4090 2676 3062 gene locus_tag LOCUS_4100 2676 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_4100 3078 3473 gene locus_tag LOCUS_4110 3078 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_4110 3619 4281 gene locus_tag LOCUS_4120 3619 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 4335 4619 gene locus_tag LOCUS_4130 gene gatC 4335 4619 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404034.1 protein_id gnl|my_center|LOCUS_4130 4621 6033 gene locus_tag LOCUS_4140 gene gatA 4621 6033 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141527.1 protein_id gnl|my_center|LOCUS_4140 6026 6451 gene locus_tag LOCUS_4150 6026 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 6456 7952 gene locus_tag LOCUS_4160 gene gatB 6456 7952 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225147.1 protein_id gnl|my_center|LOCUS_4160 >Feature sequence038 2815 344 gene locus_tag LOCUS_4170 gene mgtA 2815 344 CDS product magnesium-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948085.1 protein_id gnl|my_center|LOCUS_4170 3058 3768 gene locus_tag LOCUS_4180 3058 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 3901 5103 gene locus_tag LOCUS_4190 3901 5103 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679842.1 protein_id gnl|my_center|LOCUS_4190 5104 6192 gene locus_tag LOCUS_4200 5104 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 6326 7507 gene locus_tag LOCUS_4210 gene tuf 6326 7507 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690212.1 protein_id gnl|my_center|LOCUS_4210 >Feature sequence039 519 2558 gene locus_tag LOCUS_4220 gene ligA 519 2558 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_4220 2749 2824 gene locus_tag LOCUS_t0240 2749 2824 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2867 4789 gene locus_tag LOCUS_4230 2867 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 4794 5486 gene locus_tag LOCUS_4240 4794 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4240 >Feature sequence040 302 3727 gene locus_tag LOCUS_4250 gene rpoB 302 3727 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393945.1 protein_id gnl|my_center|LOCUS_4250 3727 7551 gene locus_tag LOCUS_4260 3727 7551 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892756.1 protein_id gnl|my_center|LOCUS_4260 >Feature sequence041 834 1133 gene locus_tag LOCUS_4270 834 1133 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582669.1 protein_id gnl|my_center|LOCUS_4270 1139 1771 gene locus_tag LOCUS_4280 gene recR 1139 1771 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956990.1 protein_id gnl|my_center|LOCUS_4280 2569 1862 gene locus_tag LOCUS_4290 2569 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 2673 5612 gene locus_tag LOCUS_4300 2673 5612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 >Feature sequence042 1758 1336 gene locus_tag LOCUS_4310 gene tsaE 1758 1336 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_4310 2722 1778 gene locus_tag LOCUS_4320 2722 1778 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633068.1 protein_id gnl|my_center|LOCUS_4320 2795 5317 gene locus_tag LOCUS_4330 2795 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 6047 5328 gene locus_tag LOCUS_4340 6047 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 6087 6590 gene locus_tag LOCUS_4350 6087 6590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 6580 6942 gene locus_tag LOCUS_4360 6580 6942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4360 >Feature sequence043 299 1234 gene locus_tag LOCUS_4370 299 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 1377 3938 gene locus_tag LOCUS_4380 1377 3938 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082363.1 protein_id gnl|my_center|LOCUS_4380 4354 3956 gene locus_tag LOCUS_4390 4354 3956 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_4390 5043 4378 gene locus_tag LOCUS_4400 5043 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 5118 6314 gene locus_tag LOCUS_4410 5118 6314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 6933 6652 gene locus_tag LOCUS_4420 6933 6652 CDS product type II toxin-antitoxin system RelB/DinJ family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665927.1 protein_id gnl|my_center|LOCUS_4420 7186 7099 gene locus_tag LOCUS_t0250 7186 7099 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 3364 1580 gene locus_tag LOCUS_4430 3364 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 4464 3421 gene locus_tag LOCUS_4440 gene rpsA 4464 3421 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_4440 4971 4594 gene locus_tag LOCUS_4450 4971 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 5721 4981 gene locus_tag LOCUS_4460 5721 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 7105 5738 gene locus_tag LOCUS_4470 gene secY 7105 5738 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_4470 >Feature sequence045 212 925 gene locus_tag LOCUS_4480 212 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 