>Feature sequence01 848 114 gene locus_tag LOCUS_00010 gene sodB 848 114 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357051.1 protein_id gnl|my_center|LOCUS_00010 1623 1027 gene locus_tag LOCUS_00020 gene ruvA 1623 1027 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_00020 1772 2671 gene locus_tag LOCUS_00030 1772 2671 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203408.1 protein_id gnl|my_center|LOCUS_00030 4144 2849 gene locus_tag LOCUS_00040 4144 2849 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109350.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00040 4383 4096 gene locus_tag LOCUS_00050 4383 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00050 6161 4641 gene locus_tag LOCUS_00060 6161 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7687 6989 gene locus_tag LOCUS_00070 7687 6989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_00070 10105 7754 gene locus_tag LOCUS_00080 10105 7754 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107560.1 protein_id gnl|my_center|LOCUS_00080 11395 10145 gene locus_tag LOCUS_00090 11395 10145 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787749.1 protein_id gnl|my_center|LOCUS_00090 12870 11407 gene locus_tag LOCUS_00100 12870 11407 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787747.1 protein_id gnl|my_center|LOCUS_00100 13197 14564 gene locus_tag LOCUS_00110 13197 14564 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793798.1 protein_id gnl|my_center|LOCUS_00110 14561 15832 gene locus_tag LOCUS_00120 14561 15832 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107493.1 protein_id gnl|my_center|LOCUS_00120 16264 15737 gene locus_tag LOCUS_00130 16264 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 16473 17306 gene locus_tag LOCUS_00140 gene lgt 16473 17306 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_00140 17602 19914 gene locus_tag LOCUS_00150 17602 19914 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814886.1 protein_id gnl|my_center|LOCUS_00150 19938 21809 gene locus_tag LOCUS_00160 19938 21809 CDS product GH32 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107965.1 protein_id gnl|my_center|LOCUS_00160 21843 24032 gene locus_tag LOCUS_00170 21843 24032 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201924.1 protein_id gnl|my_center|LOCUS_00170 24090 25208 gene locus_tag LOCUS_00180 24090 25208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_00180 25218 26111 gene locus_tag LOCUS_00190 25218 26111 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767783.1 protein_id gnl|my_center|LOCUS_00190 26359 29106 gene locus_tag LOCUS_00200 26359 29106 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461661.1 protein_id gnl|my_center|LOCUS_00200 29184 29825 gene locus_tag LOCUS_00210 29184 29825 CDS product DUF3256 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202200.1 protein_id gnl|my_center|LOCUS_00210 30226 31131 gene locus_tag LOCUS_00220 30226 31131 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_00220 31320 31862 gene locus_tag LOCUS_00230 31320 31862 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_00230 31891 33228 gene locus_tag LOCUS_00240 31891 33228 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100232.1 protein_id gnl|my_center|LOCUS_00240 33268 34023 gene locus_tag LOCUS_00250 gene tpiA 33268 34023 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_00250 34139 34594 gene locus_tag LOCUS_00260 34139 34594 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791114.1 protein_id gnl|my_center|LOCUS_00260 34594 35181 gene locus_tag LOCUS_00270 gene folE 34594 35181 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_00270 37411 35237 gene locus_tag LOCUS_00280 gene dnaG 37411 35237 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109025.1 protein_id gnl|my_center|LOCUS_00280 38164 37508 gene locus_tag LOCUS_00290 38164 37508 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435799.1 protein_id gnl|my_center|LOCUS_00290 39246 38245 gene locus_tag LOCUS_00300 39246 38245 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_00300 39573 39409 gene locus_tag LOCUS_00310 39573 39409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 39763 41064 gene locus_tag LOCUS_00320 39763 41064 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_00320 41080 43932 gene locus_tag LOCUS_00330 41080 43932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 44090 46564 gene locus_tag LOCUS_00340 44090 46564 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_00340 46645 48978 gene locus_tag LOCUS_00350 46645 48978 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_00350 49837 49037 gene locus_tag LOCUS_00360 49837 49037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 50630 49935 gene locus_tag LOCUS_00370 50630 49935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 51022 50657 gene locus_tag LOCUS_00380 51022 50657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00380 51559 51140 gene locus_tag LOCUS_00390 51559 51140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 52582 51656 gene locus_tag LOCUS_00400 52582 51656 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964642.1 protein_id gnl|my_center|LOCUS_00400 53446 52664 gene locus_tag LOCUS_00410 53446 52664 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785293.1 protein_id gnl|my_center|LOCUS_00410 54499 53600 gene locus_tag LOCUS_00420 54499 53600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 55003 55617 gene locus_tag LOCUS_00430 55003 55617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 57401 55797 gene locus_tag LOCUS_00440 57401 55797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 57879 59585 gene locus_tag LOCUS_00450 gene kdpA 57879 59585 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108291.1 protein_id gnl|my_center|LOCUS_00450 59657 61690 gene locus_tag LOCUS_00460 gene kdpB 59657 61690 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763738.1 protein_id gnl|my_center|LOCUS_00460 61708 62292 gene locus_tag LOCUS_00470 61708 62292 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764090.1 protein_id gnl|my_center|LOCUS_00470 62369 63055 gene locus_tag LOCUS_00480 62369 63055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107993.1 protein_id gnl|my_center|LOCUS_00480 63200 65455 gene locus_tag LOCUS_00490 63200 65455 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_00490 65459 67249 gene locus_tag LOCUS_00500 65459 67249 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403165.1 protein_id gnl|my_center|LOCUS_00500 67262 68395 gene locus_tag LOCUS_00510 67262 68395 CDS product sensor protein KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784495.1 protein_id gnl|my_center|LOCUS_00510 68401 69894 gene locus_tag LOCUS_00520 68401 69894 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764093.1 protein_id gnl|my_center|LOCUS_00520 70043 70918 gene locus_tag LOCUS_00530 70043 70918 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767386.1 protein_id gnl|my_center|LOCUS_00530 71292 74540 gene locus_tag LOCUS_00540 71292 74540 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203130.1 protein_id gnl|my_center|LOCUS_00540 74543 76450 gene locus_tag LOCUS_00550 74543 76450 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_00550 76471 77319 gene locus_tag LOCUS_00560 76471 77319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 77627 78112 gene locus_tag LOCUS_00570 77627 78112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 78096 79541 gene locus_tag LOCUS_00580 78096 79541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 79589 81001 gene locus_tag LOCUS_00590 79589 81001 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_00590 81008 82765 gene locus_tag LOCUS_00600 81008 82765 CDS product DUF6057 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202172.1 protein_id gnl|my_center|LOCUS_00600 82773 84233 gene locus_tag LOCUS_00610 82773 84233 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813223.1 protein_id gnl|my_center|LOCUS_00610 84676 84353 gene locus_tag LOCUS_00620 84676 84353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 86166 84820 gene locus_tag LOCUS_00630 86166 84820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 86742 87290 gene locus_tag LOCUS_00640 86742 87290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 87302 87754 gene locus_tag LOCUS_00650 87302 87754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 87759 88199 gene locus_tag LOCUS_00660 87759 88199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918262.1 protein_id gnl|my_center|LOCUS_00660 89781 88810 gene locus_tag LOCUS_00670 89781 88810 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_00670 91392 89974 gene locus_tag LOCUS_00680 91392 89974 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_00680 92793 91402 gene locus_tag LOCUS_00690 92793 91402 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785038.1 protein_id gnl|my_center|LOCUS_00690 94826 92937 gene locus_tag LOCUS_00700 gene nuoL 94826 92937 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785040.1 protein_id gnl|my_center|LOCUS_00700 95176 94859 gene locus_tag LOCUS_00710 gene nuoK 95176 94859 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775579.1 protein_id gnl|my_center|LOCUS_00710 95709 95179 gene locus_tag LOCUS_00720 95709 95179 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_00720 96184 95717 gene locus_tag LOCUS_00730 96184 95717 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785046.1 protein_id gnl|my_center|LOCUS_00730 97294 96194 gene locus_tag LOCUS_00740 gene nuoH 97294 96194 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_00740 98937 97315 gene locus_tag LOCUS_00750 98937 97315 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785050.1 protein_id gnl|my_center|LOCUS_00750 99551 98958 gene locus_tag LOCUS_00760 99551 98958 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_00760 99892 99542 gene locus_tag LOCUS_00770 99892 99542 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775585.1 protein_id gnl|my_center|LOCUS_00770 100388 99987 gene locus_tag LOCUS_00780 100388 99987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 101850 100510 gene locus_tag LOCUS_00790 gene trkA 101850 100510 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764324.1 protein_id gnl|my_center|LOCUS_00790 103754 101847 gene locus_tag LOCUS_00800 gene dxs 103754 101847 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_00800 103980 104831 gene locus_tag LOCUS_00810 103980 104831 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_00810 104807 107272 gene locus_tag LOCUS_00820 104807 107272 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_00820 109076 107454 gene locus_tag LOCUS_00830 109076 107454 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_00830 110126 109203 gene locus_tag LOCUS_00840 gene kduI 110126 109203 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_00840 111538 110147 gene locus_tag LOCUS_00850 111538 110147 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_00850 111861 113906 gene locus_tag LOCUS_00860 111861 113906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 114064 117270 gene locus_tag LOCUS_00870 114064 117270 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_00870 117298 119250 gene locus_tag LOCUS_00880 117298 119250 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_00880 119281 120930 gene locus_tag LOCUS_00890 119281 120930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 121031 122641 gene locus_tag LOCUS_00900 121031 122641 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_00900 122696 124297 gene locus_tag LOCUS_00910 122696 124297 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_00910 124528 126051 gene locus_tag LOCUS_00920 124528 126051 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109109.1 protein_id gnl|my_center|LOCUS_00920 126087 128285 gene locus_tag LOCUS_00930 126087 128285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 128289 130013 gene locus_tag LOCUS_00940 128289 130013 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474328.1 protein_id gnl|my_center|LOCUS_00940 130209 134666 gene locus_tag LOCUS_00950 130209 134666 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109105.1 protein_id gnl|my_center|LOCUS_00950 137035 134759 gene locus_tag LOCUS_00960 137035 134759 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766928.1 protein_id gnl|my_center|LOCUS_00960 141731 137073 gene locus_tag LOCUS_00970 141731 137073 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303127.1 protein_id gnl|my_center|LOCUS_00970 141966 142871 gene locus_tag LOCUS_00980 141966 142871 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_00980 144783 143383 gene locus_tag LOCUS_00990 144783 143383 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767229.1 protein_id gnl|my_center|LOCUS_00990 147941 144795 gene locus_tag LOCUS_01000 147941 144795 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108542.1 protein_id gnl|my_center|LOCUS_01000 148972 147983 gene locus_tag LOCUS_01010 148972 147983 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761836.1 protein_id gnl|my_center|LOCUS_01010 149299 150192 gene locus_tag LOCUS_01020 149299 150192 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767227.1 protein_id gnl|my_center|LOCUS_01020 150535 152085 gene locus_tag LOCUS_01030 150535 152085 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798980.1 protein_id gnl|my_center|LOCUS_01030 153422 152253 gene locus_tag LOCUS_01040 153422 152253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 153816 153741 gene locus_tag LOCUS_t00010 153816 153741 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 154102 154776 gene locus_tag LOCUS_01050 154102 154776 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763217.1 protein_id gnl|my_center|LOCUS_01050 154892 156256 gene locus_tag LOCUS_01060 gene hisS 154892 156256 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_01060 156342 156755 gene locus_tag LOCUS_01070 gene pth2 156342 156755 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320039.1 protein_id gnl|my_center|LOCUS_01070 158263 156824 gene locus_tag LOCUS_01080 gene rmuC 158263 156824 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072114.1 protein_id gnl|my_center|LOCUS_01080 160738 158264 gene locus_tag LOCUS_01090 160738 158264 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_01090 161306 160935 gene locus_tag LOCUS_01100 161306 160935 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_01100 162603 162154 gene locus_tag LOCUS_01110 162603 162154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 163001 162699 gene locus_tag LOCUS_01120 163001 162699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01120 163323 163595 gene locus_tag LOCUS_01130 163323 163595 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_01130 163638 165275 gene locus_tag LOCUS_01140 gene groL 163638 165275 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763228.1 protein_id gnl|my_center|LOCUS_01140 165647 167302 gene locus_tag LOCUS_01150 165647 167302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 167500 167979 gene locus_tag LOCUS_01160 167500 167979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 168256 168723 gene locus_tag LOCUS_01170 168256 168723 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768302.1 protein_id gnl|my_center|LOCUS_01170 169574 169071 gene locus_tag LOCUS_01180 169574 169071 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_01180 171491 169686 gene locus_tag LOCUS_01190 171491 169686 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_01190 173056 171716 gene locus_tag LOCUS_01200 gene mgtE 173056 171716 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784864.1 protein_id gnl|my_center|LOCUS_01200 173924 173100 gene locus_tag LOCUS_01210 gene rsmA 173924 173100 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_01210 174140 175024 gene locus_tag LOCUS_01220 174140 175024 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202131.1 protein_id gnl|my_center|LOCUS_01220 175028 176488 gene locus_tag LOCUS_01230 175028 176488 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_01230 177545 176547 gene locus_tag LOCUS_01240 177545 176547 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784898.1 protein_id gnl|my_center|LOCUS_01240 178382 177558 gene locus_tag LOCUS_01250 178382 177558 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_01250 178501 179427 gene locus_tag LOCUS_01260 178501 179427 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784893.1 protein_id gnl|my_center|LOCUS_01260 179424 181319 gene locus_tag LOCUS_01270 179424 181319 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695901.1 protein_id gnl|my_center|LOCUS_01270 181543 183078 gene locus_tag LOCUS_01280 181543 183078 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788346.1 protein_id gnl|my_center|LOCUS_01280 183109 183543 gene locus_tag LOCUS_01290 gene mscL 183109 183543 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785250.1 protein_id gnl|my_center|LOCUS_01290 184002 183634 gene locus_tag LOCUS_01300 184002 183634 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357588.1 protein_id gnl|my_center|LOCUS_01300 185201 184008 gene locus_tag LOCUS_01310 185201 184008 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760938.1 protein_id gnl|my_center|LOCUS_01310 185343 185828 gene locus_tag LOCUS_01320 185343 185828 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766715.1 protein_id gnl|my_center|LOCUS_01320 185955 186842 gene locus_tag LOCUS_01330 185955 186842 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763252.1 protein_id gnl|my_center|LOCUS_01330 186848 187867 gene locus_tag LOCUS_01340 186848 187867 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763251.1 protein_id gnl|my_center|LOCUS_01340 187867 189573 gene locus_tag LOCUS_01350 187867 189573 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_01350 189782 190951 gene locus_tag LOCUS_01360 189782 190951 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461650.1 protein_id gnl|my_center|LOCUS_01360 190993 191466 gene locus_tag LOCUS_01370 190993 191466 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_01370 192942 191533 gene locus_tag LOCUS_01380 gene pelB 192942 191533 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence02 1647 925 gene locus_tag LOCUS_01390 1647 925 CDS product DUF5932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787590.1 protein_id gnl|my_center|LOCUS_01390 5931 1663 gene locus_tag LOCUS_01400 5931 1663 CDS product DUF5113 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202794.1 protein_id gnl|my_center|LOCUS_01400 6412 6236 gene locus_tag LOCUS_01410 6412 6236 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780999.1 protein_id gnl|my_center|LOCUS_01410 8181 6739 gene locus_tag LOCUS_01420 8181 6739 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_01420 9474 8203 gene locus_tag LOCUS_01430 9474 8203 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_01430 11433 9490 gene locus_tag LOCUS_01440 11433 9490 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_01440 12966 11692 gene locus_tag LOCUS_01450 gene serS 12966 11692 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_01450 14236 13073 gene locus_tag LOCUS_01460 14236 13073 CDS product OprO/OprP family phosphate-selective porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785545.1 protein_id gnl|my_center|LOCUS_01460 15193 14384 gene locus_tag LOCUS_01470 gene kdsA 15193 14384 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_01470 16131 15199 gene locus_tag LOCUS_01480 16131 15199 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785352.1 protein_id gnl|my_center|LOCUS_01480 17057 16143 gene locus_tag LOCUS_01490 gene miaA 17057 16143 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_01490 17949 17155 gene locus_tag LOCUS_01500 17949 17155 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_01500 18224 18149 gene locus_tag LOCUS_t00020 18224 18149 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 18989 18351 gene locus_tag LOCUS_01510 18989 18351 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761607.1 protein_id gnl|my_center|LOCUS_01510 19048 19554 gene locus_tag LOCUS_01520 19048 19554 CDS product 3'-5' exoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762345.1 protein_id gnl|my_center|LOCUS_01520 20080 19562 gene locus_tag LOCUS_01530 20080 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 21130 20195 gene locus_tag LOCUS_01540 21130 20195 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788072.1 protein_id gnl|my_center|LOCUS_01540 22609 21131 gene locus_tag LOCUS_01550 gene rlmD 22609 21131 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_01550 22837 25557 gene locus_tag LOCUS_01560 gene ppdK 22837 25557 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202911.1 protein_id gnl|my_center|LOCUS_01560 25876 27252 gene locus_tag LOCUS_01570 25876 27252 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793803.1 protein_id gnl|my_center|LOCUS_01570 27629 27330 gene locus_tag LOCUS_01580 27629 27330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 27728 28231 gene locus_tag LOCUS_01590 27728 28231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 28244 29476 gene locus_tag LOCUS_01600 28244 29476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 29480 47788 gene locus_tag LOCUS_01610 29480 47788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 47854 49824 gene locus_tag LOCUS_01620 47854 49824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 50327 49947 gene locus_tag LOCUS_01630 50327 49947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 52451 50346 gene locus_tag LOCUS_01640 52451 50346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 52939 52448 gene locus_tag LOCUS_01650 52939 52448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 53402 54244 gene locus_tag LOCUS_01660 53402 54244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 54333 55721 gene locus_tag LOCUS_01670 54333 55721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 55812 56300 gene locus_tag LOCUS_01680 55812 56300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 56311 56943 gene locus_tag LOCUS_01690 56311 56943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 56956 58134 gene locus_tag LOCUS_01700 56956 58134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 58136 59194 gene locus_tag LOCUS_01710 58136 59194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 59213 61864 gene locus_tag LOCUS_01720 59213 61864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 61899 63515 gene locus_tag LOCUS_01730 61899 63515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 63660 63983 gene locus_tag LOCUS_01740 63660 63983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 64337 65635 gene locus_tag LOCUS_01750 64337 65635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 65635 66135 gene locus_tag LOCUS_01760 65635 66135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 66113 66766 gene locus_tag LOCUS_01770 66113 66766 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764600.1 protein_id gnl|my_center|LOCUS_01770 66753 67280 gene locus_tag LOCUS_01780 66753 67280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 67283 68062 gene locus_tag LOCUS_01790 67283 68062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 68074 68523 gene locus_tag LOCUS_01800 68074 68523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 68550 69062 gene locus_tag LOCUS_01810 68550 69062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 69076 69612 gene locus_tag LOCUS_01820 69076 69612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 72503 69654 gene locus_tag LOCUS_01830 72503 69654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 72568 72882 gene locus_tag LOCUS_01840 72568 72882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 73291 72887 gene locus_tag LOCUS_01850 73291 72887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 73554 73339 gene locus_tag LOCUS_01860 73554 73339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 73760 73566 gene locus_tag LOCUS_01870 73760 73566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 74019 73762 gene locus_tag LOCUS_01880 74019 73762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 74263 74057 gene locus_tag LOCUS_01890 74263 74057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 74652 74278 gene locus_tag LOCUS_01900 74652 74278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 76487 74670 gene locus_tag LOCUS_01910 76487 74670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 76750 76484 gene locus_tag LOCUS_01920 76750 76484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 77637 76654 gene locus_tag LOCUS_01930 77637 76654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 78117 77710 gene locus_tag LOCUS_01940 78117 77710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 78588 78316 gene locus_tag LOCUS_01950 78588 78316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 78742 78488 gene locus_tag LOCUS_01960 78742 78488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 80144 78729 gene locus_tag LOCUS_01970 80144 78729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 80337 80125 gene locus_tag LOCUS_01980 80337 80125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 80786 80352 gene locus_tag LOCUS_01990 80786 80352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 81455 80796 gene locus_tag LOCUS_02000 81455 80796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 82665 81457 gene locus_tag LOCUS_02010 82665 81457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 83701 82691 gene locus_tag LOCUS_02020 83701 82691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 84912 84640 gene locus_tag LOCUS_02030 84912 84640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 85409 85161 gene locus_tag LOCUS_02040 85409 85161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 85573 85938 gene locus_tag LOCUS_02050 85573 85938 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793641.1 protein_id gnl|my_center|LOCUS_02050 85970 86395 gene locus_tag LOCUS_02060 85970 86395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 86399 86707 gene locus_tag LOCUS_02070 86399 86707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 86721 87350 gene locus_tag LOCUS_02080 86721 87350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 87574 87726 gene locus_tag LOCUS_02090 87574 87726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 88467 88018 gene locus_tag LOCUS_02100 88467 88018 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_02100 88909 88574 gene locus_tag LOCUS_02110 88909 88574 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_02110 89732 88944 gene locus_tag LOCUS_02120 gene bamD 89732 88944 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763159.1 protein_id gnl|my_center|LOCUS_02120 89979 92006 gene locus_tag LOCUS_02130 gene uvrB 89979 92006 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_02130 92030 92599 gene locus_tag LOCUS_02140 92030 92599 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791762.1 protein_id gnl|my_center|LOCUS_02140 93059 92697 gene locus_tag LOCUS_02150 93059 92697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763961.1 protein_id gnl|my_center|LOCUS_02150 94243 93464 gene locus_tag LOCUS_02160 94243 93464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 95851 94583 gene locus_tag LOCUS_02170 gene nqrF 95851 94583 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763481.1 protein_id gnl|my_center|LOCUS_02170 96421 95870 gene locus_tag LOCUS_02180 gene nqrE 96421 95870 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763480.1 protein_id gnl|my_center|LOCUS_02180 97163 96528 gene locus_tag LOCUS_02190 97163 96528 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763479.1 protein_id gnl|my_center|LOCUS_02190 97858 97181 gene locus_tag LOCUS_02200 97858 97181 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_02200 99037 97871 gene locus_tag LOCUS_02210 99037 97871 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_02210 100416 99064 gene locus_tag LOCUS_02220 100416 99064 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_02220 102119 100746 gene locus_tag LOCUS_02230 102119 100746 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794507.1 protein_id gnl|my_center|LOCUS_02230 102291 106829 gene locus_tag LOCUS_02240 102291 106829 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_02240 106833 107858 gene locus_tag LOCUS_02250 106833 107858 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765713.1 protein_id gnl|my_center|LOCUS_02250 107870 108757 gene locus_tag LOCUS_02260 107870 108757 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761543.1 protein_id gnl|my_center|LOCUS_02260 110365 108863 gene locus_tag LOCUS_02270 110365 108863 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769710.1 protein_id gnl|my_center|LOCUS_02270 110530 112701 gene locus_tag LOCUS_02280 110530 112701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 113643 112777 gene locus_tag LOCUS_02290 113643 112777 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967956.1 protein_id gnl|my_center|LOCUS_02290 114389 113868 gene locus_tag LOCUS_02300 114389 113868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 115443 114445 gene locus_tag LOCUS_02310 115443 114445 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202798.1 protein_id gnl|my_center|LOCUS_02310 115805 115440 gene locus_tag LOCUS_02320 115805 115440 CDS product YbaN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764611.1 protein_id gnl|my_center|LOCUS_02320 115894 117039 gene locus_tag LOCUS_02330 115894 117039 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108863.1 protein_id gnl|my_center|LOCUS_02330 117416 117865 gene locus_tag LOCUS_02340 gene umuD 117416 117865 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768414.1 protein_id gnl|my_center|LOCUS_02340 117862 119130 gene locus_tag LOCUS_02350 117862 119130 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768413.1 protein_id gnl|my_center|LOCUS_02350 120921 119251 gene locus_tag LOCUS_02360 120921 119251 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787533.1 protein_id gnl|my_center|LOCUS_02360 121052 122227 gene locus_tag LOCUS_02370 121052 122227 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_02370 122475 122714 gene locus_tag LOCUS_02380 122475 122714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 122778 123266 gene locus_tag LOCUS_02390 122778 123266 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291426.1 protein_id gnl|my_center|LOCUS_02390 123412 123840 gene locus_tag LOCUS_02400 123412 123840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 124917 124039 gene locus_tag LOCUS_02410 124917 124039 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202768.1 protein_id gnl|my_center|LOCUS_02410 126515 124923 gene locus_tag LOCUS_02420 gene atpA 126515 124923 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_02420 127086 126532 gene locus_tag LOCUS_02430 127086 126532 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761392.1 protein_id gnl|my_center|LOCUS_02430 127596 127093 gene locus_tag LOCUS_02440 gene atpF 127596 127093 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787487.1 protein_id gnl|my_center|LOCUS_02440 127869 127615 gene locus_tag LOCUS_02450 gene atpE 127869 127615 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777530.1 protein_id gnl|my_center|LOCUS_02450 129093 127915 gene locus_tag LOCUS_02460 gene atpB 129093 127915 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_02460 129503 129090 gene locus_tag LOCUS_02470 129503 129090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 129822 129577 gene locus_tag LOCUS_02480 gene atpC 129822 129577 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_02480 131367 129835 gene locus_tag LOCUS_02490 gene atpD 131367 129835 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_02490 132133 131723 gene locus_tag LOCUS_02500 132133 131723 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_02500 133146 132292 gene locus_tag LOCUS_02510 133146 132292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 134590 133403 gene locus_tag LOCUS_02520 134590 133403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109198.1 protein_id gnl|my_center|LOCUS_02520 135232 134603 gene locus_tag LOCUS_02530 135232 134603 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801226.1 protein_id gnl|my_center|LOCUS_02530 136796 135294 gene locus_tag LOCUS_02540 136796 135294 CDS product DUF4836 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109199.1 protein_id gnl|my_center|LOCUS_02540 137508 136810 gene locus_tag LOCUS_02550 137508 136810 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_02550 138105 137512 gene locus_tag LOCUS_02560 138105 137512 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_02560 139440 138172 gene locus_tag LOCUS_02570 139440 138172 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767999.1 protein_id gnl|my_center|LOCUS_02570 141152 139653 gene locus_tag LOCUS_02580 141152 139653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 142260 141568 gene locus_tag LOCUS_02590 142260 141568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 142881 143747 gene locus_tag LOCUS_02600 142881 143747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 144216 143773 gene locus_tag LOCUS_02610 144216 143773 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788614.1 protein_id gnl|my_center|LOCUS_02610 144766 144317 gene locus_tag LOCUS_02620 144766 144317 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788616.1 protein_id gnl|my_center|LOCUS_02620 145234 144986 gene locus_tag LOCUS_02630 145234 144986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 146485 145502 gene locus_tag LOCUS_02640 146485 145502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 146748 146482 gene locus_tag LOCUS_02650 146748 146482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 149695 147107 gene locus_tag LOCUS_02660 149695 147107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 150256 150035 gene locus_tag LOCUS_02670 150256 150035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 150743 152149 gene locus_tag LOCUS_02680 150743 152149 