>Feature sequence01 1667 141 gene locus_tag LOCUS_00010 gene ctaD 1667 141 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140742.1 protein_id gnl|my_center|LOCUS_00010 2148 1717 gene locus_tag LOCUS_00020 2148 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2411 2151 gene locus_tag LOCUS_00030 2411 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3091 2468 gene locus_tag LOCUS_00040 3091 2468 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846725.1 protein_id gnl|my_center|LOCUS_00040 3143 3814 gene locus_tag LOCUS_00050 gene npdG 3143 3814 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_00050 3833 4066 gene locus_tag LOCUS_00060 3833 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4050 4451 gene locus_tag LOCUS_00070 4050 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5620 4448 gene locus_tag LOCUS_00080 5620 4448 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_00080 5665 5739 gene locus_tag LOCUS_t00010 5665 5739 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5766 6272 gene locus_tag LOCUS_00090 5766 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6829 6236 gene locus_tag LOCUS_00100 6829 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6948 7187 gene locus_tag LOCUS_00110 6948 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7234 7617 gene locus_tag LOCUS_00120 7234 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979704.1 protein_id gnl|my_center|LOCUS_00120 7614 8297 gene locus_tag LOCUS_00130 7614 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 8720 8307 gene locus_tag LOCUS_00140 8720 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 9259 8771 gene locus_tag LOCUS_00150 9259 8771 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_00150 10646 9315 gene locus_tag LOCUS_00160 10646 9315 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_00160 10980 10639 gene locus_tag LOCUS_00170 10980 10639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 11500 11012 gene locus_tag LOCUS_00180 11500 11012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 12604 12269 gene locus_tag LOCUS_00190 12604 12269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 13018 12677 gene locus_tag LOCUS_00200 13018 12677 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_00200 13488 13015 gene locus_tag LOCUS_00210 13488 13015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_00210 13578 14624 gene locus_tag LOCUS_00220 13578 14624 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_00220 14634 15764 gene locus_tag LOCUS_00230 gene hflX 14634 15764 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868200.1 protein_id gnl|my_center|LOCUS_00230 15745 16278 gene locus_tag LOCUS_00240 15745 16278 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_00240 16305 16820 gene locus_tag LOCUS_00250 gene tfe 16305 16820 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868546.1 protein_id gnl|my_center|LOCUS_00250 17141 16860 gene locus_tag LOCUS_00260 17141 16860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 17701 17144 gene locus_tag LOCUS_00270 17701 17144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 18035 17793 gene locus_tag LOCUS_00280 18035 17793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 18727 18071 gene locus_tag LOCUS_00290 18727 18071 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_00290 19907 18714 gene locus_tag LOCUS_00300 19907 18714 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_00300 20650 19904 gene locus_tag LOCUS_00310 20650 19904 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_00310 21063 20650 gene locus_tag LOCUS_00320 gene ribH 21063 20650 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846879.1 protein_id gnl|my_center|LOCUS_00320 21731 21066 gene locus_tag LOCUS_00330 gene ribB 21731 21066 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_00330 22394 21804 gene locus_tag LOCUS_00340 22394 21804 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493859.1 protein_id gnl|my_center|LOCUS_00340 23156 22452 gene locus_tag LOCUS_00350 23156 22452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 24015 23161 gene locus_tag LOCUS_00360 24015 23161 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870112.1 protein_id gnl|my_center|LOCUS_00360 25102 24023 gene locus_tag LOCUS_00370 25102 24023 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_00370 25428 25144 gene locus_tag LOCUS_00380 25428 25144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 25887 25435 gene locus_tag LOCUS_00390 25887 25435 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879561.1 protein_id gnl|my_center|LOCUS_00390 25949 26113 gene locus_tag LOCUS_00400 25949 26113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 26454 26122 gene locus_tag LOCUS_00410 26454 26122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 26568 27161 gene locus_tag LOCUS_00420 26568 27161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 28632 27205 gene locus_tag LOCUS_00430 28632 27205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 29006 28635 gene locus_tag LOCUS_00440 29006 28635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 29201 29013 gene locus_tag LOCUS_00450 29201 29013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 29335 30189 gene locus_tag LOCUS_00460 29335 30189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 31531 30182 gene locus_tag LOCUS_00470 31531 30182 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_00470 32038 31598 gene locus_tag LOCUS_00480 32038 31598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 32294 32031 gene locus_tag LOCUS_00490 32294 32031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 32245 32388 gene locus_tag LOCUS_00500 32245 32388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 32621 33475 gene locus_tag LOCUS_00510 32621 33475 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_00510 34358 33675 gene locus_tag LOCUS_00520 34358 33675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 34486 34908 gene locus_tag LOCUS_00530 34486 34908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 35164 35439 gene locus_tag LOCUS_00540 35164 35439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 35452 35727 gene locus_tag LOCUS_00550 35452 35727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 36962 35724 gene locus_tag LOCUS_00560 36962 35724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00560 37229 36981 gene locus_tag LOCUS_00570 37229 36981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00570 37693 37929 gene locus_tag LOCUS_00580 37693 37929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 37972 38166 gene locus_tag LOCUS_00590 37972 38166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 38322 38170 gene locus_tag LOCUS_00600 38322 38170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 38367 38582 gene locus_tag LOCUS_00610 38367 38582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 38629 39177 gene locus_tag LOCUS_00620 38629 39177 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_00620 39186 41741 gene locus_tag LOCUS_00630 39186 41741 CDS product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762568.1 protein_id gnl|my_center|LOCUS_00630 41746 42030 gene locus_tag LOCUS_00640 41746 42030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 42074 42730 gene locus_tag LOCUS_00650 gene tpiA 42074 42730 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_00650 42758 45427 gene locus_tag LOCUS_00660 gene ppdK 42758 45427 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_00660 45465 46022 gene locus_tag LOCUS_00670 45465 46022 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879609.1 protein_id gnl|my_center|LOCUS_00670 46236 46700 gene locus_tag LOCUS_00680 46236 46700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 48689 46965 gene locus_tag LOCUS_00690 48689 46965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 48927 49607 gene locus_tag LOCUS_00700 48927 49607 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_00700 49862 50155 gene locus_tag LOCUS_00710 49862 50155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 50400 50152 gene locus_tag LOCUS_00720 50400 50152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 50887 50504 gene locus_tag LOCUS_00730 50887 50504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 51566 52417 gene locus_tag LOCUS_00740 51566 52417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 52489 52878 gene locus_tag LOCUS_00750 52489 52878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 52880 53374 gene locus_tag LOCUS_00760 52880 53374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 53717 54775 gene locus_tag LOCUS_00770 53717 54775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868869.1 protein_id gnl|my_center|LOCUS_00770 54781 56148 gene locus_tag LOCUS_00780 54781 56148 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868868.1 protein_id gnl|my_center|LOCUS_00780 56469 56149 gene locus_tag LOCUS_00790 56469 56149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 56817 56470 gene locus_tag LOCUS_00800 56817 56470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 57276 56878 gene locus_tag LOCUS_00810 57276 56878 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060934.1 protein_id gnl|my_center|LOCUS_00810 58597 57308 gene locus_tag LOCUS_00820 58597 57308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 58675 59136 gene locus_tag LOCUS_00830 58675 59136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 59190 59501 gene locus_tag LOCUS_00840 59190 59501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 59733 59509 gene locus_tag LOCUS_00850 59733 59509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 60128 59952 gene locus_tag LOCUS_00860 60128 59952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 60379 60170 gene locus_tag LOCUS_00870 60379 60170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 60661 60431 gene locus_tag LOCUS_00880 60661 60431 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_00880 61362 60712 gene locus_tag LOCUS_00890 61362 60712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 61605 61420 gene locus_tag LOCUS_00900 61605 61420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 61729 61646 gene locus_tag LOCUS_t00020 61729 61646 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 62033 61770 gene locus_tag LOCUS_00910 62033 61770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 62150 63172 gene locus_tag LOCUS_00920 gene fen 62150 63172 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_00920 63215 63742 gene locus_tag LOCUS_00930 63215 63742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 65641 63743 gene locus_tag LOCUS_00940 gene acs 65641 63743 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_00940 66568 65696 gene locus_tag LOCUS_00950 66568 65696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 66702 66995 gene locus_tag LOCUS_00960 66702 66995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 67027 68646 gene locus_tag LOCUS_00970 67027 68646 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_00970 68683 69081 gene locus_tag LOCUS_00980 gene msrB 68683 69081 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_00980 70414 69128 gene locus_tag LOCUS_00990 gene pstS 70414 69128 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_00990 71969 70947 gene locus_tag LOCUS_01000 71969 70947 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_01000 72039 73076 gene locus_tag LOCUS_01010 gene pstC 72039 73076 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656744.1 protein_id gnl|my_center|LOCUS_01010 73073 73999 gene locus_tag LOCUS_01020 gene pstA 73073 73999 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_01020 73996 74832 gene locus_tag LOCUS_01030 gene pstB 73996 74832 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868848.1 protein_id gnl|my_center|LOCUS_01030 74832 75494 gene locus_tag LOCUS_01040 74832 75494 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763249.1 protein_id gnl|my_center|LOCUS_01040 75642 76652 gene locus_tag LOCUS_01050 75642 76652 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_01050 76649 77125 gene locus_tag LOCUS_01060 76649 77125 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023779.1 protein_id gnl|my_center|LOCUS_01060 77730 77134 gene locus_tag LOCUS_01070 gene psmB 77730 77134 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_01070 77892 78311 gene locus_tag LOCUS_01080 77892 78311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 79660 78308 gene locus_tag LOCUS_01090 79660 78308 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_01090 80529 79666 gene locus_tag LOCUS_01100 80529 79666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 81445 80591 gene locus_tag LOCUS_01110 81445 80591 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080966.1 protein_id gnl|my_center|LOCUS_01110 81819 81583 gene locus_tag LOCUS_01120 81819 81583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 82781 82035 gene locus_tag LOCUS_01130 82781 82035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 82851 83171 gene locus_tag LOCUS_01140 82851 83171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 83440 83952 gene locus_tag LOCUS_01150 83440 83952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 84152 84451 gene locus_tag LOCUS_01160 84152 84451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 84616 84461 gene locus_tag LOCUS_01170 84616 84461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 85063 84662 gene locus_tag LOCUS_01180 85063 84662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 85519 85139 gene locus_tag LOCUS_01190 85519 85139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 85658 86212 gene locus_tag LOCUS_01200 85658 86212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 86234 87580 gene locus_tag LOCUS_01210 86234 87580 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_01210 87648 88199 gene locus_tag LOCUS_01220 87648 88199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 89888 88239 gene locus_tag LOCUS_01230 89888 88239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 88725 88861 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttcaattatttcttcagttg 90410 90213 gene locus_tag LOCUS_01240 90410 90213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 90853 90659 gene locus_tag LOCUS_01250 90853 90659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 92844 90958 gene locus_tag LOCUS_01260 92844 90958 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_01260 93541 92846 gene locus_tag LOCUS_01270 93541 92846 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_01270 93710 94267 gene locus_tag LOCUS_01280 93710 94267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 95339 94260 gene locus_tag LOCUS_01290 95339 94260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 95856 95365 gene locus_tag LOCUS_01300 95856 95365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 96099 97214 gene locus_tag LOCUS_01310 96099 97214 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_01310 97462 97617 gene locus_tag LOCUS_01320 97462 97617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 98581 98801 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctttgtcaccagttgtaccttt 99370 100494 gene locus_tag LOCUS_01330 99370 100494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 101293 100496 gene locus_tag LOCUS_01340 101293 100496 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_01340 103098 101290 gene locus_tag LOCUS_01350 103098 101290 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_01350 103269 104087 gene locus_tag LOCUS_01360 103269 104087 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_01360 104113 104889 gene locus_tag LOCUS_01370 104113 104889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 104935 105933 gene locus_tag LOCUS_01380 gene trxB 104935 105933 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_01380 105920 106153 gene locus_tag LOCUS_01390 105920 106153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 106176 106649 gene locus_tag LOCUS_01400 106176 106649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 106891 106655 gene locus_tag LOCUS_01410 106891 106655 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877700.1 protein_id gnl|my_center|LOCUS_01410 107720 106995 gene locus_tag LOCUS_01420 gene cofE 107720 106995 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_01420 108399 107755 gene locus_tag LOCUS_01430 108399 107755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 108545 108835 gene locus_tag LOCUS_01440 108545 108835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 108897 110339 gene locus_tag LOCUS_01450 gene proS 108897 110339 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_01450 110388 111698 gene locus_tag LOCUS_01460 gene egtB 110388 111698 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_01460 112717 111695 gene locus_tag LOCUS_01470 gene egtD 112717 111695 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 protein_id gnl|my_center|LOCUS_01470 112811 113776 gene locus_tag LOCUS_01480 112811 113776 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677558.1 protein_id gnl|my_center|LOCUS_01480 117297 113773 gene locus_tag LOCUS_01490 gene smc 117297 113773 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871167.1 protein_id gnl|my_center|LOCUS_01490 118566 117472 gene locus_tag LOCUS_01500 118566 117472 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_01500 118651 119367 gene locus_tag LOCUS_01510 118651 119367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 119460 120023 gene locus_tag LOCUS_01520 119460 120023 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_01520 120530 