987 1517 gene locus_tag LOCUS_4490 987 1517 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687553.1 protein_id gnl|my_center|LOCUS_4490 3068 1572 gene locus_tag LOCUS_4500 3068 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 3172 4179 gene locus_tag LOCUS_4510 gene gap 3172 4179 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_4510 4195 4653 gene locus_tag LOCUS_4520 4195 4653 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037666673.1 protein_id gnl|my_center|LOCUS_4520 4653 5306 gene locus_tag LOCUS_4530 4653 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 >Feature sequence046 2101 338 gene locus_tag LOCUS_4540 2101 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 2423 2103 gene locus_tag LOCUS_4550 2423 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 3343 2543 gene locus_tag LOCUS_4560 3343 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4560 4045 5001 gene locus_tag LOCUS_4570 4045 5001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 6281 5007 gene locus_tag LOCUS_4580 6281 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4580 <7234 6278 gene locus_tag LOCUS_4590 <7234 6278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256081.1:transglycosylase domain-containing protein >Feature sequence047 1581 481 gene locus_tag LOCUS_4600 gene prfB 1581 481 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_4600 2444 1587 gene locus_tag LOCUS_4610 2444 1587 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863794.1 protein_id gnl|my_center|LOCUS_4610 3824 2490 gene locus_tag LOCUS_4620 gene murD 3824 2490 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966471.1 protein_id gnl|my_center|LOCUS_4620 5128 3848 gene locus_tag LOCUS_4630 5128 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 6427 5144 gene locus_tag LOCUS_4640 6427 5144 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390720.1 protein_id gnl|my_center|LOCUS_4640 <7177 6424 gene locus_tag LOCUS_4650 <7177 6424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000004512.1:lysine--tRNA ligase >Feature sequence048 617 1123 gene locus_tag LOCUS_4660 gene ruvC 617 1123 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_4660 1136 1717 gene locus_tag LOCUS_4670 gene ruvA 1136 1717 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460360.1 protein_id gnl|my_center|LOCUS_4670 1742 2776 gene locus_tag LOCUS_4680 gene ruvB 1742 2776 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723536.1 protein_id gnl|my_center|LOCUS_4680 3541 2906 gene locus_tag LOCUS_4690 3541 2906 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548802.1 protein_id gnl|my_center|LOCUS_4690 4856 3561 gene locus_tag LOCUS_4700 gene obgE 4856 3561 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002384537.1 protein_id gnl|my_center|LOCUS_4700 5317 6291 gene locus_tag LOCUS_4710 5317 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 6288 6584 gene locus_tag LOCUS_4720 6288 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 >Feature sequence049 <1 634 gene locus_tag LOCUS_4730 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390135.1:mupirocin-resistant isoleucine--tRNA ligase 637 1803 gene locus_tag LOCUS_4740 637 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 2011 2865 gene locus_tag LOCUS_4750 2011 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 3128 3355 gene locus_tag LOCUS_4760 3128 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 3506 3955 gene locus_tag LOCUS_4770 3506 3955 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_4770 3952 4497 gene locus_tag LOCUS_4780 3952 4497 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892871.1 protein_id gnl|my_center|LOCUS_4780 4526 5299 gene locus_tag LOCUS_4790 gene map 4526 5299 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017049.1 protein_id gnl|my_center|LOCUS_4790 >Feature sequence050 186 380 gene locus_tag LOCUS_4800 186 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4800 465 818 gene locus_tag LOCUS_4810 465 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 1066 881 gene locus_tag LOCUS_4820 1066 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 1937 1164 gene locus_tag LOCUS_4830 1937 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 2163 1918 gene locus_tag LOCUS_4840 2163 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 2261 2401 gene locus_tag LOCUS_4850 2261 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 3399 2440 gene locus_tag LOCUS_4860 3399 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 3593 3518 gene locus_tag LOCUS_t0260 3593 3518 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3688 3603 gene locus_tag LOCUS_t0270 3688 3603 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3776 3700 gene locus_tag LOCUS_t0280 3776 3700 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4470 3829 gene locus_tag LOCUS_4870 4470 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 