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766006.1 protein_id gnl|my_center|LOCUS_02680 152627 155017 gene locus_tag LOCUS_02690 152627 155017 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694753.1 protein_id gnl|my_center|LOCUS_02690 155023 156144 gene locus_tag LOCUS_02700 155023 156144 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107922.1 protein_id gnl|my_center|LOCUS_02700 156199 157449 gene locus_tag LOCUS_02710 156199 157449 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_02710 157467 160451 gene locus_tag LOCUS_02720 157467 160451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 160463 162043 gene locus_tag LOCUS_02730 160463 162043 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267807.1 protein_id gnl|my_center|LOCUS_02730 162050 163276 gene locus_tag LOCUS_02740 162050 163276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 163273 164388 gene locus_tag LOCUS_02750 163273 164388 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143696.1 protein_id gnl|my_center|LOCUS_02750 164395 165081 gene locus_tag LOCUS_02760 164395 165081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 165108 166022 gene locus_tag LOCUS_02770 165108 166022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 166039 166869 gene locus_tag LOCUS_02780 166039 166869 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_02780 166892 167644 gene locus_tag LOCUS_02790 gene kdsA 166892 167644 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023041482.1 protein_id gnl|my_center|LOCUS_02790 167646 168125 gene locus_tag LOCUS_02800 167646 168125 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016229.1 protein_id gnl|my_center|LOCUS_02800 168115 169059 gene locus_tag LOCUS_02810 168115 169059 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_02810 169707 170042 gene locus_tag LOCUS_02820 169707 170042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 170048 170689 gene locus_tag LOCUS_02830 170048 170689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 170686 171675 gene locus_tag LOCUS_02840 170686 171675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 171844 173718 gene locus_tag LOCUS_02850 171844 173718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 173862 174044 gene locus_tag LOCUS_02860 173862 174044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02860 >Feature sequence03 2575 227 gene locus_tag LOCUS_02870 2575 227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_02870 4876 2630 gene locus_tag LOCUS_02880 4876 2630 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_02880 5640 4999 gene locus_tag LOCUS_02890 5640 4999 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786293.1 protein_id gnl|my_center|LOCUS_02890 6899 5649 gene locus_tag LOCUS_02900 6899 5649 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_02900 8290 6932 gene locus_tag LOCUS_02910 8290 6932 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_02910 8491 9870 gene locus_tag LOCUS_02920 8491 9870 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107402.1 protein_id gnl|my_center|LOCUS_02920 9860 11167 gene locus_tag LOCUS_02930 9860 11167 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_02930 11586 11170 gene locus_tag LOCUS_02940 11586 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763662.1 protein_id gnl|my_center|LOCUS_02940 12960 11719 gene locus_tag LOCUS_02950 12960 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202177.1 protein_id gnl|my_center|LOCUS_02950 15680 13002 gene locus_tag LOCUS_02960 15680 13002 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_02960 15978 16445 gene locus_tag LOCUS_02970 gene rimP 15978 16445 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783918.1 protein_id gnl|my_center|LOCUS_02970 16448 17707 gene locus_tag LOCUS_02980 gene nusA 16448 17707 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_02980 17831 20737 gene locus_tag LOCUS_02990 gene infB 17831 20737 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108813.1 protein_id gnl|my_center|LOCUS_02990 20864 21430 gene locus_tag LOCUS_03000 20864 21430 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796780.1 protein_id gnl|my_center|LOCUS_03000 21432 22886 gene locus_tag LOCUS_03010 gene sufB 21432 22886 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_03010 22951 23703 gene locus_tag LOCUS_03020 gene sufC 22951 23703 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_03020 23706 25049 gene locus_tag LOCUS_03030 gene sufD 23706 25049 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_03030 25251 26468 gene locus_tag LOCUS_03040 25251 26468 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_03040 26511 26819 gene locus_tag LOCUS_03050 26511 26819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 27445 26921 gene locus_tag LOCUS_03060 27445 26921 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798230.1 protein_id gnl|my_center|LOCUS_03060 27792 27520 gene locus_tag LOCUS_03070 27792 27520 CDS product LysO family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763960.1 protein_id gnl|my_center|LOCUS_03070 27964 28566 gene locus_tag LOCUS_03080 27964 28566 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_03080 29429 28656 gene locus_tag LOCUS_03090 29429 28656 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217507.1 protein_id gnl|my_center|LOCUS_03090 29645 31159 gene locus_tag LOCUS_03100 gene gpmI 29645 31159 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_03100 31281 31862 gene locus_tag LOCUS_03110 31281 31862 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_03110 33411 32098 gene locus_tag LOCUS_03120 33411 32098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 35650 33566 gene locus_tag LOCUS_03130 35650 33566 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108937.1 protein_id gnl|my_center|LOCUS_03130 36842 35784 gene locus_tag LOCUS_03140 36842 35784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 38067 36865 gene locus_tag LOCUS_03150 38067 36865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 39687 38095 gene locus_tag LOCUS_03160 gene susD 39687 38095 CDS product starch-binding outer membrane lipoprotein SusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767005.1 protein_id gnl|my_center|LOCUS_03160 42891 39706 gene locus_tag LOCUS_03170 42891 39706 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108938.1 protein_id gnl|my_center|LOCUS_03170 45152 42969 gene locus_tag LOCUS_03180 45152 42969 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767003.1 protein_id gnl|my_center|LOCUS_03180 47068 45326 gene locus_tag LOCUS_03190 47068 45326 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767002.1 protein_id gnl|my_center|LOCUS_03190 49777 47423 gene locus_tag LOCUS_03200 49777 47423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 49834 50082 gene locus_tag LOCUS_03210 49834 50082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 51234 50071 gene locus_tag LOCUS_03220 51234 50071 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_03220 51493 53094 gene locus_tag LOCUS_03230 51493 53094 CDS product DUF6377 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767001.1 protein_id gnl|my_center|LOCUS_03230 53142 54506 gene locus_tag LOCUS_03240 53142 54506 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_03240 57477 54799 gene locus_tag LOCUS_03250 57477 54799 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_03250 59709 57745 gene locus_tag LOCUS_03260 gene gyrB 59709 57745 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763685.1 protein_id gnl|my_center|LOCUS_03260 60169 59915 gene locus_tag LOCUS_03270 gene rpsT 60169 59915 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_03270 60284 60212 gene locus_tag LOCUS_t00030 60284 60212 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 60456 61178 gene locus_tag LOCUS_03280 gene recO 60456 61178 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_03280 62013 61564 gene locus_tag LOCUS_03290 62013 61564 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_03290 63345 62041 gene locus_tag LOCUS_03300 gene ftsZ 63345 62041 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_03300 64949 63378 gene locus_tag LOCUS_03310 64949 63378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 65690 64953 gene locus_tag LOCUS_03320 65690 64953 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_03320 67063 65687 gene locus_tag LOCUS_03330 gene murC 67063 65687 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_03330 68183 67053 gene locus_tag LOCUS_03340 gene murG 68183 67053 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_03340 69547 68252 gene locus_tag LOCUS_03350 69547 68252 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763712.1 protein_id gnl|my_center|LOCUS_03350 70896 69562 gene locus_tag LOCUS_03360 gene murD 70896 69562 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_03360 72116 70902 gene locus_tag LOCUS_03370 gene mraY 72116 70902 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_03370 73633 72179 gene locus_tag LOCUS_03380 73633 72179 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_03380 75774 73648 gene locus_tag LOCUS_03390 75774 73648 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796729.1 protein_id gnl|my_center|LOCUS_03390 76141 75782 gene locus_tag LOCUS_03400 76141 75782 CDS product FtsL-like putative cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763719.1 protein_id gnl|my_center|LOCUS_03400 77069 76158 gene locus_tag LOCUS_03410 gene rsmH 77069 76158 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_03410 77377 78195 gene locus_tag LOCUS_03420 77377 78195 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784029.1 protein_id gnl|my_center|LOCUS_03420 78220 79209 gene locus_tag LOCUS_03430 78220 79209 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_03430 80621 79290 gene locus_tag LOCUS_03440 80621 79290 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_03440 80742 81176 gene locus_tag LOCUS_03450 gene dut 80742 81176 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_03450 81214 83004 gene locus_tag LOCUS_03460 81214 83004 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_03460 83100 83855 gene locus_tag LOCUS_03470 83100 83855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 83839 85152 gene locus_tag LOCUS_03480 83839 85152 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991962.1 protein_id gnl|my_center|LOCUS_03480 87277 85250 gene locus_tag LOCUS_03490 87277 85250 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_03490 87516 87340 gene locus_tag LOCUS_03500 87516 87340 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_03500 87683 89032 gene locus_tag LOCUS_03510 gene purB 87683 89032 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_03510 89094 90425 gene locus_tag LOCUS_03520 89094 90425 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760797.1 protein_id gnl|my_center|LOCUS_03520 90559 91902 gene locus_tag LOCUS_03530 gene asnS 90559 91902 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_03530 92054 92611 gene locus_tag LOCUS_03540 92054 92611 CDS product DUF4488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760799.1 protein_id gnl|my_center|LOCUS_03540 92921 93382 gene locus_tag LOCUS_03550 gene rplM 92921 93382 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760800.1 protein_id gnl|my_center|LOCUS_03550 93389 93775 gene locus_tag LOCUS_03560 gene rpsI 93389 93775 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_03560 94043 94801 gene locus_tag LOCUS_03570 gene rpsB 94043 94801 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_03570 94937 95929 gene locus_tag LOCUS_03580 gene tsf 94937 95929 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764142.1 protein_id gnl|my_center|LOCUS_03580 96417 96079 gene locus_tag LOCUS_03590 96417 96079 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764143.1 protein_id gnl|my_center|LOCUS_03590 96530 97183 gene locus_tag LOCUS_03600 96530 97183 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_03600 97188 97805 gene locus_tag LOCUS_03610 97188 97805 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_03610 97802 98281 gene locus_tag LOCUS_03620 gene ispF 97802 98281 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_03620 99252 98362 gene locus_tag LOCUS_03630 99252 98362 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766430.1 protein_id gnl|my_center|LOCUS_03630 99347 100183 gene locus_tag LOCUS_03640 99347 100183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 100596 103721 gene locus_tag LOCUS_03650 100596 103721 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_03650 103741 105438 gene locus_tag LOCUS_03660 103741 105438 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence04 567 758 gene locus_tag LOCUS_03670 567 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1339 2103 gene locus_tag LOCUS_03680 1339 2103 CDS product DUF1295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657484.1 protein_id gnl|my_center|LOCUS_03680 2110 3345 gene locus_tag LOCUS_03690 2110 3345 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108119.1 protein_id gnl|my_center|LOCUS_03690 3342 4214 gene locus_tag LOCUS_03700 3342 4214 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108118.1 protein_id gnl|my_center|LOCUS_03700 4959 4261 gene locus_tag LOCUS_03710 4959 4261 CDS product DUF3307 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836846.1 protein_id gnl|my_center|LOCUS_03710 5614 4961 gene locus_tag LOCUS_03720 5614 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 6653 5985 gene locus_tag LOCUS_03730 6653 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 8817 6661 gene locus_tag LOCUS_03740 8817 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 10526 8904 gene locus_tag LOCUS_03750 10526 8904 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790465.1 protein_id gnl|my_center|LOCUS_03750 11155 10538 gene locus_tag LOCUS_03760 11155 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781085.1 protein_id gnl|my_center|LOCUS_03760 12966 11278 gene locus_tag LOCUS_03770 12966 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 14407 13031 gene locus_tag LOCUS_03780 14407 13031 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797878.1 protein_id gnl|my_center|LOCUS_03780 15269 14496 gene locus_tag LOCUS_03790 15269 14496 CDS product DUF4493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792636.1 protein_id gnl|my_center|LOCUS_03790 15561 16406 gene locus_tag LOCUS_03800 15561 16406 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787242.1 protein_id gnl|my_center|LOCUS_03800 17483 16431 gene locus_tag LOCUS_03810 17483 16431 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_03810 17623 18840 gene locus_tag LOCUS_03820 17623 18840 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_03820 19078 19614 gene locus_tag LOCUS_03830 19078 19614 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765529.1 protein_id gnl|my_center|LOCUS_03830 20617 19841 gene locus_tag LOCUS_03840 20617 19841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 21332 20586 gene locus_tag LOCUS_03850 21332 20586 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817720.1 protein_id gnl|my_center|LOCUS_03850 22111 22040 gene locus_tag LOCUS_t00040 22111 22040 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22230 22159 gene locus_tag LOCUS_t00050 22230 22159 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22445 22804 gene locus_tag LOCUS_03860 gene rsfS 22445 22804 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784862.1 protein_id gnl|my_center|LOCUS_03860 22826 24898 gene locus_tag LOCUS_03870 gene ftsH 22826 24898 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_03870 25021 25809 gene locus_tag LOCUS_03880 25021 25809 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_03880 27018 25885 gene locus_tag LOCUS_03890 gene lpxB 27018 25885 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764238.1 protein_id gnl|my_center|LOCUS_03890 27788 27015 gene locus_tag LOCUS_03900 gene surE 27788 27015 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764237.1 protein_id gnl|my_center|LOCUS_03900 28054 28821 gene locus_tag LOCUS_03910 28054 28821 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784850.1 protein_id gnl|my_center|LOCUS_03910 28827 29726 gene locus_tag LOCUS_03920 28827 29726 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_03920 29742 30530 gene locus_tag LOCUS_03930 29742 30530 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784846.1 protein_id gnl|my_center|LOCUS_03930 30534 31802 gene locus_tag LOCUS_03940 30534 31802 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784844.1 protein_id gnl|my_center|LOCUS_03940 32000 34285 gene locus_tag LOCUS_03950 32000 34285 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760913.1 protein_id gnl|my_center|LOCUS_03950 34710 34363 gene locus_tag LOCUS_03960 34710 34363 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760912.1 protein_id gnl|my_center|LOCUS_03960 35691 34723 gene locus_tag LOCUS_03970 35691 34723 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_03970 35825 38443 gene locus_tag LOCUS_03980 gene alaS 35825 38443 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_03980 38659 40812 gene locus_tag LOCUS_03990 38659 40812 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_03990 40909 41760 gene locus_tag LOCUS_04000 gene lipA 40909 41760 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_04000 43433 42816 gene locus_tag LOCUS_04010 43433 42816 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202221.1 protein_id gnl|my_center|LOCUS_04010 44591 43608 gene locus_tag LOCUS_04020 gene gldB 44591 43608 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202220.1 protein_id gnl|my_center|LOCUS_04020 45461 44604 gene locus_tag LOCUS_04030 45461 44604 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775707.1 protein_id gnl|my_center|LOCUS_04030 45963 47576 gene locus_tag LOCUS_04040 45963 47576 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109161.1 protein_id gnl|my_center|LOCUS_04040 47683 48906 gene locus_tag LOCUS_04050 47683 48906 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109160.1 protein_id gnl|my_center|LOCUS_04050 48926 50593 gene locus_tag LOCUS_04060 48926 50593 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109159.1 protein_id gnl|my_center|LOCUS_04060 51956 50985 gene locus_tag LOCUS_04070 51956 50985 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_04070 52125 52844 gene locus_tag LOCUS_04080 52125 52844 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_04080 52856 54103 gene locus_tag LOCUS_04090 52856 54103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_04090 54106 55350 gene locus_tag LOCUS_04100 54106 55350 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108314.1 protein_id gnl|my_center|LOCUS_04100 55402 56499 gene locus_tag LOCUS_04110 55402 56499 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_04110 56503 57828 gene locus_tag LOCUS_04120 56503 57828 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_04120 59113 57923 gene locus_tag LOCUS_04130 gene uxuA 59113 57923 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766742.1 protein_id gnl|my_center|LOCUS_04130 59965 59159 gene locus_tag LOCUS_04140 59965 59159 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_04140 60098 60964 gene locus_tag LOCUS_04150 60098 60964 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_04150 61094 61528 gene locus_tag LOCUS_04160 61094 61528 CDS product DUF6078 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760904.1 protein_id gnl|my_center|LOCUS_04160 63512 61980 gene locus_tag LOCUS_04170 63512 61980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 64537 63527 gene locus_tag LOCUS_04180 64537 63527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 65998 64553 gene locus_tag LOCUS_04190 65998 64553 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461245.1 protein_id gnl|my_center|LOCUS_04190 66820 66026 gene locus_tag LOCUS_04200 66820 66026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 69351 67153 gene locus_tag LOCUS_04210 69351 67153 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_04210 71988 69451 gene locus_tag LOCUS_04220 71988 69451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 74875 71993 gene locus_tag LOCUS_04230 74875 71993 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036929.1 protein_id gnl|my_center|LOCUS_04230 79053 75025 gene locus_tag LOCUS_04240 79053 75025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 81001 79283 gene locus_tag LOCUS_04250 81001 79283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 83331 81202 gene locus_tag LOCUS_04260 83331 81202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 85212 83365 gene locus_tag LOCUS_04270 85212 83365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 86935 85247 gene locus_tag LOCUS_04280 86935 85247 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201972.1 protein_id gnl|my_center|LOCUS_04280 90052 86939 gene locus_tag LOCUS_04290 90052 86939 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_04290 90520 93582 gene locus_tag LOCUS_04300 90520 93582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 93782 96130 gene locus_tag LOCUS_04310 93782 96130 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence05 913 1374 gene locus_tag LOCUS_04320 913 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1431 2390 gene locus_tag LOCUS_04330 1431 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 2966 4558 gene locus_tag LOCUS_04340 2966 4558 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_04340 6725 4647 gene locus_tag LOCUS_04350 6725 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 7793 6879 gene locus_tag LOCUS_04360 7793 6879 CDS product DUF5106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107815.1 protein_id gnl|my_center|LOCUS_04360 8327 7944 gene locus_tag LOCUS_04370 8327 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 8859 8275 gene locus_tag LOCUS_04380 8859 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 10369 9002 gene locus_tag LOCUS_04390 10369 9002 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_04390 11881 10388 gene locus_tag LOCUS_04400 11881 10388 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_04400 12982 11954 gene locus_tag LOCUS_04410 gene ruvB 12982 11954 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_04410 13218 13823 gene locus_tag LOCUS_04420 13218 13823 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_04420 13796 14857 gene locus_tag LOCUS_04430 13796 14857 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_04430 14854 16098 gene locus_tag LOCUS_04440 gene mnmA 14854 16098 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203548.1 protein_id gnl|my_center|LOCUS_04440 17166 16246 gene locus_tag LOCUS_04450 17166 16246 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201877.1 protein_id gnl|my_center|LOCUS_04450 17778 17176 gene locus_tag LOCUS_04460 17778 17176 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783748.1 protein_id gnl|my_center|LOCUS_04460 18336 17803 gene locus_tag LOCUS_04470 18336 17803 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796886.1 protein_id gnl|my_center|LOCUS_04470 18411 19667 gene locus_tag LOCUS_04480 18411 19667 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_04480 19773 21590 gene locus_tag LOCUS_04490 gene argS 19773 21590 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_04490 21707 22336 gene locus_tag LOCUS_04500 21707 22336 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108811.1 protein_id gnl|my_center|LOCUS_04500 22375 24195 gene locus_tag LOCUS_04510 22375 24195 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767705.1 protein_id gnl|my_center|LOCUS_04510 24924 24277 gene locus_tag LOCUS_04520 24924 24277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 26659 25055 gene locus_tag LOCUS_04530 gene pckA 26659 25055 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791971.1 protein_id gnl|my_center|LOCUS_04530 27020 27673 gene locus_tag LOCUS_04540 gene upp 27020 27673 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761972.1 protein_id gnl|my_center|LOCUS_04540 28767 27757 gene locus_tag LOCUS_04550 28767 27757 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_04550 30625 28772 gene locus_tag LOCUS_04560 30625 28772 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108505.1 protein_id gnl|my_center|LOCUS_04560 30833 30905 gene locus_tag LOCUS_t00060 30833 30905 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34199 31209 gene locus_tag LOCUS_04570 gene secDF 34199 31209 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797413.1 protein_id gnl|my_center|LOCUS_04570 36264 34471 gene locus_tag LOCUS_04580 36264 34471 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109114.1 protein_id gnl|my_center|LOCUS_04580 38192 36276 gene locus_tag LOCUS_04590 38192 36276 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109107.1 protein_id gnl|my_center|LOCUS_04590 41490 38353 gene locus_tag LOCUS_04600 41490 38353 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_04600 42699 41614 gene locus_tag LOCUS_04610 42699 41614 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_04610 43667 42771 gene locus_tag LOCUS_04620 43667 42771 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_04620 44319 43642 gene locus_tag LOCUS_04630 44319 43642 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_04630 44984 44334 gene locus_tag LOCUS_04640 44984 44334 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 protein_id gnl|my_center|LOCUS_04640 45901 44981 gene locus_tag LOCUS_04650 gene lepB 45901 44981 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783767.1 protein_id gnl|my_center|LOCUS_04650 47349 45925 gene locus_tag LOCUS_04660 gene lepB 47349 45925 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_04660 48078 47353 gene locus_tag LOCUS_04670 gene dapB 48078 47353 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762922.1 protein_id gnl|my_center|LOCUS_04670 48190 49458 gene locus_tag LOCUS_04680 48190 49458 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_04680 50469 49462 gene locus_tag LOCUS_04690 50469 49462 CDS product tRNA-dihydrouridine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813861.1 protein_id gnl|my_center|LOCUS_04690 50468 50875 gene locus_tag LOCUS_04700 50468 50875 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783508.1 protein_id gnl|my_center|LOCUS_04700 50875 51984 gene locus_tag LOCUS_04710 gene dprA 50875 51984 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698553.1 protein_id gnl|my_center|LOCUS_04710 53576 52821 gene locus_tag LOCUS_04720 53576 52821 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_04720 55594 53612 gene locus_tag LOCUS_04730 55594 53612 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761732.1 protein_id gnl|my_center|LOCUS_04730 56277 55630 gene locus_tag LOCUS_04740 56277 55630 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_04740 57240 56608 gene locus_tag LOCUS_04750 57240 56608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 59081 57495 gene locus_tag LOCUS_04760 59081 57495 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_04760 59568 59110 gene locus_tag LOCUS_04770 gene coaD 59568 59110 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761751.1 protein_id gnl|my_center|LOCUS_04770 61537 59582 gene locus_tag LOCUS_04780 61537 59582 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783474.1 protein_id gnl|my_center|LOCUS_04780 62689 61559 gene locus_tag LOCUS_04790 62689 61559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_04790 63753 62791 gene locus_tag LOCUS_04800 63753 62791 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783471.1 protein_id gnl|my_center|LOCUS_04800 65126 64101 gene locus_tag LOCUS_04810 65126 64101 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795918.1 protein_id gnl|my_center|LOCUS_04810 65278 66510 gene locus_tag LOCUS_04820 65278 66510 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_04820 66519 66941 gene locus_tag LOCUS_04830 gene ybeY 66519 66941 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783716.1 protein_id gnl|my_center|LOCUS_04830 67147 69018 gene locus_tag LOCUS_04840 gene mnmG 67147 69018 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_04840 69078 69602 gene locus_tag LOCUS_04850 69078 69602 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762874.1 protein_id gnl|my_center|LOCUS_04850 69696 71507 gene locus_tag LOCUS_04860 gene uvrC 69696 71507 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108727.1 protein_id gnl|my_center|LOCUS_04860 71600 72052 gene locus_tag LOCUS_04870 gene dtd 71600 72052 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_04870 72054 72374 gene locus_tag LOCUS_04880 72054 72374 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_04880 72380 73336 gene locus_tag LOCUS_04890 gene deoC 72380 73336 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201863.1 protein_id gnl|my_center|LOCUS_04890 74398 73424 gene locus_tag LOCUS_04900 74398 73424 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796989.1 protein_id gnl|my_center|LOCUS_04900 74490 77261 gene locus_tag LOCUS_04910 gene polA 74490 77261 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_04910 77415 77801 gene locus_tag LOCUS_04920 77415 77801 CDS product DUF3836 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783692.1 protein_id gnl|my_center|LOCUS_04920 78061 79164 gene locus_tag LOCUS_04930 gene ychF 78061 79164 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_04930 79175 80089 gene locus_tag LOCUS_04940 79175 80089 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108643.1 protein_id gnl|my_center|LOCUS_04940 80086 80754 gene locus_tag LOCUS_04950 80086 80754 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767382.