120072 gene locus_tag LOCUS_01530 120530 120072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 120818 120570 gene locus_tag LOCUS_01540 120818 120570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 120945 121817 gene locus_tag LOCUS_01550 120945 121817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 121942 123033 gene locus_tag LOCUS_01560 gene dinB 121942 123033 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066563.1 protein_id gnl|my_center|LOCUS_01560 123976 123044 gene locus_tag LOCUS_01570 123976 123044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 124697 124218 gene locus_tag LOCUS_01580 124697 124218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 125363 124698 gene locus_tag LOCUS_01590 125363 124698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 125592 125395 gene locus_tag LOCUS_01600 125592 125395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 126018 125647 gene locus_tag LOCUS_01610 126018 125647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 126102 126488 gene locus_tag LOCUS_01620 126102 126488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 126516 127394 gene locus_tag LOCUS_01630 126516 127394 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020663.1 protein_id gnl|my_center|LOCUS_01630 127607 127816 gene locus_tag LOCUS_01640 127607 127816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 127869 129080 gene locus_tag LOCUS_01650 127869 129080 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_01650 129201 131390 gene locus_tag LOCUS_01660 129201 131390 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871078.1 protein_id gnl|my_center|LOCUS_01660 131529 132158 gene locus_tag LOCUS_01670 131529 132158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 133825 132521 gene locus_tag LOCUS_01680 133825 132521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148703624.1 protein_id gnl|my_center|LOCUS_01680 133961 134881 gene locus_tag LOCUS_01690 gene cofD 133961 134881 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_01690 134883 135515 gene locus_tag LOCUS_01700 134883 135515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 136487 135507 gene locus_tag LOCUS_01710 136487 135507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 136803 136495 gene locus_tag LOCUS_01720 gene yciH 136803 136495 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_01720 136904 137224 gene locus_tag LOCUS_01730 136904 137224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 137263 137424 gene locus_tag LOCUS_01740 137263 137424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 137432 139180 gene locus_tag LOCUS_01750 137432 139180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 139799 139164 gene locus_tag LOCUS_01760 139799 139164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 139898 142363 gene locus_tag LOCUS_01770 139898 142363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 142839 142348 gene locus_tag LOCUS_01780 142839 142348 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_01780 144841 142874 gene locus_tag LOCUS_01790 144841 142874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 145224 144979 gene locus_tag LOCUS_01800 145224 144979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 145448 145372 gene locus_tag LOCUS_t00030 145448 145372 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 145521 146420 gene locus_tag LOCUS_01810 gene map 145521 146420 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_01810 147082 146525 gene locus_tag LOCUS_01820 147082 146525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 147332 147150 gene locus_tag LOCUS_01830 147332 147150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 148411 147329 gene locus_tag LOCUS_01840 148411 147329 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_01840 >Feature sequence02 500 1888 gene locus_tag LOCUS_01850 gene cysS 500 1888 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546384.1 protein_id gnl|my_center|LOCUS_01850 1978 2256 gene locus_tag LOCUS_01860 1978 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 3317 2394 gene locus_tag LOCUS_01870 3317 2394 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_01870 3419 4576 gene locus_tag LOCUS_01880 3419 4576 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867549.1 protein_id gnl|my_center|LOCUS_01880 5193 4606 gene locus_tag LOCUS_01890 5193 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 5646 5278 gene locus_tag LOCUS_01900 5646 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 6056 5643 gene locus_tag LOCUS_01910 6056 5643 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_01910 6152 7060 gene locus_tag LOCUS_01920 6152 7060 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202474.1 protein_id gnl|my_center|LOCUS_01920 7104 7631 gene locus_tag LOCUS_01930 7104 7631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 7668 8669 gene locus_tag LOCUS_01940 7668 8669 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_01940 9054 8671 gene locus_tag LOCUS_01950 9054 8671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 9167 10603 gene locus_tag LOCUS_01960 9167 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 11061 10657 gene locus_tag LOCUS_01970 11061 10657 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978531.1 protein_id gnl|my_center|LOCUS_01970 11493 11101 gene locus_tag LOCUS_01980 11493 11101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 11544 12143 gene locus_tag LOCUS_01990 11544 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 12133 13197 gene locus_tag LOCUS_02000 12133 13197 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_02000 13645 13220 gene locus_tag LOCUS_02010 13645 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 14067 13642 gene locus_tag LOCUS_02020 14067 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 14895 14104 gene locus_tag LOCUS_02030 14895 14104 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919263.1 protein_id gnl|my_center|LOCUS_02030 15017 15286 gene locus_tag LOCUS_02040 15017 15286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 15914 15462 gene locus_tag LOCUS_02050 gene msrA 15914 15462 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_02050 16349 15966 gene locus_tag LOCUS_02060 16349 15966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 17261 16410 gene locus_tag LOCUS_02070 17261 16410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 17364 17834 gene locus_tag LOCUS_02080 17364 17834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 21024 18058 gene locus_tag LOCUS_r00010 21024 18058 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 22656 21192 gene locus_tag LOCUS_r00020 22656 21192 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 23042 24331 gene locus_tag LOCUS_02090 gene hemL 23042 24331 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878736.1 protein_id gnl|my_center|LOCUS_02090 24698 24342 gene locus_tag LOCUS_02100 24698 24342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 24783 25616 gene locus_tag LOCUS_02110 24783 25616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 25678 26133 gene locus_tag LOCUS_02120 25678 26133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 26139 26501 gene locus_tag LOCUS_02130 26139 26501 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496878.1 protein_id gnl|my_center|LOCUS_02130 26553 27221 gene locus_tag LOCUS_02140 26553 27221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 27625 27218 gene locus_tag LOCUS_02150 27625 27218 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_02150 27941 27663 gene locus_tag LOCUS_02160 27941 27663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 28110 27943 gene locus_tag LOCUS_02170 28110 27943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 28166 29305 gene locus_tag LOCUS_02180 28166 29305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 29804 29295 gene locus_tag LOCUS_02190 29804 29295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 30111 30530 gene locus_tag LOCUS_02200 30111 30530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 30533 30730 gene locus_tag LOCUS_02210 30533 30730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 30925 30731 gene locus_tag LOCUS_02220 30925 30731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 31273 30965 gene locus_tag LOCUS_02230 gene rpsJ 31273 30965 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_02230 32581 31283 gene locus_tag LOCUS_02240 gene tuf 32581 31283 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_02240 32713 33849 gene locus_tag LOCUS_02250 gene fbp 32713 33849 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_02250 33915 34325 gene locus_tag LOCUS_02260 33915 34325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 34363 36132 gene locus_tag LOCUS_02270 34363 36132 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930711.1 protein_id gnl|my_center|LOCUS_02270 36181 36849 gene locus_tag LOCUS_02280 36181 36849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 36942 37478 gene locus_tag LOCUS_02290 gene endA 36942 37478 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_02290 37852 37475 gene locus_tag LOCUS_02300 37852 37475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 38091 37855 gene locus_tag LOCUS_02310 38091 37855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 38185 39957 gene locus_tag LOCUS_02320 38185 39957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 39960 40400 gene locus_tag LOCUS_02330 39960 40400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 41297 40524 gene locus_tag LOCUS_02340 41297 40524 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_02340 41967 41338 gene locus_tag LOCUS_02350 41967 41338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 42503 42009 gene locus_tag LOCUS_02360 42503 42009 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082186.1 protein_id gnl|my_center|LOCUS_02360 42889 42542 gene locus_tag LOCUS_02370 42889 42542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 43022 43495 gene locus_tag LOCUS_02380 gene mntR 43022 43495 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003725831.1 protein_id gnl|my_center|LOCUS_02380 45324 43501 gene locus_tag LOCUS_02390 45324 43501 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496860.1 protein_id gnl|my_center|LOCUS_02390 45622 47037 gene locus_tag LOCUS_02400 45622 47037 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_02400 47039 47632 gene locus_tag LOCUS_02410 gene udg 47039 47632 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_02410 48323 47670 gene locus_tag LOCUS_02420 48323 47670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 48411 48911 gene locus_tag LOCUS_02430 48411 48911 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 protein_id gnl|my_center|LOCUS_02430 48989 49369 gene locus_tag LOCUS_02440 48989 49369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 50521 49583 gene locus_tag LOCUS_02450 50521 49583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_02450 50814 52100 gene locus_tag LOCUS_02460 gene aspS 50814 52100 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978146.1 protein_id gnl|my_center|LOCUS_02460 52363 52130 gene locus_tag LOCUS_02470 52363 52130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 52456 52758 gene locus_tag LOCUS_02480 52456 52758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 53356 53601 gene locus_tag LOCUS_02490 53356 53601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 54829 53816 gene locus_tag LOCUS_02500 gene leuB 54829 53816 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978405.1 protein_id gnl|my_center|LOCUS_02500 56366 54852 gene locus_tag LOCUS_02510 56366 54852 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870707.1 protein_id gnl|my_center|LOCUS_02510 56845 56363 gene locus_tag LOCUS_02520 gene ilvN 56845 56363 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_02520 58533 56854 gene locus_tag LOCUS_02530 gene ilvB 58533 56854 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146975.1 protein_id gnl|my_center|LOCUS_02530 59590 58727 gene locus_tag LOCUS_02540 59590 58727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 59760 60320 gene locus_tag LOCUS_02550 59760 60320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 60592 60317 gene locus_tag LOCUS_02560 60592 60317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 60761 61165 gene locus_tag LOCUS_02570 60761 61165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 62231 61176 gene locus_tag LOCUS_02580 62231 61176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 63305 62277 gene locus_tag LOCUS_02590 63305 62277 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_02590 63689 63396 gene locus_tag LOCUS_02600 63689 63396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 63778 64074 gene locus_tag LOCUS_02610 63778 64074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 64330 64079 gene locus_tag LOCUS_02620 64330 64079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 64681 64379 gene locus_tag LOCUS_02630 64681 64379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 68008 64766 gene locus_tag LOCUS_02640 gene carB 68008 64766 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788239.1 protein_id gnl|my_center|LOCUS_02640 69023 67995 gene locus_tag LOCUS_02650 gene carA 69023 67995 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979553.1 protein_id gnl|my_center|LOCUS_02650 70437 69244 gene locus_tag LOCUS_02660 gene cdvC 70437 69244 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_02660 70931 70434 gene locus_tag LOCUS_02670 70931 70434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 71497 70934 gene locus_tag LOCUS_02680 71497 70934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 71655 72815 gene locus_tag LOCUS_02690 71655 72815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 72839 73297 gene locus_tag LOCUS_02700 72839 73297 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 protein_id gnl|my_center|LOCUS_02700 74402 73311 gene locus_tag LOCUS_02710 74402 73311 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065440.1 protein_id gnl|my_center|LOCUS_02710 74664 74449 gene locus_tag LOCUS_02720 74664 74449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 74757 75920 gene locus_tag LOCUS_02730 74757 75920 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_02730 76145 75924 gene locus_tag LOCUS_02740 76145 75924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 76863 77432 gene locus_tag LOCUS_02750 76863 77432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 79038 77452 gene locus_tag LOCUS_02760 gene uvrC 79038 77452 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_02760 81853 79028 gene locus_tag LOCUS_02770 gene uvrA 81853 79028 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_02770 83792 81843 gene locus_tag LOCUS_02780 gene uvrB 83792 81843 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_02780 84480 83848 gene locus_tag LOCUS_02790 84480 83848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 84569 84793 gene locus_tag LOCUS_02800 84569 84793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 85000 85419 gene locus_tag LOCUS_02810 85000 85419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 85643 85416 gene locus_tag LOCUS_02820 85643 85416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 86803 85694 gene locus_tag LOCUS_02830 86803 85694 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_02830 87842 86898 gene locus_tag LOCUS_02840 87842 86898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 87894 89171 gene locus_tag LOCUS_02850 87894 89171 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_02850 89607 89308 gene locus_tag LOCUS_02860 89607 89308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 90106 89669 gene locus_tag LOCUS_02870 90106 89669 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_02870 90264 90503 gene locus_tag LOCUS_02880 90264 90503 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_02880 90779 90958 gene locus_tag LOCUS_02890 90779 90958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 91069 91305 gene locus_tag LOCUS_02900 91069 91305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 92333 91425 gene locus_tag LOCUS_02910 92333 91425 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992240.1 protein_id gnl|my_center|LOCUS_02910 92500 93075 gene locus_tag LOCUS_02920 gene purN 92500 93075 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942403.1 protein_id gnl|my_center|LOCUS_02920 93404 93072 gene locus_tag LOCUS_02930 93404 93072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 93678 93394 gene locus_tag LOCUS_02940 93678 93394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 93771 94637 gene locus_tag LOCUS_02950 gene folD 93771 94637 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_02950 94624 95187 gene locus_tag LOCUS_02960 94624 95187 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000164546.1 protein_id gnl|my_center|LOCUS_02960 96452 95172 gene locus_tag LOCUS_02970 gene purD 96452 95172 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_02970 96533 99730 gene locus_tag LOCUS_02980 gene ileS 96533 99730 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_02980 99776 100360 gene locus_tag LOCUS_02990 gene dps 99776 100360 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144276.1 protein_id gnl|my_center|LOCUS_02990 100472 100801 gene locus_tag LOCUS_03000 100472 100801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 100842 101948 gene locus_tag LOCUS_03010 gene sucC 100842 101948 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887890.1 protein_id gnl|my_center|LOCUS_03010 101945 102856 gene locus_tag