5352 4504 gene locus_tag LOCUS_4880 5352 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 6214 5345 gene locus_tag LOCUS_4890 6214 5345 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_4890 >Feature sequence051 566 171 gene locus_tag LOCUS_4900 566 171 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000675692.1 protein_id gnl|my_center|LOCUS_4900 822 1454 gene locus_tag LOCUS_4910 822 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 1624 1842 gene locus_tag LOCUS_4920 1624 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 1754 2233 gene locus_tag LOCUS_4930 1754 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 3451 2468 gene locus_tag LOCUS_4940 3451 2468 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_4940 3892 3578 gene locus_tag LOCUS_4950 3892 3578 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015938.1 protein_id gnl|my_center|LOCUS_4950 4097 4807 gene locus_tag LOCUS_4960 4097 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 4904 5557 gene locus_tag LOCUS_4970 4904 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 5631 6203 gene locus_tag LOCUS_4980 5631 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 >Feature sequence052 4937 4611 gene locus_tag LOCUS_4990 4937 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 5984 5028 gene locus_tag LOCUS_5000 5984 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5000 >Feature sequence053 238 543 gene locus_tag LOCUS_5010 238 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 653 1450 gene locus_tag LOCUS_5020 gene soj 653 1450 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_5020 1471 2364 gene locus_tag LOCUS_5030 1471 2364 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_5030 2417 3229 gene locus_tag LOCUS_5040 2417 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 3303 4112 gene locus_tag LOCUS_5050 3303 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5050 4833 5195 gene locus_tag LOCUS_5060 4833 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 5876 5559 gene locus_tag LOCUS_5070 gene rpsJ 5876 5559 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948644.1 protein_id gnl|my_center|LOCUS_5070 >Feature sequence054 1 372 gene locus_tag LOCUS_5080 1 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 410 1837 gene locus_tag LOCUS_5090 410 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 >Feature sequence055 622 1656 gene locus_tag LOCUS_5100 gene pheS 622 1656 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164219.1 protein_id gnl|my_center|LOCUS_5100 1653 4190 gene locus_tag LOCUS_5110 gene pheT 1653 4190 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_5110 4205 4819 gene locus_tag LOCUS_5120 4205 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 5834 4812 gene locus_tag LOCUS_5130 5834 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5130 >Feature sequence056 1847 1161 gene locus_tag LOCUS_5140 1847 1161 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905527.1 protein_id gnl|my_center|LOCUS_5140 2412 2023 gene locus_tag LOCUS_5150 2412 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 2674 2600 gene locus_tag LOCUS_t0290 2674 2600 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3839 2733 gene locus_tag LOCUS_5160 gene dnaJ 3839 2733 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048002.1 protein_id gnl|my_center|LOCUS_5160 5013 3880 gene locus_tag LOCUS_5170 5013 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 <5725 5098 gene locus_tag LOCUS_5180 <5725 5098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005065061.1:molecular chaperone DnaK >Feature sequence057 47 2065 gene locus_tag LOCUS_5190 47 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 2136 2762 gene locus_tag LOCUS_5200 2136 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 2766 3482 gene locus_tag LOCUS_5210 2766 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 3967 3479 gene locus_tag LOCUS_5220 3967 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 4081 4701 gene locus_tag LOCUS_5230 4081 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 >Feature sequence058 2473 161 gene locus_tag LOCUS_5240 gene topA 2473 161 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_5240 2908 2549 gene locus_tag LOCUS_5250 2908 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 3902 3024 gene locus_tag LOCUS_5260 3902 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5260 5453 4254 gene locus_tag LOCUS_5270 5453 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 >Feature sequence059 <1 1168 gene locus_tag LOCUS_5280 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:YifB family Mg chelatase-like AAA ATPase 1293 1367 gene locus_tag LOCUS_t0300 1293 1367 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1485 1940 gene locus_tag LOCUS_5290 1485 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5290 1909 2103 gene locus_tag LOCUS_5300 gene rpmI 1909 2103 