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence06 167 820 gene locus_tag LOCUS_04960 167 820 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760474.1 protein_id gnl|my_center|LOCUS_04960 1781 834 gene locus_tag LOCUS_04970 gene cysK 1781 834 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203747.1 protein_id gnl|my_center|LOCUS_04970 1982 1909 gene locus_tag LOCUS_t00070 1982 1909 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2099 2026 gene locus_tag LOCUS_t00080 2099 2026 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2253 2870 gene locus_tag LOCUS_04980 2253 2870 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108963.1 protein_id gnl|my_center|LOCUS_04980 2893 3639 gene locus_tag LOCUS_04990 gene fabG 2893 3639 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_04990 3764 4444 gene locus_tag LOCUS_05000 3764 4444 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_05000 6203 4785 gene locus_tag LOCUS_05010 6203 4785 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792018.1 protein_id gnl|my_center|LOCUS_05010 8758 6347 gene locus_tag LOCUS_05020 8758 6347 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792029.1 protein_id gnl|my_center|LOCUS_05020 10174 8849 gene locus_tag LOCUS_05030 10174 8849 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804263.1 protein_id gnl|my_center|LOCUS_05030 11409 10171 gene locus_tag LOCUS_05040 11409 10171 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_05040 12244 11483 gene locus_tag LOCUS_05050 12244 11483 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792021.1 protein_id gnl|my_center|LOCUS_05050 14791 12503 gene locus_tag LOCUS_05060 14791 12503 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766433.1 protein_id gnl|my_center|LOCUS_05060 14999 16492 gene locus_tag LOCUS_05070 gene purH 14999 16492 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_05070 16520 17542 gene locus_tag LOCUS_05080 16520 17542 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_05080 17656 18501 gene locus_tag LOCUS_05090 gene mreC 17656 18501 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_05090 18516 19016 gene locus_tag LOCUS_05100 gene mreD 18516 19016 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_05100 19118 20866 gene locus_tag LOCUS_05110 gene mrdA 19118 20866 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_05110 20847 22301 gene locus_tag LOCUS_05120 gene rodA 20847 22301 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_05120 22766 22260 gene locus_tag LOCUS_05130 22766 22260 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799202.1 protein_id gnl|my_center|LOCUS_05130 24421 22892 gene locus_tag LOCUS_05140 gene ricT 24421 22892 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_05140 25593 24466 gene locus_tag LOCUS_05150 25593 24466 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_05150 26553 25600 gene locus_tag LOCUS_05160 gene metF 26553 25600 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_05160 27844 26663 gene locus_tag LOCUS_05170 gene cls 27844 26663 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203419.1 protein_id gnl|my_center|LOCUS_05170 28747 29208 gene locus_tag LOCUS_05180 28747 29208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 29337 29262 gene locus_tag LOCUS_t00090 29337 29262 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 29452 29865 gene locus_tag LOCUS_05190 29452 29865 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000381519.1 protein_id gnl|my_center|LOCUS_05190 30978 29920 gene locus_tag LOCUS_05200 gene aroB 30978 29920 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109049.1 protein_id gnl|my_center|LOCUS_05200 31154 31489 gene locus_tag LOCUS_05210 31154 31489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784807.1 protein_id gnl|my_center|LOCUS_05210 31561 34422 gene locus_tag LOCUS_05220 31561 34422 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_05220 35825 34503 gene locus_tag LOCUS_05230 35825 34503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 37183 35930 gene locus_tag LOCUS_05240 37183 35930 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203542.1 protein_id gnl|my_center|LOCUS_05240 38371 37196 gene locus_tag LOCUS_05250 38371 37196 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760823.1 protein_id gnl|my_center|LOCUS_05250 39367 38381 gene locus_tag LOCUS_05260 39367 38381 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_05260 40834 39377 gene locus_tag LOCUS_05270 40834 39377 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_05270 42443 41082 gene locus_tag LOCUS_05280 42443 41082 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786996.1 protein_id gnl|my_center|LOCUS_05280 43368 42448 gene locus_tag LOCUS_05290 43368 42448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_05290 44989 43391 gene locus_tag LOCUS_05300 44989 43391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 46598 45261 gene locus_tag LOCUS_05310 gene gdhA 46598 45261 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766346.1 protein_id gnl|my_center|LOCUS_05310 46826 49786 gene locus_tag LOCUS_05320 46826 49786 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_05320 50708 49851 gene locus_tag LOCUS_05330 50708 49851 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470046.1 protein_id gnl|my_center|LOCUS_05330 50988 52181 gene locus_tag LOCUS_05340 50988 52181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 53682 52348 gene locus_tag LOCUS_05350 53682 52348 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790434.1 protein_id gnl|my_center|LOCUS_05350 56509 54224 gene locus_tag LOCUS_05360 56509 54224 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790429.1 protein_id gnl|my_center|LOCUS_05360 56820 58025 gene locus_tag LOCUS_05370 56820 58025 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108777.1 protein_id gnl|my_center|LOCUS_05370 58086 61514 gene locus_tag LOCUS_05380 58086 61514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 61543 62904 gene locus_tag LOCUS_05390 61543 62904 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_05390 62928 63701 gene locus_tag LOCUS_05400 gene lpxA 62928 63701 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762937.1 protein_id gnl|my_center|LOCUS_05400 63715 64350 gene locus_tag LOCUS_05410 63715 64350 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108448.1 protein_id gnl|my_center|LOCUS_05410 64404 65762 gene locus_tag LOCUS_05420 64404 65762 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108446.1 protein_id gnl|my_center|LOCUS_05420 65803 66735 gene locus_tag LOCUS_05430 65803 66735 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694299.1 protein_id gnl|my_center|LOCUS_05430 66704 68185 gene locus_tag LOCUS_05440 66704 68185 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_05440 68370 70016 gene locus_tag LOCUS_05450 68370 70016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 70016 71149 gene locus_tag LOCUS_05460 70016 71149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence07 92 1378 gene locus_tag LOCUS_05470 92 1378 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_05470 1385 1864 gene locus_tag LOCUS_05480 1385 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2945 1983 gene locus_tag LOCUS_05490 2945 1983 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435320.1 protein_id gnl|my_center|LOCUS_05490 3562 3023 gene locus_tag LOCUS_05500 3562 3023 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109292.1 protein_id gnl|my_center|LOCUS_05500 3658 3873 gene locus_tag LOCUS_05510 3658 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 4166 4603 gene locus_tag LOCUS_05520 4166 4603 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_05520 5012 7663 gene locus_tag LOCUS_05530 5012 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 9365 7737 gene locus_tag LOCUS_05540 9365 7737 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295296.1 protein_id gnl|my_center|LOCUS_05540 12027 9373 gene locus_tag LOCUS_05550 12027 9373 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765337.1 protein_id gnl|my_center|LOCUS_05550 12733 14052 gene locus_tag LOCUS_05560 12733 14052 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_05560 15853 14420 gene locus_tag LOCUS_05570 15853 14420 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767100.1 protein_id gnl|my_center|LOCUS_05570 17237 16038 gene locus_tag LOCUS_05580 17237 16038 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_05580 18609 17230 gene locus_tag LOCUS_05590 18609 17230 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_05590 19817 18642 gene locus_tag LOCUS_05600 19817 18642 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_05600 20948 19827 gene locus_tag LOCUS_05610 20948 19827 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785016.1 protein_id gnl|my_center|LOCUS_05610 22558 21179 gene locus_tag LOCUS_05620 22558 21179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 24194 22701 gene locus_tag LOCUS_05630 24194 22701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 26120 24273 gene locus_tag LOCUS_05640 26120 24273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 27521 26145 gene locus_tag LOCUS_05650 27521 26145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 29292 27535 gene locus_tag LOCUS_05660 29292 27535 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_05660 32514 29314 gene locus_tag LOCUS_05670 32514 29314 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_05670 34176 33286 gene locus_tag LOCUS_05680 34176 33286 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_05680 34333 36543 gene locus_tag LOCUS_05690 34333 36543 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202053.1 protein_id gnl|my_center|LOCUS_05690 36905 38239 gene locus_tag LOCUS_05700 36905 38239 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 protein_id gnl|my_center|LOCUS_05700 38427 39209 gene locus_tag LOCUS_05710 gene djlA 38427 39209 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073436.1 protein_id gnl|my_center|LOCUS_05710 39215 39730 gene locus_tag LOCUS_05720 39215 39730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 39798 40697 gene locus_tag LOCUS_05730 gene rfbA 39798 40697 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_05730 40713 41285 gene locus_tag LOCUS_05740 gene rfbC 40713 41285 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_05740 43271 41727 gene locus_tag LOCUS_05750 43271 41727 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107456.1 protein_id gnl|my_center|LOCUS_05750 43445 44626 gene locus_tag LOCUS_05760 43445 44626 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107661.1 protein_id gnl|my_center|LOCUS_05760 46181 44733 gene locus_tag LOCUS_05770 46181 44733 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_05770 48216 46216 gene locus_tag LOCUS_05780 gene pulA 48216 46216 CDS product type I pullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203210.1 protein_id gnl|my_center|LOCUS_05780 48794 48225 gene locus_tag LOCUS_05790 gene ruvC 48794 48225 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_05790 49096 48791 gene locus_tag LOCUS_05800 49096 48791 CDS product DUF4286 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203211.1 protein_id gnl|my_center|LOCUS_05800 49246 50910 gene locus_tag LOCUS_05810 49246 50910 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794233.1 protein_id gnl|my_center|LOCUS_05810 51093 54338 gene locus_tag LOCUS_05820 51093 54338 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_05820 54354 57227 gene locus_tag LOCUS_05830 54354 57227 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_05830 58037 57591 gene locus_tag LOCUS_05840 58037 57591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 58900 58328 gene locus_tag LOCUS_05850 58900 58328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 59156 58911 gene locus_tag LOCUS_05860 59156 58911 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761253.1 protein_id gnl|my_center|LOCUS_05860 60003 59266 gene locus_tag LOCUS_05870 60003 59266 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_05870 62512 60050 gene locus_tag LOCUS_05880 gene pheT 62512 60050 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107364.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence08 481 2013 gene locus_tag LOCUS_05890 481 2013 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868625.1 protein_id gnl|my_center|LOCUS_05890 3372 2242 gene locus_tag LOCUS_05900 3372 2242 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_05900 5657 3561 gene locus_tag LOCUS_05910 5657 3561 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_05910 7030 5942 gene locus_tag LOCUS_05920 7030 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769608.1 protein_id gnl|my_center|LOCUS_05920 7608 7105 gene locus_tag LOCUS_05930 7608 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7984 7622 gene locus_tag LOCUS_05940 7984 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 9346 8186 gene locus_tag LOCUS_05950 gene araJ 9346 8186 CDS product MFS transporter AraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108639.1 protein_id gnl|my_center|LOCUS_05950 11831 9471 gene locus_tag LOCUS_05960 11831 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 12659 11949 gene locus_tag LOCUS_05970 12659 11949 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796789.1 protein_id gnl|my_center|LOCUS_05970 13279 12815 gene locus_tag LOCUS_05980 13279 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769198.1 protein_id gnl|my_center|LOCUS_05980 13778 13269 gene locus_tag LOCUS_05990 13778 13269 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763658.1 protein_id gnl|my_center|LOCUS_05990 14616 13843 gene locus_tag LOCUS_06000 gene argB 14616 13843 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_06000 16521 14629 gene locus_tag LOCUS_06010 gene speA 16521 14629 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783873.1 protein_id gnl|my_center|LOCUS_06010 17078 16542 gene locus_tag LOCUS_06020 17078 16542 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_06020 19411 17075 gene locus_tag LOCUS_06030 gene topA 19411 17075 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_06030 21281 19623 gene locus_tag LOCUS_06040 21281 19623 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791194.1 protein_id gnl|my_center|LOCUS_06040 24298 21284 gene locus_tag LOCUS_06050 24298 21284 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108497.1 protein_id gnl|my_center|LOCUS_06050 24840 24316 gene locus_tag LOCUS_06060 24840 24316 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108496.1 protein_id gnl|my_center|LOCUS_06060 24927 25415 gene locus_tag LOCUS_06070 24927 25415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 25539 26006 gene locus_tag LOCUS_06080 25539 26006 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005928359.1 protein_id gnl|my_center|LOCUS_06080 26006 26323 gene locus_tag LOCUS_06090 26006 26323 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797188.1 protein_id gnl|my_center|LOCUS_06090 27202 26516 gene locus_tag LOCUS_06100 27202 26516 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 protein_id gnl|my_center|LOCUS_06100 28616 27207 gene locus_tag LOCUS_06110 28616 27207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 28777 29649 gene locus_tag LOCUS_06120 28777 29649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 29751 32204 gene locus_tag LOCUS_06130 29751 32204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 32316 32669 gene locus_tag LOCUS_06140 32316 32669 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_06140 32635 32943 gene locus_tag LOCUS_06150 32635 32943 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760436.1 protein_id gnl|my_center|LOCUS_06150 34091 32961 gene locus_tag LOCUS_06160 gene buk 34091 32961 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814251.1 protein_id gnl|my_center|LOCUS_06160 35004 34084 gene locus_tag LOCUS_06170 35004 34084 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791349.1 protein_id gnl|my_center|LOCUS_06170 35086 36861 gene locus_tag LOCUS_06180 35086 36861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 37684 36839 gene locus_tag LOCUS_06190 gene rhuM 37684 36839 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 protein_id gnl|my_center|LOCUS_06190 39268 37937 gene locus_tag LOCUS_06200 39268 37937 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764627.1 protein_id gnl|my_center|LOCUS_06200 39883 39314 gene locus_tag LOCUS_06210 gene xpt 39883 39314 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760704.1 protein_id gnl|my_center|LOCUS_06210 40959 40012 gene locus_tag LOCUS_06220 40959 40012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 41110 42537 gene locus_tag LOCUS_06230 41110 42537 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784328.1 protein_id gnl|my_center|LOCUS_06230 43452 42541 gene locus_tag LOCUS_06240 43452 42541 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_06240 44825 43461 gene locus_tag LOCUS_06250 44825 43461 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_06250 45049 45312 gene locus_tag LOCUS_06260 45049 45312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 45921 45370 gene locus_tag LOCUS_06270 45921 45370 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108357.1 protein_id gnl|my_center|LOCUS_06270 46524 46051 gene locus_tag LOCUS_06280 46524 46051 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_06280 46660 46526 gene locus_tag LOCUS_06290 46660 46526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 47850 46735 gene locus_tag LOCUS_06300 gene prfB 47850 46735 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108912216.1 protein_id gnl|my_center|LOCUS_06300 49734 47929 gene locus_tag LOCUS_06310 49734 47929 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762502.1 protein_id gnl|my_center|LOCUS_06310 49828 50892 gene locus_tag LOCUS_06320 49828 50892 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_06320 50910 51911 gene locus_tag LOCUS_06330 50910 51911 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_06330 51924 52361 gene locus_tag LOCUS_06340 51924 52361 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_06340 53890 52700 gene locus_tag LOCUS_06350 53890 52700 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303089.1 protein_id gnl|my_center|LOCUS_06350 54504 54028 gene locus_tag LOCUS_06360 gene trxA 54504 54028 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107795.1 protein_id gnl|my_center|LOCUS_06360 54660 54860 gene locus_tag LOCUS_06370 54660 54860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 55037 55219 gene locus_tag LOCUS_06380 55037 55219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 55569 55348 gene locus_tag LOCUS_06390 55569 55348 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_06390 56202 55633 gene locus_tag LOCUS_06400 56202 55633 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_06400 56885 56214 gene locus_tag LOCUS_06410 56885 56214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770196.1 protein_id gnl|my_center|LOCUS_06410 57527 57042 gene locus_tag LOCUS_06420 57527 57042 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762403.1 protein_id gnl|my_center|LOCUS_06420 58647 57694 gene locus_tag LOCUS_06430 58647 57694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 58807 58721 gene locus_tag LOCUS_t00100 58807 58721 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 59012 60034 gene locus_tag LOCUS_06440 59012 60034 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_06440 61294 60077 gene locus_tag LOCUS_06450 61294 60077 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192717.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence09 640 53 gene locus_tag LOCUS_06460 640 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1618 1028 gene locus_tag LOCUS_06470 1618 1028 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810751.1 protein_id gnl|my_center|LOCUS_06470 2045 1728 gene locus_tag LOCUS_06480 2045 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2566 2231 gene locus_tag LOCUS_06490 2566 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 2723 2968 gene locus_tag LOCUS_06500 2723 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3507 2965 gene locus_tag LOCUS_06510 3507 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 3843 4838 gene locus_tag LOCUS_06520 3843 4838 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202034.1 protein_id gnl|my_center|LOCUS_06520 4897 5034 gene locus_tag LOCUS_06530 4897 5034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 5031 6668 gene locus_tag LOCUS_06540 5031 6668 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143918059.1 protein_id gnl|my_center|LOCUS_06540 6701 6615 gene locus_tag LOCUS_t00110 6701 6615 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6789 6716 gene locus_tag LOCUS_t00120 6789 6716 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8206 6866 gene locus_tag LOCUS_06550 gene argH 8206 6866 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784384.1 protein_id gnl|my_center|LOCUS_06550 8645 8220 gene locus_tag LOCUS_06560 8645 8220 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_06560 9381 8746 gene locus_tag LOCUS_06570 gene pyrE 9381 8746 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_06570 10173 9481 gene locus_tag LOCUS_06580 10173 9481 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_06580 10636 10157 gene locus_tag LOCUS_06590 10636 10157 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_06590 11475 10633 gene locus_tag LOCUS_06600 gene prmC 11475 10633 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_06600 11512 12546 gene locus_tag LOCUS_06610 gene ribD 11512 12546 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_06610 12685 14136 gene locus_tag LOCUS_06620 12685 14136 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202030.1 protein_id gnl|my_center|LOCUS_06620 14161 14898 gene locus_tag LOCUS_06630 14161 14898 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784372.1 protein_id gnl|my_center|LOCUS_06630 14903 17542 gene locus_tag LOCUS_06640 14903 17542 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_06640 17618 18133 gene locus_tag LOCUS_06650 17618 18133 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_06650 18192 18740 gene locus_tag LOCUS_06660 18192 18740 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536380.1 protein_id gnl|my_center|LOCUS_06660 18862 19692 gene locus_tag LOCUS_06670 gene murI 18862 19692 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108947.1 protein_id gnl|my_center|LOCUS_06670 21023 19761 gene locus_tag LOCUS_06680 21023 19761 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_06680 21133 22119 gene locus_tag LOCUS_06690 gene dusB 21133 22119 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_06690 23113 22190 gene locus_tag LOCUS_06700 23113 22190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 24223 23249 gene locus_tag LOCUS_06710 24223 23249 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761715.1 protein_id gnl|my_center|LOCUS_06710 25224 24214 gene locus_tag LOCUS_06720 25224 24214 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_06720 26131 25229 gene locus_tag LOCUS_06730 26131 25229 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_06730 26209 28455 gene locus_tag LOCUS_06740 gene rnr 26209 28455 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_06740 29846 28617 gene locus_tag LOCUS_06750 29846 28617 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_06750 30184 29849 gene locus_tag LOCUS_06760 gene rbfA 30184 29849 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_06760 30836 30195 gene locus_tag LOCUS_06770 30836 30195 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765299.1 protein_id gnl|my_center|LOCUS_06770 32381 30921 gene locus_tag LOCUS_06780 gene pyk 32381 30921 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761922.1 protein_id gnl|my_center|LOCUS_06780 32825 32400 gene locus_tag LOCUS_06790 gene aroQ 32825 32400 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_06790 32892 33821 gene locus_tag LOCUS_06800 gene xerD 32892 33821 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761920.1 protein_id gnl|my_center|LOCUS_06800 34031 35641 gene locus_tag LOCUS_06810 34031 35641 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791939.1 protein_id gnl|my_center|LOCUS_06810 35825 36766 gene locus_tag LOCUS_06820 35825 36766 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765298.1 protein_id gnl|my_center|LOCUS_06820 36786 38324 gene locus_tag LOCUS_06830 36786 38324 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_06830 38544 39716 gene locus_tag LOCUS_06840 38544 39716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 39738 41279 gene locus_tag LOCUS_06850 39738 41279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 41688 41419 gene locus_tag LOCUS_06860 41688 41419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 42468 41749 gene locus_tag LOCUS_06870 42468 41749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06870 42838 43611 gene locus_tag LOCUS_06880 42838 43611 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062694907.1 protein_id gnl|my_center|LOCUS_06880 43788 45830 gene locus_tag LOCUS_06890 gene metG 43788 45830 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_06890 45915 47357 gene locus_tag LOCUS_06900 45915 47357 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814097.1 protein_id gnl|my_center|LOCUS_06900 47372 48418 gene locus_tag LOCUS_06910 47372 48418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 48485 49348 gene locus_tag LOCUS_06920 48485 49348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 49369 50430 gene locus_tag LOCUS_06930 49369 50430 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_06930 50435 51286 gene locus_tag LOCUS_06940 50435 51286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 51332 52594 gene locus_tag LOCUS_06950 51332 52594 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_06950 52587 53342 gene locus_tag LOCUS_06960 52587 53342 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108544.1 protein_id gnl|my_center|LOCUS_06960 53364 54452 gene locus_tag LOCUS_06970 53364 54452 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_06970 56371 54830 gene locus_tag LOCUS_06980 56371 54830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 59535 57043 gene locus_tag LOCUS_06990 59535 57043 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_06990 59631 60326 gene locus_tag LOCUS_07000 59631 60326 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689757.1 protein_id gnl|my_center|LOCUS_07000 60339 60818 gene locus_tag LOCUS_07010 60339 60818 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966225.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence10 295 221 gene locus_tag LOCUS_t00130 295 221 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 456 3086 gene locus_tag LOCUS_07020 456 3086 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203665.1 protein_id gnl|my_center|LOCUS_07020 3093 3707 gene locus_tag LOCUS_07030 3093 3707 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_07030 3719 4645 gene locus_tag LOCUS_07040 3719 4645 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_07040 4936 5766 gene locus_tag LOCUS_07050 4936 5766 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108347.1 protein_id gnl|my_center|LOCUS_07050 5788 6429 gene locus_tag LOCUS_07060 5788 6429 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791337.1 protein_id gnl|my_center|LOCUS_07060 6713 6934 gene locus_tag LOCUS_07070 6713 6934 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791339.1 protein_id gnl|my_center|LOCUS_07070 7052 8986 gene locus_tag LOCUS_07080 7052 8986 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_07080 9065 9562 gene locus_tag LOCUS_07090 9065 9562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 10648 9653 gene locus_tag LOCUS_07100 10648 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 11653 10907 gene locus_tag LOCUS_07110 11653 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 12012 12563 gene locus_tag LOCUS_07120 gene updY 12012 12563 CDS product capsular polysaccharide transcription antiterminator UpdY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770021.1 protein_id gnl|my_center|LOCUS_07120 12615 14522 gene locus_tag LOCUS_07130 12615 14522 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107342.1 protein_id gnl|my_center|LOCUS_07130 14550 15716 gene locus_tag LOCUS_07140 14550 15716 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791792.1 protein_id gnl|my_center|LOCUS_07140 15735 16952 gene locus_tag LOCUS_07150 15735 16952 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760698.1 protein_id gnl|my_center|LOCUS_07150 16952 18112 gene locus_tag LOCUS_07160 16952 18112 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202157.1 protein_id gnl|my_center|LOCUS_07160 18124 18924 gene locus_tag LOCUS_07170 18124 18924 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108518.1 protein_id gnl|my_center|LOCUS_07170 18933 21383 gene locus_tag LOCUS_07180 18933 21383 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039946.1 protein_id gnl|my_center|LOCUS_07180 22488 23681 gene locus_tag LOCUS_07190 22488 23681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 23728 24234 gene locus_tag LOCUS_07200 23728 24234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 25460 24237 gene locus_tag LOCUS_07210 25460 24237 CDS product DUF3874 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766174.1 protein_id gnl|my_center|LOCUS_07210 25783 26400 gene locus_tag LOCUS_07220 25783 26400 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759907.1 protein_id gnl|my_center|LOCUS_07220 26685 27134 gene locus_tag LOCUS_07230 26685 27134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 27131 28030 gene locus_tag LOCUS_07240 27131 28030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 28049 29140 gene locus_tag LOCUS_07250 28049 29140 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_07250 29147 29755 gene locus_tag LOCUS_07260 29147 29755 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202264.1 protein_id gnl|my_center|LOCUS_07260 29764 30498 gene locus_tag LOCUS_07270 29764 30498 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203389.1 protein_id gnl|my_center|LOCUS_07270 30508 31545 gene locus_tag LOCUS_07280 30508 31545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 31591 32685 gene locus_tag LOCUS_07290 31591 32685 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201897.1 protein_id gnl|my_center|LOCUS_07290 32695 33615 gene locus_tag LOCUS_07300 32695 33615 CDS product SP_1767 family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765893.1 protein_id gnl|my_center|LOCUS_07300 34163 33993 gene locus_tag LOCUS_07310 34163 33993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 35120 36232 gene locus_tag LOCUS_07320 35120 36232 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_07320 36237 36872 gene locus_tag LOCUS_07330 36237 36872 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775527.1 protein_id gnl|my_center|LOCUS_07330 36900 37127 gene locus_tag LOCUS_07340 36900 37127 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775528.1 protein_id gnl|my_center|LOCUS_07340 37129 38169 gene locus_tag LOCUS_07350 37129 38169 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_07350 38171 38932 gene locus_tag LOCUS_07360 38171 38932 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801362.1 protein_id gnl|my_center|LOCUS_07360 38937 40001 gene locus_tag LOCUS_07370 38937 40001 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_07370 40006 40755 gene locus_tag LOCUS_07380 40006 40755 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103768.1 protein_id gnl|my_center|LOCUS_07380 40777 41832 gene locus_tag LOCUS_07390 40777 41832 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_07390 41829 42242 gene locus_tag LOCUS_07400 41829 42242 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706256.1 protein_id gnl|my_center|LOCUS_07400 42251 42838 gene locus_tag LOCUS_07410 42251 42838 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801359.1 protein_id gnl|my_center|LOCUS_07410 42893 43864 gene locus_tag LOCUS_07420 42893 43864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 43903 44820 gene locus_tag LOCUS_07430 43903 44820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 46124 46369 gene locus_tag LOCUS_07440 46124 46369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 46449 47408 gene locus_tag LOCUS_07450 46449 47408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 47450 48412 gene locus_tag LOCUS_07460 47450 48412 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108803.1 protein_id gnl|my_center|LOCUS_07460 49982 50917 gene locus_tag LOCUS_07470 49982 50917 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108803.1 protein_id gnl|my_center|LOCUS_07470 51676 52074 gene locus_tag LOCUS_07480 51676 52074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 53143 53901 gene locus_tag LOCUS_07490 53143 53901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 56110 56445 gene locus_tag LOCUS_07500 56110 56445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 56701 57303 gene locus_tag LOCUS_07510 56701 57303 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795841.1 protein_id gnl|my_center|LOCUS_07510 57300 58433 gene locus_tag LOCUS_07520 57300 58433 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937635.1 protein_id gnl|my_center|LOCUS_07520 58696 59298 gene locus_tag LOCUS_07530 58696 59298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 60129 60557 gene locus_tag LOCUS_07540 60129 60557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence11 184 1353 gene locus_tag LOCUS_07550 gene pncB 184 1353 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 protein_id gnl|my_center|LOCUS_07550 1642 3138 gene locus_tag LOCUS_07560 1642 3138 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_07560 3173 4570 gene locus_tag LOCUS_07570 gene leuC 3173 4570 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_07570 4586 5182 gene locus_tag LOCUS_07580 gene leuD 4586 5182 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_07580 5199 6728 gene locus_tag LOCUS_07590 5199 6728 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_07590 6743 7804 gene locus_tag LOCUS_07600 gene leuB 6743 7804 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789841.1 protein_id gnl|my_center|LOCUS_07600 7970 8791 gene locus_tag LOCUS_07610 7970 8791 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789811.1 protein_id gnl|my_center|LOCUS_07610 10561 8849 gene locus_tag LOCUS_07620 gene recQ 10561 8849 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555810.1 protein_id gnl|my_center|LOCUS_07620 10880 11335 gene locus_tag LOCUS_07630 10880 11335 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763211.1 protein_id gnl|my_center|LOCUS_07630 11505 13463 gene locus_tag LOCUS_07640 11505 13463 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_07640 13477 14151 gene locus_tag LOCUS_07650 13477 14151 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789797.1 protein_id gnl|my_center|LOCUS_07650 14253 14714 gene locus_tag LOCUS_07660 14253 14714 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789793.1 protein_id gnl|my_center|LOCUS_07660 14736 16013 gene locus_tag LOCUS_07670 14736 16013 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_07670 16164 18107 gene locus_tag LOCUS_07680 16164 18107 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_07680 18146 20182 gene locus_tag LOCUS_07690 18146 20182 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_07690 21599 20406 gene locus_tag LOCUS_07700 21599 20406 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_07700 22373 21672 gene locus_tag LOCUS_07710 22373 21672 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210775.1 protein_id gnl|my_center|LOCUS_07710 23682 22471 gene locus_tag LOCUS_07720 23682 22471 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763746.1 protein_id gnl|my_center|LOCUS_07720 25508 23688 gene locus_tag LOCUS_07730 25508 23688 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763745.1 protein_id gnl|my_center|LOCUS_07730 26072 25680 gene locus_tag LOCUS_07740 26072 25680 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784512.1 protein_id gnl|my_center|LOCUS_07740 26291 26365 gene locus_tag LOCUS_t00140 26291 26365 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26420 26494 gene locus_tag LOCUS_t00150 26420 26494 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26770 27750 gene locus_tag LOCUS_07750 gene pfkA 26770 27750 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_07750 28517 27861 gene locus_tag LOCUS_07760 28517 27861 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_07760 28789 29322 gene locus_tag LOCUS_07770 28789 29322 CDS product DUF2490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767685.1 protein_id gnl|my_center|LOCUS_07770 29366 29872 gene locus_tag LOCUS_07780 29366 29872 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_07780 29986 30240 gene locus_tag LOCUS_07790 29986 30240 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763353.1 protein_id gnl|my_center|LOCUS_07790 30275 32128 gene locus_tag LOCUS_07800 30275 32128 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763354.1 protein_id gnl|my_center|LOCUS_07800 32128 33363 gene locus_tag LOCUS_07810 32128 33363 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763355.1 protein_id gnl|my_center|LOCUS_07810 34991 33735 gene locus_tag LOCUS_07820 34991 33735 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763375.1 protein_id gnl|my_center|LOCUS_07820 36601 35234 gene locus_tag LOCUS_07830 36601 35234 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107869.1 protein_id gnl|my_center|LOCUS_07830 36919 38241 gene locus_tag LOCUS_07840 36919 38241 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203189.1 protein_id gnl|my_center|LOCUS_07840 38312 39643 gene locus_tag LOCUS_07850 gene ffh 38312 39643 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_07850 40802 39729 gene locus_tag LOCUS_07860 40802 39729 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_07860 40964 41500 gene locus_tag LOCUS_07870 40964 41500 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203456.1 protein_id gnl|my_center|LOCUS_07870 41591 44383 gene locus_tag LOCUS_07880 41591 44383 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108148.1 protein_id gnl|my_center|LOCUS_07880 45120 44458 gene locus_tag LOCUS_07890 gene ung 45120 44458 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_07890 46291 45251 gene locus_tag