LOCUS_03020 gene sucD 101945 102856 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_03020 103275 103063 gene locus_tag LOCUS_03030 103275 103063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 103406 103501 gene locus_tag LOCUS_t00040 103406 103501 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 103572 104237 gene locus_tag LOCUS_03040 103572 104237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 104304 104732 gene locus_tag LOCUS_03050 104304 104732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 104812 105351 gene locus_tag LOCUS_03060 104812 105351 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_03060 105443 105586 gene locus_tag LOCUS_03070 105443 105586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 105732 106259 gene locus_tag LOCUS_03080 105732 106259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 106342 108117 gene locus_tag LOCUS_03090 106342 108117 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_03090 108621 108154 gene locus_tag LOCUS_03100 108621 108154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 109357 108800 gene locus_tag LOCUS_03110 109357 108800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 109525 110628 gene locus_tag LOCUS_03120 109525 110628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 111180 110629 gene locus_tag LOCUS_03130 111180 110629 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_03130 111435 111235 gene locus_tag LOCUS_03140 111435 111235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 111590 111663 gene locus_tag LOCUS_t00050 111590 111663 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 111725 112528 gene locus_tag LOCUS_03150 111725 112528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 112631 114004 gene locus_tag LOCUS_03160 112631 114004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 114055 114291 gene locus_tag LOCUS_03170 114055 114291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 114673 114963 gene locus_tag LOCUS_03180 114673 114963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 114960 115649 gene locus_tag LOCUS_03190 114960 115649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 116127 115666 gene locus_tag LOCUS_03200 116127 115666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 116381 116698 gene locus_tag LOCUS_03210 116381 116698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 116903 117223 gene locus_tag LOCUS_03220 116903 117223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 119247 117220 gene locus_tag LOCUS_03230 119247 117220 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966811.1 protein_id gnl|my_center|LOCUS_03230 119524 119291 gene locus_tag LOCUS_03240 119524 119291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 119628 120668 gene locus_tag LOCUS_03250 119628 120668 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931000.1 protein_id gnl|my_center|LOCUS_03250 121017 120865 gene locus_tag LOCUS_03260 121017 120865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 121110 121343 gene locus_tag LOCUS_03270 121110 121343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 121833 121333 gene locus_tag LOCUS_03280 121833 121333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 121953 122207 gene locus_tag LOCUS_03290 121953 122207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 122562 122224 gene locus_tag LOCUS_03300 122562 122224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 123127 122612 gene locus_tag LOCUS_03310 123127 122612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 123402 123608 gene locus_tag LOCUS_03320 123402 123608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 124805 123612 gene locus_tag LOCUS_03330 gene truD 124805 123612 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_03330 126379 124805 gene locus_tag LOCUS_03340 126379 124805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 126848 126474 gene locus_tag LOCUS_03350 gene pth2 126848 126474 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_03350 126894 128030 gene locus_tag LOCUS_03360 126894 128030 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_03360 128274 128540 gene locus_tag LOCUS_03370 128274 128540 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_03370 128591 130732 gene locus_tag LOCUS_03380 128591 130732 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429724.1 protein_id gnl|my_center|LOCUS_03380 130735 131031 gene locus_tag LOCUS_03390 130735 131031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 131928 131041 gene locus_tag LOCUS_03400 gene cyoE 131928 131041 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence03 806 2902 gene locus_tag LOCUS_03410 806 2902 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_03410 2973 4502 gene locus_tag LOCUS_03420 gene abfD 2973 4502 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_03420 5173 4517 gene locus_tag LOCUS_03430 5173 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 5964 5215 gene locus_tag LOCUS_03440 5964 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 6081 6407 gene locus_tag LOCUS_03450 gene trxA 6081 6407 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385489.1 protein_id gnl|my_center|LOCUS_03450 6478 7017 gene locus_tag LOCUS_03460 6478 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 7395 7036 gene locus_tag LOCUS_03470 7395 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7510 7439 gene locus_tag LOCUS_t00060 7510 7439 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7758 7561 gene locus_tag LOCUS_03480 7758 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 7833 9230 gene locus_tag LOCUS_03490 7833 9230 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_03490 9897 9223 gene locus_tag LOCUS_03500 gene rpiA 9897 9223 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_03500 10857 9898 gene locus_tag LOCUS_03510 10857 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 11272 11036 gene locus_tag LOCUS_03520 11272 11036 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_03520 12051 11329 gene locus_tag LOCUS_03530 12051 11329 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846811.1 protein_id gnl|my_center|LOCUS_03530 12926 12057 gene locus_tag LOCUS_03540 12926 12057 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903430.1 protein_id gnl|my_center|LOCUS_03540 13039 12952 gene locus_tag LOCUS_t00070 13039 12952 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13086 14435 gene locus_tag LOCUS_03550 gene glmM 13086 14435 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978186.1 protein_id gnl|my_center|LOCUS_03550 14470 14856 gene locus_tag LOCUS_03560 gene rpl7ae 14470 14856 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_03560 14853 15065 gene locus_tag LOCUS_03570 14853 15065 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762341.1 protein_id gnl|my_center|LOCUS_03570 15072 15272 gene locus_tag LOCUS_03580 15072 15272 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_03580 15275 15676 gene locus_tag LOCUS_03590 gene ndk 15275 15676 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_03590 15683 17464 gene locus_tag LOCUS_03600 gene infB 15683 17464 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978230.1 protein_id gnl|my_center|LOCUS_03600 17862 17461 gene locus_tag LOCUS_03610 gene trxA 17862 17461 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846726.1 protein_id gnl|my_center|LOCUS_03610 18062 17907 gene locus_tag LOCUS_03620 18062 17907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 18598 18182 gene locus_tag LOCUS_03630 18598 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 18708 19871 gene locus_tag LOCUS_03640 18708 19871 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146468.1 protein_id gnl|my_center|LOCUS_03640 19989 20516 gene locus_tag LOCUS_03650 19989 20516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 20720 22000 gene locus_tag LOCUS_03660 gene hisS 20720 22000 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868795.1 protein_id gnl|my_center|LOCUS_03660 22646 21981 gene locus_tag LOCUS_03670 22646 21981 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_03670 22782 23291 gene locus_tag LOCUS_03680 22782 23291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 23385 23930 gene locus_tag LOCUS_03690 23385 23930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 24001 24086 gene locus_tag LOCUS_t00080 24001 24086 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25039 24089 gene locus_tag LOCUS_03700 25039 24089 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978451.1 protein_id gnl|my_center|LOCUS_03700 25234 25752 gene locus_tag LOCUS_03710 25234 25752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 25745 27829 gene locus_tag LOCUS_03720 25745 27829 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846340.1 protein_id gnl|my_center|LOCUS_03720 27826 29955 gene locus_tag LOCUS_03730 27826 29955 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_03730 29952 30944 gene locus_tag LOCUS_03740 29952 30944 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_03740 30941 31171 gene locus_tag LOCUS_03750 30941 31171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 31644 31168 gene locus_tag LOCUS_03760 31644 31168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 31917 31648 gene locus_tag LOCUS_03770 31917 31648 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763726.1 protein_id gnl|my_center|LOCUS_03770 32849 31914 gene locus_tag LOCUS_03780 32849 31914 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_03780 33767 32850 gene locus_tag LOCUS_03790 gene ilvE 33767 32850 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099287.1 protein_id gnl|my_center|LOCUS_03790 34404 33802 gene locus_tag LOCUS_03800 34404 33802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 35296 34451 gene locus_tag LOCUS_03810 gene fpr 35296 34451 CDS product ferredoxin-NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 protein_id gnl|my_center|LOCUS_03810 35419 35493 gene locus_tag LOCUS_t00090 35419 35493 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 36028 35474 gene locus_tag LOCUS_03820 36028 35474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 36141 36422 gene locus_tag LOCUS_03830 gene albA 36141 36422 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_03830 37314 36448 gene locus_tag LOCUS_03840 37314 36448 CDS product isocitrate lyase/PEP mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665727.1 protein_id gnl|my_center|LOCUS_03840 37887 37378 gene locus_tag LOCUS_03850 37887 37378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 37981 39693 gene locus_tag LOCUS_03860 37981 39693 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_03860 39694 40125 gene locus_tag LOCUS_03870 39694 40125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 40127 40471 gene locus_tag LOCUS_03880 40127 40471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 40475 41242 gene locus_tag LOCUS_03890 40475 41242 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762424.1 protein_id gnl|my_center|LOCUS_03890 41583 41239 gene locus_tag LOCUS_03900 41583 41239 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583113.1 protein_id gnl|my_center|LOCUS_03900 41632 43089 gene locus_tag LOCUS_03910 gene argH 41632 43089 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870298.1 protein_id gnl|my_center|LOCUS_03910 43178 43102 gene locus_tag LOCUS_t00100 43178 43102 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 43275 43352 gene locus_tag LOCUS_t00110 43275 43352 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 43457 44173 gene locus_tag LOCUS_03920 43457 44173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 44189 45265 gene locus_tag LOCUS_03930 44189 45265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 45434 45270 gene locus_tag LOCUS_03940 45434 45270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 46353 45511 gene locus_tag LOCUS_03950 46353 45511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 47230 46433 gene locus_tag LOCUS_03960 47230 46433 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_03960 47314 48435 gene locus_tag LOCUS_03970 47314 48435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 48444 49601 gene locus_tag LOCUS_03980 48444 49601 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875879.1 protein_id gnl|my_center|LOCUS_03980 49598 49909 gene locus_tag LOCUS_03990 49598 49909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 50009 51556 gene locus_tag LOCUS_04000 50009 51556 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_04000 51563 53050 gene locus_tag LOCUS_04010 gene accC 51563 53050 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756612.1 protein_id gnl|my_center|LOCUS_04010 53055 53570 gene locus_tag LOCUS_04020 53055 53570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 54045 53581 gene locus_tag LOCUS_04030 54045 53581 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_04030 54201 54533 gene locus_tag LOCUS_04040 54201 54533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 54562 55098 gene locus_tag LOCUS_04050 54562 55098 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109092.1 protein_id gnl|my_center|LOCUS_04050 55098 55679 gene locus_tag LOCUS_04060 55098 55679 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 protein_id gnl|my_center|LOCUS_04060 55682 56818 gene locus_tag LOCUS_04070 55682 56818 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064737.1 protein_id gnl|my_center|LOCUS_04070 56819 58117 gene locus_tag LOCUS_04080 gene nuoH 56819 58117 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257851.1 protein_id gnl|my_center|LOCUS_04080 58114 58614 gene locus_tag LOCUS_04090 58114 58614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 58607 59119 gene locus_tag LOCUS_04100 58607 59119 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124337.1 protein_id gnl|my_center|LOCUS_04100 59100 59405 gene locus_tag LOCUS_04110 gene nuoK 59100 59405 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_04110 59405 60958 gene locus_tag LOCUS_04120 59405 60958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 60962 63034 gene locus_tag LOCUS_04130 gene nuoL 60962 63034 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_04130 63048 64532 gene locus_tag LOCUS_04140 gene fpoN 63048 64532 CDS product F(420)H(2) dehydrogenase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_04140 65373 64522 gene locus_tag LOCUS_04150 65373 64522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 65492 65414 gene locus_tag LOCUS_t00120 65492 65414 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 65574 66206 gene locus_tag LOCUS_04160 65574 66206 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871978.1 protein_id gnl|my_center|LOCUS_04160 66248 66321 gene locus_tag LOCUS_t00130 66248 66321 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 67040 66435 gene locus_tag LOCUS_04170 gene pyrE 67040 66435 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_04170 67073 68173 gene locus_tag LOCUS_04180 67073 68173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 69271 68165 gene locus_tag LOCUS_04190 69271 68165 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250198.1 protein_id gnl|my_center|LOCUS_04190 69346 69843 gene locus_tag LOCUS_04200 gene rimI 69346 69843 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_04200 69840 70586 gene locus_tag LOCUS_04210 69840 70586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 >Feature sequence04 711 511 gene locus_tag LOCUS_04220 711 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 923 1069 gene locus_tag LOCUS_04230 923 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 1135 1716 gene locus_tag LOCUS_04240 1135 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1757 1984 gene locus_tag LOCUS_04250 1757 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2013 2243 gene locus_tag LOCUS_04260 2013 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2671 2246 gene locus_tag LOCUS_04270 2671 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 3238 2675 gene locus_tag LOCUS_04280 3238 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3645 3424 gene locus_tag LOCUS_04290 3645 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3740 4120 gene locus_tag LOCUS_04300 3740 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 4152 4505 gene locus_tag LOCUS_04310 4152 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 4708 4502 gene locus_tag LOCUS_04320 4708 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4925 4692 gene locus_tag LOCUS_04330 4925 4692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5099 5371 gene locus_tag LOCUS_04340 5099 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5934 5368 gene locus_tag LOCUS_04350 5934 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6153 6407 gene locus_tag LOCUS_04360 6153 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 7212 6397 gene locus_tag LOCUS_04370 7212 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 9076 7262 gene locus_tag LOCUS_04380 9076 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 9217 9642 gene locus_tag LOCUS_04390 9217 9642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 9695 9907 gene locus_tag LOCUS_04400 9695 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 10077 10325 gene locus_tag LOCUS_04410 10077 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 10503 10348 gene locus_tag LOCUS_04420 10503 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 10829 10569 gene locus_tag LOCUS_04430 10829 10569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 11317 11865 gene locus_tag LOCUS_04440 11317 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 12973 11882 