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227847.1 protein_id gnl|my_center|LOCUS_5300 2136 2483 gene locus_tag LOCUS_5310 gene rplT 2136 2483 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124850.1 protein_id gnl|my_center|LOCUS_5310 3315 3031 gene locus_tag LOCUS_5320 3315 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 >Feature sequence060 595 296 gene locus_tag LOCUS_5330 595 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 1012 599 gene locus_tag LOCUS_5340 gene rplP 1012 599 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393930.1 protein_id gnl|my_center|LOCUS_5340 1645 1013 gene locus_tag LOCUS_5350 gene rpsC 1645 1013 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701310.1 protein_id gnl|my_center|LOCUS_5350 2070 1645 gene locus_tag LOCUS_5360 gene rplV 2070 1645 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183025.1 protein_id gnl|my_center|LOCUS_5360 2330 2067 gene locus_tag LOCUS_5370 gene rpsS 2330 2067 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006583236.1 protein_id gnl|my_center|LOCUS_5370 3179 2331 gene locus_tag LOCUS_5380 gene rplB 3179 2331 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938601.1 protein_id gnl|my_center|LOCUS_5380 3487 3179 gene locus_tag LOCUS_5390 gene rplW 3487 3179 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037421480.1 protein_id gnl|my_center|LOCUS_5390 4086 3487 gene locus_tag LOCUS_5400 gene rplD 4086 3487 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_5400 4724 4086 gene locus_tag LOCUS_5410 gene rplC 4724 4086 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854292.1 protein_id gnl|my_center|LOCUS_5410 5210 4863 gene locus_tag LOCUS_5420 5210 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5420 >Feature sequence061 306 896 gene locus_tag LOCUS_5430 306 896 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973941.1 protein_id gnl|my_center|LOCUS_5430 877 1596 gene locus_tag LOCUS_5440 877 1596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973942.1 protein_id gnl|my_center|LOCUS_5440 1593 3782 gene locus_tag LOCUS_5450 1593 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 3842 4321 gene locus_tag LOCUS_5460 3842 4321 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444179.1 protein_id gnl|my_center|LOCUS_5460 <5287 4352 gene locus_tag LOCUS_5470 <5287 4352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016374.1:type III restriction-modification system endonuclease >Feature sequence062 509 1279 gene locus_tag LOCUS_5480 509 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 1512 2768 gene locus_tag LOCUS_5490 1512 2768 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107170.1 protein_id gnl|my_center|LOCUS_5490 2813 3484 gene locus_tag LOCUS_5500 2813 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 4008 4166 gene locus_tag LOCUS_5510 4008 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 4842 5093 gene locus_tag LOCUS_5520 4842 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 >Feature sequence063 1076 117 gene locus_tag LOCUS_5530 1076 117 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681377.1 protein_id gnl|my_center|LOCUS_5530 1857 1069 gene locus_tag LOCUS_5540 1857 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 2573 1854 gene locus_tag LOCUS_5550 2573 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5550 4447 2573 gene locus_tag LOCUS_5560 4447 2573 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_5560 5073 4462 gene locus_tag LOCUS_5570 5073 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 >Feature sequence064 981 766 gene locus_tag LOCUS_5580 981 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 1672 1250 gene locus_tag LOCUS_5590 gene rpsP 1672 1250 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125510.1 protein_id gnl|my_center|LOCUS_5590 2659 1820 gene locus_tag LOCUS_5600 2659 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 2841 2755 gene locus_tag LOCUS_t0310 2841 2755 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4554 2911 gene locus_tag LOCUS_5610 4554 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 >Feature sequence065 1518 835 gene locus_tag LOCUS_5620 1518 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 2751 1525 gene locus_tag LOCUS_5630 gene tyrS 2751 1525 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816372.1 protein_id gnl|my_center|LOCUS_5630 >Feature sequence066 261 695 gene locus_tag LOCUS_5640 261 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 832 1038 gene locus_tag LOCUS_5650 gene infA 832 1038 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_5650 1198 1584 gene locus_tag LOCUS_5660 gene rpsM 1198 1584 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_5660 1614 2033 gene locus_tag LOCUS_5670 gene rpsK 1614 2033 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583369.1 protein_id gnl|my_center|LOCUS_5670 2035 2652 gene locus_tag LOCUS_5680 gene rpsD 2035 2652 