LOCUS_07900 gene asnA 46291 45251 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_07900 46520 46592 gene locus_tag LOCUS_t00160 46520 46592 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 47145 50024 gene locus_tag LOCUS_07910 47145 50024 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_07910 50037 51680 gene locus_tag LOCUS_07920 50037 51680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence12 460 1791 gene locus_tag LOCUS_07930 460 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 2611 3153 gene locus_tag LOCUS_07940 2611 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 3286 5067 gene locus_tag LOCUS_07950 gene lepA 3286 5067 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_07950 5339 5920 gene locus_tag LOCUS_07960 5339 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6476 7462 gene locus_tag LOCUS_07970 6476 7462 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761242.1 protein_id gnl|my_center|LOCUS_07970 7546 8838 gene locus_tag LOCUS_07980 gene rsxC 7546 8838 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107360.1 protein_id gnl|my_center|LOCUS_07980 8851 9840 gene locus_tag LOCUS_07990 8851 9840 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_07990 9837 10514 gene locus_tag LOCUS_08000 9837 10514 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_08000 10529 11113 gene locus_tag LOCUS_08010 10529 11113 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761246.1 protein_id gnl|my_center|LOCUS_08010 11133 11735 gene locus_tag LOCUS_08020 gene rsxA 11133 11735 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_08020 11921 12955 gene locus_tag LOCUS_08030 gene galE 11921 12955 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_08030 13491 14768 gene locus_tag LOCUS_08040 13491 14768 CDS product voltage-gated chloride channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037141.1 protein_id gnl|my_center|LOCUS_08040 14920 16278 gene locus_tag LOCUS_08050 14920 16278 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109290.1 protein_id gnl|my_center|LOCUS_08050 17028 16285 gene locus_tag LOCUS_08060 17028 16285 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109289.1 protein_id gnl|my_center|LOCUS_08060 21347 17055 gene locus_tag LOCUS_08070 21347 17055 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_08070 24172 21611 gene locus_tag LOCUS_08080 24172 21611 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_08080 24825 24253 gene locus_tag LOCUS_08090 24825 24253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 25080 25277 gene locus_tag LOCUS_08100 25080 25277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786459.1 protein_id gnl|my_center|LOCUS_08100 25825 25385 gene locus_tag LOCUS_08110 25825 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 26957 26223 gene locus_tag LOCUS_08120 26957 26223 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_08120 28021 26954 gene locus_tag LOCUS_08130 28021 26954 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_08130 29420 28200 gene locus_tag LOCUS_08140 29420 28200 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765923.1 protein_id gnl|my_center|LOCUS_08140 30187 29441 gene locus_tag LOCUS_08150 30187 29441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763426.1 protein_id gnl|my_center|LOCUS_08150 31425 30199 gene locus_tag LOCUS_08160 31425 30199 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794794.1 protein_id gnl|my_center|LOCUS_08160 32787 31444 gene locus_tag LOCUS_08170 32787 31444 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107656.1 protein_id gnl|my_center|LOCUS_08170 32934 33152 gene locus_tag LOCUS_08180 32934 33152 CDS product DUF4492 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786916.1 protein_id gnl|my_center|LOCUS_08180 33182 34681 gene locus_tag LOCUS_08190 33182 34681 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763430.1 protein_id gnl|my_center|LOCUS_08190 34716 35867 gene locus_tag LOCUS_08200 gene cydB 34716 35867 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_08200 36528 35995 gene locus_tag LOCUS_08210 36528 35995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 38355 36709 gene locus_tag LOCUS_08220 38355 36709 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202279.1 protein_id gnl|my_center|LOCUS_08220 38755 38369 gene locus_tag LOCUS_08230 38755 38369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203139.1 protein_id gnl|my_center|LOCUS_08230 39587 38763 gene locus_tag LOCUS_08240 gene ispE 39587 38763 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_08240 39899 41200 gene locus_tag LOCUS_08250 39899 41200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 41801 41304 gene locus_tag LOCUS_08260 41801 41304 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107089.1 protein_id gnl|my_center|LOCUS_08260 41956 43527 gene locus_tag LOCUS_08270 gene dnaB 41956 43527 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761250.1 protein_id gnl|my_center|LOCUS_08270 45114 43711 gene locus_tag LOCUS_08280 45114 43711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 48548 45126 gene locus_tag LOCUS_08290 48548 45126 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165360391.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence13 1478 150 gene locus_tag LOCUS_08300 1478 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1705 2796 gene locus_tag LOCUS_08310 gene gmd 1705 2796 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786803.1 protein_id gnl|my_center|LOCUS_08310 2809 3909 gene locus_tag LOCUS_08320 2809 3909 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763415.1 protein_id gnl|my_center|LOCUS_08320 4058 4225 gene locus_tag LOCUS_08330 4058 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 4771 7620 gene locus_tag LOCUS_08340 4771 7620 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_08340 7673 8890 gene locus_tag LOCUS_08350 gene fucP 7673 8890 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_08350 8968 9393 gene locus_tag LOCUS_08360 8968 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_08360 9411 9917 gene locus_tag LOCUS_08370 9411 9917 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788621.1 protein_id gnl|my_center|LOCUS_08370 10308 9919 gene locus_tag LOCUS_08380 10308 9919 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787805.1 protein_id gnl|my_center|LOCUS_08380 12170 10410 gene locus_tag LOCUS_08390 gene aspS 12170 10410 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_08390 12437 13849 gene locus_tag LOCUS_08400 12437 13849 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986486.1 protein_id gnl|my_center|LOCUS_08400 14811 13777 gene locus_tag LOCUS_08410 14811 13777 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108880.1 protein_id gnl|my_center|LOCUS_08410 15607 14990 gene locus_tag LOCUS_08420 15607 14990 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_08420 16629 15718 gene locus_tag LOCUS_08430 16629 15718 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_08430 18093 16846 gene locus_tag LOCUS_08440 18093 16846 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202697.1 protein_id gnl|my_center|LOCUS_08440 19126 18206 gene locus_tag LOCUS_08450 19126 18206 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_08450 20314 19238 gene locus_tag LOCUS_08460 gene serC 20314 19238 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_08460 21882 20560 gene locus_tag LOCUS_08470 21882 20560 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_08470 22015 23859 gene locus_tag LOCUS_08480 gene glmS 22015 23859 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_08480 25233 24046 gene locus_tag LOCUS_08490 25233 24046 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_08490 25893 25267 gene locus_tag LOCUS_08500 25893 25267 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_08500 26590 25928 gene locus_tag LOCUS_08510 26590 25928 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109201.1 protein_id gnl|my_center|LOCUS_08510 26717 29332 gene locus_tag LOCUS_08520 26717 29332 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109202.1 protein_id gnl|my_center|LOCUS_08520 29353 29955 gene locus_tag LOCUS_08530 29353 29955 CDS product LolA-like putative outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109203.1 protein_id gnl|my_center|LOCUS_08530 30141 31088 gene locus_tag LOCUS_08540 gene trxB 30141 31088 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_08540 31120 33936 gene locus_tag LOCUS_08550 31120 33936 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_08550 34274 35449 gene locus_tag LOCUS_08560 34274 35449 CDS product DUF5687 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759989.1 protein_id gnl|my_center|LOCUS_08560 35461 36168 gene locus_tag LOCUS_08570 35461 36168 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_08570 36451 36930 gene locus_tag LOCUS_08580 36451 36930 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759987.1 protein_id gnl|my_center|LOCUS_08580 36941 38023 gene locus_tag LOCUS_08590 36941 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 38479 38105 gene locus_tag LOCUS_08600 38479 38105 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_08600 39273 38521 gene locus_tag LOCUS_08610 39273 38521 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801071.1 protein_id gnl|my_center|LOCUS_08610 39418 40839 gene locus_tag LOCUS_08620 39418 40839 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764708.1 protein_id gnl|my_center|LOCUS_08620 40856 41326 gene locus_tag LOCUS_08630 40856 41326 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760315.1 protein_id gnl|my_center|LOCUS_08630 41353 42369 gene locus_tag LOCUS_08640 gene floA 41353 42369 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785715.1 protein_id gnl|my_center|LOCUS_08640 42391 43269 gene locus_tag LOCUS_08650 42391 43269 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_08650 43388 44797 gene locus_tag LOCUS_08660 gene mnmE 43388 44797 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202306.1 protein_id gnl|my_center|LOCUS_08660 45996 44902 gene locus_tag LOCUS_08670 45996 44902 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816638.1 protein_id gnl|my_center|LOCUS_08670 46295 45993 gene locus_tag LOCUS_08680 46295 45993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 47290 46520 gene locus_tag LOCUS_08690 47290 46520 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328575.1 protein_id gnl|my_center|LOCUS_08690 47791 47306 gene locus_tag LOCUS_08700 47791 47306 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004328577.1 protein_id gnl|my_center|LOCUS_08700 48556 48374 gene locus_tag LOCUS_08710 48556 48374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence14 1563 94 gene locus_tag LOCUS_08720 1563 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 3431 1671 gene locus_tag LOCUS_08730 3431 1671 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798520.1 protein_id gnl|my_center|LOCUS_08730 3871 5145 gene locus_tag LOCUS_08740 3871 5145 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_08740 5209 6162 gene locus_tag LOCUS_08750 5209 6162 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786931.1 protein_id gnl|my_center|LOCUS_08750 6165 6632 gene locus_tag LOCUS_08760 6165 6632 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_08760 6774 6980 gene locus_tag LOCUS_08770 6774 6980 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788091.1 protein_id gnl|my_center|LOCUS_08770 7139 7903 gene locus_tag LOCUS_08780 gene mazG 7139 7903 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_08780 8448 8023 gene locus_tag LOCUS_08790 8448 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785406.1 protein_id gnl|my_center|LOCUS_08790 8835 8458 gene locus_tag LOCUS_08800 8835 8458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785404.1 protein_id gnl|my_center|LOCUS_08800 9435 8887 gene locus_tag LOCUS_08810 9435 8887 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_08810 10426 9512 gene locus_tag LOCUS_08820 10426 9512 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801215.1 protein_id gnl|my_center|LOCUS_08820 12317 10533 gene locus_tag LOCUS_08830 gene rpsA 12317 10533 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_08830 13324 12623 gene locus_tag LOCUS_08840 13324 12623 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453781.1 protein_id gnl|my_center|LOCUS_08840 14212 13373 gene locus_tag LOCUS_08850 14212 13373 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767088.1 protein_id gnl|my_center|LOCUS_08850 14913 14305 gene locus_tag LOCUS_08860 14913 14305 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_08860 15515 17272 gene locus_tag LOCUS_08870 gene ilvD 15515 17272 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_08870 17284 18987 gene locus_tag LOCUS_08880 gene ilvB 17284 18987 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790701.1 protein_id gnl|my_center|LOCUS_08880 19003 19560 gene locus_tag LOCUS_08890 gene ilvN 19003 19560 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_08890 19572 20315 gene locus_tag LOCUS_08900 19572 20315 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766475.1 protein_id gnl|my_center|LOCUS_08900 20364 21407 gene locus_tag LOCUS_08910 gene ilvC 20364 21407 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_08910 21726 22289 gene locus_tag LOCUS_08920 21726 22289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 22565 23089 gene locus_tag LOCUS_08930 22565 23089 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_08930 24431 23169 gene locus_tag LOCUS_08940 24431 23169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_08940 25775 24465 gene locus_tag LOCUS_08950 25775 24465 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_08950 27927 25783 gene locus_tag LOCUS_08960 27927 25783 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762569.1 protein_id gnl|my_center|LOCUS_08960 28285 29334 gene locus_tag LOCUS_08970 gene rlmN 28285 29334 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840521.1 protein_id gnl|my_center|LOCUS_08970 29347 30405 gene locus_tag LOCUS_08980 29347 30405 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_08980 30428 31522 gene locus_tag LOCUS_08990 gene pdxA 30428 31522 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760044.1 protein_id gnl|my_center|LOCUS_08990 31712 32587 gene locus_tag LOCUS_09000 31712 32587 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555689.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09000 32606 33814 gene locus_tag LOCUS_09010 gene fucP 32606 33814 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_09010 34847 33885 gene locus_tag LOCUS_09020 34847 33885 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762527.1 protein_id gnl|my_center|LOCUS_09020 35122 36429 gene locus_tag LOCUS_09030 35122 36429 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_09030 36759 38807 gene locus_tag LOCUS_09040 36759 38807 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_09040 39800 38865 gene locus_tag LOCUS_09050 39800 38865 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055221127.1 protein_id gnl|my_center|LOCUS_09050 40471 39806 gene locus_tag LOCUS_09060 40471 39806 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_09060 40949 40464 gene locus_tag LOCUS_09070 40949 40464 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764781.1 protein_id gnl|my_center|LOCUS_09070 41476 40991 gene locus_tag LOCUS_09080 41476 40991 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_09080 41704 44337 gene locus_tag LOCUS_09090 41704 44337 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_09090 44409 45695 gene locus_tag LOCUS_09100 44409 45695 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_09100 45682 46212 gene locus_tag LOCUS_09110 45682 46212 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_09110 46402 47007 gene locus_tag LOCUS_09120 46402 47007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_09120 47014 47394 gene locus_tag LOCUS_09130 gene secG 47014 47394 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109227.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence15 1463 96 gene locus_tag LOCUS_09140 1463 96 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_09140 2092 1481 gene locus_tag LOCUS_09150 gene udk 2092 1481 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_09150 2167 2466 gene locus_tag LOCUS_09160 2167 2466 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760502.1 protein_id gnl|my_center|LOCUS_09160 2538 3014 gene locus_tag LOCUS_09170 2538 3014 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766233.1 protein_id gnl|my_center|LOCUS_09170 3338 4189 gene locus_tag LOCUS_09180 gene hisG 3338 4189 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_09180 4211 5497 gene locus_tag LOCUS_09190 gene hisD 4211 5497 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_09190 5510 6547 gene locus_tag LOCUS_09200 gene hisC 5510 6547 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_09200 6552 7676 gene locus_tag LOCUS_09210 gene hisB 6552 7676 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_09210 8303 7818 gene locus_tag LOCUS_09220 8303 7818 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949083.1 protein_id gnl|my_center|LOCUS_09220 9912 8389 gene locus_tag LOCUS_09230 9912 8389 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_09230 10046 12262 gene locus_tag LOCUS_09240 10046 12262 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_09240 12398 12787 gene locus_tag LOCUS_09250 12398 12787 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_09250 13511 12876 gene locus_tag LOCUS_09260 13511 12876 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763514.1 protein_id gnl|my_center|LOCUS_09260 14156 13527 gene locus_tag LOCUS_09270 14156 13527 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107609.1 protein_id gnl|my_center|LOCUS_09270 14765 14187 gene locus_tag LOCUS_09280 14765 14187 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786125.1 protein_id gnl|my_center|LOCUS_09280 14945 15679 gene locus_tag LOCUS_09290 14945 15679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791920.1 protein_id gnl|my_center|LOCUS_09290 15797 16972 gene locus_tag LOCUS_09300 15797 16972 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786133.1 protein_id gnl|my_center|LOCUS_09300 17033 18196 gene locus_tag LOCUS_09310 17033 18196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 19047 18463 gene locus_tag LOCUS_09320 19047 18463 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203220.1 protein_id gnl|my_center|LOCUS_09320 19602 19084 gene locus_tag LOCUS_09330 19602 19084 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_09330 20396 19599 gene locus_tag LOCUS_09340 20396 19599 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_09340 20893 20561 gene locus_tag LOCUS_09350 20893 20561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789521.1 protein_id gnl|my_center|LOCUS_09350 21432 20896 gene locus_tag LOCUS_09360 21432 20896 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767848.1 protein_id gnl|my_center|LOCUS_09360 21602 22483 gene locus_tag LOCUS_09370 21602 22483 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661159.1 protein_id gnl|my_center|LOCUS_09370 22708 23112 gene locus_tag LOCUS_09380 gene mce 22708 23112 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_09380 23287 24888 gene locus_tag LOCUS_09390 23287 24888 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_09390 24911 25846 gene locus_tag LOCUS_09400 24911 25846 CDS product OadG family transporter subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767844.1 protein_id gnl|my_center|LOCUS_09400 25866 26291 gene locus_tag LOCUS_09410 25866 26291 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_09410 26293 27453 gene locus_tag LOCUS_09420 26293 27453 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_09420 27669 27920 gene locus_tag LOCUS_09430 27669 27920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 28413 28943 gene locus_tag LOCUS_09440 28413 28943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 28951 30432 gene locus_tag LOCUS_09450 28951 30432 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_09450 30503 31534 gene locus_tag LOCUS_09460 30503 31534 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_09460 32141 31551 gene locus_tag LOCUS_09470 32141 31551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 32939 32427 gene locus_tag LOCUS_09480 32939 32427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 33450 33034 gene locus_tag LOCUS_09490 33450 33034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 34713 33535 gene locus_tag LOCUS_09500 34713 33535 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130543805.1 protein_id gnl|my_center|LOCUS_09500 34771 35208 gene locus_tag LOCUS_09510 34771 35208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 35205 36356 gene locus_tag LOCUS_09520 35205 36356 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202358.1 protein_id gnl|my_center|LOCUS_09520 36364 38028 gene locus_tag LOCUS_09530 gene menD 36364 38028 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766783.1 protein_id gnl|my_center|LOCUS_09530 38054 38878 gene locus_tag LOCUS_09540 gene menB 38054 38878 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795543.1 protein_id gnl|my_center|LOCUS_09540 39311 38946 gene locus_tag LOCUS_09550 39311 38946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 39645 39346 gene locus_tag LOCUS_09560 39645 39346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 39843 40142 gene locus_tag LOCUS_09570 39843 40142 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778918.1 protein_id gnl|my_center|LOCUS_09570 40165 41520 gene locus_tag LOCUS_09580 gene dcm 40165 41520 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_09580 41504 42145 gene locus_tag LOCUS_09590 41504 42145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 42129 43214 gene locus_tag LOCUS_09600 42129 43214 CDS product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964363.1 protein_id gnl|my_center|LOCUS_09600 43253 43768 gene locus_tag LOCUS_09610 43253 43768 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203406.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence16 285 1184 gene locus_tag LOCUS_09620 285 1184 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962250.1 protein_id gnl|my_center|LOCUS_09620 2025 1735 gene locus_tag LOCUS_09630 2025 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2546 2022 gene locus_tag LOCUS_09640 2546 2022 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974802.1 protein_id gnl|my_center|LOCUS_09640 4591 3023 gene locus_tag LOCUS_09650 4591 3023 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763318.1 protein_id gnl|my_center|LOCUS_09650 5472 4618 gene locus_tag LOCUS_09660 gene rfbD 5472 4618 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_09660 6051 5503 gene locus_tag LOCUS_09670 6051 5503 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_09670 6712 6053 gene locus_tag LOCUS_09680 6712 6053 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786014.1 protein_id gnl|my_center|LOCUS_09680 6851 10555 gene locus_tag LOCUS_09690 gene purL 6851 10555 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_09690 10900 14805 gene locus_tag LOCUS_09700 10900 14805 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789596.1 protein_id gnl|my_center|LOCUS_09700 14813 15370 gene locus_tag LOCUS_09710 14813 15370 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763312.1 protein_id gnl|my_center|LOCUS_09710 15379 15960 gene locus_tag LOCUS_09720 15379 15960 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_09720 17656 16199 gene locus_tag LOCUS_09730 17656 16199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 18983 20074 gene locus_tag LOCUS_09740 18983 20074 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768087.1 protein_id gnl|my_center|LOCUS_09740 20088 21122 gene locus_tag LOCUS_09750 20088 21122 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_09750 21125 22153 gene locus_tag LOCUS_09760 21125 22153 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202775.1 protein_id gnl|my_center|LOCUS_09760 22329 23834 gene locus_tag LOCUS_09770 22329 23834 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761361.1 protein_id gnl|my_center|LOCUS_09770 25569 23926 gene locus_tag LOCUS_09780 25569 23926 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797936.1 protein_id gnl|my_center|LOCUS_09780 27391 25715 gene locus_tag LOCUS_09790 27391 25715 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_09790 27631 29493 gene locus_tag LOCUS_09800 gene mutA 27631 29493 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 protein_id gnl|my_center|LOCUS_09800 29499 31649 gene locus_tag LOCUS_09810 gene scpA 29499 31649 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_09810 31755 33668 gene locus_tag LOCUS_09820 31755 33668 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202190.1 protein_id gnl|my_center|LOCUS_09820 33822 34400 gene locus_tag LOCUS_09830 33822 34400 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791874.1 protein_id gnl|my_center|LOCUS_09830 35790 34504 gene locus_tag LOCUS_09840 35790 34504 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357375.1 protein_id gnl|my_center|LOCUS_09840 36511 35810 gene locus_tag LOCUS_09850 36511 35810 CDS product DUF5020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109270.1 protein_id gnl|my_center|LOCUS_09850 37407 37201 gene locus_tag LOCUS_09860 37407 37201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 38610 37408 gene locus_tag LOCUS_09870 38610 37408 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785063.1 protein_id gnl|my_center|LOCUS_09870 39683 38691 gene locus_tag LOCUS_09880 39683 38691 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_09880 42903 40378 gene locus_tag LOCUS_09890 42903 40378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence17 859 206 gene locus_tag LOCUS_09900 gene nth 859 206 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_09900 1913 873 gene locus_tag LOCUS_09910 gene corA 1913 873 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785927.1 protein_id gnl|my_center|LOCUS_09910 2523 3353 gene locus_tag LOCUS_09920 gene dinD 2523 3353 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 protein_id gnl|my_center|LOCUS_09920 3470 4048 gene locus_tag LOCUS_09930 3470 4048 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203655.1 protein_id gnl|my_center|LOCUS_09930 4301 4987 gene locus_tag LOCUS_09940 4301 4987 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762200.1 protein_id gnl|my_center|LOCUS_09940 4990 5682 gene locus_tag LOCUS_09950 gene queC 4990 5682 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762201.1 protein_id gnl|my_center|LOCUS_09950 5717 6172 gene locus_tag LOCUS_09960 gene queF 5717 6172 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_09960 8138 6264 gene locus_tag LOCUS_09970 8138 6264 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_09970 8265 8591 gene locus_tag LOCUS_09980 8265 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 8584 8931 gene locus_tag LOCUS_09990 8584 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767910.1 protein_id gnl|my_center|LOCUS_09990 10001 8928 gene locus_tag LOCUS_10000 10001 8928 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966322.1 protein_id gnl|my_center|LOCUS_10000 11307 9982 gene locus_tag LOCUS_10010 11307 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 13609 11447 gene locus_tag LOCUS_10020 13609 11447 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203170.1 protein_id gnl|my_center|LOCUS_10020 15896 13731 gene locus_tag LOCUS_10030 15896 13731 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789096.1 protein_id gnl|my_center|LOCUS_10030 16215 16775 gene locus_tag LOCUS_10040 16215 16775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 17592 16840 gene locus_tag LOCUS_10050 17592 16840 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760542.1 protein_id gnl|my_center|LOCUS_10050 18455 17616 gene locus_tag LOCUS_10060 18455 17616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 19709 18804 gene locus_tag LOCUS_10070 19709 18804 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660983.1 protein_id gnl|my_center|LOCUS_10070 21067 19727 gene locus_tag LOCUS_10080 21067 19727 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 protein_id gnl|my_center|LOCUS_10080 21823 21077 gene locus_tag LOCUS_10090 21823 21077 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_10090 23069 21867 gene locus_tag LOCUS_10100 23069 21867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 25321 23066 gene locus_tag LOCUS_10110 25321 23066 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_10110 25416 26690 gene locus_tag LOCUS_10120 25416 26690 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_10120 26741 30103 gene locus_tag LOCUS_10130 gene mfd 26741 30103 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766199.1 protein_id gnl|my_center|LOCUS_10130 30312 31391 gene locus_tag LOCUS_10140 30312 31391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 31769 33052 gene locus_tag LOCUS_10150 31769 33052 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_10150 33221 35872 gene locus_tag LOCUS_10160 33221 35872 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769481.1 protein_id gnl|my_center|LOCUS_10160 35931 37322 gene locus_tag LOCUS_10170 35931 37322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 37802 38743 gene locus_tag LOCUS_10180 37802 38743 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108586.1 protein_id gnl|my_center|LOCUS_10180 39092 40603 gene locus_tag LOCUS_10190 gene accC 39092 40603 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_10190 40624 41145 gene locus_tag LOCUS_10200 40624 41145 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790282.1 protein_id gnl|my_center|LOCUS_10200 41148 42680 gene locus_tag LOCUS_10210 41148 42680 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766267.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence18 684 1433 gene locus_tag LOCUS_10220 684 1433 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_10220 2501 1599 gene locus_tag LOCUS_10230 2501 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 2983 2522 gene locus_tag LOCUS_10240 2983 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788217.1 protein_id gnl|my_center|LOCUS_10240 3413 4498 gene locus_tag LOCUS_10250 3413 4498 CDS product HpaII family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794495.1 protein_id gnl|my_center|LOCUS_10250 4695 5492 gene locus_tag LOCUS_10260 4695 5492 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 protein_id gnl|my_center|LOCUS_10260 5479 7176 gene locus_tag LOCUS_10270 5479 7176 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_10270 8211 7324 gene locus_tag LOCUS_10280 gene fabD 8211 7324 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_10280 9100 8267 gene locus_tag LOCUS_10290 gene thiD 9100 8267 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765649.1 protein_id gnl|my_center|LOCUS_10290 9327 10067 gene locus_tag LOCUS_10300 9327 10067 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787639.1 protein_id gnl|my_center|LOCUS_10300 10073 11563 gene locus_tag LOCUS_10310 10073 11563 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_10310 11603 12919 gene locus_tag LOCUS_10320 gene xylA 11603 12919 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_10320 13027 14094 gene locus_tag LOCUS_10330 13027 14094 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_10330 14680 14177 gene locus_tag LOCUS_10340 gene tpx 14680 14177 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788597.1 protein_id gnl|my_center|LOCUS_10340 18418 14867 gene locus_tag LOCUS_10350 gene nifJ 18418 14867 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_10350 19646 18468 gene locus_tag LOCUS_10360 19646 18468 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203237.1 protein_id gnl|my_center|LOCUS_10360 19852 21015 gene locus_tag LOCUS_10370 19852 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032528599.1 protein_id gnl|my_center|LOCUS_10370 23213 21078 gene locus_tag LOCUS_10380 23213 21078 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_10380 24635 23379 gene locus_tag LOCUS_10390 24635 23379 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_10390 25267 24653 gene locus_tag LOCUS_10400 gene lptC 25267 24653 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764532.1 protein_id gnl|my_center|LOCUS_10400 26633 25272 gene locus_tag LOCUS_10410 26633 25272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760038.1 protein_id gnl|my_center|LOCUS_10410 27880 26654 gene locus_tag LOCUS_10420 27880 26654 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_10420 28628 27900 gene locus_tag LOCUS_10430 28628 27900 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202250.1 protein_id gnl|my_center|LOCUS_10430 28859 29989 gene locus_tag LOCUS_10440 28859 29989 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_10440 29986 31569 gene locus_tag LOCUS_10450 29986 31569 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785445.1 protein_id gnl|my_center|LOCUS_10450 31667 35026 gene locus_tag LOCUS_10460 gene secA 31667 35026 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_10460 35160 36158 gene locus_tag LOCUS_10470 35160 36158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 36188 36664 gene locus_tag LOCUS_10480 36188 36664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_10480 36812 37810 gene locus_tag LOCUS_10490 36812 37810 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765092.1 protein_id gnl|my_center|LOCUS_10490 38603 37833 gene locus_tag LOCUS_10500 38603 37833 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107576.1 protein_id gnl|my_center|LOCUS_10500 38705 39574 gene locus_tag LOCUS_10510 gene rhuM 38705 39574 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201977.1 protein_id gnl|my_center|LOCUS_10510 42321 39676 gene locus_tag LOCUS_10520 42321 39676 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence19 184 290 gene locus_tag LOCUS_r00010 184 290 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 864 331 gene locus_tag LOCUS_10530 864 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1946 972 gene locus_tag LOCUS_10540 1946 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3603 2023 gene locus_tag LOCUS_10550 gene nadB 3603 2023 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_10550 3807 4172 gene locus_tag LOCUS_10560 3807 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4231 5571 gene locus_tag LOCUS_10570 gene lpdA 4231 5571 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108698.1 protein_id gnl|my_center|LOCUS_10570 5602 7002 gene locus_tag LOCUS_10580 gene dacB 5602 7002 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201838.1 protein_id gnl|my_center|LOCUS_10580 7091 7885 gene locus_tag LOCUS_10590 7091 7885 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783664.1 protein_id gnl|my_center|LOCUS_10590 8600 7959 gene locus_tag LOCUS_10600 8600 7959 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_10600 11959 8633 gene locus_tag LOCUS_10610 11959 8633 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_10610 12838 12071 gene locus_tag LOCUS_10620 12838 12071 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062696006.1 protein_id gnl|my_center|LOCUS_10620 13713 12835 gene locus_tag LOCUS_10630 13713 12835 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108714.1 protein_id gnl|my_center|LOCUS_10630 14417 13746 gene locus_tag LOCUS_10640 gene mnmD 14417 13746 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_10640 14883 14422 gene locus_tag LOCUS_10650 14883 14422 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783683.1 protein_id gnl|my_center|LOCUS_10650 15809 14859 gene locus_tag LOCUS_10660 15809 14859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783685.1 protein_id gnl|my_center|LOCUS_10660 17086 15812 gene locus_tag LOCUS_10670 gene purD 17086 15812 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_10670 19414 17123 gene locus_tag LOCUS_10680 19414 17123 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108719.1 protein_id gnl|my_center|LOCUS_10680 20960 19530 gene locus_tag LOCUS_10690 20960 19530 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991905.1 protein_id gnl|my_center|LOCUS_10690 21942 21046 gene locus_tag LOCUS_10700 21942 21046 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_10700 22064 22195 gene locus_tag LOCUS_10710 22064 22195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 22589 24640 gene locus_tag LOCUS_10720 gene btuB 22589 24640 CDS product TonB-dependent vitamin B12 receptor BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002228170.1 protein_id gnl|my_center|LOCUS_10720 25867 24803 gene locus_tag LOCUS_10730 gene mnmA 25867 24803 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767559.1 protein_id gnl|my_center|LOCUS_10730 28121 26145 gene locus_tag LOCUS_10740 28121 26145 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_10740 28453 32577 gene locus_tag LOCUS_10750 28453 32577 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107220.1 protein_id gnl|my_center|LOCUS_10750 33075 36260 gene locus_tag LOCUS_10760 33075 36260 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_10760 36297 38051 gene locus_tag LOCUS_10770 36297 38051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 38101 39888 gene locus_tag LOCUS_10780 38101 39888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 40034 41950 gene locus_tag LOCUS_10790 40034 41950 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107215.