gene locus_tag LOCUS_04450 12973 11882 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846248.1 protein_id gnl|my_center|LOCUS_04450 13577 14134 gene locus_tag LOCUS_04460 13577 14134 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391642.1 protein_id gnl|my_center|LOCUS_04460 14142 14570 gene locus_tag LOCUS_04470 14142 14570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 14773 14585 gene locus_tag LOCUS_04480 14773 14585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 15592 14801 gene locus_tag LOCUS_04490 15592 14801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 16118 15648 gene locus_tag LOCUS_04500 16118 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 16270 16530 gene locus_tag LOCUS_04510 16270 16530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 16667 16533 gene locus_tag LOCUS_04520 16667 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 16777 17457 gene locus_tag LOCUS_04530 gene purQ 16777 17457 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666779.1 protein_id gnl|my_center|LOCUS_04530 17454 19619 gene locus_tag LOCUS_04540 gene purL 17454 19619 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868861.1 protein_id gnl|my_center|LOCUS_04540 19612 21054 gene locus_tag LOCUS_04550 gene purF 19612 21054 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942281.1 protein_id gnl|my_center|LOCUS_04550 21096 21374 gene locus_tag LOCUS_04560 21096 21374 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_04560 21437 22261 gene locus_tag LOCUS_04570 21437 22261 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863110.1 protein_id gnl|my_center|LOCUS_04570 22605 23120 gene locus_tag LOCUS_04580 22605 23120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 23247 23669 gene locus_tag LOCUS_04590 23247 23669 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_04590 24060 23761 gene locus_tag LOCUS_04600 24060 23761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 24647 24162 gene locus_tag LOCUS_04610 24647 24162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 25693 25244 gene locus_tag LOCUS_04620 25693 25244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 26048 25821 gene locus_tag LOCUS_04630 26048 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 26232 26053 gene locus_tag LOCUS_04640 26232 26053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 26562 26488 gene locus_tag LOCUS_t00140 26562 26488 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 26920 26630 gene locus_tag LOCUS_04650 26920 26630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 27494 26937 gene locus_tag LOCUS_04660 27494 26937 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_04660 27876 27484 gene locus_tag LOCUS_04670 27876 27484 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_04670 28061 27882 gene locus_tag LOCUS_04680 28061 27882 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250478.1 protein_id gnl|my_center|LOCUS_04680 28582 28061 gene locus_tag LOCUS_04690 28582 28061 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 protein_id gnl|my_center|LOCUS_04690 29303 28587 gene locus_tag LOCUS_04700 29303 28587 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_04700 29743 29303 gene locus_tag LOCUS_04710 29743 29303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 30167 29745 gene locus_tag LOCUS_04720 30167 29745 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867453.1 protein_id gnl|my_center|LOCUS_04720 30498 30169 gene locus_tag LOCUS_04730 30498 30169 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_04730 30761 30495 gene locus_tag LOCUS_04740 30761 30495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 30964 30758 gene locus_tag LOCUS_04750 30964 30758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 31752 30961 gene locus_tag LOCUS_04760 31752 30961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 32213 31755 gene locus_tag LOCUS_04770 gene rplV 32213 31755 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_04770 32614 32219 gene locus_tag LOCUS_04780 gene rpsS 32614 32219 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_04780 32925 32659 gene locus_tag LOCUS_04790 32925 32659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 33734 32922 gene locus_tag LOCUS_04800 gene rpl4p 33734 32922 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867463.1 protein_id gnl|my_center|LOCUS_04800 34729 33734 gene locus_tag LOCUS_04810 34729 33734 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867464.1 protein_id gnl|my_center|LOCUS_04810 35747 34935 gene locus_tag LOCUS_04820 35747 34935 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879419.1 protein_id gnl|my_center|LOCUS_04820 36517 35780 gene locus_tag LOCUS_04830 gene psmA 36517 35780 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_04830 36570 36986 gene locus_tag LOCUS_04840 36570 36986 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878568.1 protein_id gnl|my_center|LOCUS_04840 37928 37329 gene locus_tag LOCUS_04850 37928 37329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 38147 37959 gene locus_tag LOCUS_04860 38147 37959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 38273 38614 gene locus_tag LOCUS_04870 38273 38614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 39257 38607 gene locus_tag LOCUS_04880 gene cdvB1/B2 39257 38607 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_04880 40424 39351 gene locus_tag LOCUS_04890 40424 39351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 41152 40421 gene locus_tag LOCUS_04900 41152 40421 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_04900 41399 41226 gene locus_tag LOCUS_04910 41399 41226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 42495 41371 gene locus_tag LOCUS_04920 42495 41371 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680038.1 protein_id gnl|my_center|LOCUS_04920 43462 42485 gene locus_tag LOCUS_04930 gene bioB 43462 42485 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057907.1 protein_id gnl|my_center|LOCUS_04930 44850 43534 gene locus_tag LOCUS_04940 gene bioA 44850 43534 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000144314.1 protein_id gnl|my_center|LOCUS_04940 45032 45715 gene locus_tag LOCUS_04950 gene bioD 45032 45715 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398591.1 protein_id gnl|my_center|LOCUS_04950 46272 45724 gene locus_tag LOCUS_04960 46272 45724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 46637 47968 gene locus_tag LOCUS_04970 46637 47968 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021373.1 protein_id gnl|my_center|LOCUS_04970 48150 48353 gene locus_tag LOCUS_04980 48150 48353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 49839 48445 gene locus_tag LOCUS_04990 gene hmgB 49839 48445 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_04990 50646 49942 gene locus_tag LOCUS_05000 50646 49942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 50721 51773 gene locus_tag LOCUS_05010 50721 51773 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902020.1 protein_id gnl|my_center|LOCUS_05010 53023 51770 gene locus_tag LOCUS_05020 53023 51770 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_05020 54504 53176 gene locus_tag LOCUS_05030 gene thrC 54504 53176 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868155.1 protein_id gnl|my_center|LOCUS_05030 54610 54984 gene locus_tag LOCUS_05040 54610 54984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 55657 55274 gene locus_tag LOCUS_05050 55657 55274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 56171 55722 gene locus_tag LOCUS_05060 56171 55722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 56786 56223 gene locus_tag LOCUS_05070 56786 56223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 56931 57215 gene locus_tag LOCUS_05080 56931 57215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 57216 57998 gene locus_tag LOCUS_05090 57216 57998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 58032 58859 gene locus_tag LOCUS_05100 58032 58859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 59160 58852 gene locus_tag LOCUS_05110 59160 58852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 60266 59157 gene locus_tag LOCUS_05120 60266 59157 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_05120 61234 60266 gene locus_tag LOCUS_05130 61234 60266 CDS product TIGR04024 family LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_05130 61327 61482 gene locus_tag LOCUS_05140 61327 61482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 62162 61494 gene locus_tag LOCUS_05150 62162 61494 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978969.1 protein_id gnl|my_center|LOCUS_05150 62360 62202 gene locus_tag LOCUS_05160 62360 62202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence05 488 847 gene locus_tag LOCUS_05170 488 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1329 853 gene locus_tag LOCUS_05180 1329 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 1456 2094 gene locus_tag LOCUS_05190 1456 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2427 2098 gene locus_tag LOCUS_05200 2427 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2515 2967 gene locus_tag LOCUS_05210 2515 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3226 4179 gene locus_tag LOCUS_05220 3226 4179 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_05220 4176 4961 gene locus_tag LOCUS_05230 4176 4961 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_05230 5439 5140 gene locus_tag LOCUS_05240 5439 5140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 5480 5893 gene locus_tag LOCUS_05250 5480 5893 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_05250 5893 6576 gene locus_tag LOCUS_05260 5893 6576 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_05260 6601 7878 gene locus_tag LOCUS_05270 gene hemL 6601 7878 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_05270 7875 8810 gene locus_tag LOCUS_05280 gene hemC 7875 8810 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723240.1 protein_id gnl|my_center|LOCUS_05280 8807 9547 gene locus_tag LOCUS_05290 gene cobA 8807 9547 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_05290 9547 10344 gene locus_tag LOCUS_05300 9547 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 10921 10346 gene locus_tag LOCUS_05310 gene purE 10921 10346 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_05310 11259 12668 gene locus_tag LOCUS_05320 gene sufB 11259 12668 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_05320 12695 14095 gene locus_tag LOCUS_05330 gene sufB 12695 14095 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074405.1 protein_id gnl|my_center|LOCUS_05330 14101 14409 gene locus_tag LOCUS_05340 14101 14409 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_05340 14413 15657 gene locus_tag LOCUS_05350 14413 15657 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259320.1 protein_id gnl|my_center|LOCUS_05350 15654 16097 gene locus_tag LOCUS_05360 15654 16097 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_05360 16099 16446 gene locus_tag LOCUS_05370 16099 16446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 17647 16436 gene locus_tag LOCUS_05380 17647 16436 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_05380 17789 18457 gene locus_tag LOCUS_05390 gene lpxE 17789 18457 CDS product lipid A 1-phosphatase LpxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881106.1 protein_id gnl|my_center|LOCUS_05390 18757 18446 gene locus_tag LOCUS_05400 18757 18446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 18893 19603 gene locus_tag LOCUS_05410 18893 19603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 20268 19900 gene locus_tag LOCUS_05420 20268 19900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 20766 21383 gene locus_tag LOCUS_05430 20766 21383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532967.1 protein_id gnl|my_center|LOCUS_05430 21384 22004 gene locus_tag LOCUS_05440 21384 22004 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261932.1 protein_id gnl|my_center|LOCUS_05440 22312 22001 gene locus_tag LOCUS_05450 22312 22001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 23289 22309 gene locus_tag LOCUS_05460 gene hemB 23289 22309 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_05460 24592 23321 gene locus_tag LOCUS_05470 gene hemA 24592 23321 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_05470 25236 24583 gene locus_tag LOCUS_05480 25236 24583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 25339 26349 gene locus_tag LOCUS_05490 25339 26349 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_05490 26684 26346 gene locus_tag LOCUS_05500 26684 26346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 27690 26692 gene locus_tag LOCUS_05510 27690 26692 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_05510 28374 27769 gene locus_tag LOCUS_05520 28374 27769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 29229 28459 gene locus_tag LOCUS_05530 gene sufC 29229 28459 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722442.1 protein_id gnl|my_center|LOCUS_05530 30275 29322 gene locus_tag LOCUS_05540 30275 29322 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_05540 30520 30272 gene locus_tag LOCUS_05550 30520 30272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 30915 30616 gene locus_tag LOCUS_05560 30915 30616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 31300 30917 gene locus_tag LOCUS_05570 31300 30917 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868249.1 protein_id gnl|my_center|LOCUS_05570 31945 31355 gene locus_tag LOCUS_05580 31945 31355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 32669 31989 gene locus_tag LOCUS_05590 32669 31989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 32765 33817 gene locus_tag LOCUS_05600 32765 33817 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980662.1 protein_id gnl|my_center|LOCUS_05600 33939 34250 gene locus_tag LOCUS_05610 gene eif1A 33939 34250 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_05610 34300 34491 gene locus_tag LOCUS_05620 gene cspB 34300 34491 CDS product cold-shock protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723180.1 protein_id gnl|my_center|LOCUS_05620 34799 35410 gene locus_tag LOCUS_05630 34799 35410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 35442 35855 gene locus_tag LOCUS_05640 35442 35855 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249829.1 protein_id gnl|my_center|LOCUS_05640 36058 36747 gene locus_tag LOCUS_05650 36058 36747 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_05650 36740 38065 gene locus_tag LOCUS_05660 36740 38065 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867603.1 protein_id gnl|my_center|LOCUS_05660 38088 39233 gene locus_tag LOCUS_05670 38088 39233 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_05670 39406 40116 gene locus_tag LOCUS_05680 39406 40116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 40336 40142 gene locus_tag LOCUS_05690 40336 40142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 40698 40336 gene locus_tag LOCUS_05700 40698 40336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 40754 41314 gene locus_tag LOCUS_05710 40754 41314 CDS product DUF309 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762118.1 protein_id gnl|my_center|LOCUS_05710 42584 41286 gene locus_tag LOCUS_05720 42584 41286 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 protein_id gnl|my_center|LOCUS_05720 42769 43785 gene locus_tag LOCUS_05730 gene galT 42769 43785 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_05730 43827 44267 gene locus_tag LOCUS_05740 43827 44267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 44701 44264 gene locus_tag LOCUS_05750 44701 44264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 45410 44694 gene locus_tag LOCUS_05760 45410 44694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 46757 45459 gene locus_tag LOCUS_05770 46757 45459 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_05770 46825 47049 gene locus_tag LOCUS_05780 46825 47049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 47501 48829 gene locus_tag LOCUS_05790 gene thiC 47501 48829 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_05790 49216 48812 gene locus_tag LOCUS_05800 49216 48812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 50073 49222 gene locus_tag LOCUS_05810 50073 49222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 51440 50073 gene locus_tag LOCUS_05820 gene aspC 51440 50073 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080007.1 protein_id gnl|my_center|LOCUS_05820 52542 51445 gene locus_tag LOCUS_05830 gene aroC 52542 51445 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_05830 53956 52688 gene locus_tag LOCUS_05840 gene aroA 53956 52688 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_05840 54800 53946 gene locus_tag LOCUS_05850 54800 53946 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870958.1 protein_id gnl|my_center|LOCUS_05850 55621 54800 gene locus_tag LOCUS_05860 gene aroE 55621 54800 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229967.1 protein_id gnl|my_center|LOCUS_05860 56335 55664 gene locus_tag LOCUS_05870 gene aroD 56335 55664 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_05870 57398 56337 gene locus_tag LOCUS_05880 57398 56337 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_05880 58173 57391 gene locus_tag LOCUS_05890 58173 57391 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_05890 58319 59437 gene locus_tag LOCUS_05900 gene mqnC 58319 59437 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763062.1 protein_id gnl|my_center|LOCUS_05900 60874 59432 gene locus_tag LOCUS_05910 60874 59432 