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173699.1 protein_id gnl|my_center|LOCUS_5680 2663 3586 gene locus_tag LOCUS_5690 2663 3586 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393908.1 protein_id gnl|my_center|LOCUS_5690 3592 4038 gene locus_tag LOCUS_5700 gene rplQ 3592 4038 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531439.1 protein_id gnl|my_center|LOCUS_5700 4038 4466 gene locus_tag LOCUS_5710 gene rplM 4038 4466 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_5710 >Feature sequence067 1387 506 gene locus_tag LOCUS_5720 1387 506 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116510.1 protein_id gnl|my_center|LOCUS_5720 1792 1547 gene locus_tag LOCUS_5730 1792 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 2337 1843 gene locus_tag LOCUS_5740 2337 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 3135 2908 gene locus_tag LOCUS_5750 3135 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 3477 3283 gene locus_tag LOCUS_5760 3477 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 3851 3522 gene locus_tag LOCUS_5770 3851 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5770 4180 3872 gene locus_tag LOCUS_5780 4180 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5780 >Feature sequence068 756 490 gene locus_tag LOCUS_5790 756 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 1239 769 gene locus_tag LOCUS_5800 gene nrdR 1239 769 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894570.1 protein_id gnl|my_center|LOCUS_5800 2609 1260 gene locus_tag LOCUS_5810 2609 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5810 3951 2689 gene locus_tag LOCUS_5820 gene ftsA 3951 2689 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003364017.1 protein_id gnl|my_center|LOCUS_5820 >Feature sequence069 2468 2034 gene locus_tag LOCUS_5830 2468 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 2946 2593 gene locus_tag LOCUS_5840 2946 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5840 >Feature sequence070 1617 1042 gene locus_tag LOCUS_5850 gene pth 1617 1042 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814896.1 protein_id gnl|my_center|LOCUS_5850 1665 1904 gene locus_tag LOCUS_5860 1665 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 2075 1999 gene locus_tag LOCUS_t0320 2075 1999 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2199 2124 gene locus_tag LOCUS_t0330 2199 2124 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2876 2292 gene locus_tag LOCUS_5870 2876 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 3246 3004 gene locus_tag LOCUS_5880 3246 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5880 >Feature sequence071 3391 2903 gene locus_tag LOCUS_5890 3391 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 3604 3410 gene locus_tag LOCUS_5900 3604 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 >Feature sequence072 3374 519 gene locus_tag LOCUS_5910 3374 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 >Feature sequence073 48 803 gene locus_tag LOCUS_5920 48 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5920 800 1651 gene locus_tag LOCUS_5930 800 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5930 1651 2130 gene locus_tag LOCUS_5940 1651 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 2120 3130 gene locus_tag LOCUS_5950 2120 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 >Feature sequence074 219 143 gene locus_tag LOCUS_t0340 219 143 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 261 1076 gene locus_tag LOCUS_5960 261 1076 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547942.1 protein_id gnl|my_center|LOCUS_5960 1132 2472 gene locus_tag LOCUS_5970 1132 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 2513 2587 gene locus_tag LOCUS_t0350 2513 2587 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2695 2916 gene locus_tag LOCUS_5980 2695 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 2928 3317 gene locus_tag LOCUS_5990 2928 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 >Feature sequence075 1321 1246 gene locus_tag LOCUS_t0360 1321 1246 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1472 1395 gene locus_tag LOCUS_t0370 1472 1395 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1543 1619 gene locus_tag LOCUS_t0380 1543 1619 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1639 1712 gene locus_tag LOCUS_t0390 1639 1712 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1726 2106 gene locus_tag LOCUS_6000 1726 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 >Feature sequence076 1879 827 gene locus_tag LOCUS_6010 1879 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 <3478 1960 gene locus_tag LOCUS_6020 <3478 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393948.1:50S ribosomal protein L1 >Feature sequence077 100 600 gene locus_tag LOCUS_6030 100 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 1011 2279 gene locus_tag LOCUS_6040 1011 