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence20 100 894 gene locus_tag LOCUS_10800 100 894 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761063.1 protein_id gnl|my_center|LOCUS_10800 913 1398 gene locus_tag LOCUS_10810 913 1398 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797943.1 protein_id gnl|my_center|LOCUS_10810 1871 1395 gene locus_tag LOCUS_10820 1871 1395 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790644.1 protein_id gnl|my_center|LOCUS_10820 2002 3288 gene locus_tag LOCUS_10830 2002 3288 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_10830 3322 3852 gene locus_tag LOCUS_10840 3322 3852 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766462.1 protein_id gnl|my_center|LOCUS_10840 4378 3914 gene locus_tag LOCUS_10850 4378 3914 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_10850 4968 4381 gene locus_tag LOCUS_10860 4968 4381 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_10860 5473 5009 gene locus_tag LOCUS_10870 5473 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790650.1 protein_id gnl|my_center|LOCUS_10870 6290 5487 gene locus_tag LOCUS_10880 6290 5487 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_10880 6454 6366 gene locus_tag LOCUS_t00170 6454 6366 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7401 6625 gene locus_tag LOCUS_10890 7401 6625 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_10890 8390 7407 gene locus_tag LOCUS_10900 8390 7407 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108113.1 protein_id gnl|my_center|LOCUS_10900 9147 8461 gene locus_tag LOCUS_10910 9147 8461 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_10910 9388 10080 gene locus_tag LOCUS_10920 gene cmk 9388 10080 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_10920 10073 10945 gene locus_tag LOCUS_10930 10073 10945 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_10930 11052 12032 gene locus_tag LOCUS_10940 gene pfkA 11052 12032 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761048.1 protein_id gnl|my_center|LOCUS_10940 13607 12264 gene locus_tag LOCUS_10950 13607 12264 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_10950 14398 13604 gene locus_tag LOCUS_10960 14398 13604 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762999.1 protein_id gnl|my_center|LOCUS_10960 15189 14392 gene locus_tag LOCUS_10970 15189 14392 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778456.1 protein_id gnl|my_center|LOCUS_10970 16626 15214 gene locus_tag LOCUS_10980 gene potA 16626 15214 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769055.1 protein_id gnl|my_center|LOCUS_10980 17167 16823 gene locus_tag LOCUS_10990 17167 16823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 19395 17200 gene locus_tag LOCUS_11000 19395 17200 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055269995.1 protein_id gnl|my_center|LOCUS_11000 20754 19654 gene locus_tag LOCUS_11010 gene meaB 20754 19654 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_11010 21925 20849 gene locus_tag LOCUS_11020 21925 20849 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_11020 27797 22095 gene locus_tag LOCUS_11030 27797 22095 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072066367.1 protein_id gnl|my_center|LOCUS_11030 27965 28405 gene locus_tag LOCUS_11040 27965 28405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 29577 28483 gene locus_tag LOCUS_11050 gene gcvT 29577 28483 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_11050 30917 29691 gene locus_tag LOCUS_11060 gene pepT 30917 29691 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_11060 30930 31208 gene locus_tag LOCUS_11070 30930 31208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 31237 32424 gene locus_tag LOCUS_11080 31237 32424 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107637.1 protein_id gnl|my_center|LOCUS_11080 32955 32518 gene locus_tag LOCUS_11090 32955 32518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 33272 33198 gene locus_tag LOCUS_t00180 33272 33198 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33583 34119 gene locus_tag LOCUS_11100 33583 34119 CDS product DUF4199 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202309.1 protein_id gnl|my_center|LOCUS_11100 34125 35075 gene locus_tag LOCUS_11110 34125 35075 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_11110 35078 35590 gene locus_tag LOCUS_11120 35078 35590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 35583 36260 gene locus_tag LOCUS_11130 35583 36260 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812917.1 protein_id gnl|my_center|LOCUS_11130 36264 36839 gene locus_tag LOCUS_11140 36264 36839 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_11140 36845 37855 gene locus_tag LOCUS_11150 36845 37855 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_11150 37870 39867 gene locus_tag LOCUS_11160 37870 39867 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_11160 39947 40786 gene locus_tag LOCUS_11170 39947 40786 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_11170 40900 41454 gene locus_tag LOCUS_11180 40900 41454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence21 61 1630 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctatacgtattaagtaatttctactattgtagat 1612 1911 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcactcttcgtgagtgcgtggattgaaact 2649 4556 gene locus_tag LOCUS_11190 gene nuoF 2649 4556 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766746.1 protein_id gnl|my_center|LOCUS_11190 4561 6330 gene locus_tag LOCUS_11200 4561 6330 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766747.1 protein_id gnl|my_center|LOCUS_11200 6335 6820 gene locus_tag LOCUS_11210 gene nuoE 6335 6820 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_11210 7649 6804 gene locus_tag LOCUS_11220 gene coaW 7649 6804 CDS product type II pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442504.1 protein_id gnl|my_center|LOCUS_11220 7905 8747 gene locus_tag LOCUS_11230 7905 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 10224 9130 gene locus_tag LOCUS_11240 10224 9130 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963858.1 protein_id gnl|my_center|LOCUS_11240 11420 10236 gene locus_tag LOCUS_11250 11420 10236 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_11250 11596 12330 gene locus_tag LOCUS_11260 gene ric 11596 12330 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814727.1 protein_id gnl|my_center|LOCUS_11260 13991 12417 gene locus_tag LOCUS_11270 13991 12417 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_11270 14536 14261 gene locus_tag LOCUS_11280 14536 14261 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_11280 14716 15789 gene locus_tag LOCUS_11290 gene mutY 14716 15789 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_11290 15780 16229 gene locus_tag LOCUS_11300 gene ssb 15780 16229 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795194.1 protein_id gnl|my_center|LOCUS_11300 16364 17677 gene locus_tag LOCUS_11310 16364 17677 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_11310 17680 18297 gene locus_tag LOCUS_11320 17680 18297 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_11320 20133 18346 gene locus_tag LOCUS_11330 20133 18346 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762293.1 protein_id gnl|my_center|LOCUS_11330 20834 20148 gene locus_tag LOCUS_11340 20834 20148 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762294.1 protein_id gnl|my_center|LOCUS_11340 21969 20914 gene locus_tag LOCUS_11350 21969 20914 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_11350 22930 22154 gene locus_tag LOCUS_11360 gene trpA 22930 22154 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765046.1 protein_id gnl|my_center|LOCUS_11360 23544 22927 gene locus_tag LOCUS_11370 23544 22927 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765047.1 protein_id gnl|my_center|LOCUS_11370 24329 23541 gene locus_tag LOCUS_11380 gene trpC 24329 23541 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_11380 25358 24363 gene locus_tag LOCUS_11390 gene trpD 25358 24363 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763093.1 protein_id gnl|my_center|LOCUS_11390 25935 25372 gene locus_tag LOCUS_11400 25935 25372 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_11400 27365 25953 gene locus_tag LOCUS_11410 27365 25953 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_11410 28543 27362 gene locus_tag LOCUS_11420 gene trpB 28543 27362 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_11420 28968 29540 gene locus_tag LOCUS_11430 28968 29540 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788262.1 protein_id gnl|my_center|LOCUS_11430 30419 29568 gene locus_tag LOCUS_11440 30419 29568 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787242.1 protein_id gnl|my_center|LOCUS_11440 30653 32071 gene locus_tag LOCUS_11450 gene xylE 30653 32071 CDS product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202803.1 protein_id gnl|my_center|LOCUS_11450 32414 32142 gene locus_tag LOCUS_11460 32414 32142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 32785 32423 gene locus_tag LOCUS_11470 32785 32423 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760687.1 protein_id gnl|my_center|LOCUS_11470 33133 32861 gene locus_tag LOCUS_11480 33133 32861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 33267 33779 gene locus_tag LOCUS_11490 33267 33779 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786521.1 protein_id gnl|my_center|LOCUS_11490 33872 34834 gene locus_tag LOCUS_11500 33872 34834 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202513.1 protein_id gnl|my_center|LOCUS_11500 34992 35411 gene locus_tag LOCUS_11510 gene ruvX 34992 35411 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786562.1 protein_id gnl|my_center|LOCUS_11510 35429 35983 gene locus_tag LOCUS_11520 gene def 35429 35983 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_11520 35980 37989 gene locus_tag LOCUS_11530 35980 37989 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_11530 38104 40044 gene locus_tag LOCUS_11540 gene thrS 38104 40044 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107262.1 protein_id gnl|my_center|LOCUS_11540 40152 40742 gene locus_tag LOCUS_11550 gene infC 40152 40742 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_11550 40815 41012 gene locus_tag LOCUS_11560 gene rpmI 40815 41012 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_11560 41116 41466 gene locus_tag LOCUS_11570 gene rplT 41116 41466 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786577.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence22 1064 36 gene locus_tag LOCUS_11580 1064 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1956 1084 gene locus_tag LOCUS_11590 1956 1084 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765359.1 protein_id gnl|my_center|LOCUS_11590 3627 1990 gene locus_tag LOCUS_11600 3627 1990 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765358.1 protein_id gnl|my_center|LOCUS_11600 4708 3632 gene locus_tag LOCUS_11610 4708 3632 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108483.1 protein_id gnl|my_center|LOCUS_11610 5981 4731 gene locus_tag LOCUS_11620 5981 4731 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761968.1 protein_id gnl|my_center|LOCUS_11620 6138 5947 gene locus_tag LOCUS_11630 6138 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 6832 6215 gene locus_tag LOCUS_11640 6832 6215 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765568.1 protein_id gnl|my_center|LOCUS_11640 6933 8591 gene locus_tag LOCUS_11650 gene hcp 6933 8591 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761363.1 protein_id gnl|my_center|LOCUS_11650 8729 9193 gene locus_tag LOCUS_11660 8729 9193 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 protein_id gnl|my_center|LOCUS_11660 9281 10027 gene locus_tag LOCUS_11670 9281 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 10024 10728 gene locus_tag LOCUS_11680 10024 10728 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761172.1 protein_id gnl|my_center|LOCUS_11680 11487 10732 gene locus_tag LOCUS_11690 11487 10732 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_11690 12200 11502 gene locus_tag LOCUS_11700 12200 11502 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 protein_id gnl|my_center|LOCUS_11700 13986 12205 gene locus_tag LOCUS_11710 13986 12205 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107334.1 protein_id gnl|my_center|LOCUS_11710 14061 16892 gene locus_tag LOCUS_11720 gene uvrA 14061 16892 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_11720 16922 17410 gene locus_tag LOCUS_11730 gene ybaK 16922 17410 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_11730 18625 17501 gene locus_tag LOCUS_11740 18625 17501 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107778.1 protein_id gnl|my_center|LOCUS_11740 19741 18641 gene locus_tag LOCUS_11750 19741 18641 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785546.1 protein_id gnl|my_center|LOCUS_11750 20583 19873 gene locus_tag LOCUS_11760 20583 19873 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763423.1 protein_id gnl|my_center|LOCUS_11760 20903 20580 gene locus_tag LOCUS_11770 20903 20580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11770 21590 20910 gene locus_tag LOCUS_11780 21590 20910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11780 24137 21663 gene locus_tag LOCUS_11790 24137 21663 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108886.1 protein_id gnl|my_center|LOCUS_11790 24453 24965 gene locus_tag LOCUS_11800 24453 24965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 25179 26744 gene locus_tag LOCUS_11810 25179 26744 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107335.1 protein_id gnl|my_center|LOCUS_11810 28397 26847 gene locus_tag LOCUS_11820 28397 26847 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_11820 29190 28588 gene locus_tag LOCUS_11830 29190 28588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 30753 29305 gene locus_tag LOCUS_11840 30753 29305 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_11840 30822 31439 gene locus_tag LOCUS_11850 gene recR 30822 31439 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_11850 31452 31916 gene locus_tag LOCUS_11860 31452 31916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 31913 32437 gene locus_tag LOCUS_11870 31913 32437 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763510.1 protein_id gnl|my_center|LOCUS_11870 33029 32439 gene locus_tag LOCUS_11880 33029 32439 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787276.1 protein_id gnl|my_center|LOCUS_11880 33212 33538 gene locus_tag LOCUS_11890 33212 33538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 33595 34137 gene locus_tag LOCUS_11900 33595 34137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11900 34291 34367 gene locus_tag LOCUS_t00190 34291 34367 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 34375 34449 gene locus_tag LOCUS_t00200 34375 34449 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 36461 35157 gene locus_tag LOCUS_11910 36461 35157 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815375.1 protein_id gnl|my_center|LOCUS_11910 38159 36669 gene locus_tag LOCUS_11920 38159 36669 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_11920 39246 38170 gene locus_tag LOCUS_11930 39246 38170 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107293.1 protein_id gnl|my_center|LOCUS_11930 39478 40500 gene locus_tag LOCUS_11940 39478 40500 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_11940 40541 41209 gene locus_tag LOCUS_11950 40541 41209 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence23 2193 94 gene locus_tag LOCUS_11960 gene recG 2193 94 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_11960 2870 2208 gene locus_tag LOCUS_11970 2870 2208 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791123.1 protein_id gnl|my_center|LOCUS_11970 3418 2870 gene locus_tag LOCUS_11980 3418 2870 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_11980 4319 3498 gene locus_tag LOCUS_11990 4319 3498 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203535.1 protein_id gnl|my_center|LOCUS_11990 4739 4323 gene locus_tag LOCUS_12000 4739 4323 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_12000 5483 4743 gene locus_tag LOCUS_12010 5483 4743 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_12010 6184 5471 gene locus_tag LOCUS_12020 6184 5471 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_12020 6295 7185 gene locus_tag LOCUS_12030 6295 7185 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760837.1 protein_id gnl|my_center|LOCUS_12030 9726 7222 gene locus_tag LOCUS_12040 9726 7222 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108921.1 protein_id gnl|my_center|LOCUS_12040 11142 9940 gene locus_tag LOCUS_12050 11142 9940 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_12050 11334 12194 gene locus_tag LOCUS_12060 gene folP 11334 12194 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_12060 12198 12992 gene locus_tag LOCUS_12070 gene cdaA 12198 12992 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_12070 14023 12989 gene locus_tag LOCUS_12080 14023 12989 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108932.1 protein_id gnl|my_center|LOCUS_12080 14910 14020 gene locus_tag LOCUS_12090 14910 14020 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_12090 15728 15033 gene locus_tag LOCUS_12100 15728 15033 CDS product LrgB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762629.1 protein_id gnl|my_center|LOCUS_12100 16059 15709 gene locus_tag LOCUS_12110 16059 15709 CDS product CidA/LrgA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108934.1 protein_id gnl|my_center|LOCUS_12110 16312 17322 gene locus_tag LOCUS_12120 gene pta 16312 17322 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_12120 17418 18623 gene locus_tag LOCUS_12130 17418 18623 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784326.1 protein_id gnl|my_center|LOCUS_12130 18757 19797 gene locus_tag LOCUS_12140 18757 19797 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_12140 20661 19885 gene locus_tag LOCUS_12150 20661 19885 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_12150 20994 20674 gene locus_tag LOCUS_12160 20994 20674 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_12160 21745 21056 gene locus_tag LOCUS_12170 gene radC 21745 21056 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801604.1 protein_id gnl|my_center|LOCUS_12170 22771 21782 gene locus_tag LOCUS_12180 22771 21782 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_12180 23628 23062 gene locus_tag LOCUS_12190 gene efp 23628 23062 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784338.1 protein_id gnl|my_center|LOCUS_12190 23820 23981 gene locus_tag LOCUS_12200 gene rpmH 23820 23981 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_12200 24123 24794 gene locus_tag LOCUS_12210 24123 24794 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766997.1 protein_id gnl|my_center|LOCUS_12210 24828 25901 gene locus_tag LOCUS_12220 24828 25901 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796526.1 protein_id gnl|my_center|LOCUS_12220 25898 26875 gene locus_tag LOCUS_12230 25898 26875 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_12230 26923 28080 gene locus_tag LOCUS_12240 26923 28080 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_12240 28077 28733 gene locus_tag LOCUS_12250 28077 28733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 28746 29144 gene locus_tag LOCUS_12260 28746 29144 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784350.1 protein_id gnl|my_center|LOCUS_12260 30204 29239 gene locus_tag LOCUS_12270 30204 29239 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_12270 31594 30347 gene locus_tag LOCUS_12280 31594 30347 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_12280 31801 32031 gene locus_tag LOCUS_12290 31801 32031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 32028 32501 gene locus_tag LOCUS_12300 32028 32501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 32683 33648 gene locus_tag LOCUS_12310 32683 33648 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790351.1 protein_id gnl|my_center|LOCUS_12310 34243 33857 gene locus_tag LOCUS_12320 34243 33857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 34378 34635 gene locus_tag LOCUS_12330 34378 34635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 35959 34727 gene locus_tag LOCUS_12340 35959 34727 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156575772.1 protein_id gnl|my_center|LOCUS_12340 36551 35943 gene locus_tag LOCUS_12350 36551 35943 CDS product IS607-like element ISTko2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250792.1 protein_id gnl|my_center|LOCUS_12350 36878 36651 gene locus_tag LOCUS_12360 36878 36651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 38077 36923 gene locus_tag LOCUS_12370 38077 36923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 38286 38211 gene locus_tag LOCUS_t00210 38286 38211 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38459 38532 gene locus_tag LOCUS_t00220 38459 38532 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 38775 39167 gene locus_tag LOCUS_12380 38775 39167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 39434 39793 gene locus_tag LOCUS_12390 39434 39793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 39798 40673 gene locus_tag LOCUS_12400 39798 40673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence24 79 1065 gene locus_tag LOCUS_12410 79 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1571 1155 gene locus_tag LOCUS_12420 1571 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12420 2338 1586 gene locus_tag LOCUS_12430 2338 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12430 2676 6164 gene locus_tag LOCUS_12440 gene ileS 2676 6164 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107458.1 protein_id gnl|my_center|LOCUS_12440 6233 6613 gene locus_tag LOCUS_12450 6233 6613 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_12450 6742 7389 gene locus_tag LOCUS_12460 6742 7389 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_12460 7386 8348 gene locus_tag LOCUS_12470 7386 8348 CDS product DUF4296 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660240.1 protein_id gnl|my_center|LOCUS_12470 8345 8680 gene locus_tag LOCUS_12480 8345 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107461.1 protein_id gnl|my_center|LOCUS_12480 9492 8698 gene locus_tag LOCUS_12490 9492 8698 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761499.1 protein_id gnl|my_center|LOCUS_12490 9567 11882 gene locus_tag LOCUS_12500 9567 11882 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_12500 11893 12132 gene locus_tag LOCUS_12510 11893 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 12542 13300 gene locus_tag LOCUS_12520 12542 13300 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295276.1 protein_id gnl|my_center|LOCUS_12520 13412 13900 gene locus_tag LOCUS_12530 13412 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12530 13882 16374 gene locus_tag LOCUS_12540 13882 16374 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201927.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12540 17967 16546 gene locus_tag LOCUS_12550 17967 16546 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108266.1 protein_id gnl|my_center|LOCUS_12550 18158 17964 gene locus_tag LOCUS_12560 18158 17964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 19099 18149 gene locus_tag LOCUS_12570 19099 18149 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107858.1 protein_id gnl|my_center|LOCUS_12570 20798 19161 gene locus_tag LOCUS_12580 20798 19161 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765520.1 protein_id gnl|my_center|LOCUS_12580 21861 20923 gene locus_tag LOCUS_12590 21861 20923 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_12590 22552 21944 gene locus_tag LOCUS_12600 22552 21944 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788060.1 protein_id gnl|my_center|LOCUS_12600 23174 22776 gene locus_tag LOCUS_12610 23174 22776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 24264 23335 gene locus_tag LOCUS_12620 24264 23335 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_12620 24937 24386 gene locus_tag LOCUS_12630 24937 24386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 26743 25304 gene locus_tag LOCUS_12640 26743 25304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 28087 26945 gene locus_tag LOCUS_12650 28087 26945 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_12650 28223 28714 gene locus_tag LOCUS_12660 28223 28714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 29401 28709 gene locus_tag LOCUS_12670 29401 28709 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107370.1 protein_id gnl|my_center|LOCUS_12670 30645 29515 gene locus_tag LOCUS_12680 gene thiH 30645 29515 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_12680 32383 30683 gene locus_tag LOCUS_12690 gene thiC 32383 30683 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_12690 33179 32403 gene locus_tag LOCUS_12700 33179 32403 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107373.1 protein_id gnl|my_center|LOCUS_12700 33848 33237 gene locus_tag LOCUS_12710 33848 33237 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107374.1 protein_id gnl|my_center|LOCUS_12710 34053 33853 gene locus_tag LOCUS_12720 gene thiS 34053 33853 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765536.1 protein_id gnl|my_center|LOCUS_12720 34886 35617 gene locus_tag LOCUS_12730 34886 35617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763127.1 protein_id gnl|my_center|LOCUS_12730 35756 36112 gene locus_tag LOCUS_12740 35756 36112 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763126.1 protein_id gnl|my_center|LOCUS_12740 36157 37539 gene locus_tag LOCUS_12750 36157 37539 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765058.1 protein_id gnl|my_center|LOCUS_12750 37680 39869 gene locus_tag LOCUS_12760 37680 39869 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence25 425 1561 gene locus_tag LOCUS_12770 425 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1598 3247 gene locus_tag LOCUS_12780 1598 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 3470 4276 gene locus_tag LOCUS_12790 3470 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 5373 4369 gene locus_tag LOCUS_12800 5373 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795545.1 protein_id gnl|my_center|LOCUS_12800 6446 5397 gene locus_tag LOCUS_12810 gene recA 6446 5397 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_12810 6965 6516 gene locus_tag LOCUS_12820 gene bcp 6965 6516 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785789.1 protein_id gnl|my_center|LOCUS_12820 8253 7060 gene locus_tag LOCUS_12830 8253 7060 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_12830 8394 9182 gene locus_tag LOCUS_12840 8394 9182 CDS product META domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785793.1 protein_id gnl|my_center|LOCUS_12840 11493 9244 gene locus_tag LOCUS_12850 11493 9244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 12329 11595 gene locus_tag LOCUS_12860 12329 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 12894 12334 gene locus_tag LOCUS_12870 12894 12334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 13769 12891 gene locus_tag LOCUS_12880 13769 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 14024 14608 gene locus_tag LOCUS_12890 14024 14608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 14622 15146 gene locus_tag LOCUS_12900 14622 15146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 17952 15193 gene locus_tag LOCUS_12910 17952 15193 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202738.1 protein_id gnl|my_center|LOCUS_12910 18260 20179 gene locus_tag LOCUS_12920 gene dnaK 18260 20179 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_12920 21668 20355 gene locus_tag LOCUS_12930 21668 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 22083 22700 gene locus_tag LOCUS_12940 22083 22700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 22729 23124 gene locus_tag LOCUS_12950 22729 23124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 23879 23205 gene locus_tag LOCUS_12960 23879 23205 CDS product DUF6198 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107754.1 protein_id gnl|my_center|LOCUS_12960 24078 24338 gene locus_tag LOCUS_12970 24078 24338 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788897.1 protein_id gnl|my_center|LOCUS_12970 26575 24452 gene locus_tag LOCUS_12980 26575 24452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 27755 26634 gene locus_tag LOCUS_12990 27755 26634 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786035.1 protein_id gnl|my_center|LOCUS_12990 28814 27759 gene locus_tag LOCUS_13000 28814 27759 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202359.1 protein_id gnl|my_center|LOCUS_13000 29268 28867 gene locus_tag LOCUS_13010 29268 28867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 29498 29295 gene locus_tag LOCUS_13020 29498 29295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 30410 29676 gene locus_tag LOCUS_13030 30410 29676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 31033 30407 gene locus_tag LOCUS_13040 31033 30407 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759907.1 protein_id gnl|my_center|LOCUS_13040 31311 32468 gene locus_tag LOCUS_13050 31311 32468 CDS product DUF3874 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109169.1 protein_id gnl|my_center|LOCUS_13050 32773 33036 gene locus_tag LOCUS_13060 32773 33036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 33484 33269 gene locus_tag LOCUS_13070 33484 33269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 35575 33512 gene locus_tag LOCUS_13080 35575 33512 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_13080 35865 35587 gene locus_tag LOCUS_13090 35865 35587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 36967 35966 gene locus_tag LOCUS_13100 36967 35966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 37588 38193 gene locus_tag LOCUS_13110 37588 38193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence26 90 163 gene locus_tag LOCUS_t00230 90 163 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 186 261 gene locus_tag LOCUS_t00240 186 261 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 371 595 gene locus_tag LOCUS_13120 371 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 614 1222 gene locus_tag LOCUS_13130 614 1222 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_13130 1882 1307 gene locus_tag LOCUS_13140 1882 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2990 2232 gene locus_tag LOCUS_13150 2990 2232 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760853.1 protein_id gnl|my_center|LOCUS_13150 4085 3018 gene locus_tag LOCUS_13160 4085 3018 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_13160 5311 4124 gene locus_tag LOCUS_13170 5311 4124 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203532.1 protein_id gnl|my_center|LOCUS_13170 6128 5286 gene locus_tag LOCUS_13180 6128 5286 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_13180 7402 6452 gene locus_tag LOCUS_13190 7402 6452 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203527.1 protein_id gnl|my_center|LOCUS_13190 7528 8229 gene locus_tag LOCUS_13200 7528 8229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 8298 9179 gene locus_tag LOCUS_13210 8298 9179 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_13210 9183 10802 gene locus_tag LOCUS_13220 9183 10802 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202758.1 protein_id gnl|my_center|LOCUS_13220 10771 12114 gene locus_tag LOCUS_13230 10771 12114 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817735.1 protein_id gnl|my_center|LOCUS_13230 14012 12111 gene locus_tag LOCUS_13240 14012 12111 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_13240 15802 14081 gene locus_tag LOCUS_13250 gene recJ 15802 14081 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_13250 17212 16022 gene locus_tag LOCUS_13260 17212 16022 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_13260 18639 17248 gene locus_tag LOCUS_13270 18639 17248 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_13270 18777 19631 gene locus_tag LOCUS_13280 18777 19631 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203249.1 protein_id gnl|my_center|LOCUS_13280 21238 19703 gene locus_tag LOCUS_13290 gene rny 21238 19703 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_13290 21652 21347 gene locus_tag LOCUS_13300 21652 21347 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790425.1 protein_id gnl|my_center|LOCUS_13300 21965 21672 gene locus_tag LOCUS_13310 21965 21672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109256.1 protein_id gnl|my_center|LOCUS_13310 22168 22500 gene locus_tag LOCUS_13320 22168 22500 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764612.1 protein_id gnl|my_center|LOCUS_13320 22487 23032 gene locus_tag LOCUS_13330 22487 23032 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817247.1 protein_id gnl|my_center|LOCUS_13330 23329 23526 gene locus_tag LOCUS_13340 23329 23526 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_13340 23613 24020 gene locus_tag LOCUS_13350 23613 24020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 24489 24416 gene locus_tag LOCUS_t00250 24489 24416 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 25159 24560 gene locus_tag LOCUS_13360 25159 24560 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657288.1 protein_id gnl|my_center|LOCUS_13360 25794 25162 gene locus_tag LOCUS_13370 25794 25162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790373.1 protein_id gnl|my_center|LOCUS_13370 27242 25842 gene locus_tag LOCUS_13380 27242 25842 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790372.1 protein_id gnl|my_center|LOCUS_13380 27896 27246 gene locus_tag LOCUS_13390 27896 27246 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_13390 29247 27943 gene locus_tag LOCUS_13400 29247 27943 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798122.1 protein_id gnl|my_center|LOCUS_13400 29424 29509 gene locus_tag LOCUS_t00260 29424 29509 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 29650 31092 gene locus_tag LOCUS_13410 29650 31092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 31135 32313 gene locus_tag LOCUS_13420 31135 32313 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_13420 32400 35282 gene locus_tag LOCUS_13430 32400 35282 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_13430 36746 35379 gene locus_tag LOCUS_13440 36746 35379 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760379.