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_05910 61311 60937 gene locus_tag LOCUS_05920 61311 60937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence06 191 535 gene locus_tag LOCUS_05930 191 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 833 552 gene locus_tag LOCUS_05940 833 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1942 830 gene locus_tag LOCUS_05950 1942 830 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_05950 1994 3382 gene locus_tag LOCUS_05960 1994 3382 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_05960 3373 5016 gene locus_tag LOCUS_05970 gene pheT 3373 5016 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_05970 5301 5720 gene locus_tag LOCUS_05980 5301 5720 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_05980 5763 6002 gene locus_tag LOCUS_05990 5763 6002 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_05990 6022 6588 gene locus_tag LOCUS_06000 6022 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 7233 6601 gene locus_tag LOCUS_06010 7233 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 7389 9656 gene locus_tag LOCUS_06020 7389 9656 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_06020 9739 9664 gene locus_tag LOCUS_t00150 9739 9664 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 9828 10361 gene locus_tag LOCUS_06030 9828 10361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 10392 11360 gene locus_tag LOCUS_06040 gene pdxS 10392 11360 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979488.1 protein_id gnl|my_center|LOCUS_06040 11357 11974 gene locus_tag LOCUS_06050 gene pdxT 11357 11974 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_06050 12070 12438 gene locus_tag LOCUS_06060 12070 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 13059 12490 gene locus_tag LOCUS_06070 13059 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 15449 13131 gene locus_tag LOCUS_06080 15449 13131 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_06080 16268 15453 gene locus_tag LOCUS_06090 16268 15453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 16611 16333 gene locus_tag LOCUS_06100 16611 16333 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918134.1 protein_id gnl|my_center|LOCUS_06100 17149 16652 gene locus_tag LOCUS_06110 17149 16652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 17259 18014 gene locus_tag LOCUS_06120 17259 18014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 19371 18007 gene locus_tag LOCUS_06130 gene purB 19371 18007 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 protein_id gnl|my_center|LOCUS_06130 19633 19478 gene locus_tag LOCUS_06140 19633 19478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 19723 21171 gene locus_tag LOCUS_06150 19723 21171 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_06150 21168 21578 gene locus_tag LOCUS_06160 21168 21578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 21575 21886 gene locus_tag LOCUS_06170 21575 21886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 22359 21883 gene locus_tag LOCUS_06180 22359 21883 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867653.1 protein_id gnl|my_center|LOCUS_06180 22476 22796 gene locus_tag LOCUS_06190 22476 22796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 23747 22797 gene locus_tag LOCUS_06200 gene thiL 23747 22797 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874412.1 protein_id gnl|my_center|LOCUS_06200 25029 23731 gene locus_tag LOCUS_06210 gene glmM 25029 23731 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870612.1 protein_id gnl|my_center|LOCUS_06210 25083 25156 gene locus_tag LOCUS_t00160 25083 25156 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 25544 25362 gene locus_tag LOCUS_06220 25544 25362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 25606 25821 gene locus_tag LOCUS_06230 25606 25821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 26106 25825 gene locus_tag LOCUS_06240 26106 25825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 26191 26775 gene locus_tag LOCUS_06250 26191 26775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 26981 26778 gene locus_tag LOCUS_06260 26981 26778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 28859 27108 gene locus_tag LOCUS_06270 28859 27108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 28934 29359 gene locus_tag LOCUS_06280 28934 29359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 29431 29360 gene locus_tag LOCUS_t00170 29431 29360 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 29692 29471 gene locus_tag LOCUS_06290 gene hpkA 29692 29471 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_06290 29789 30544 gene locus_tag LOCUS_06300 29789 30544 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_06300 30608 30925 gene locus_tag LOCUS_06310 30608 30925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 30968 31741 gene locus_tag LOCUS_06320 30968 31741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 32257 31733 gene locus_tag LOCUS_06330 32257 31733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 32847 32254 gene locus_tag LOCUS_06340 32847 32254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 33288 33001 gene locus_tag LOCUS_06350 33288 33001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 34039 33392 gene locus_tag LOCUS_06360 34039 33392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 34315 34100 gene locus_tag LOCUS_06370 34315 34100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 34393 34674 gene locus_tag LOCUS_06380 34393 34674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 35132 34671 gene locus_tag LOCUS_06390 35132 34671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 35201 36214 gene locus_tag LOCUS_06400 35201 36214 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496543.1 protein_id gnl|my_center|LOCUS_06400 36264 36953 gene locus_tag LOCUS_06410 36264 36953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 36985 37674 gene locus_tag LOCUS_06420 36985 37674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 38073 37654 gene locus_tag LOCUS_06430 38073 37654 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_06430 38861 38070 gene locus_tag LOCUS_06440 gene uppS 38861 38070 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_06440 40072 38921 gene locus_tag LOCUS_06450 40072 38921 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_06450 40641 40144 gene locus_tag LOCUS_06460 40641 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 40895 41044 gene locus_tag LOCUS_06470 40895 41044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 41116 41538 gene locus_tag LOCUS_06480 41116 41538 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868556.1 protein_id gnl|my_center|LOCUS_06480 41538 41834 gene locus_tag LOCUS_06490 41538 41834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 41910 42695 gene locus_tag LOCUS_06500 41910 42695 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_06500 42685 43257 gene locus_tag LOCUS_06510 42685 43257 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496497.1 protein_id gnl|my_center|LOCUS_06510 43244 45118 gene locus_tag LOCUS_06520 43244 45118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 45105 46229 gene locus_tag LOCUS_06530 45105 46229 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_06530 46631 46230 gene locus_tag LOCUS_06540 46631 46230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 46748 46981 gene locus_tag LOCUS_06550 46748 46981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 47028 47381 gene locus_tag LOCUS_06560 47028 47381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 47404 47802 gene locus_tag LOCUS_06570 47404 47802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 47811 48095 gene locus_tag LOCUS_06580 47811 48095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 48883 48092 gene locus_tag LOCUS_06590 48883 48092 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_06590 49404 48883 gene locus_tag LOCUS_06600 49404 48883 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426450.1 protein_id gnl|my_center|LOCUS_06600 51600 49435 gene locus_tag LOCUS_06610 51600 49435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 53693 51603 gene locus_tag LOCUS_06620 53693 51603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 53813 54259 gene locus_tag LOCUS_06630 53813 54259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 54312 55058 gene locus_tag LOCUS_06640 54312 55058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 55055 55648 gene locus_tag LOCUS_06650 gene rrmJ 55055 55648 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_06650 56786 55650 gene locus_tag LOCUS_06660 56786 55650 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_06660 56848 57468 gene locus_tag LOCUS_06670 gene rnhB 56848 57468 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_06670 58139 57465 gene locus_tag LOCUS_06680 58139 57465 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence07 1463 2374 gene locus_tag LOCUS_06690 1463 2374 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_06690 2358 3170 gene locus_tag LOCUS_06700 2358 3170 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_06700 3213 4946 gene locus_tag LOCUS_06710 3213 4946 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_06710 4989 5171 gene locus_tag LOCUS_06720 4989 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5250 6359 gene locus_tag LOCUS_06730 gene radA 5250 6359 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762467.1 protein_id gnl|my_center|LOCUS_06730 6450 7526 gene locus_tag LOCUS_06740 gene rlmN 6450 7526 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583788.1 protein_id gnl|my_center|LOCUS_06740 7561 7860 gene locus_tag LOCUS_06750 7561 7860 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978432.1 protein_id gnl|my_center|LOCUS_06750 7863 8189 gene locus_tag LOCUS_06760 7863 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 8210 8776 gene locus_tag LOCUS_06770 8210 8776 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249851.1 protein_id gnl|my_center|LOCUS_06770 8773 9477 gene locus_tag LOCUS_06780 8773 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 9467 9988 gene locus_tag LOCUS_06790 9467 9988 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061290.1 protein_id gnl|my_center|LOCUS_06790 11023 9989 gene locus_tag LOCUS_06800 11023 9989 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_06800 11117 11203 gene locus_tag LOCUS_t00180 11117 11203 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11240 11401 gene locus_tag LOCUS_06810 11240 11401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 11474 11644 gene locus_tag LOCUS_06820 11474 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 12459 11641 gene locus_tag LOCUS_06830 12459 11641 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_06830 13659 12463 gene locus_tag LOCUS_06840 13659 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 13777 14079 gene locus_tag LOCUS_06850 13777 14079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 14961 14098 gene locus_tag LOCUS_06860 14961 14098 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_06860 15110 15511 gene locus_tag LOCUS_06870 15110 15511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 17441 15768 gene locus_tag LOCUS_06880 17441 15768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 18341 17514 gene locus_tag LOCUS_06890 18341 17514 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 protein_id gnl|my_center|LOCUS_06890 18527 19303 gene locus_tag LOCUS_06900 18527 19303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 19651 19307 gene locus_tag LOCUS_06910 19651 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 20884 19730 gene locus_tag LOCUS_06920 20884 19730 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314722.1 protein_id gnl|my_center|LOCUS_06920 21573 20881 gene locus_tag LOCUS_06930 21573 20881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 22349 21624 gene locus_tag LOCUS_06940 gene psmA 22349 21624 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_06940 22561 22391 gene locus_tag LOCUS_06950 22561 22391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 22485 23759 gene locus_tag LOCUS_06960 gene gdhA 22485 23759 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_06960 23784 24467 gene locus_tag LOCUS_06970 23784 24467 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080220.1 protein_id gnl|my_center|LOCUS_06970 24483 26630 gene locus_tag LOCUS_06980 24483 26630 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966065.1 protein_id gnl|my_center|LOCUS_06980 26667 27428 gene locus_tag LOCUS_06990 26667 27428 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_06990 27519 27884 gene locus_tag LOCUS_07000 27519 27884 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244166.1 protein_id gnl|my_center|LOCUS_07000 28012 29154 gene locus_tag LOCUS_07010 gene dnaG 28012 29154 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_07010 29163 29846 gene locus_tag LOCUS_07020 29163 29846 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048169713.1 protein_id gnl|my_center|LOCUS_07020 30484 29843 gene locus_tag LOCUS_07030 30484 29843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 31542 30505 gene locus_tag LOCUS_07040 31542 30505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 32669 31542 gene locus_tag LOCUS_07050 32669 31542 CDS product [LysW]-lysine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228894.1 protein_id gnl|my_center|LOCUS_07050 33513 32671 gene locus_tag LOCUS_07060 gene lysX 33513 32671 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_07060 33677 33510 gene locus_tag LOCUS_07070 gene lysW/argW 33677 33510 CDS product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_07070 34866 33700 gene locus_tag LOCUS_07080 34866 33700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 35402 34983 gene locus_tag LOCUS_07090 35402 34983 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230688.1 protein_id gnl|my_center|LOCUS_07090 36570 35395 gene locus_tag LOCUS_07100 36570 35395 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228893.1 protein_id gnl|my_center|LOCUS_07100 37366 36563 gene locus_tag LOCUS_07110 37366 36563 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_07110 38415 37369 gene locus_tag LOCUS_07120 gene argC 38415 37369 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 protein_id gnl|my_center|LOCUS_07120 38569 38943 gene locus_tag LOCUS_07130 38569 38943 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_07130 38936 39265 gene locus_tag LOCUS_07140 38936 39265 CDS product YnfA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_07140 40139 39282 gene locus_tag LOCUS_07150 gene lysX 40139 39282 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229004.1 protein_id gnl|my_center|LOCUS_07150 40306 40139 gene locus_tag LOCUS_07160 gene lysW/argW 40306 40139 CDS product alpha-aminoadipate/glutamate carrier protein LysW/ArgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_07160 41502 40303 gene locus_tag LOCUS_07170 41502 40303 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061009.1 protein_id gnl|my_center|LOCUS_07170 41702 41532 gene locus_tag LOCUS_07180 41702 41532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 41635 42660 gene locus_tag LOCUS_07190 41635 42660 CDS product aliphatic sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_07190 42661 43425 gene locus_tag LOCUS_07200 42661 43425 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_07200 43431 44189 gene locus_tag LOCUS_07210 43431 44189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_07210 45295 44195 gene locus_tag LOCUS_07220 45295 44195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066039.1 protein_id gnl|my_center|LOCUS_07220 45406 46368 gene locus_tag LOCUS_07230 45406 46368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07230 46400 48898 gene locus_tag LOCUS_07240 46400 48898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07240 49633 48899 gene locus_tag LOCUS_07250 49633 48899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 49707 50255 gene locus_tag LOCUS_07260 49707 50255 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706269.