2279 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_6040 <3328 2396 gene locus_tag LOCUS_6050 <3328 2396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003699919.1:translation elongation factor 4 >Feature sequence078 124 197 gene locus_tag LOCUS_t0400 124 197 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 203 289 gene locus_tag LOCUS_t0410 203 289 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 797 291 gene locus_tag LOCUS_6060 797 291 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_6060 909 1475 gene locus_tag LOCUS_6070 909 1475 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085281.1 protein_id gnl|my_center|LOCUS_6070 1497 2378 gene locus_tag LOCUS_6080 gene htpX 1497 2378 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262126.1 protein_id gnl|my_center|LOCUS_6080 >Feature sequence079 1419 88 gene locus_tag LOCUS_6090 1419 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 1693 2781 gene locus_tag LOCUS_6100 1693 2781 CDS product IS5-like element IS903B family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012579081.1 protein_id gnl|my_center|LOCUS_6100 >Feature sequence080 <1 768 gene locus_tag LOCUS_6110 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229611.1:trigger factor 1371 781 gene locus_tag LOCUS_6120 gene clpP 1371 781 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_6120 1509 2303 gene locus_tag LOCUS_6130 1509 2303 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420070.1 protein_id gnl|my_center|LOCUS_6130 2591 3205 gene locus_tag LOCUS_6140 2591 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 >Feature sequence081 2928 463 gene locus_tag LOCUS_6150 gene leuS 2928 463 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583912.1 protein_id gnl|my_center|LOCUS_6150 >Feature sequence082 1620 1231 gene locus_tag LOCUS_6160 1620 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 1672 2709 gene locus_tag LOCUS_6170 gene recA 1672 2709 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504720.1 protein_id gnl|my_center|LOCUS_6170 >Feature sequence083 1101 1457 gene locus_tag LOCUS_6180 1101 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6180 >Feature sequence084 641 1738 gene locus_tag LOCUS_6190 641 1738 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728563.1 protein_id gnl|my_center|LOCUS_6190 >Feature sequence085 663 1052 gene locus_tag LOCUS_6200 663 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 1422 2348 gene locus_tag LOCUS_6210 1422 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6210 2497 2727 gene locus_tag LOCUS_6220 2497 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 >Feature sequence086 219 632 gene locus_tag LOCUS_6230 gene rpsL 219 632 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_6230 632 1111 gene locus_tag LOCUS_6240 gene rpsG 632 1111 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258227.1 protein_id gnl|my_center|LOCUS_6240 >Feature sequence087 1457 222 gene locus_tag LOCUS_6250 1457 222 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_6250 1559 2617 gene locus_tag LOCUS_6260 gene tsaD 1559 2617 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_6260 >Feature sequence088 319 831 gene locus_tag LOCUS_6270 319 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 893 968 gene locus_tag LOCUS_t0420 893 968 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1101 1610 gene locus_tag LOCUS_6280 1101 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 1610 2719 gene locus_tag LOCUS_6290 1610 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 >Feature sequence089 2284 959 gene locus_tag LOCUS_6300 2284 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 >Feature sequence090 783 1439 gene locus_tag LOCUS_6310 gene rr06 783 1439 CDS product two-component system response regulator RR06 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001024075.1 protein_id gnl|my_center|LOCUS_6310 >Feature sequence091 166 1554 gene locus_tag LOCUS_6320 gene argH 166 1554 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_6320 1668 2729 gene locus_tag LOCUS_6330 1668 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 >Feature sequence092 <1 1522 gene locus_tag LOCUS_6340 <1 1522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120701253.1:ATP-dependent DNA helicase 1509 2504 gene locus_tag LOCUS_6350 1509 2504 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287490.1 protein_id gnl|my_center|LOCUS_6350 >Feature sequence093 92 1642 gene locus_tag LOCUS_6360 gene metG 92 1642 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_6360 1710 2471 gene locus_tag LOCUS_6370 1710 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6370 >Feature sequence094 816 139 gene locus_tag LOCUS_6380 gene trmB 816 139 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_6380 1685 816 gene locus_tag LOCUS_6390 1685 816 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832526.1 protein_id gnl|my_center|LOCUS_6390 