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence27 143 1129 gene locus_tag LOCUS_13450 143 1129 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797481.1 protein_id gnl|my_center|LOCUS_13450 1209 2903 gene locus_tag LOCUS_13460 1209 2903 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_13460 4840 2993 gene locus_tag LOCUS_13470 4840 2993 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_13470 5349 4840 gene locus_tag LOCUS_13480 gene purE 5349 4840 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_13480 5748 5368 gene locus_tag LOCUS_13490 gene gcvH 5748 5368 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_13490 6471 5791 gene locus_tag LOCUS_13500 6471 5791 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_13500 7949 6474 gene locus_tag LOCUS_13510 gene rpoN 7949 6474 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_13510 9654 7990 gene locus_tag LOCUS_13520 9654 7990 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_13520 9745 11439 gene locus_tag LOCUS_13530 9745 11439 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_13530 12534 11647 gene locus_tag LOCUS_13540 12534 11647 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_13540 13214 12630 gene locus_tag LOCUS_13550 13214 12630 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_13550 13351 14052 gene locus_tag LOCUS_13560 13351 14052 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_13560 14130 14294 gene locus_tag LOCUS_13570 14130 14294 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804009.1 protein_id gnl|my_center|LOCUS_13570 15940 14360 gene locus_tag LOCUS_13580 15940 14360 CDS product DUF5597 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920642.1 protein_id gnl|my_center|LOCUS_13580 16332 19490 gene locus_tag LOCUS_13590 16332 19490 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_13590 19586 21247 gene locus_tag LOCUS_13600 19586 21247 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108889.1 protein_id gnl|my_center|LOCUS_13600 21269 22657 gene locus_tag LOCUS_13610 21269 22657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 22711 25008 gene locus_tag LOCUS_13620 22711 25008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 25896 25180 gene locus_tag LOCUS_13630 25896 25180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108442.1 protein_id gnl|my_center|LOCUS_13630 26618 26025 gene locus_tag LOCUS_13640 26618 26025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 27152 26712 gene locus_tag LOCUS_13650 27152 26712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 29956 27755 gene locus_tag LOCUS_13660 gene pnp 29956 27755 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_13660 30391 31536 gene locus_tag LOCUS_13670 30391 31536 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791376.1 protein_id gnl|my_center|LOCUS_13670 31716 32180 gene locus_tag LOCUS_13680 gene greA 31716 32180 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_13680 32233 32634 gene locus_tag LOCUS_13690 32233 32634 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_13690 32756 35131 gene locus_tag LOCUS_13700 32756 35131 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_13700 36231 35191 gene locus_tag LOCUS_13710 36231 35191 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_13710 36398 36482 gene locus_tag LOCUS_t00270 36398 36482 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence28 564 1886 gene locus_tag LOCUS_13720 564 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2003 3076 gene locus_tag LOCUS_13730 2003 3076 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759897.1 protein_id gnl|my_center|LOCUS_13730 3129 3641 gene locus_tag LOCUS_13740 3129 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4999 3767 gene locus_tag LOCUS_13750 4999 3767 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767048.1 protein_id gnl|my_center|LOCUS_13750 6819 5197 gene locus_tag LOCUS_13760 6819 5197 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 protein_id gnl|my_center|LOCUS_13760 7178 7810 gene locus_tag LOCUS_13770 7178 7810 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_13770 7850 9019 gene locus_tag LOCUS_13780 gene dnaJ 7850 9019 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_13780 9222 9875 gene locus_tag LOCUS_13790 9222 9875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 9887 11191 gene locus_tag LOCUS_13800 9887 11191 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_13800 11378 12472 gene locus_tag LOCUS_13810 11378 12472 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766110.1 protein_id gnl|my_center|LOCUS_13810 12507 13814 gene locus_tag LOCUS_13820 12507 13814 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760657.1 protein_id gnl|my_center|LOCUS_13820 13852 15006 gene locus_tag LOCUS_13830 gene galK 13852 15006 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_13830 15262 17253 gene locus_tag LOCUS_13840 15262 17253 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_13840 17253 17687 gene locus_tag LOCUS_13850 gene rpiB 17253 17687 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_13850 17829 18893 gene locus_tag LOCUS_13860 17829 18893 CDS product DUF4468 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107873.1 protein_id gnl|my_center|LOCUS_13860 18919 20313 gene locus_tag LOCUS_13870 gene pelB 18919 20313 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_13870 20482 21903 gene locus_tag LOCUS_13880 20482 21903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 24308 22014 gene locus_tag LOCUS_13890 24308 22014 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202231.1 protein_id gnl|my_center|LOCUS_13890 24655 24933 gene locus_tag LOCUS_13900 24655 24933 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786499.1 protein_id gnl|my_center|LOCUS_13900 24948 25178 gene locus_tag LOCUS_13910 24948 25178 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_13910 25213 26295 gene locus_tag LOCUS_13920 25213 26295 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_13920 26496 27269 gene locus_tag LOCUS_13930 26496 27269 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786495.1 protein_id gnl|my_center|LOCUS_13930 27299 27847 gene locus_tag LOCUS_13940 27299 27847 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_13940 28043 30121 gene locus_tag LOCUS_13950 28043 30121 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 protein_id gnl|my_center|LOCUS_13950 30136 30954 gene locus_tag LOCUS_13960 30136 30954 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107201.1 protein_id gnl|my_center|LOCUS_13960 30968 31957 gene locus_tag LOCUS_13970 30968 31957 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_13970 32239 33150 gene locus_tag LOCUS_13980 32239 33150 CDS product DUF4421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107781.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence29 996 73 gene locus_tag LOCUS_13990 996 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1337 2935 gene locus_tag LOCUS_14000 1337 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3070 4017 gene locus_tag LOCUS_14010 3070 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4130 4972 gene locus_tag LOCUS_14020 4130 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5132 5941 gene locus_tag LOCUS_14030 5132 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5938 6444 gene locus_tag LOCUS_14040 5938 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6441 6905 gene locus_tag LOCUS_14050 6441 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 6889 7395 gene locus_tag LOCUS_14060 6889 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 7493 8344 gene locus_tag LOCUS_14070 7493 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 8698 8886 gene locus_tag LOCUS_14080 8698 8886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 8889 9995 gene locus_tag LOCUS_14090 8889 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 10067 10285 gene locus_tag LOCUS_14100 10067 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 11261 10350 gene locus_tag LOCUS_14110 11261 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 11585 11274 gene locus_tag LOCUS_14120 11585 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 11738 12361 gene locus_tag LOCUS_14130 11738 12361 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648594.1 protein_id gnl|my_center|LOCUS_14130 12584 12997 gene locus_tag LOCUS_14140 12584 12997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 13116 13292 gene locus_tag LOCUS_14150 13116 13292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 13255 14760 gene locus_tag LOCUS_14160 13255 14760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 14830 14748 gene locus_tag LOCUS_t00280 14830 14748 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15892 14903 gene locus_tag LOCUS_14170 15892 14903 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801668.1 protein_id gnl|my_center|LOCUS_14170 16777 15929 gene locus_tag LOCUS_14180 16777 15929 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801667.1 protein_id gnl|my_center|LOCUS_14180 19417 16787 gene locus_tag LOCUS_14190 19417 16787 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_14190 20866 19508 gene locus_tag LOCUS_14200 20866 19508 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_14200 21141 22682 gene locus_tag LOCUS_14210 21141 22682 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784203.1 protein_id gnl|my_center|LOCUS_14210 22699 23346 gene locus_tag LOCUS_14220 22699 23346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 24320 27523 gene locus_tag LOCUS_14230 24320 27523 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 protein_id gnl|my_center|LOCUS_14230 27537 29030 gene locus_tag LOCUS_14240 27537 29030 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759577.1 protein_id gnl|my_center|LOCUS_14240 29058 29762 gene locus_tag LOCUS_14250 29058 29762 CDS product DUF5012 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108196.1 protein_id gnl|my_center|LOCUS_14250 29768 30337 gene locus_tag LOCUS_14260 29768 30337 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759578.1 protein_id gnl|my_center|LOCUS_14260 31534 30428 gene locus_tag LOCUS_14270 31534 30428 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence30 1189 290 gene locus_tag LOCUS_14280 1189 290 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_14280 1404 2171 gene locus_tag LOCUS_14290 1404 2171 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_14290 2173 3246 gene locus_tag LOCUS_14300 2173 3246 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_14300 4823 3333 gene locus_tag LOCUS_14310 gene proS 4823 3333 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_14310 6069 4915 gene locus_tag LOCUS_14320 6069 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8116 6107 gene locus_tag LOCUS_14330 8116 6107 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_14330 8576 8133 gene locus_tag LOCUS_14340 8576 8133 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761472.1 protein_id gnl|my_center|LOCUS_14340 9277 8609 gene locus_tag LOCUS_14350 9277 8609 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761471.1 protein_id gnl|my_center|LOCUS_14350 10139 9345 gene locus_tag LOCUS_14360 10139 9345 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108488.1 protein_id gnl|my_center|LOCUS_14360 11257 10136 gene locus_tag LOCUS_14370 11257 10136 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765612.1 protein_id gnl|my_center|LOCUS_14370 12608 11322 gene locus_tag LOCUS_14380 12608 11322 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_14380 13371 12610 gene locus_tag LOCUS_14390 gene kdsB 13371 12610 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_14390 13443 13829 gene locus_tag LOCUS_14400 13443 13829 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761418.1 protein_id gnl|my_center|LOCUS_14400 14651 13833 gene locus_tag LOCUS_14410 14651 13833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764147.1 protein_id gnl|my_center|LOCUS_14410 17120 14781 gene locus_tag LOCUS_14420 17120 14781 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_14420 17506 17324 gene locus_tag LOCUS_14430 17506 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 17570 18460 gene locus_tag LOCUS_14440 gene pyrB 17570 18460 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761416.1 protein_id gnl|my_center|LOCUS_14440 18486 18944 gene locus_tag LOCUS_14450 gene pyrI 18486 18944 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_14450 19139 19516 gene locus_tag LOCUS_14460 19139 19516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 19557 20252 gene locus_tag LOCUS_14470 19557 20252 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787542.1 protein_id gnl|my_center|LOCUS_14470 20285 21565 gene locus_tag LOCUS_14480 20285 21565 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787540.1 protein_id gnl|my_center|LOCUS_14480 21673 22326 gene locus_tag LOCUS_14490 21673 22326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 22443 23135 gene locus_tag LOCUS_14500 gene mtgA 22443 23135 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_14500 24558 23143 gene locus_tag LOCUS_14510 24558 23143 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107340.1 protein_id gnl|my_center|LOCUS_14510 24858 26456 gene locus_tag LOCUS_14520 24858 26456 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_14520 26486 28360 gene locus_tag LOCUS_14530 gene yidC 26486 28360 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_14530 28833 30941 gene locus_tag LOCUS_14540 28833 30941 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107338.1 protein_id gnl|my_center|LOCUS_14540 31102 31704 gene locus_tag LOCUS_14550 gene yihA 31102 31704 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence31 512 147 gene locus_tag LOCUS_14560 512 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1267 677 gene locus_tag LOCUS_14570 1267 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763625.1 protein_id gnl|my_center|LOCUS_14570 1759 1280 gene locus_tag LOCUS_14580 1759 1280 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763624.1 protein_id gnl|my_center|LOCUS_14580 2531 1866 gene locus_tag LOCUS_14590 2531 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 3218 2535 gene locus_tag LOCUS_14600 3218 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 3520 3221 gene locus_tag LOCUS_14610 3520 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5304 3883 gene locus_tag LOCUS_14620 5304 3883 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814235.1 protein_id gnl|my_center|LOCUS_14620 6595 5606 gene locus_tag LOCUS_14630 gene nadA 6595 5606 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802044.1 protein_id gnl|my_center|LOCUS_14630 7048 7593 gene locus_tag LOCUS_14640 7048 7593 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_14640 8314 7676 gene locus_tag LOCUS_14650 8314 7676 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201836.1 protein_id gnl|my_center|LOCUS_14650 8554 10452 gene locus_tag LOCUS_14660 8554 10452 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_14660 10503 11282 gene locus_tag LOCUS_14670 10503 11282 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_14670 11842 12513 gene locus_tag LOCUS_14680 11842 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 12514 13617 gene locus_tag LOCUS_14690 12514 13617 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107963.1 protein_id gnl|my_center|LOCUS_14690 13686 15323 gene locus_tag LOCUS_14700 13686 15323 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107435.1 protein_id gnl|my_center|LOCUS_14700 17142 15400 gene locus_tag LOCUS_14710 gene sulP 17142 15400 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108696.1 protein_id gnl|my_center|LOCUS_14710 17312 17890 gene locus_tag LOCUS_14720 17312 17890 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783570.1 protein_id gnl|my_center|LOCUS_14720 18060 19340 gene locus_tag LOCUS_14730 gene eno 18060 19340 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760327.1 protein_id gnl|my_center|LOCUS_14730 19544 19620 gene locus_tag LOCUS_t00290 19544 19620 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 19780 20748 gene locus_tag LOCUS_14740 19780 20748 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_14740 23635 21044 gene locus_tag LOCUS_14750 gene mutS 23635 21044 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_14750 23883 24392 gene locus_tag LOCUS_14760 23883 24392 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_14760 24512 24441 gene locus_tag LOCUS_t00300 24512 24441 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 25159 24638 gene locus_tag LOCUS_14770 25159 24638 CDS product DUF4251 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107608.1 protein_id gnl|my_center|LOCUS_14770 26412 25351 gene locus_tag LOCUS_14780 26412 25351 CDS product Ppx/GppA family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292463.1 protein_id gnl|my_center|LOCUS_14780 28480 26417 gene locus_tag LOCUS_14790 28480 26417 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788264.1 protein_id gnl|my_center|LOCUS_14790 29688 28570 gene locus_tag LOCUS_14800 29688 28570 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766215.1 protein_id gnl|my_center|LOCUS_14800 30506 29685 gene locus_tag LOCUS_14810 30506 29685 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203172.1 protein_id gnl|my_center|LOCUS_14810 30846 30661 gene locus_tag LOCUS_14820 30846 30661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence32 1061 180 gene locus_tag LOCUS_14830 gene folD 1061 180 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_14830 2099 1143 gene locus_tag LOCUS_14840 2099 1143 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_14840 2264 3559 gene locus_tag LOCUS_14850 2264 3559 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_14850 3580 4467 gene locus_tag LOCUS_14860 3580 4467 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_14860 4792 6201 gene locus_tag LOCUS_14870 gene dnaA 4792 6201 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759760.1 protein_id gnl|my_center|LOCUS_14870 7214 6474 gene locus_tag LOCUS_14880 7214 6474 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_14880 7577 10123 gene locus_tag LOCUS_14890 7577 10123 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_14890 10289 10657 gene locus_tag LOCUS_14900 gene folB 10289 10657 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759754.1 protein_id gnl|my_center|LOCUS_14900 11046 11255 gene locus_tag LOCUS_14910 11046 11255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 11293 11565 gene locus_tag LOCUS_14920 11293 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 14367 11908 gene locus_tag LOCUS_14930 14367 11908 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_14930 16122 14782 gene locus_tag LOCUS_14940 16122 14782 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790680.1 protein_id gnl|my_center|LOCUS_14940 17479 16220 gene locus_tag LOCUS_14950 gene icd 17479 16220 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203424.1 protein_id gnl|my_center|LOCUS_14950 19810 17555 gene locus_tag LOCUS_14960 19810 17555 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108124.1 protein_id gnl|my_center|LOCUS_14960 20075 22279 gene locus_tag LOCUS_14970 20075 22279 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_14970 23102 22410 gene locus_tag LOCUS_14980 23102 22410 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_14980 23283 25007 gene locus_tag LOCUS_14990 gene lysS 23283 25007 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759776.1 protein_id gnl|my_center|LOCUS_14990 25137 26105 gene locus_tag LOCUS_15000 25137 26105 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_15000 26118 27467 gene locus_tag LOCUS_15010 26118 27467 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_15010 27581 28309 gene locus_tag LOCUS_15020 27581 28309 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798173.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence33 160 315 gene locus_tag LOCUS_15030 160 315 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_15030 673 1638 gene locus_tag LOCUS_15040 gene ftsY 673 1638 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_15040 1635 2933 gene locus_tag LOCUS_15050 gene rimO 1635 2933 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765734.1 protein_id gnl|my_center|LOCUS_15050 2955 3245 gene locus_tag LOCUS_15060 2955 3245 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761575.1 protein_id gnl|my_center|LOCUS_15060 3238 4638 gene locus_tag LOCUS_15070 3238 4638 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202863.1 protein_id gnl|my_center|LOCUS_15070 4838 5833 gene locus_tag LOCUS_15080 4838 5833 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_15080 5992 6861 gene locus_tag LOCUS_15090 5992 6861 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_15090 6869 7972 gene locus_tag LOCUS_15100 6869 7972 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_15100 7992 8990 gene locus_tag LOCUS_15110 7992 8990 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_15110 9063 10028 gene locus_tag LOCUS_15120 9063 10028 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_15120 10030 10734 gene locus_tag LOCUS_15130 10030 10734 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803588.1 protein_id gnl|my_center|LOCUS_15130 10775 12598 gene locus_tag LOCUS_15140 10775 12598 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_15140 12620 13372 gene locus_tag LOCUS_15150 12620 13372 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765730.1 protein_id gnl|my_center|LOCUS_15150 13399 14112 gene locus_tag LOCUS_15160 13399 14112 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_15160 14238 14498 gene locus_tag LOCUS_15170 14238 14498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_15170 14603 15733 gene locus_tag LOCUS_15180 14603 15733 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_15180 17306 16089 gene locus_tag LOCUS_15190 17306 16089 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787888.1 protein_id gnl|my_center|LOCUS_15190 19923 17356 gene locus_tag LOCUS_15200 gene gyrA 19923 17356 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_15200 20273 22822 gene locus_tag LOCUS_15210 20273 22822 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202860.1 protein_id gnl|my_center|LOCUS_15210 22928 24979 gene locus_tag LOCUS_15220 gene htpG 22928 24979 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_15220 25566 25063 gene locus_tag LOCUS_15230 25566 25063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 25726 28035 gene locus_tag LOCUS_15240 25726 28035 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840909.1 protein_id gnl|my_center|LOCUS_15240 28116 28194 gene locus_tag LOCUS_t00310 28116 28194 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28218 28292 gene locus_tag LOCUS_t00320 28218 28292 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence34 807 1598 gene locus_tag LOCUS_15250 807 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 2279 1926 gene locus_tag LOCUS_15260 2279 1926 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964792.1 protein_id gnl|my_center|LOCUS_15260 2445 2828 gene locus_tag LOCUS_15270 2445 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2832 3383 gene locus_tag LOCUS_15280 2832 3383 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764887.1 protein_id gnl|my_center|LOCUS_15280 3565 4692 gene locus_tag LOCUS_15290 gene hemW 3565 4692 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_15290 5620 4763 gene locus_tag LOCUS_15300 5620 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 7341 5953 gene locus_tag LOCUS_15310 gene glmM 7341 5953 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_15310 7967 7344 gene locus_tag LOCUS_15320 7967 7344 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657631.1 protein_id gnl|my_center|LOCUS_15320 9137 8100 gene locus_tag LOCUS_15330 9137 8100 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_15330 10701 9184 gene locus_tag LOCUS_15340 10701 9184 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109032.1 protein_id gnl|my_center|LOCUS_15340 11809 11147 gene locus_tag LOCUS_15350 gene rpe 11809 11147 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_15350 13292 11907 gene locus_tag LOCUS_15360 13292 11907 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766767.1 protein_id gnl|my_center|LOCUS_15360 13837 13289 gene locus_tag LOCUS_15370 13837 13289 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_15370 14000 14752 gene locus_tag LOCUS_15380 14000 14752 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786065.1 protein_id gnl|my_center|LOCUS_15380 15912 14893 gene locus_tag LOCUS_15390 gene fmt 15912 14893 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_15390 17692 15893 gene locus_tag LOCUS_15400 17692 15893 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_15400 18271 17705 gene locus_tag LOCUS_15410 18271 17705 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_15410 18380 19471 gene locus_tag LOCUS_15420 gene dinB 18380 19471 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768057.1 protein_id gnl|my_center|LOCUS_15420 19819 20679 gene locus_tag LOCUS_15430 19819 20679 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_15430 20848 21255 gene locus_tag LOCUS_15440 20848 21255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107702.1 protein_id gnl|my_center|LOCUS_15440 21255 22499 gene locus_tag LOCUS_15450 21255 22499 CDS product clostripain-related cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107701.1 protein_id gnl|my_center|LOCUS_15450 23227 22940 gene locus_tag LOCUS_15460 23227 22940 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762199.1 protein_id gnl|my_center|LOCUS_15460 23844 23221 gene locus_tag LOCUS_15470 23844 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107867.1 protein_id gnl|my_center|LOCUS_15470 24883 24080 gene locus_tag LOCUS_15480 24883 24080 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786103.1 protein_id gnl|my_center|LOCUS_15480 25621 26355 gene locus_tag LOCUS_15490 25621 26355 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107183.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence35 144 1355 gene locus_tag LOCUS_15500 144 1355 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_15500 1769 4897 gene locus_tag LOCUS_15510 1769 4897 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769174.1 protein_id gnl|my_center|LOCUS_15510 4936 7377 gene locus_tag LOCUS_15520 4936 7377 CDS product beta-galactosidase GalA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036450.1 protein_id gnl|my_center|LOCUS_15520 8542 7460 gene locus_tag LOCUS_15530 gene proB 8542 7460 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108944.1 protein_id gnl|my_center|LOCUS_15530 8708 9490 gene locus_tag LOCUS_15540 8708 9490 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764352.1 protein_id gnl|my_center|LOCUS_15540 10326 9598 gene locus_tag LOCUS_15550 10326 9598 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762145.1 protein_id gnl|my_center|LOCUS_15550 10581 11060 gene locus_tag LOCUS_15560 10581 11060 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_15560 11078 11641 gene locus_tag LOCUS_15570 11078 11641 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_15570 11687 12895 gene locus_tag LOCUS_15580 11687 12895 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_15580 12892 13860 gene locus_tag LOCUS_15590 gene argC 12892 13860 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762696.1 protein_id gnl|my_center|LOCUS_15590 13882 15006 gene locus_tag LOCUS_15600 13882 15006 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202045.1 protein_id gnl|my_center|LOCUS_15600 15825 15097 gene locus_tag LOCUS_15610 15825 15097 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108179.1 protein_id gnl|my_center|LOCUS_15610 15925 16893 gene locus_tag LOCUS_15620 15925 16893 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_15620 16874 17782 gene locus_tag LOCUS_15630 16874 17782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759694.1 protein_id gnl|my_center|LOCUS_15630 17795 18409 gene locus_tag LOCUS_15640 17795 18409 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763992.1 protein_id gnl|my_center|LOCUS_15640 18406 19713 gene locus_tag LOCUS_15650 18406 19713 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763991.1 protein_id gnl|my_center|LOCUS_15650 19721 20719 gene locus_tag LOCUS_15660 19721 20719 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_15660 20720 22030 gene locus_tag LOCUS_15670 20720 22030 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_15670 22137 22904 gene locus_tag LOCUS_15680 gene proC 22137 22904 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_15680 22986 23213 gene locus_tag LOCUS_15690 22986 23213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 24625 23276 gene locus_tag LOCUS_15700 24625 23276 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202606.