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence08 1665 1240 gene locus_tag LOCUS_07270 1665 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2375 1755 gene locus_tag LOCUS_07280 gene sodA 2375 1755 CDS product superoxide dismutase SodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398583.1 protein_id gnl|my_center|LOCUS_07280 2551 2396 gene locus_tag LOCUS_07290 2551 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2502 4481 gene locus_tag LOCUS_07300 2502 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 6087 4483 gene locus_tag LOCUS_07310 gene pckA 6087 4483 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_07310 6233 6637 gene locus_tag LOCUS_07320 6233 6637 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869973.1 protein_id gnl|my_center|LOCUS_07320 6621 7076 gene locus_tag LOCUS_07330 6621 7076 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867445.1 protein_id gnl|my_center|LOCUS_07330 7372 7073 gene locus_tag LOCUS_07340 7372 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 8145 7369 gene locus_tag LOCUS_07350 8145 7369 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869661.1 protein_id gnl|my_center|LOCUS_07350 8185 8358 gene locus_tag LOCUS_07360 8185 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 8361 8819 gene locus_tag LOCUS_07370 8361 8819 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_07370 8855 9334 gene locus_tag LOCUS_07380 8855 9334 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_07380 9790 9335 gene locus_tag LOCUS_07390 9790 9335 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251060.1 protein_id gnl|my_center|LOCUS_07390 9956 10618 gene locus_tag LOCUS_07400 9956 10618 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_07400 10611 11477 gene locus_tag LOCUS_07410 10611 11477 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868902.1 protein_id gnl|my_center|LOCUS_07410 12121 11474 gene locus_tag LOCUS_07420 12121 11474 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939941.1 protein_id gnl|my_center|LOCUS_07420 12479 12189 gene locus_tag LOCUS_07430 gene rpl12p 12479 12189 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_07430 13049 12540 gene locus_tag LOCUS_07440 13049 12540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 13129 15801 gene locus_tag LOCUS_07450 gene alaS 13129 15801 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870068.1 protein_id gnl|my_center|LOCUS_07450 15809 18679 gene locus_tag LOCUS_07460 gene leuS 15809 18679 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_07460 19384 18956 gene locus_tag LOCUS_07470 19384 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 19719 20732 gene locus_tag LOCUS_07480 19719 20732 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_07480 21433 20729 gene locus_tag LOCUS_07490 21433 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 21469 21789 gene locus_tag LOCUS_07500 21469 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 21885 21797 gene locus_tag LOCUS_t00190 21885 21797 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22548 21949 gene locus_tag LOCUS_07510 22548 21949 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_07510 22988 22551 gene locus_tag LOCUS_07520 22988 22551 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250029.1 protein_id gnl|my_center|LOCUS_07520 23456 22992 gene locus_tag LOCUS_07530 23456 22992 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_07530 23844 23521 gene locus_tag LOCUS_07540 23844 23521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 25149 23971 gene locus_tag LOCUS_07550 25149 23971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 25425 25201 gene locus_tag LOCUS_07560 25425 25201 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249927.1 protein_id gnl|my_center|LOCUS_07560 29232 25435 gene locus_tag LOCUS_07570 29232 25435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 32584 29234 gene locus_tag LOCUS_07580 32584 29234 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250034.1 protein_id gnl|my_center|LOCUS_07580 32838 32587 gene locus_tag LOCUS_07590 32838 32587 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250035.1 protein_id gnl|my_center|LOCUS_07590 33721 32942 gene locus_tag LOCUS_07600 gene larB 33721 32942 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869660.1 protein_id gnl|my_center|LOCUS_07600 34669 33755 gene locus_tag LOCUS_07610 gene mdh 34669 33755 CDS product NAD-dependent malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 protein_id gnl|my_center|LOCUS_07610 34759 35982 gene locus_tag LOCUS_07620 gene larC 34759 35982 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 protein_id gnl|my_center|LOCUS_07620 35982 36779 gene locus_tag LOCUS_07630 gene larE 35982 36779 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_07630 37658 36852 gene locus_tag LOCUS_07640 37658 36852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 38488 37730 gene locus_tag LOCUS_07650 38488 37730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 39403 38582 gene locus_tag LOCUS_07660 39403 38582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 40326 39508 gene locus_tag LOCUS_07670 40326 39508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 40464 42044 gene locus_tag LOCUS_07680 40464 42044 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_07680 42393 42070 gene locus_tag LOCUS_07690 42393 42070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 42706 42446 gene locus_tag LOCUS_07700 42706 42446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 42687 42983 gene locus_tag LOCUS_07710 42687 42983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 43130 43384 gene locus_tag LOCUS_07720 43130 43384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 43438 43689 gene locus_tag LOCUS_07730 43438 43689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence09 1361 1528 gene locus_tag LOCUS_07740 1361 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 2638 1754 gene locus_tag LOCUS_07750 2638 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2749 2824 gene locus_tag LOCUS_t00200 2749 2824 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2879 3535 gene locus_tag LOCUS_07760 2879 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 4095 3532 gene locus_tag LOCUS_07770 gene endA 4095 3532 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496827.1 protein_id gnl|my_center|LOCUS_07770 4193 4702 gene locus_tag LOCUS_07780 gene rplJ 4193 4702 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870047.1 protein_id gnl|my_center|LOCUS_07780 4957 4694 gene locus_tag LOCUS_07790 4957 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5022 5098 gene locus_tag LOCUS_t00210 5022 5098 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5528 5100 gene locus_tag LOCUS_07800 5528 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 6849 5521 gene locus_tag LOCUS_07810 6849 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 7255 8634 gene locus_tag LOCUS_07820 7255 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 10697 8631 gene locus_tag LOCUS_07830 10697 8631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 11696 10749 gene locus_tag LOCUS_07840 11696 10749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 11899 12714 gene locus_tag LOCUS_07850 11899 12714 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_07850 12704 13180 gene locus_tag LOCUS_07860 12704 13180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 14048 13368 gene locus_tag LOCUS_07870 14048 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 14497 14102 gene locus_tag LOCUS_07880 14497 14102 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876316.1 protein_id gnl|my_center|LOCUS_07880 14765 14520 gene locus_tag LOCUS_07890 14765 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 14961 14749 gene locus_tag LOCUS_07900 14961 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 15781 14963 gene locus_tag LOCUS_07910 gene rrp42 15781 14963 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_07910 16518 15784 gene locus_tag LOCUS_07920 gene rrp41 16518 15784 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_07920 17198 16518 gene locus_tag LOCUS_07930 17198 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 17884 17198 gene locus_tag LOCUS_07940 17884 17198 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978418.1 protein_id gnl|my_center|LOCUS_07940 17972 18571 gene locus_tag LOCUS_07950 17972 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 18617 18964 gene locus_tag LOCUS_07960 18617 18964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 18957 19466 gene locus_tag LOCUS_07970 18957 19466 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980140.1 protein_id gnl|my_center|LOCUS_07970 19468 19914 gene locus_tag LOCUS_07980 19468 19914 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_07980 19918 20634 gene locus_tag LOCUS_07990 19918 20634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 21223 20612 gene locus_tag LOCUS_08000 gene leuD 21223 20612 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433181.1 protein_id gnl|my_center|LOCUS_08000 22613 21198 gene locus_tag LOCUS_08010 gene leuC 22613 21198 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340234.1 protein_id gnl|my_center|LOCUS_08010 23106 22615 gene locus_tag LOCUS_08020 gene leuD 23106 22615 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_08020 24374 23103 gene locus_tag LOCUS_08030 gene leuC 24374 23103 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880579.1 protein_id gnl|my_center|LOCUS_08030 24448 25236 gene locus_tag LOCUS_08040 gene cofE 24448 25236 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023428.1 protein_id gnl|my_center|LOCUS_08040 25271 25822 gene locus_tag LOCUS_08050 25271 25822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 26168 25845 gene locus_tag LOCUS_08060 26168 25845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 26258 26806 gene locus_tag LOCUS_08070 26258 26806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 27780 26818 gene locus_tag LOCUS_08080 27780 26818 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980384.1 protein_id gnl|my_center|LOCUS_08080 29677 27770 gene locus_tag LOCUS_08090 29677 27770 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_08090 29874 29731 gene locus_tag LOCUS_08100 29874 29731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 29927 30895 gene locus_tag LOCUS_08110 gene gyaR 29927 30895 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_08110 31465 31091 gene locus_tag LOCUS_08120 31465 31091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 31762 31490 gene locus_tag LOCUS_08130 31762 31490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 31847 33157 gene locus_tag LOCUS_08140 31847 33157 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125470.1 protein_id gnl|my_center|LOCUS_08140 33775 33329 gene locus_tag LOCUS_08150 33775 33329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 34803 33802 gene locus_tag LOCUS_08160 34803 33802 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_08160 35360 34800 gene locus_tag LOCUS_08170 35360 34800 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762154.1 protein_id gnl|my_center|LOCUS_08170 35989 35357 gene locus_tag LOCUS_08180 35989 35357 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_08180 36547 35993 gene locus_tag LOCUS_08190 36547 35993 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_08190 37991 36558 gene locus_tag LOCUS_08200 gene secY 37991 36558 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 protein_id gnl|my_center|LOCUS_08200 38448 38002 gene locus_tag LOCUS_08210 38448 38002 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762714.1 protein_id gnl|my_center|LOCUS_08210 38926 38450 gene locus_tag LOCUS_08220 38926 38450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 39636 38923 gene locus_tag LOCUS_08230 39636 38923 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763044.1 protein_id gnl|my_center|LOCUS_08230 40121 39639 gene locus_tag LOCUS_08240 40121 39639 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869975.1 protein_id gnl|my_center|LOCUS_08240 41072 40158 gene locus_tag LOCUS_08250 gene argF 41072 40158 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence10 1818 307 gene locus_tag LOCUS_08260 gene tgtA 1818 307 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_08260 2398 1850 gene locus_tag LOCUS_08270 2398 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 2462 3658 gene locus_tag LOCUS_08280 2462 3658 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_08280 3660 4643 gene locus_tag LOCUS_08290 gene kae1 3660 4643 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978326.1 protein_id gnl|my_center|LOCUS_08290 4963 4637 gene locus_tag LOCUS_08300 4963 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4995 5621 gene locus_tag LOCUS_08310 4995 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 5614 6153 gene locus_tag LOCUS_08320 5614 6153 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_08320 7162 6131 gene locus_tag LOCUS_08330 gene twy1 7162 6131 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761845.1 protein_id gnl|my_center|LOCUS_08330 7280 9427 gene locus_tag LOCUS_08340 7280 9427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 9501 10463 gene locus_tag LOCUS_08350 gene dusB 9501 10463 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_08350 10672 10848 gene locus_tag LOCUS_08360 10672 10848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 10955 11644 gene locus_tag LOCUS_08370 10955 11644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 12220 11645 gene locus_tag LOCUS_08380 12220 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 12513 12292 gene locus_tag LOCUS_08390 12513 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 12973 12524 gene locus_tag LOCUS_08400 12973 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 14567 13002 gene locus_tag LOCUS_08410 14567 13002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 16174 14612 gene locus_tag LOCUS_08420 16174 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 16969 16175 gene locus_tag LOCUS_08430 16969 16175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18473 17010 gene locus_tag LOCUS_08440 18473 17010 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762689.1 protein_id gnl|my_center|LOCUS_08440 19076 18645 gene locus_tag LOCUS_08450 19076 18645 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869709.1 protein_id gnl|my_center|LOCUS_08450 19717 19103 gene locus_tag LOCUS_08460 19717 19103 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_08460 21023 19755 gene locus_tag LOCUS_08470 gene serS 21023 19755 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 protein_id gnl|my_center|LOCUS_08470 21265 21023 gene locus_tag LOCUS_08480 21265 21023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 22649 21228 gene locus_tag LOCUS_08490 22649 21228 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_08490 23098 22649 gene locus_tag LOCUS_08500 23098 22649 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762532.1 protein_id gnl|my_center|LOCUS_08500 23222 23554 gene locus_tag LOCUS_08510 23222 23554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 23664 23933 gene locus_tag LOCUS_08520 23664 23933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 24563 24036 gene locus_tag LOCUS_08530 24563 24036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 24916 24602 gene locus_tag LOCUS_08540 24916 24602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 25577 25008 gene locus_tag LOCUS_08550 25577 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 25912 26397 gene locus_tag LOCUS_08560 25912 26397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 26518 26880 gene locus_tag LOCUS_08570 26518 26880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 26986 27636 gene locus_tag LOCUS_08580 26986 27636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 27766 28626 gene locus_tag LOCUS_08590 27766 28626 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_08590 28701 28628 gene locus_tag LOCUS_t00220 28701 28628 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 28792 28878 gene locus_tag LOCUS_t00230 28792 28878 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29269 28883 gene locus_tag LOCUS_08600 29269 28883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 29378 30277 gene locus_tag LOCUS_08610 29378 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 30360 30284 gene locus_tag LOCUS_t00240 30360 30284 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 30947 30393 gene locus_tag LOCUS_08620 30947 30393 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 protein_id gnl|my_center|LOCUS_08620 31028 31102 gene locus_tag LOCUS_t00250 31028 31102 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31385 32503 gene locus_tag LOCUS_08630 31385 32503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 32537 33010 gene locus_tag LOCUS_08640 32537 33010 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_08640 33066 33395 gene locus_tag LOCUS_08650 33066 33395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 33623 33462 gene locus_tag LOCUS_08660 33623 33462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence11 39 269 gene locus_tag LOCUS_08670 39 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1089 262 gene locus_tag LOCUS_08680 1089 262 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249452.1 protein_id gnl|my_center|LOCUS_08680 2882 1095 gene locus_tag LOCUS_08690 2882 1095 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877518.1 protein_id gnl|my_center|LOCUS_08690 2980 3091 gene locus_tag LOCUS_r00030 2980 3091 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 4755 3280 gene locus_tag LOCUS_08700 4755 3280 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_08700 5170 4793 gene locus_tag LOCUS_08710 5170 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5246 6913 gene locus_tag LOCUS_08720 5246 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 6910 7884 gene locus_tag LOCUS_08730 6910 7884 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_08730 7881 8546 gene locus_tag LOCUS_08740 gene fsa 7881 8546 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_08740 8851 8594 gene locus_tag LOCUS_08750 8851 8594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 10094 9117 gene locus_tag LOCUS_08760 gene corA 10094 9117 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 protein_id gnl|my_center|LOCUS_08760 10313 10385 gene locus_tag LOCUS_t00260 10313 10385 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 10740 10393 gene locus_tag LOCUS_08770 10740 10393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 11539 10781 gene locus_tag LOCUS_08780 11539 10781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 11834 11565 gene locus_tag LOCUS_08790 11834 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 12178 11870 gene locus_tag LOCUS_08800 12178 11870 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_08800 12191 12997 gene locus_tag LOCUS_08810 12191 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 13858 12989 gene locus_tag LOCUS_08820 13858 