2314 1709 gene locus_tag LOCUS_6400 2314 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 >Feature sequence095 1369 407 gene locus_tag LOCUS_6410 1369 407 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724106.1 protein_id gnl|my_center|LOCUS_6410 2399 1392 gene locus_tag LOCUS_6420 2399 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 >Feature sequence096 349 1431 gene locus_tag LOCUS_6430 gene prfA 349 1431 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_6430 1409 2269 gene locus_tag LOCUS_6440 gene prmC 1409 2269 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927443.1 protein_id gnl|my_center|LOCUS_6440 >Feature sequence097 <1 1415 gene locus_tag LOCUS_6450 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228405.1:DNA polymerase I 1674 1922 gene locus_tag LOCUS_6460 1674 1922 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262990.1 protein_id gnl|my_center|LOCUS_6460 1922 2248 gene locus_tag LOCUS_6470 1922 2248 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262989.1 protein_id gnl|my_center|LOCUS_6470 >Feature sequence098 76 348 gene locus_tag LOCUS_6480 76 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 554 739 gene locus_tag LOCUS_6490 554 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6490 2100 826 gene locus_tag LOCUS_6500 2100 826 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054687.1 protein_id gnl|my_center|LOCUS_6500 >Feature sequence099 124 672 gene locus_tag LOCUS_6510 124 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6510 732 2066 gene locus_tag LOCUS_6520 732 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 >Feature sequence100 40 363 gene locus_tag LOCUS_6530 40 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 449 1807 gene locus_tag LOCUS_6540 449 1807 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479959.1 protein_id gnl|my_center|LOCUS_6540 >Feature sequence101 <1 706 gene locus_tag LOCUS_6550 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256170.1:ATP-dependent DNA helicase RecG 719 1285 gene locus_tag LOCUS_6560 719 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 <1921 1381 gene locus_tag LOCUS_6570 <1921 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705177.1:ABC transporter permease >Feature sequence102 1376 780 gene locus_tag LOCUS_6580 1376 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 1910 1476 gene locus_tag LOCUS_6590 1910 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 >Feature sequence103 >Feature sequence104 564 956 gene locus_tag LOCUS_6600 564 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 958 1644 gene locus_tag LOCUS_6610 958 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 >Feature sequence105 >Feature sequence106 987 454 gene locus_tag LOCUS_6620 987 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 >Feature sequence107 946 311 gene locus_tag LOCUS_6630 946 311 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263264.1 protein_id gnl|my_center|LOCUS_6630 <1677 949 gene locus_tag LOCUS_6640 <1677 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003130508.1:HAD-IIB family hydrolase >Feature sequence108 1169 72 gene locus_tag LOCUS_6650 1169 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 >Feature sequence109 >Feature sequence110 1237 899 gene locus_tag LOCUS_6660 1237 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 >Feature sequence111 >Feature sequence112 477 932 gene locus_tag LOCUS_6670 477 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6670 1260 1006 gene locus_tag LOCUS_6680 1260 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 >Feature sequence113 >Feature sequence114 >Feature sequence115 <1 922 gene locus_tag LOCUS_6690 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222811.1:histidine--tRNA ligase >Feature sequence116 >Feature sequence117 701 78 gene locus_tag LOCUS_6700 701 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_6700 1291 953 gene locus_tag LOCUS_6710 1291 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_6710 >Feature sequence118 >Feature sequence119 298 222 gene locus_tag LOCUS_t0430 298 222 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 402 326 gene locus_tag LOCUS_t0440 402 326 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence120 >Feature sequence121 >Feature sequence122 215 901 gene locus_tag LOCUS_6720 215 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6720 >Feature sequence123 <1148 556 gene locus_tag LOCUS_6730 <1148 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582519.1:ABC transporter ATP-binding protein >Feature sequence124 >Feature sequence125 962 69 gene locus_tag LOCUS_6740 962 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6740 >Feature sequence126 >Feature sequence127 >Feature sequence128 >Feature sequence129 320 820 gene locus_tag LOCUS_6750 gene grpE 320 820 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257941.1 protein_id gnl|my_center|LOCUS_6750