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence36 1383 289 gene locus_tag LOCUS_15710 gene trpS 1383 289 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_15710 1544 4768 gene locus_tag LOCUS_15720 gene carB 1544 4768 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 protein_id gnl|my_center|LOCUS_15720 5945 5124 gene locus_tag LOCUS_15730 5945 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6386 5979 gene locus_tag LOCUS_15740 6386 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7970 6771 gene locus_tag LOCUS_15750 7970 6771 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109064.1 protein_id gnl|my_center|LOCUS_15750 8205 8936 gene locus_tag LOCUS_15760 gene yaaA 8205 8936 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032557521.1 protein_id gnl|my_center|LOCUS_15760 10914 9031 gene locus_tag LOCUS_15770 gene mutL 10914 9031 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_15770 11245 10949 gene locus_tag LOCUS_15780 11245 10949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760777.1 protein_id gnl|my_center|LOCUS_15780 12969 11251 gene locus_tag LOCUS_15790 12969 11251 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_15790 14474 13101 gene locus_tag LOCUS_15800 14474 13101 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_15800 15337 14483 gene locus_tag LOCUS_15810 15337 14483 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814398.1 protein_id gnl|my_center|LOCUS_15810 16722 15373 gene locus_tag LOCUS_15820 16722 15373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 18306 16831 gene locus_tag LOCUS_15830 gene guaB 18306 16831 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760772.1 protein_id gnl|my_center|LOCUS_15830 20643 18460 gene locus_tag LOCUS_15840 gene recQ 20643 18460 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764112.1 protein_id gnl|my_center|LOCUS_15840 22037 20787 gene locus_tag LOCUS_15850 gene clpX 22037 20787 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_15850 22798 22127 gene locus_tag LOCUS_15860 gene clpP 22798 22127 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_15860 24311 22965 gene locus_tag LOCUS_15870 gene tig 24311 22965 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence37 197 123 gene locus_tag LOCUS_t00330 197 123 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 295 221 gene locus_tag LOCUS_t00340 295 221 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 688 389 gene locus_tag LOCUS_15880 gene raiA 688 389 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782154.1 protein_id gnl|my_center|LOCUS_15880 1582 704 gene locus_tag LOCUS_15890 gene xerC 1582 704 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_15890 1849 1658 gene locus_tag LOCUS_15900 gene rpsU 1849 1658 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_15900 2063 3799 gene locus_tag LOCUS_15910 2063 3799 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_15910 3818 4345 gene locus_tag LOCUS_15920 3818 4345 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_15920 5621 4596 gene locus_tag LOCUS_15930 5621 4596 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_15930 6373 5636 gene locus_tag LOCUS_15940 6373 5636 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_15940 7916 6513 gene locus_tag LOCUS_15950 7916 6513 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201883.1 protein_id gnl|my_center|LOCUS_15950 8059 10350 gene locus_tag LOCUS_15960 8059 10350 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107420.1 protein_id gnl|my_center|LOCUS_15960 10617 11126 gene locus_tag LOCUS_15970 10617 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 12733 11222 gene locus_tag LOCUS_15980 12733 11222 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_15980 14078 12858 gene locus_tag LOCUS_15990 14078 12858 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_15990 15612 14089 gene locus_tag LOCUS_16000 gene gltX 15612 14089 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_16000 15733 17748 gene locus_tag LOCUS_16010 15733 17748 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_16010 18215 17751 gene locus_tag LOCUS_16020 18215 17751 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765417.1 protein_id gnl|my_center|LOCUS_16020 18941 18231 gene locus_tag LOCUS_16030 18941 18231 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895939.1 protein_id gnl|my_center|LOCUS_16030 21428 18960 gene locus_tag LOCUS_16040 gene priA 21428 18960 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_16040 21529 22506 gene locus_tag LOCUS_16050 21529 22506 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053899.1 protein_id gnl|my_center|LOCUS_16050 23144 22602 gene locus_tag LOCUS_16060 23144 22602 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence38 2484 1081 gene locus_tag LOCUS_16070 2484 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 4036 2477 gene locus_tag LOCUS_16080 4036 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 5883 4177 gene locus_tag LOCUS_16090 5883 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 7397 6120 gene locus_tag LOCUS_16100 gene tilS 7397 6120 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107882.1 protein_id gnl|my_center|LOCUS_16100 7546 10023 gene locus_tag LOCUS_16110 gene feoB 7546 10023 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767925.1 protein_id gnl|my_center|LOCUS_16110 10040 10219 gene locus_tag LOCUS_16120 10040 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 10299 10371 gene locus_tag LOCUS_t00350 10299 10371 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10525 11751 gene locus_tag LOCUS_16130 10525 11751 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_16130 12092 12164 gene locus_tag LOCUS_t00360 12092 12164 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 12177 12252 gene locus_tag LOCUS_t00370 12177 12252 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12840 17357 gene locus_tag LOCUS_16140 gene gltB 12840 17357 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_16140 17396 18739 gene locus_tag LOCUS_16150 17396 18739 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_16150 18926 20527 gene locus_tag LOCUS_16160 gene asnB 18926 20527 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_16160 20543 21376 gene locus_tag LOCUS_16170 gene dapF 20543 21376 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765061.1 protein_id gnl|my_center|LOCUS_16170 21406 22635 gene locus_tag LOCUS_16180 21406 22635 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence39 98 346 gene locus_tag LOCUS_16190 98 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1036 557 gene locus_tag LOCUS_16200 1036 557 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816623.1 protein_id gnl|my_center|LOCUS_16200 2191 1184 gene locus_tag LOCUS_16210 2191 1184 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964264.1 protein_id gnl|my_center|LOCUS_16210 2427 3281 gene locus_tag LOCUS_16220 2427 3281 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_16220 4859 3501 gene locus_tag LOCUS_16230 4859 3501 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_16230 5951 4872 gene locus_tag LOCUS_16240 gene aroC 5951 4872 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_16240 6905 5979 gene locus_tag LOCUS_16250 6905 5979 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764420.1 protein_id gnl|my_center|LOCUS_16250 7496 6915 gene locus_tag LOCUS_16260 7496 6915 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_16260 8528 7581 gene locus_tag LOCUS_16270 8528 7581 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764421.1 protein_id gnl|my_center|LOCUS_16270 9391 8645 gene locus_tag LOCUS_16280 9391 8645 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_16280 10156 9416 gene locus_tag LOCUS_16290 gene ubiE 10156 9416 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_16290 11231 10284 gene locus_tag LOCUS_16300 11231 10284 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_16300 12266 11268 gene locus_tag LOCUS_16310 12266 11268 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_16310 12482 13141 gene locus_tag LOCUS_16320 12482 13141 CDS product DUF5715 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785158.1 protein_id gnl|my_center|LOCUS_16320 13151 13915 gene locus_tag LOCUS_16330 gene truA 13151 13915 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_16330 14891 14001 gene locus_tag LOCUS_16340 14891 14001 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767778.1 protein_id gnl|my_center|LOCUS_16340 15092 17122 gene locus_tag LOCUS_16350 15092 17122 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201861.1 protein_id gnl|my_center|LOCUS_16350 17098 17856 gene locus_tag LOCUS_16360 17098 17856 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796993.1 protein_id gnl|my_center|LOCUS_16360 18005 19396 gene locus_tag LOCUS_16370 18005 19396 CDS product DUF5723 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767614.1 protein_id gnl|my_center|LOCUS_16370 19554 19297 gene locus_tag LOCUS_16380 19554 19297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 20017 19574 gene locus_tag LOCUS_16390 gene yfcE 20017 19574 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478509.1 protein_id gnl|my_center|LOCUS_16390 20311 21201 gene locus_tag LOCUS_16400 20311 21201 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057642364.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence40 235 2769 gene locus_tag LOCUS_16410 235 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 5496 2986 gene locus_tag LOCUS_16420 5496 2986 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839988.1 protein_id gnl|my_center|LOCUS_16420 6089 5505 gene locus_tag LOCUS_16430 gene nadD 6089 5505 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_16430 6262 6080 gene locus_tag LOCUS_16440 6262 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 6835 6269 gene locus_tag LOCUS_16450 gene gmk 6835 6269 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_16450 7709 6846 gene locus_tag LOCUS_16460 7709 6846 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_16460 7813 8502 gene locus_tag LOCUS_16470 gene tsaB 7813 8502 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_16470 8554 9156 gene locus_tag LOCUS_16480 8554 9156 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_16480 9176 10489 gene locus_tag LOCUS_16490 gene murA 9176 10489 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790583.1 protein_id gnl|my_center|LOCUS_16490 10486 10998 gene locus_tag LOCUS_16500 gene rimM 10486 10998 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_16500 10995 11900 gene locus_tag LOCUS_16510 10995 11900 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_16510 11903 13066 gene locus_tag LOCUS_16520 11903 13066 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_16520 13104 14444 gene locus_tag LOCUS_16530 gene rseP 13104 14444 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_16530 15598 15137 gene locus_tag LOCUS_16540 gene nrdG 15598 15137 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203409.1 protein_id gnl|my_center|LOCUS_16540 18059 15672 gene locus_tag LOCUS_16550 18059 15672 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790561.1 protein_id gnl|my_center|LOCUS_16550 19943 18525 gene locus_tag LOCUS_16560 19943 18525 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_16560 20069 20884 gene locus_tag LOCUS_16570 20069 20884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790485.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence41 433 2883 gene locus_tag LOCUS_16580 433 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2967 4271 gene locus_tag LOCUS_16590 2967 4271 CDS product zinc-dependent metalloproteinase lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013547570.1 protein_id gnl|my_center|LOCUS_16590 4633 4944 gene locus_tag LOCUS_16600 4633 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5029 6330 gene locus_tag LOCUS_16610 5029 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 7257 7910 gene locus_tag LOCUS_16620 7257 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 8923 8345 gene locus_tag LOCUS_16630 8923 8345 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_16630 9820 8924 gene locus_tag LOCUS_16640 9820 8924 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783550.1 protein_id gnl|my_center|LOCUS_16640 12664 9830 gene locus_tag LOCUS_16650 gene leuS 12664 9830 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_16650 12919 13995 gene locus_tag LOCUS_16660 12919 13995 CDS product glycosyl hydrolase 53 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109367.1 protein_id gnl|my_center|LOCUS_16660 14023 16488 gene locus_tag LOCUS_16670 gene galB 14023 16488 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_16670 18382 16886 gene locus_tag LOCUS_16680 18382 16886 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797086.1 protein_id gnl|my_center|LOCUS_16680 18860 18432 gene locus_tag LOCUS_16690 18860 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 18979 20352 gene locus_tag LOCUS_16700 gene miaB 18979 20352 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence42 2426 345 gene locus_tag LOCUS_16710 2426 345 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_16710 2594 4858 gene locus_tag LOCUS_16720 2594 4858 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_16720 4893 5318 gene locus_tag LOCUS_16730 4893 5318 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_16730 5822 5388 gene locus_tag LOCUS_16740 5822 5388 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_16740 6390 5827 gene locus_tag LOCUS_16750 gene pth 6390 5827 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_16750 7035 6439 gene locus_tag LOCUS_16760 7035 6439 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_16760 7625 7251 gene locus_tag LOCUS_16770 7625 7251 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785761.1 protein_id gnl|my_center|LOCUS_16770 7812 8738 gene locus_tag LOCUS_16780 gene nusB 7812 8738 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_16780 8784 9092 gene locus_tag LOCUS_16790 gene yajC 8784 9092 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_16790 9106 10134 gene locus_tag LOCUS_16800 9106 10134 CDS product YbbR-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768081.1 protein_id gnl|my_center|LOCUS_16800 10136 10738 gene locus_tag LOCUS_16810 gene coaE 10136 10738 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785766.1 protein_id gnl|my_center|LOCUS_16810 10806 11231 gene locus_tag LOCUS_16820 10806 11231 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_16820 11650 11387 gene locus_tag LOCUS_16830 gene rpmA 11650 11387 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_16830 11989 11672 gene locus_tag LOCUS_16840 gene rplU 11989 11672 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775748.1 protein_id gnl|my_center|LOCUS_16840 12777 12139 gene locus_tag LOCUS_16850 12777 12139 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759985.1 protein_id gnl|my_center|LOCUS_16850 13940 12789 gene locus_tag LOCUS_16860 13940 12789 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_16860 16569 14059 gene locus_tag LOCUS_16870 16569 14059 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_16870 16724 16809 gene locus_tag LOCUS_t00380 16724 16809 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17160 16909 gene locus_tag LOCUS_16880 17160 16909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 17472 18308 gene locus_tag LOCUS_16890 gene lgt 17472 18308 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108644.1 protein_id gnl|my_center|LOCUS_16890 18987 19748 gene locus_tag LOCUS_16900 18987 19748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence43 88 570 gene locus_tag LOCUS_16910 88 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 647 1432 gene locus_tag LOCUS_16920 647 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4865 1452 gene locus_tag LOCUS_16930 4865 1452 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205984.1 protein_id gnl|my_center|LOCUS_16930 6102 4882 gene locus_tag LOCUS_16940 6102 4882 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766205.1 protein_id gnl|my_center|LOCUS_16940 6236 7018 gene locus_tag LOCUS_16950 6236 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 7215 8252 gene locus_tag LOCUS_16960 7215 8252 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108011.1 protein_id gnl|my_center|LOCUS_16960 8357 8226 gene locus_tag LOCUS_16970 8357 8226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8392 9039 gene locus_tag LOCUS_16980 8392 9039 CDS product murein L,D-transpeptidase catalytic domain family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784354.1 protein_id gnl|my_center|LOCUS_16980 10279 9137 gene locus_tag LOCUS_16990 10279 9137 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_16990 11423 10293 gene locus_tag LOCUS_17000 gene tgt 11423 10293 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_17000 13912 11483 gene locus_tag LOCUS_17010 gene lon 13912 11483 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_17010 14142 14855 gene locus_tag LOCUS_17020 14142 14855 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692148.1 protein_id gnl|my_center|LOCUS_17020 15897 14863 gene locus_tag LOCUS_17030 15897 14863 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_17030 16124 17311 gene locus_tag LOCUS_17040 16124 17311 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_17040 17597 18130 gene locus_tag LOCUS_17050 17597 18130 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787811.1 protein_id gnl|my_center|LOCUS_17050 18926 18117 gene locus_tag LOCUS_17060 18926 18117 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence44 74 370 gene locus_tag LOCUS_17070 74 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766192.1 protein_id gnl|my_center|LOCUS_17070 375 929 gene locus_tag LOCUS_17080 375 929 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766193.1 protein_id gnl|my_center|LOCUS_17080 1085 3910 gene locus_tag LOCUS_17090 1085 3910 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766196.1 protein_id gnl|my_center|LOCUS_17090 4023 4331 gene locus_tag LOCUS_17100 4023 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769696.1 protein_id gnl|my_center|LOCUS_17100 4439 6256 gene locus_tag LOCUS_17110 4439 6256 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_17110 6363 7427 gene locus_tag LOCUS_17120 gene mnmA 6363 7427 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_17120 9043 7520 gene locus_tag LOCUS_17130 9043 7520 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_17130 9723 9124 gene locus_tag LOCUS_17140 9723 9124 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759972.1 protein_id gnl|my_center|LOCUS_17140 9897 10580 gene locus_tag LOCUS_17150 9897 10580 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759971.1 protein_id gnl|my_center|LOCUS_17150 10592 12628 gene locus_tag LOCUS_17160 10592 12628 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_17160 12637 13113 gene locus_tag LOCUS_17170 12637 13113 CDS product DUF4847 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785244.1 protein_id gnl|my_center|LOCUS_17170 13129 13560 gene locus_tag LOCUS_17180 13129 13560 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_17180 13566 15221 gene locus_tag LOCUS_17190 13566 15221 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_17190 15360 15857 gene locus_tag LOCUS_17200 15360 15857 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658777.1 protein_id gnl|my_center|LOCUS_17200 16134 15844 gene locus_tag LOCUS_17210 16134 15844 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775689.1 protein_id gnl|my_center|LOCUS_17210 17252 16131 gene locus_tag LOCUS_17220 gene recF 17252 16131 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_17220 17401 18078 gene locus_tag LOCUS_17230 17401 18078 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_17230 18236 18730 gene locus_tag LOCUS_17240 gene ribH 18236 18730 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_17240 18791 18874 gene locus_tag LOCUS_t00390 18791 18874 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 18883 18956 gene locus_tag LOCUS_t00400 18883 18956 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence45 1504 179 gene locus_tag LOCUS_17250 1504 179 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932609.1 protein_id gnl|my_center|LOCUS_17250 3113 1674 gene locus_tag LOCUS_17260 3113 1674 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761512.1 protein_id gnl|my_center|LOCUS_17260 3450 4856 gene locus_tag LOCUS_17270 gene uxaC 3450 4856 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_17270 4951 5757 gene locus_tag LOCUS_17280 4951 5757 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_17280 6386 5823 gene locus_tag LOCUS_17290 6386 5823 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_17290 6604 6858 gene locus_tag LOCUS_17300 6604 6858 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_17300 6885 7376 gene locus_tag LOCUS_17310 6885 7376 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_17310 7531 8391 gene locus_tag LOCUS_17320 gene thiD 7531 8391 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_17320 9025 8474 gene locus_tag LOCUS_17330 9025 8474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 9331 9035 gene locus_tag LOCUS_17340 9331 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 9643 9434 gene locus_tag LOCUS_17350 9643 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 9909 10385 gene locus_tag LOCUS_17360 gene ndk 9909 10385 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760845.1 protein_id gnl|my_center|LOCUS_17360 10501 10574 gene locus_tag LOCUS_t00410 10501 10574 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10616 10691 gene locus_tag LOCUS_t00420 10616 10691 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10785 11201 gene locus_tag LOCUS_17370 10785 11201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 12058 11393 gene locus_tag LOCUS_17380 gene lipB 12058 11393 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765857.1 protein_id gnl|my_center|LOCUS_17380 12251 13108 gene locus_tag LOCUS_17390 12251 13108 CDS product RsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787233.1 protein_id gnl|my_center|LOCUS_17390 13112 13738 gene locus_tag LOCUS_17400 gene rsmG 13112 13738 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_17400 13762 14397 gene locus_tag LOCUS_17410 13762 14397 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_17410 14528 17320 gene locus_tag LOCUS_17420 gene gcvP 14528 17320 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765866.1 protein_id gnl|my_center|LOCUS_17420 18117 17485 gene locus_tag LOCUS_17430 18117 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence46 255 716 gene locus_tag LOCUS_17440 255 716 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_17440 1511 723 gene locus_tag LOCUS_17450 gene ccsA 1511 723 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107762.1 protein_id gnl|my_center|LOCUS_17450 2740 1508 gene locus_tag LOCUS_17460 2740 1508 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107763.1 protein_id gnl|my_center|LOCUS_17460 5190 2770 gene locus_tag LOCUS_17470 5190 2770 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_17470 5484 6497 gene locus_tag LOCUS_17480 5484 6497 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_17480 6545 7072 gene locus_tag LOCUS_17490 gene cobC 6545 7072 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787967.1 protein_id gnl|my_center|LOCUS_17490 9014 7074 gene locus_tag LOCUS_17500 9014 7074 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_17500 9318 10706 gene locus_tag LOCUS_17510 9318 10706 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765754.1 protein_id gnl|my_center|LOCUS_17510 10715 12142 gene locus_tag LOCUS_17520 10715 12142 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_17520 12176 12373 gene locus_tag LOCUS_17530 12176 12373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 12373 13179 gene locus_tag LOCUS_17540 gene tatC 12373 13179 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760986.1 protein_id gnl|my_center|LOCUS_17540 13637 13278 gene locus_tag LOCUS_17550 13637 13278 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107395.1 protein_id gnl|my_center|LOCUS_17550 15071 13785 gene locus_tag LOCUS_17560 15071 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 15771 15331 gene locus_tag LOCUS_17570 15771 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 16098 16790 gene locus_tag LOCUS_17580 16098 16790 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_17580 16931 18064 gene locus_tag LOCUS_17590 16931 18064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence47 2098 233 gene locus_tag LOCUS_17600 2098 233 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795166.1 protein_id gnl|my_center|LOCUS_17600 2973 2143 gene locus_tag LOCUS_17610 2973 2143 CDS product DUF3805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107812.1 protein_id gnl|my_center|LOCUS_17610 3360 2983 gene locus_tag LOCUS_17620 3360 2983 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786184.1 protein_id gnl|my_center|LOCUS_17620 4107 3382 gene locus_tag LOCUS_17630 4107 3382 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786188.1 protein_id gnl|my_center|LOCUS_17630 5325 4120 gene locus_tag LOCUS_17640 5325 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786395.1 protein_id gnl|my_center|LOCUS_17640 5830 5453 gene locus_tag LOCUS_17650 5830 5453 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762436.1 protein_id gnl|my_center|LOCUS_17650 6142 8112 gene locus_tag LOCUS_17660 gene rho 6142 8112 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798804.1 protein_id gnl|my_center|LOCUS_17660 8636 8253 gene locus_tag LOCUS_17670 8636 8253 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_17670 8792 9916 gene locus_tag LOCUS_17680 gene dnaN 8792 9916 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_17680 9935 10711 gene locus_tag LOCUS_17690 9935 10711 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762413.1 protein_id gnl|my_center|LOCUS_17690 10713 11909 gene locus_tag LOCUS_17700 gene coaBC 10713 11909 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_17700 11931 13598 gene locus_tag LOCUS_17710 gene recN 11931 13598 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203085.1 protein_id gnl|my_center|LOCUS_17710 13632 14387 gene locus_tag LOCUS_17720 gene rlmB 13632 14387 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_17720 14404 16104 gene locus_tag LOCUS_17730 14404 16104 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107737.1 protein_id gnl|my_center|LOCUS_17730 17331 16315 gene locus_tag LOCUS_17740 17331 16315 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence48 355 104 gene locus_tag LOCUS_17750 355 104 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_17750 837 1844 gene locus_tag LOCUS_17760 837 1844 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_17760 2527 2000 gene locus_tag LOCUS_17770 2527 2000 CDS product DUF3332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765673.1 protein_id gnl|my_center|LOCUS_17770 2785 4362 gene locus_tag LOCUS_17780 2785 4362 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_17780 5484 4435 gene locus_tag LOCUS_17790 5484 4435 CDS product DUF4831 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202253.1 protein_id gnl|my_center|LOCUS_17790 7015 5495 gene locus_tag LOCUS_17800 7015 5495 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_17800 7111 7647 gene locus_tag LOCUS_17810 gene hpt 7111 7647 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_17810 7674 8243 gene locus_tag LOCUS_17820 7674 8243 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_17820 8376 9560 gene locus_tag LOCUS_17830 gene obgE 8376 9560 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_17830 9587 10372 gene locus_tag LOCUS_17840 gene pgeF 9587 10372 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 protein_id gnl|my_center|LOCUS_17840 10390 11061 gene locus_tag LOCUS_17850 10390 11061 CDS product phenylalanine--tRNA ligase beta subunit-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291724.1 protein_id gnl|my_center|LOCUS_17850 11068 11697 gene locus_tag LOCUS_17860 11068 11697 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760060.1 protein_id gnl|my_center|LOCUS_17860 11705 11896 gene locus_tag LOCUS_17870 11705 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 12046 12573 gene locus_tag LOCUS_17880 12046 12573 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788062.1 protein_id gnl|my_center|LOCUS_17880 12704 13390 gene locus_tag LOCUS_17890 12704 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 14647 13469 gene locus_tag LOCUS_17900 14647 13469 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_17900 15077 15844 gene locus_tag LOCUS_17910 15077 15844 CDS product DUF4465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470082.1 protein_id gnl|my_center|LOCUS_17910 15956 16507 gene locus_tag LOCUS_17920 15956 16507 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763367.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence49 1469 177 gene locus_tag LOCUS_17930 gene tyrS 1469 177 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_17930 2119 1550 gene locus_tag LOCUS_17940 2119 1550 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767460.1 protein_id gnl|my_center|LOCUS_17940 2419 2198 gene locus_tag LOCUS_17950 gene yidD 2419 2198 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_17950 2811 2416 gene locus_tag LOCUS_17960 gene rnpA 2811 2416 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_17960 3638 2892 gene locus_tag LOCUS_17970 3638 2892 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_17970 4452 3643 gene locus_tag LOCUS_17980 4452 3643 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767457.1 protein_id gnl|my_center|LOCUS_17980 5036 4449 gene locus_tag LOCUS_17990 5036 4449 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767456.1 protein_id gnl|my_center|LOCUS_17990 6657 5362 gene locus_tag LOCUS_18000 gene metK 6657 5362 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_18000 7553 6945 gene locus_tag LOCUS_18010 7553 6945 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761745.1 protein_id gnl|my_center|LOCUS_18010 9917 7773 gene locus_tag LOCUS_18020 9917 7773 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107819.1 protein_id gnl|my_center|LOCUS_18020 11929 9920 gene locus_tag LOCUS_18030 11929 9920 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_18030 12495 12013 gene locus_tag LOCUS_18040 gene folK 12495 12013 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_18040 13559 12504 gene locus_tag LOCUS_18050 gene queA 13559 12504 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_18050 14278 13574 gene locus_tag LOCUS_18060 gene truB 14278 13574 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_18060 15091 14288 gene locus_tag LOCUS_18070 15091 14288 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_18070 15354 15088 gene locus_tag LOCUS_18080 15354 15088 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_18080 16257 15388 gene locus_tag LOCUS_18090 16257 15388 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_18090 17030 16263 gene locus_tag LOCUS_18100 17030 16263 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767448.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence50 1289 105 gene locus_tag LOCUS_18110 gene hydF 1289 105 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798360.1 protein_id gnl|my_center|LOCUS_18110 2778 1360 gene locus_tag LOCUS_18120 gene hydG 2778 1360 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203501.1 protein_id gnl|my_center|LOCUS_18120 3851 2808 gene locus_tag LOCUS_18130 gene hydE 3851 2808 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108014.1 protein_id gnl|my_center|LOCUS_18130 5341 3866 gene locus_tag LOCUS_18140 5341 3866 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798358.1 protein_id gnl|my_center|LOCUS_18140 6264 5722 gene locus_tag LOCUS_18150 6264 5722 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787716.1 protein_id gnl|my_center|LOCUS_18150 7409 6282 gene locus_tag LOCUS_18160 7409 6282 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107471.1 protein_id gnl|my_center|LOCUS_18160 7513 8826 gene locus_tag LOCUS_18170 7513 8826 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107472.1 protein_id gnl|my_center|LOCUS_18170 8823 9605 gene locus_tag LOCUS_18180 8823 9605 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787724.1 protein_id gnl|my_center|LOCUS_18180 10958 9696 gene locus_tag LOCUS_18190 10958 9696 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_18190 12216 10984 gene locus_tag LOCUS_18200 gene serB 12216 10984 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793930.1 protein_id gnl|my_center|LOCUS_18200 13539 12331 gene locus_tag LOCUS_18210 13539 12331 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_18210 14052 13591 gene locus_tag LOCUS_18220 14052 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 14528 14812 gene locus_tag LOCUS_18230 14528 14812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 14802 15422 gene locus_tag LOCUS_18240 14802 15422 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803436.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence51 277 1167 gene locus_tag LOCUS_18250 277 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1198 1905 gene locus_tag LOCUS_18260 1198 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 1892 3589 gene locus_tag LOCUS_18270 1892 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 3599 4201 gene locus_tag LOCUS_18280 3599 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 5423 4482 gene locus_tag LOCUS_18290 5423 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 5695 5531 gene locus_tag LOCUS_18300 5695 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 7088 6129 gene locus_tag LOCUS_18310 gene rhuM 7088 6129 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_18310 7680 8834 gene locus_tag LOCUS_18320 7680 8834 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_18320 8895 9812 gene locus_tag LOCUS_18330 8895 9812 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783741.1 protein_id gnl|my_center|LOCUS_18330 10142 9987 gene locus_tag LOCUS_18340 10142 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 10098 10385 gene locus_tag LOCUS_18350 10098 10385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 11363 10416 gene locus_tag LOCUS_18360 11363 10416 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_18360 12190 11417 gene locus_tag LOCUS_18370 12190 11417 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660848.1 protein_id gnl|my_center|LOCUS_18370 12486 13808 gene locus_tag LOCUS_18380 12486 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 13848 15236 gene locus_tag LOCUS_18390 13848 15236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 16238 15312 gene locus_tag LOCUS_18400 16238 15312 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783972.