12989 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020634.1 protein_id gnl|my_center|LOCUS_08820 15574 13865 gene locus_tag LOCUS_08830 15574 13865 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_08830 16575 15595 gene locus_tag LOCUS_08840 gene gds 16575 15595 CDS product geranylgeranyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980132.1 protein_id gnl|my_center|LOCUS_08840 17212 16562 gene locus_tag LOCUS_08850 17212 16562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 17957 17205 gene locus_tag LOCUS_08860 17957 17205 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250424.1 protein_id gnl|my_center|LOCUS_08860 18922 17981 gene locus_tag LOCUS_08870 gene mvk 18922 17981 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870599.1 protein_id gnl|my_center|LOCUS_08870 19564 18941 gene locus_tag LOCUS_08880 gene rpsB 19564 18941 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867661.1 protein_id gnl|my_center|LOCUS_08880 20810 19572 gene locus_tag LOCUS_08890 gene eno 20810 19572 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_08890 21048 20812 gene locus_tag LOCUS_08900 21048 20812 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_08900 21099 21186 gene locus_tag LOCUS_t00270 21099 21186 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 21812 21198 gene locus_tag LOCUS_08910 21812 21198 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496416.1 protein_id gnl|my_center|LOCUS_08910 21878 22534 gene locus_tag LOCUS_08920 21878 22534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 22531 23139 gene locus_tag LOCUS_08930 22531 23139 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_08930 23139 24212 gene locus_tag LOCUS_08940 23139 24212 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877787.1 protein_id gnl|my_center|LOCUS_08940 25956 24199 gene locus_tag LOCUS_08950 gene glmS 25956 24199 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_08950 26575 26000 gene locus_tag LOCUS_08960 26575 26000 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_08960 27130 26585 gene locus_tag LOCUS_08970 27130 26585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 27483 27806 gene locus_tag LOCUS_08980 27483 27806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 28304 27798 gene locus_tag LOCUS_08990 28304 27798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 28457 29488 gene locus_tag LOCUS_09000 28457 29488 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577656.1 protein_id gnl|my_center|LOCUS_09000 29478 30653 gene locus_tag LOCUS_09010 29478 30653 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398440.1 protein_id gnl|my_center|LOCUS_09010 32008 30650 gene locus_tag LOCUS_09020 32008 30650 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939066.1 protein_id gnl|my_center|LOCUS_09020 32189 33109 gene locus_tag LOCUS_09030 32189 33109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence12 321 1562 gene locus_tag LOCUS_09040 gene ahcY 321 1562 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_09040 1964 1581 gene locus_tag LOCUS_09050 1964 1581 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 protein_id gnl|my_center|LOCUS_09050 2116 3369 gene locus_tag LOCUS_09060 2116 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 3360 4166 gene locus_tag LOCUS_09070 3360 4166 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_09070 4175 5029 gene locus_tag LOCUS_09080 gene zurM 4175 5029 CDS product zinc ABC transporter permease ZurM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933330.1 protein_id gnl|my_center|LOCUS_09080 5160 6815 gene locus_tag LOCUS_09090 5160 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 6818 7570 gene locus_tag LOCUS_09100 6818 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 7964 8884 gene locus_tag LOCUS_09110 7964 8884 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_09110 9097 10095 gene locus_tag LOCUS_09120 gene ilvC 9097 10095 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_09120 10491 10108 gene locus_tag LOCUS_09130 10491 10108 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_09130 10712 10996 gene locus_tag LOCUS_09140 gene albA 10712 10996 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_09140 10989 11936 gene locus_tag LOCUS_09150 10989 11936 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_09150 12003 14504 gene locus_tag LOCUS_09160 12003 14504 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978604.1 protein_id gnl|my_center|LOCUS_09160 14497 14904 gene locus_tag LOCUS_09170 14497 14904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 14946 15866 gene locus_tag LOCUS_09180 gene meaB 14946 15866 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_09180 15871 17472 gene locus_tag LOCUS_09190 15871 17472 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_09190 17473 17868 gene locus_tag LOCUS_09200 gene mce 17473 17868 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_09200 18507 17893 gene locus_tag LOCUS_09210 18507 17893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 18556 19176 gene locus_tag LOCUS_09220 18556 19176 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721944.1 protein_id gnl|my_center|LOCUS_09220 19218 19469 gene locus_tag LOCUS_09230 19218 19469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 19453 19716 gene locus_tag LOCUS_09240 19453 19716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 21088 19772 gene locus_tag LOCUS_09250 21088 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 21212 21616 gene locus_tag LOCUS_09260 21212 21616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 22179 21613 gene locus_tag LOCUS_09270 22179 21613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 22332 22559 gene locus_tag LOCUS_09280 22332 22559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 22837 23412 gene locus_tag LOCUS_09290 22837 23412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 23572 23399 gene locus_tag LOCUS_09300 23572 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 23589 24743 gene locus_tag LOCUS_09310 23589 24743 CDS product CofH family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240397.1 protein_id gnl|my_center|LOCUS_09310 25045 24740 gene locus_tag LOCUS_09320 25045 24740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 25638 25315 gene locus_tag LOCUS_09330 25638 25315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 26088 25756 gene locus_tag LOCUS_09340 26088 25756 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_09340 26468 26205 gene locus_tag LOCUS_09350 26468 26205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 26579 26980 gene locus_tag LOCUS_09360 26579 26980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 26977 27330 gene locus_tag LOCUS_09370 26977 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 27478 27795 gene locus_tag LOCUS_09380 27478 27795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 28123 27815 gene locus_tag LOCUS_09390 28123 27815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 29017 28151 gene locus_tag LOCUS_09400 29017 28151 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence13 <1 798 gene locus_tag LOCUS_09410 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016795.1:histidinol-phosphate transaminase 795 1634 gene locus_tag LOCUS_09420 795 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1631 2602 gene locus_tag LOCUS_09430 gene cbiB 1631 2602 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_09430 2595 3320 gene locus_tag LOCUS_09440 gene cobS 2595 3320 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879812.1 protein_id gnl|my_center|LOCUS_09440 3317 3901 gene locus_tag LOCUS_09450 3317 3901 CDS product TIGR00454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870628.1 protein_id gnl|my_center|LOCUS_09450 4081 3884 gene locus_tag LOCUS_09460 4081 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4359 4078 gene locus_tag LOCUS_09470 4359 4078 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_09470 4429 6192 gene locus_tag LOCUS_09480 gene ade 4429 6192 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_09480 6237 7853 gene locus_tag LOCUS_09490 gene thsB 6237 7853 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_09490 7893 8762 gene locus_tag LOCUS_09500 7893 8762 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171138895.1 protein_id gnl|my_center|LOCUS_09500 9023 8763 gene locus_tag LOCUS_09510 9023 8763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 9391 9032 gene locus_tag LOCUS_09520 9391 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 10924 9401 gene locus_tag LOCUS_09530 gene guaA 10924 9401 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_09530 11501 10929 gene locus_tag LOCUS_09540 11501 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 12271 11537 gene locus_tag LOCUS_09550 12271 11537 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868117.1 protein_id gnl|my_center|LOCUS_09550 12297 13160 gene locus_tag LOCUS_09560 gene folP 12297 13160 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250112.1 protein_id gnl|my_center|LOCUS_09560 13206 14636 gene locus_tag LOCUS_09570 gene guaB 13206 14636 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_09570 15846 14764 gene locus_tag LOCUS_09580 gene pseC 15846 14764 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_09580 15954 16424 gene locus_tag LOCUS_09590 15954 16424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 17236 16421 gene locus_tag LOCUS_09600 17236 16421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 17792 17241 gene locus_tag LOCUS_09610 17792 17241 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_09610 17880 18959 gene locus_tag LOCUS_09620 17880 18959 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_09620 18962 19561 gene locus_tag LOCUS_09630 18962 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 20557 19562 gene locus_tag LOCUS_09640 gene dph2 20557 19562 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_09640 20640 21968 gene locus_tag LOCUS_09650 20640 21968 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496722.1 protein_id gnl|my_center|LOCUS_09650 22044 21969 gene locus_tag LOCUS_t00280 22044 21969 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 22125 23222 gene locus_tag LOCUS_09660 22125 23222 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_09660 23224 24480 gene locus_tag LOCUS_09670 23224 24480 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_09670 24513 25496 gene locus_tag LOCUS_09680 gene hisG 24513 25496 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_09680 25496 26764 gene locus_tag LOCUS_09690 gene hisD 25496 26764 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496833.1 protein_id gnl|my_center|LOCUS_09690 26764 27834 gene locus_tag LOCUS_09700 gene hisC 26764 27834 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931013.1 protein_id gnl|my_center|LOCUS_09700 27831 28799 gene locus_tag LOCUS_09710 27831 28799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 28824 29411 gene locus_tag LOCUS_09720 gene hisB 28824 29411 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_09720 29411 30019 gene locus_tag LOCUS_09730 gene hisH 29411 30019 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879754.1 protein_id gnl|my_center|LOCUS_09730 30016 30723 gene locus_tag LOCUS_09740 gene hisA 30016 30723 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897810.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence14 342 1 gene locus_tag LOCUS_09750 342 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 792 562 gene locus_tag LOCUS_09760 792 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1121 882 gene locus_tag LOCUS_09770 1121 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 2095 1223 gene locus_tag LOCUS_09780 2095 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 3781 2249 gene locus_tag LOCUS_09790 3781 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3916 4128 gene locus_tag LOCUS_09800 3916 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 4461 4961 gene locus_tag LOCUS_09810 4461 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 5353 5616 gene locus_tag LOCUS_09820 5353 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 5616 7064 gene locus_tag LOCUS_09830 gene gatA 5616 7064 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965958.1 protein_id gnl|my_center|LOCUS_09830 7061 8467 gene locus_tag LOCUS_09840 gene gatB 7061 8467 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846244.1 protein_id gnl|my_center|LOCUS_09840 8464 8727 gene locus_tag LOCUS_09850 8464 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 9965 8739 gene locus_tag LOCUS_09860 9965 8739 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_09860 10665 10048 gene locus_tag LOCUS_09870 10665 10048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 11071 10724 gene locus_tag LOCUS_09880 11071 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 11145 11438 gene locus_tag LOCUS_09890 11145 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 11665 11441 gene locus_tag LOCUS_09900 11665 11441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 12207 11671 gene locus_tag LOCUS_09910 12207 11671 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_09910 12270 12827 gene locus_tag LOCUS_09920 12270 12827 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_09920 12871 12947 gene locus_tag LOCUS_t00290 12871 12947 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 13194 13361 gene locus_tag LOCUS_09930 13194 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 13660 13373 gene locus_tag LOCUS_09940 13660 13373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 13852 14076 gene locus_tag LOCUS_09950 13852 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 14143 14391 gene locus_tag LOCUS_09960 14143 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 14426 14665 gene locus_tag LOCUS_09970 14426 14665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 14659 14877 gene locus_tag LOCUS_09980 14659 14877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 14945 15358 gene locus_tag LOCUS_09990 14945 15358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 15741 15355 gene locus_tag LOCUS_10000 15741 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 16179 15799 gene locus_tag LOCUS_10010 16179 15799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 16317 16463 gene locus_tag LOCUS_10020 16317 16463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 17261 16485 gene locus_tag LOCUS_10030 17261 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 17548 18354 gene locus_tag LOCUS_10040 17548 18354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 18426 19634 gene locus_tag LOCUS_10050 gene ilvA 18426 19634 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_10050 19649 19876 gene locus_tag LOCUS_10060 19649 19876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 20020 21162 gene locus_tag LOCUS_10070 gene purK 20020 21162 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081519.1 protein_id gnl|my_center|LOCUS_10070 21196 21567 gene locus_tag LOCUS_10080 21196 21567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 21618 22955 gene locus_tag LOCUS_10090 21618 22955 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023694.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence15 1482 562 gene locus_tag LOCUS_10100 1482 562 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_10100 1893 1600 gene locus_tag LOCUS_10110 1893 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1988 2131 gene locus_tag LOCUS_10120 1988 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2194 2595 gene locus_tag LOCUS_10130 2194 2595 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_10130 2792 2592 gene locus_tag LOCUS_10140 2792 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2876 3760 gene locus_tag LOCUS_10150 gene menA 2876 3760 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000536365.1 protein_id gnl|my_center|LOCUS_10150 3795 4895 gene locus_tag LOCUS_10160 3795 4895 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_10160 6040 5090 gene locus_tag LOCUS_10170 6040 5090 CDS product asparagine synthase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763183.1 protein_id gnl|my_center|LOCUS_10170 6141 6557 gene locus_tag LOCUS_10180 6141 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 6844 6554 gene locus_tag LOCUS_10190 6844 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 7459 6905 gene locus_tag LOCUS_10200 7459 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 7542 7898 gene locus_tag LOCUS_10210 7542 7898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 8185 7880 gene locus_tag LOCUS_10220 8185 7880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 8370 8582 gene locus_tag LOCUS_10230 8370 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 8803 9141 gene locus_tag LOCUS_10240 8803 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 9188 9790 gene locus_tag LOCUS_10250 9188 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 9860 11728 gene locus_tag LOCUS_10260 9860 11728 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878055.1 protein_id gnl|my_center|LOCUS_10260 11728 12606 gene locus_tag LOCUS_10270 gene speB 11728 12606 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_10270 12763 13614 gene locus_tag LOCUS_10280 gene speB 12763 13614 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263658.1 protein_id gnl|my_center|LOCUS_10280 13777 14349 gene locus_tag LOCUS_10290 gene pgsA 13777 14349 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 protein_id gnl|my_center|LOCUS_10290 14642 14352 gene locus_tag LOCUS_10300 14642 14352 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_10300 14905 15774 gene locus_tag LOCUS_10310 14905 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 15815 16813 gene locus_tag LOCUS_10320 15815 16813 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763693.1 protein_id gnl|my_center|LOCUS_10320 18387 16822 gene locus_tag LOCUS_10330 gene pyrG 18387 16822 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_10330 19285 18482 gene locus_tag LOCUS_10340 gene trpA 19285 18482 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_10340 19672 19355 gene locus_tag LOCUS_10350 19672 19355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence16 1774 2091 gene locus_tag LOCUS_10360 1774 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2352 2648 gene locus_tag LOCUS_10370 2352 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3207 2671 gene locus_tag LOCUS_10380 3207 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3836 3973 gene locus_tag LOCUS_10390 3836 3973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 4011 4604 gene locus_tag LOCUS_10400 4011 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 4708 4854 gene locus_tag LOCUS_10410 4708 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5463 5062 gene locus_tag LOCUS_10420 5463 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 6783 5587 gene locus_tag LOCUS_10430 gene trpB 6783 5587 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_10430 7556 6780 gene locus_tag LOCUS_10440 7556 6780 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870432.1 protein_id gnl|my_center|LOCUS_10440 8595 7549 gene locus_tag LOCUS_10450 gene trpD 8595 7549 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316297.1 protein_id gnl|my_center|LOCUS_10450 9182 8592 gene locus_tag LOCUS_10460 9182 8592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10460 10528 9179 gene locus_tag LOCUS_10470 gene trpE 10528 9179 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_10470 10668 10850 gene locus_tag LOCUS_10480 10668 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 11485 10877 gene locus_tag LOCUS_10490 11485 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 11599 11793 gene locus_tag LOCUS_10500 11599 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 12212 12628 gene locus_tag LOCUS_10510 12212 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 13033 12671 gene locus_tag LOCUS_10520 13033 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 13066 13305 gene locus_tag LOCUS_10530 13066 13305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 14216 13725 gene locus_tag LOCUS_10540 14216 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 15210 14620 gene locus_tag LOCUS_10550 15210 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 16045 15275 gene locus_tag LOCUS_10560 gene phnE 16045 15275 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800868.1 protein_id gnl|my_center|LOCUS_10560 16886 16071 gene locus_tag LOCUS_10570 16886 16071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 17917 16919 gene locus_tag LOCUS_10580 17917 16919 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915065.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence17 1845 1546 gene locus_tag LOCUS_10590 1845 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1970 1897 gene locus_tag LOCUS_t00300 1970 1897 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2661 1993 gene locus_tag LOCUS_10600 2661 1993 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 protein_id gnl|my_center|LOCUS_10600 3775 2663 gene locus_tag LOCUS_10610 3775 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 6473 3822 gene locus_tag LOCUS_10620 6473 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 8883 6727 gene locus_tag LOCUS_10630 8883 6727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 9149 8988 gene locus_tag LOCUS_10640 9149 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 9584 9219 gene locus_tag LOCUS_10650 9584 9219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 10740 9586 gene locus_tag LOCUS_10660 10740 9586 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_10660 10798 11265 gene locus_tag LOCUS_10670 10798 11265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 12133 11255 gene locus_tag LOCUS_10680 12133 11255 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_10680 12407 12231 gene locus_tag LOCUS_10690 12407 12231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 13218 12448 gene locus_tag LOCUS_10700 13218 12448 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080389.1 protein_id gnl|my_center|LOCUS_10700 14480 13275 gene locus_tag LOCUS_10710 14480 13275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 16375 14804 gene locus_tag LOCUS_10720 16375 14804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 16583 16377 gene locus_tag LOCUS_10730 16583 16377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence18 2272 203 gene locus_tag LOCUS_10740 2272 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3411 2272 gene locus_tag LOCUS_10750 gene mre11 3411 2272 CDS product DNA double-strand break repair protein Mre11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980186.1 protein_id gnl|my_center|LOCUS_10750 4943 3411 gene locus_tag LOCUS_10760 gene herA 4943 3411 CDS product DNA double-strand break repair helicase HerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980185.1 protein_id gnl|my_center|LOCUS_10760 5791 4940 gene locus_tag LOCUS_10770 5791 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 6801 5851 gene locus_tag LOCUS_10780 6801 5851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6870 7688 gene locus_tag LOCUS_10790 6870 7688 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_10790 7819 8736 gene locus_tag LOCUS_10800 gene nadA 7819 8736 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257284.1 protein_id gnl|my_center|LOCUS_10800 8740 9141 gene locus_tag LOCUS_10810 8740 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 9953 9138 gene locus_tag LOCUS_10820 gene nadC 9953 9138 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 protein_id gnl|my_center|LOCUS_10820 10187 9999 gene locus_tag LOCUS_10830 10187 9999 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869895.1 protein_id gnl|my_center|LOCUS_10830 10725 10189 gene locus_tag LOCUS_10840 gene rpoE 10725 10189 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_10840 10922 12049 gene locus_tag LOCUS_10850 10922 12049 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_10850 12060 12554 gene locus_tag LOCUS_10860 12060 12554 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_10860 12707 13084 gene locus_tag LOCUS_10870 12707 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 13121 15160 gene locus_tag LOCUS_10880 13121 15160 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_10880 15534 15277 gene locus_tag LOCUS_10890 15534 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 16006 15602 gene locus_tag LOCUS_10900 16006 15602 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249984.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence19 1209 721 gene locus_tag LOCUS_10910 1209 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1309 1974 gene locus_tag LOCUS_10920 1309 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2557 1976 gene locus_tag LOCUS_10930 2557 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3015 2560 gene locus_tag LOCUS_10940 3015 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3232 3951 gene locus_tag LOCUS_10950 3232 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 4884 4087 gene locus_tag LOCUS_10960 4884 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 5998 5066 gene locus_tag LOCUS_10970 5998 5066 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_10970 7489 6068 gene locus_tag LOCUS_10980 7489 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 7614 9008 gene locus_tag LOCUS_10990 gene aspA 7614 9008 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230430.1 protein_id gnl|my_center|LOCUS_10990 9012 10280 gene locus_tag LOCUS_11000 9012 10280 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_11000 10353 11300 gene locus_tag LOCUS_11010 10353 11300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 11567 11340 gene locus_tag LOCUS_11020 11567 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence20 273 470 gene locus_tag LOCUS_11030 273 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1264 668 gene locus_tag LOCUS_11040 1264 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1343 1747 gene locus_tag LOCUS_11050 1343 1747 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_11050 3020 1740 gene locus_tag LOCUS_11060 gene prf1 3020 1740 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_11060 3190 4428 gene locus_tag LOCUS_11070 3190 4428 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846588.1 protein_id gnl|my_center|LOCUS_11070 5158 4514 gene locus_tag LOCUS_11080 5158 4514 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461015.1 protein_id gnl|my_center|LOCUS_11080 5321 5536 gene locus_tag LOCUS_11090 5321 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 5614 6318 gene locus_tag LOCUS_11100 5614 6318 CDS product CbtA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_11100 6393 6722 gene locus_tag LOCUS_11110 6393 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 6730 7071 gene locus_tag LOCUS_11120 6730 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 8111 7086 gene locus_tag LOCUS_11130 8111 7086 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060989.1 protein_id gnl|my_center|LOCUS_11130 8485 8174 gene locus_tag LOCUS_11140 8485 8174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 9419 8469 gene locus_tag LOCUS_11150 9419 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 11368 9614 gene locus_tag LOCUS_11160 11368 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence21 508 179 gene locus_tag LOCUS_11170 gene metG 508 179 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762104.1 protein_id gnl|my_center|LOCUS_11170 743 546 gene locus_tag LOCUS_11180 743 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 915 1331 gene locus_tag LOCUS_11190 915 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1334 2542 gene locus_tag LOCUS_11200 gene cruC 1334 2542 CDS product hydroxychlorobactene glucosyltransferase CruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_11200 2608 3795 gene locus_tag LOCUS_11210 2608 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3842 5011 gene locus_tag LOCUS_11220 gene cofG 3842 5011 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496498.1 protein_id gnl|my_center|LOCUS_11220 5008 6267 gene locus_tag LOCUS_11230 gene cofH 5008 6267 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870949.1 protein_id gnl|my_center|LOCUS_11230 6268 7629 gene locus_tag LOCUS_11240 6268 7629 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583143.1 protein_id gnl|my_center|LOCUS_11240 7869 8846 gene locus_tag LOCUS_11250 7869 8846 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941519.1 protein_id gnl|my_center|LOCUS_11250 8964 9308 gene locus_tag LOCUS_11260 8964 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 9322 10056 gene locus_tag LOCUS_11270 9322 10056 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240307.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence22 300 743 gene locus_tag LOCUS_11280 300 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1254 733 gene locus_tag LOCUS_11290 1254 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1352 1954 gene locus_tag LOCUS_11300 1352 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2015 2089 gene locus_tag LOCUS_t00310 2015 2089 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2682 2125 gene locus_tag LOCUS_11310 2682 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3841 2927 gene locus_tag LOCUS_11320 gene ilvE 3841 2927 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_11320 3937 4143 gene locus_tag LOCUS_11330 3937 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5702 4287 gene locus_tag LOCUS_11340 5702 4287 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_11340 6773 5733 gene locus_tag LOCUS_11350 6773 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6845 6921 gene locus_tag LOCUS_t00320 6845 6921 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6998 7978 gene locus_tag LOCUS_11360 6998 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 8445 7993 gene locus_tag LOCUS_11370 8445 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 8580 8831 gene locus_tag LOCUS_11380 8580 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 <9980 9081 gene locus_tag LOCUS_11390 <9980 9081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433836.1:radical SAM protein >Feature sequence23 542 330 gene locus_tag LOCUS_11400 542 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 655 1920 gene locus_tag LOCUS_11410 655 1920 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_11410 1922 2764 gene locus_tag LOCUS_11420 1922 2764 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_11420 2798 2873 gene locus_tag LOCUS_t00330 2798 2873 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2912 3262 gene locus_tag LOCUS_11430 2912 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 3720 3259 gene locus_tag LOCUS_11440 3720 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 5371 3773 gene locus_tag LOCUS_11450 5371 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5960 5355 gene locus_tag LOCUS_11460 5960 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 7117 6149 gene locus_tag LOCUS_11470 7117 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence24 908 1810 gene locus_tag LOCUS_11480 908 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2253 2032 gene locus_tag LOCUS_11490 2253 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3714 3031 gene locus_tag LOCUS_11500 3714 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3791 4192 gene locus_tag LOCUS_11510 3791 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 4255 4869 gene locus_tag LOCUS_11520 4255 4869 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438166.1 protein_id gnl|my_center|LOCUS_11520 5093 4908 gene locus_tag LOCUS_11530 5093 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 5443 5213 gene locus_tag LOCUS_11540 5443 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5723 5529 gene locus_tag LOCUS_11550 5723 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence25 440 285 gene locus_tag LOCUS_11560 440 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 379 621 gene locus_tag LOCUS_11570 379 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1692 934 gene locus_tag LOCUS_11580 1692 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1930 1736 gene locus_tag LOCUS_11590 1930 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3522 1933 gene locus_tag LOCUS_11600 3522 1933 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470643.1 protein_id gnl|my_center|LOCUS_11600 5118 3532 gene locus_tag LOCUS_11610 5118 3532 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_11610 6395 5148 gene locus_tag LOCUS_11620 6395 5148 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence26 1502 2308 gene locus_tag LOCUS_11630 1502 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2311 2760 gene locus_tag LOCUS_11640 2311 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2802 2966 gene locus_tag LOCUS_11650 2802 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3390 2971 gene locus_tag LOCUS_11660 3390 2971 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_11660 3561 3977 gene locus_tag LOCUS_11670 3561 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 4010 5053 gene locus_tag LOCUS_11680 4010 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5361 5050 gene locus_tag LOCUS_11690 gene cutA 5361 5050 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250982.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence27 582 1424 gene locus_tag LOCUS_11700 582 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 2016 1438 gene locus_tag LOCUS_11710 2016 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2168 4951 gene locus_tag LOCUS_11720 2168 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence28 517 1593 gene locus_tag LOCUS_11730 gene asd 517 1593 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_11730 1665 2132 gene locus_tag LOCUS_11740 1665 2132 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903000.1 protein_id gnl|my_center|LOCUS_11740 2132 3064 gene locus_tag LOCUS_11750 gene cyoE 2132 3064 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083746.1 protein_id gnl|my_center|LOCUS_11750 3268 3059 gene locus_tag LOCUS_11760 3268 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 3589 4062 gene locus_tag LOCUS_11770 3589 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 4165 4812 gene locus_tag LOCUS_11780 4165 4812 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479969.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence29 565 8 gene locus_tag LOCUS_11790 565 8 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744266.1 protein_id gnl|my_center|LOCUS_11790 708 1043 gene locus_tag LOCUS_11800 708 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 1442 1044 gene locus_tag LOCUS_11810 1442 1044 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_11810 1586 1510 gene locus_tag LOCUS_t00340 1586 1510 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2372 1659 gene locus_tag LOCUS_11820 2372 1659 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377790.1 protein_id gnl|my_center|LOCUS_11820 2444 2953 gene locus_tag LOCUS_11830 gene bcp 2444 2953 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_11830