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence52 3 78 gene locus_tag LOCUS_t00430 3 78 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 105 179 gene locus_tag LOCUS_t00440 105 179 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1489 620 gene locus_tag LOCUS_18410 gene dapA 1489 620 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_18410 3629 1626 gene locus_tag LOCUS_18420 gene ligA 3629 1626 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_18420 3733 4413 gene locus_tag LOCUS_18430 gene trmD 3733 4413 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_18430 5470 4559 gene locus_tag LOCUS_18440 5470 4559 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_18440 6234 5458 gene locus_tag LOCUS_18450 6234 5458 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793749.1 protein_id gnl|my_center|LOCUS_18450 6776 6348 gene locus_tag LOCUS_18460 6776 6348 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793753.1 protein_id gnl|my_center|LOCUS_18460 8573 7557 gene locus_tag LOCUS_18470 gene holA 8573 7557 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_18470 9361 8585 gene locus_tag LOCUS_18480 9361 8585 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_18480 9419 9871 gene locus_tag LOCUS_18490 9419 9871 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_18490 10736 9945 gene locus_tag LOCUS_18500 10736 9945 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761550.1 protein_id gnl|my_center|LOCUS_18500 11840 10746 gene locus_tag LOCUS_18510 11840 10746 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_18510 12852 12034 gene locus_tag LOCUS_18520 12852 12034 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964639.1 protein_id gnl|my_center|LOCUS_18520 13747 13025 gene locus_tag LOCUS_18530 13747 13025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 15651 15145 gene locus_tag LOCUS_18540 15651 15145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 16426 15809 gene locus_tag LOCUS_18550 16426 15809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence53 233 48 gene locus_tag LOCUS_18560 233 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1480 878 gene locus_tag LOCUS_18570 1480 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2836 1550 gene locus_tag LOCUS_18580 gene frc 2836 1550 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549137.1 protein_id gnl|my_center|LOCUS_18580 4320 2995 gene locus_tag LOCUS_18590 4320 2995 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_18590 4514 5200 gene locus_tag LOCUS_18600 4514 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_18600 5209 6030 gene locus_tag LOCUS_18610 5209 6030 CDS product DUF3822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764221.1 protein_id gnl|my_center|LOCUS_18610 6021 6587 gene locus_tag LOCUS_18620 6021 6587 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_18620 7980 6547 gene locus_tag LOCUS_18630 gene cls 7980 6547 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764220.1 protein_id gnl|my_center|LOCUS_18630 9607 8366 gene locus_tag LOCUS_18640 9607 8366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18640 10571 9690 gene locus_tag LOCUS_18650 10571 9690 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762851.1 protein_id gnl|my_center|LOCUS_18650 12162 10591 gene locus_tag LOCUS_18660 12162 10591 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762846.1 protein_id gnl|my_center|LOCUS_18660 15489 12184 gene locus_tag LOCUS_18670 15489 12184 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165360391.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence54 192 1853 gene locus_tag LOCUS_18680 192 1853 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786793.1 protein_id gnl|my_center|LOCUS_18680 1881 3875 gene locus_tag LOCUS_18690 1881 3875 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_18690 4306 3956 gene locus_tag LOCUS_18700 4306 3956 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759980.1 protein_id gnl|my_center|LOCUS_18700 5158 4313 gene locus_tag LOCUS_18710 gene panC 5158 4313 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_18710 5387 6223 gene locus_tag LOCUS_18720 5387 6223 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_18720 6250 7713 gene locus_tag LOCUS_18730 6250 7713 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_18730 9168 8158 gene locus_tag LOCUS_18740 gene gap 9168 8158 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_18740 9376 9161 gene locus_tag LOCUS_18750 9376 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 9644 11197 gene locus_tag LOCUS_18760 gene guaA 9644 11197 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_18760 11356 12162 gene locus_tag LOCUS_18770 11356 12162 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_18770 12665 12228 gene locus_tag LOCUS_18780 12665 12228 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765741.1 protein_id gnl|my_center|LOCUS_18780 14029 12761 gene locus_tag LOCUS_18790 14029 12761 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107523.1 protein_id gnl|my_center|LOCUS_18790 14703 14026 gene locus_tag LOCUS_18800 14703 14026 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_18800 15551 14820 gene locus_tag LOCUS_18810 15551 14820 CDS product NigD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992150.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence55 318 49 gene locus_tag LOCUS_18820 318 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 672 487 gene locus_tag LOCUS_18830 672 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1065 2096 gene locus_tag LOCUS_18840 1065 2096 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_18840 2483 4585 gene locus_tag LOCUS_18850 2483 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4862 6856 gene locus_tag LOCUS_18860 4862 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 8099 6984 gene locus_tag LOCUS_18870 8099 6984 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048040655.1 protein_id gnl|my_center|LOCUS_18870 8596 10698 gene locus_tag LOCUS_18880 8596 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 10837 11601 gene locus_tag LOCUS_18890 10837 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 11788 12405 gene locus_tag LOCUS_18900 11788 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 12610 13128 gene locus_tag LOCUS_18910 12610 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 13323 13796 gene locus_tag LOCUS_18920 13323 13796 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_18920 14780 13887 gene locus_tag LOCUS_18930 14780 13887 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_18930 15355 15119 gene locus_tag LOCUS_18940 15355 15119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 >Feature sequence56 1784 135 gene locus_tag LOCUS_18950 1784 135 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759583.1 protein_id gnl|my_center|LOCUS_18950 3630 1873 gene locus_tag LOCUS_18960 3630 1873 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203546.1 protein_id gnl|my_center|LOCUS_18960 5649 3661 gene locus_tag LOCUS_18970 5649 3661 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_18970 6918 5659 gene locus_tag LOCUS_18980 gene hflX 6918 5659 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_18980 9357 7072 gene locus_tag LOCUS_18990 9357 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 10334 9387 gene locus_tag LOCUS_19000 10334 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 11185 10469 gene locus_tag LOCUS_19010 11185 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 11592 11188 gene locus_tag LOCUS_19020 11592 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 12199 11690 gene locus_tag LOCUS_19030 12199 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 12688 12311 gene locus_tag LOCUS_19040 12688 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 14331 12709 gene locus_tag LOCUS_19050 14331 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 14824 14336 gene locus_tag LOCUS_19060 14824 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence57 94 1578 gene locus_tag LOCUS_19070 94 1578 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107959.1 protein_id gnl|my_center|LOCUS_19070 1658 2827 gene locus_tag LOCUS_19080 1658 2827 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_19080 2901 4010 gene locus_tag LOCUS_19090 gene prfA 2901 4010 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_19090 4049 4873 gene locus_tag LOCUS_19100 gene pyrF 4049 4873 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759883.1 protein_id gnl|my_center|LOCUS_19100 5144 6184 gene locus_tag LOCUS_19110 gene lpxD 5144 6184 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202193.1 protein_id gnl|my_center|LOCUS_19110 6190 7575 gene locus_tag LOCUS_19120 6190 7575 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_19120 7582 8349 gene locus_tag LOCUS_19130 gene lpxA 7582 8349 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785118.1 protein_id gnl|my_center|LOCUS_19130 8399 8953 gene locus_tag LOCUS_19140 8399 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769509.1 protein_id gnl|my_center|LOCUS_19140 9082 9999 gene locus_tag LOCUS_19150 gene miaA 9082 9999 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759877.1 protein_id gnl|my_center|LOCUS_19150 11017 10007 gene locus_tag LOCUS_19160 11017 10007 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_19160 12160 11144 gene locus_tag LOCUS_19170 12160 11144 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203484.1 protein_id gnl|my_center|LOCUS_19170 13473 12157 gene locus_tag LOCUS_19180 gene mtaB 13473 12157 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_19180 13854 14048 gene locus_tag LOCUS_19190 13854 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence58 1915 116 gene locus_tag LOCUS_19200 1915 116 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_19200 3555 2272 gene locus_tag LOCUS_19210 3555 2272 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_19210 3677 4129 gene locus_tag LOCUS_19220 3677 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 5383 4211 gene locus_tag LOCUS_19230 5383 4211 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582733.1 protein_id gnl|my_center|LOCUS_19230 5614 6702 gene locus_tag LOCUS_19240 5614 6702 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_19240 9043 6812 gene locus_tag LOCUS_19250 9043 6812 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259699.1 protein_id gnl|my_center|LOCUS_19250 10174 9077 gene locus_tag LOCUS_19260 10174 9077 CDS product family 16 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405546.1 protein_id gnl|my_center|LOCUS_19260 11437 10232 gene locus_tag LOCUS_19270 11437 10232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 11763 11335 gene locus_tag LOCUS_19280 11763 11335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19280 12306 11791 gene locus_tag LOCUS_19290 12306 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19290 12961 12404 gene locus_tag LOCUS_19300 12961 12404 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107442.1 protein_id gnl|my_center|LOCUS_19300 13550 14173 gene locus_tag LOCUS_19310 13550 14173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 >Feature sequence59 369 1004 gene locus_tag LOCUS_19320 369 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 1096 2499 gene locus_tag LOCUS_19330 1096 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 3873 2740 gene locus_tag LOCUS_19340 3873 2740 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_19340 6334 4094 gene locus_tag LOCUS_19350 6334 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 8123 6420 gene locus_tag LOCUS_19360 8123 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 9442 8237 gene locus_tag LOCUS_19370 9442 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 10786 9497 gene locus_tag LOCUS_19380 10786 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108309.1 protein_id gnl|my_center|LOCUS_19380 10987 11706 gene locus_tag LOCUS_19390 10987 11706 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_19390 12346 11873 gene locus_tag LOCUS_19400 gene rlmH 12346 11873 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_19400 12441 13295 gene locus_tag LOCUS_19410 gene nadC 12441 13295 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_19410 13373 13972 gene locus_tag LOCUS_19420 13373 13972 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765853.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence60 230 1666 gene locus_tag LOCUS_19430 230 1666 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_19430 1671 2159 gene locus_tag LOCUS_19440 1671 2159 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780691.1 protein_id gnl|my_center|LOCUS_19440 2183 3439 gene locus_tag LOCUS_19450 2183 3439 CDS product DcaP family trimeric outer membrane transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108770.1 protein_id gnl|my_center|LOCUS_19450 3551 5671 gene locus_tag LOCUS_19460 3551 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 6888 5758 gene locus_tag LOCUS_19470 6888 5758 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759848.1 protein_id gnl|my_center|LOCUS_19470 6982 8319 gene locus_tag LOCUS_19480 6982 8319 CDS product glycosyl hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109139.1 protein_id gnl|my_center|LOCUS_19480 8790 8437 gene locus_tag LOCUS_19490 gene rplS 8790 8437 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_19490 9007 9747 gene locus_tag LOCUS_19500 9007 9747 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763633.1 protein_id gnl|my_center|LOCUS_19500 9759 10601 gene locus_tag LOCUS_19510 9759 10601 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801566.1 protein_id gnl|my_center|LOCUS_19510 10717 13647 gene locus_tag LOCUS_19520 10717 13647 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202060.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence61 2294 105 gene locus_tag LOCUS_19530 2294 105 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_19530 2638 3489 gene locus_tag LOCUS_19540 2638 3489 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109173.1 protein_id gnl|my_center|LOCUS_19540 3507 4094 gene locus_tag LOCUS_19550 3507 4094 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_19550 5360 4101 gene locus_tag LOCUS_19560 5360 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786796.1 protein_id gnl|my_center|LOCUS_19560 7023 5365 gene locus_tag LOCUS_19570 7023 5365 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786798.1 protein_id gnl|my_center|LOCUS_19570 8204 7227 gene locus_tag LOCUS_19580 8204 7227 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_19580 8883 8215 gene locus_tag LOCUS_19590 8883 8215 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_19590 9387 8911 gene locus_tag LOCUS_19600 9387 8911 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788684.1 protein_id gnl|my_center|LOCUS_19600 10733 9498 gene locus_tag LOCUS_19610 10733 9498 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762299.1 protein_id gnl|my_center|LOCUS_19610 10963 12135 gene locus_tag LOCUS_19620 10963 12135 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_19620 12137 13381 gene locus_tag LOCUS_19630 12137 13381 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence62 108 3401 gene locus_tag LOCUS_19640 108 3401 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_19640 4673 3477 gene locus_tag LOCUS_19650 4673 3477 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_19650 6687 4756 gene locus_tag LOCUS_19660 6687 4756 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_19660 6848 7267 gene locus_tag LOCUS_19670 6848 7267 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815090.1 protein_id gnl|my_center|LOCUS_19670 7317 7868 gene locus_tag LOCUS_19680 7317 7868 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780311.1 protein_id gnl|my_center|LOCUS_19680 8287 9573 gene locus_tag LOCUS_19690 8287 9573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19690 9623 10321 gene locus_tag LOCUS_19700 9623 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19700 10344 11114 gene locus_tag LOCUS_19710 10344 11114 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055304.1 protein_id gnl|my_center|LOCUS_19710 11111 12034 gene locus_tag LOCUS_19720 11111 12034 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929426.1 protein_id gnl|my_center|LOCUS_19720 12046 12990 gene locus_tag LOCUS_19730 12046 12990 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143966.1 protein_id gnl|my_center|LOCUS_19730 >Feature sequence63 274 2727 gene locus_tag LOCUS_19740 gene feoB 274 2727 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767925.1 protein_id gnl|my_center|LOCUS_19740 2850 3038 gene locus_tag LOCUS_19750 2850 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 2974 4038 gene locus_tag LOCUS_19760 2974 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 4588 5595 gene locus_tag LOCUS_19770 4588 5595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 5592 5990 gene locus_tag LOCUS_19780 5592 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19780 6876 6424 gene locus_tag LOCUS_19790 6876 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 7148 7543 gene locus_tag LOCUS_19800 7148 7543 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763033.1 protein_id gnl|my_center|LOCUS_19800 7671 8762 gene locus_tag LOCUS_19810 gene ald 7671 8762 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795308.1 protein_id gnl|my_center|LOCUS_19810 8927 9142 gene locus_tag LOCUS_19820 8927 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19820 9203 11113 gene locus_tag LOCUS_19830 9203 11113 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19830 11277 12683 gene locus_tag LOCUS_19840 11277 12683 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_19840 >Feature sequence64 1096 236 gene locus_tag LOCUS_19850 1096 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 1638 1165 gene locus_tag LOCUS_19860 1638 1165 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760630.1 protein_id gnl|my_center|LOCUS_19860 2288 1710 gene locus_tag LOCUS_19870 2288 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3506 2496 gene locus_tag LOCUS_19880 3506 2496 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013616093.1 protein_id gnl|my_center|LOCUS_19880 4225 3524 gene locus_tag LOCUS_19890 4225 3524 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_19890 4511 5023 gene locus_tag LOCUS_19900 4511 5023 CDS product DMP19 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841243.1 protein_id gnl|my_center|LOCUS_19900 5112 5921 gene locus_tag LOCUS_19910 5112 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 6056 6628 gene locus_tag LOCUS_19920 6056 6628 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769654.1 protein_id gnl|my_center|LOCUS_19920 6628 7086 gene locus_tag LOCUS_19930 gene smpB 6628 7086 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_19930 7161 9920 gene locus_tag LOCUS_19940 gene metH 7161 9920 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203181.1 protein_id gnl|my_center|LOCUS_19940 11109 10357 gene locus_tag LOCUS_19950 11109 10357 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_19950 12538 11111 gene locus_tag LOCUS_19960 12538 11111 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_19960 12740 12666 gene locus_tag LOCUS_t00450 12740 12666 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence65 2700 121 gene locus_tag LOCUS_19970 2700 121 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_19970 4399 2732 gene locus_tag LOCUS_19980 4399 2732 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_19980 5102 4683 gene locus_tag LOCUS_19990 5102 4683 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562679.1 protein_id gnl|my_center|LOCUS_19990 6962 5136 gene locus_tag LOCUS_20000 6962 5136 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660668.1 protein_id gnl|my_center|LOCUS_20000 7564 6959 gene locus_tag LOCUS_20010 7564 6959 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_20010 8903 7584 gene locus_tag LOCUS_20020 8903 7584 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788433.1 protein_id gnl|my_center|LOCUS_20020 10689 8932 gene locus_tag LOCUS_20030 10689 8932 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538526.1 protein_id gnl|my_center|LOCUS_20030 11544 10705 gene locus_tag LOCUS_20040 11544 10705 CDS product DUF2764 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_20040 12144 11554 gene locus_tag LOCUS_20050 12144 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538528.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence66 1469 2323 gene locus_tag LOCUS_20060 1469 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2336 3049 gene locus_tag LOCUS_20070 2336 3049 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016982.1 protein_id gnl|my_center|LOCUS_20070 3250 4617 gene locus_tag LOCUS_20080 3250 4617 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892661.1 protein_id gnl|my_center|LOCUS_20080 4614 5198 gene locus_tag LOCUS_20090 4614 5198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 5176 8568 gene locus_tag LOCUS_20100 5176 8568 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_20100 8565 9716 gene locus_tag LOCUS_20110 8565 9716 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_20110 9751 11475 gene locus_tag LOCUS_20120 9751 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence67 1940 75 gene locus_tag LOCUS_20130 1940 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 2225 1965 gene locus_tag LOCUS_20140 2225 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2585 2229 gene locus_tag LOCUS_20150 2585 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4104 3019 gene locus_tag LOCUS_20160 4104 3019 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765630.1 protein_id gnl|my_center|LOCUS_20160 5448 4120 gene locus_tag LOCUS_20170 5448 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107436.1 protein_id gnl|my_center|LOCUS_20170 5822 6751 gene locus_tag LOCUS_20180 5822 6751 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_20180 6776 7966 gene locus_tag LOCUS_20190 6776 7966 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795977.1 protein_id gnl|my_center|LOCUS_20190 8891 8043 gene locus_tag LOCUS_20200 8891 8043 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 protein_id gnl|my_center|LOCUS_20200 9549 8938 gene locus_tag LOCUS_20210 9549 8938 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795972.1 protein_id gnl|my_center|LOCUS_20210 11608 9605 gene locus_tag LOCUS_20220 11608 9605 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785291.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence68 1635 271 gene locus_tag LOCUS_20230 1635 271 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_20230 1965 3806 gene locus_tag LOCUS_20240 1965 3806 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_20240 3810 4499 gene locus_tag LOCUS_20250 3810 4499 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760381.1 protein_id gnl|my_center|LOCUS_20250 5603 4581 gene locus_tag LOCUS_20260 gene mltG 5603 4581 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_20260 5764 6900 gene locus_tag LOCUS_20270 5764 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 7289 7014 gene locus_tag LOCUS_20280 7289 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 10185 7597 gene locus_tag LOCUS_20290 gene clpB 10185 7597 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_20290 10834 10502 gene locus_tag LOCUS_20300 10834 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 11281 10931 gene locus_tag LOCUS_20310 11281 10931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 11222 11701 gene locus_tag LOCUS_20320 11222 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20320 >Feature sequence69 231 157 gene locus_tag LOCUS_t00460 231 157 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 483 1073 gene locus_tag LOCUS_20330 gene hisH 483 1073 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107745.1 protein_id gnl|my_center|LOCUS_20330 1092 1811 gene locus_tag LOCUS_20340 gene hisA 1092 1811 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764911.1 protein_id gnl|my_center|LOCUS_20340 1824 2579 gene locus_tag LOCUS_20350 gene hisF 1824 2579 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_20350 2613 3224 gene locus_tag LOCUS_20360 gene hisIE 2613 3224 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_20360 3243 3923 gene locus_tag LOCUS_20370 3243 3923 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_20370 4041 5363 gene locus_tag LOCUS_20380 4041 5363 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_20380 5477 6637 gene locus_tag LOCUS_20390 gene lysA 5477 6637 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788814.1 protein_id gnl|my_center|LOCUS_20390 7006 7971 gene locus_tag LOCUS_20400 7006 7971 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795161.1 protein_id gnl|my_center|LOCUS_20400 10197 8053 gene locus_tag LOCUS_20410 10197 8053 CDS product DUF5686 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658844.1 protein_id gnl|my_center|LOCUS_20410 10368 11069 gene locus_tag LOCUS_20420 10368 11069 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_20420 >Feature sequence70 633 1238 gene locus_tag LOCUS_20430 633 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4159 1325 gene locus_tag LOCUS_20440 4159 1325 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201991.1 protein_id gnl|my_center|LOCUS_20440 4336 4500 gene locus_tag LOCUS_20450 4336 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 6730 4523 gene locus_tag LOCUS_20460 6730 4523 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_20460 6884 8110 gene locus_tag LOCUS_20470 6884 8110 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_20470 8245 9120 gene locus_tag LOCUS_20480 8245 9120 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107520.1 protein_id gnl|my_center|LOCUS_20480 9323 10741 gene locus_tag LOCUS_20490 9323 10741 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109116.1 protein_id gnl|my_center|LOCUS_20490 >Feature sequence71 967 116 gene locus_tag LOCUS_20500 967 116 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001026122.1 protein_id gnl|my_center|LOCUS_20500 1642 1262 gene locus_tag LOCUS_20510 1642 1262 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202858.1 protein_id gnl|my_center|LOCUS_20510 2362 1685 gene locus_tag LOCUS_20520 2362 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 2533 3123 gene locus_tag LOCUS_20530 2533 3123 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993359.1 protein_id gnl|my_center|LOCUS_20530 3334 3828 gene locus_tag LOCUS_20540 3334 3828 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005641953.1 protein_id gnl|my_center|LOCUS_20540 4954 3965 gene locus_tag LOCUS_20550 4954 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 5742 4981 gene locus_tag LOCUS_20560 5742 4981 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_20560 6785 5925 gene locus_tag LOCUS_20570 6785 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 7695 7369 gene locus_tag LOCUS_20580 7695 7369 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_20580 7851 8417 gene locus_tag LOCUS_20590 7851 8417 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764900.1 protein_id gnl|my_center|LOCUS_20590 8460 9095 gene locus_tag LOCUS_20600 8460 9095 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107864.1 protein_id gnl|my_center|LOCUS_20600 9665 9165 gene locus_tag LOCUS_20610 9665 9165 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_20610 9874 10206 gene locus_tag LOCUS_20620 9874 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence72 1466 186 gene locus_tag LOCUS_20630 1466 186 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766015.1 protein_id gnl|my_center|LOCUS_20630 2446 1463 gene locus_tag LOCUS_20640 2446 1463 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766013.1 protein_id gnl|my_center|LOCUS_20640 4285 2453 gene locus_tag LOCUS_20650 4285 2453 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_20650 5366 4416 gene locus_tag LOCUS_20660 5366 4416 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245533.1 protein_id gnl|my_center|LOCUS_20660 5792 5412 gene locus_tag LOCUS_20670 5792 5412 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108802.1 protein_id gnl|my_center|LOCUS_20670 7600 5840 gene locus_tag LOCUS_20680 7600 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 9558 7753 gene locus_tag LOCUS_20690 gene typA 9558 7753 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_20690 9768 10037 gene locus_tag LOCUS_20700 gene rpsO 9768 10037 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence73 177 347 gene locus_tag LOCUS_20710 177 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1574 432 gene locus_tag LOCUS_20720 1574 432 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202960.1 protein_id gnl|my_center|LOCUS_20720 1870 2583 gene locus_tag LOCUS_20730 1870 2583 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763082.1 protein_id gnl|my_center|LOCUS_20730 2585 3193 gene locus_tag LOCUS_20740 2585 3193 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788304.1 protein_id gnl|my_center|LOCUS_20740 3444 4184 gene locus_tag LOCUS_20750 3444 4184 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_20750 4181 5548 gene locus_tag LOCUS_20760 4181 5548 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764614.1 protein_id gnl|my_center|LOCUS_20760 5551 6165 gene locus_tag LOCUS_20770 5551 6165 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764615.1 protein_id gnl|my_center|LOCUS_20770 7139 6411 gene locus_tag LOCUS_20780 gene pflA 7139 6411 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202364.1 protein_id gnl|my_center|LOCUS_20780 9466 7244 gene locus_tag LOCUS_20790 gene pflB 9466 7244 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786073.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence74 865 488 gene locus_tag LOCUS_20800 865 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20800 1093 1371 gene locus_tag LOCUS_20810 1093 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 1601 1801 gene locus_tag LOCUS_20820 1601 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1802 2920 gene locus_tag LOCUS_20830 1802 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 3015 4007 gene locus_tag LOCUS_20840 3015 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3985 6198 gene locus_tag LOCUS_20850 3985 6198 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829332.1 protein_id gnl|my_center|LOCUS_20850 7759 6494 gene locus_tag LOCUS_20860 7759 6494 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015782.1 protein_id gnl|my_center|LOCUS_20860 <9195 8080 gene locus_tag LOCUS_20870 <9195 8080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108393.1:conjugal transfer protein MobC >Feature sequence75 48 920 gene locus_tag LOCUS_20880 gene rfbG 48 920 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202465.1 protein_id gnl|my_center|LOCUS_20880 917 1828 gene locus_tag LOCUS_20890 917 1828 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_20890 1825 2892 gene locus_tag LOCUS_20900 1825 2892 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824469.1 protein_id gnl|my_center|LOCUS_20900 2932 3981 gene locus_tag LOCUS_20910 2932 3981 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203384.1 protein_id gnl|my_center|LOCUS_20910 3986 5035 gene locus_tag LOCUS_20920 3986 5035 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_20920 5050 5469 gene locus_tag LOCUS_20930 5050 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 6017 6682 gene locus_tag LOCUS_20940 6017 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 6679 7227 gene locus_tag LOCUS_20950 6679 7227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 7224 8345 gene locus_tag LOCUS_20960 7224 8345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence76 469 200 gene locus_tag LOCUS_20970 gene rpsR 469 200 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_20970 819 472 gene locus_tag LOCUS_20980 gene rpsF 819 472 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_20980 1000 1446 gene locus_tag LOCUS_20990 1000 1446 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790948.1 protein_id gnl|my_center|LOCUS_20990 1584 1760 gene locus_tag LOCUS_21000 1584 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2538 1840 gene locus_tag LOCUS_21010 2538 1840 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_21010 4105 2540 gene locus_tag LOCUS_21020 4105 2540 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_21020 6539 4371 gene locus_tag LOCUS_21030 6539 4371 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 protein_id gnl|my_center|LOCUS_21030 7511 6849 gene locus_tag LOCUS_21040 7511 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 7858 7565 gene locus_tag LOCUS_21050 7858 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 >Feature sequence77 247 56 gene locus_tag LOCUS_21060 247 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 1077 244 gene locus_tag LOCUS_21070 1077 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3485 1098 gene locus_tag LOCUS_21080 3485 1098 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800665.1 protein_id gnl|my_center|LOCUS_21080 4206 3529 gene locus_tag LOCUS_21090 4206 3529 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_21090 6614 4230 gene locus_tag LOCUS_21100 6614 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 6995 7285 gene locus_tag LOCUS_21110 6995 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence78 775 164 gene locus_tag LOCUS_21120 775 164 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762117.1 protein_id gnl|my_center|LOCUS_21120 1034 792 gene locus_tag LOCUS_21130 1034 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789240.1 protein_id gnl|my_center|LOCUS_21130 1186 2643 gene locus_tag LOCUS_21140 1186 2643 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_21140 2724 3659 gene locus_tag LOCUS_21150 2724 3659 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_21150 4172 3675 gene locus_tag LOCUS_21160 4172 3675 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765089.1 protein_id gnl|my_center|LOCUS_21160 4339 4677 gene locus_tag LOCUS_21170 4339 4677 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788181.1 protein_id gnl|my_center|LOCUS_21170 4670 5737 gene locus_tag LOCUS_21180 4670 5737 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202943.1 protein_id gnl|my_center|LOCUS_21180 5891 7060 gene locus_tag LOCUS_21190 gene purT 5891 7060 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765582.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence79 265 1908 gene locus_tag LOCUS_21200 265 1908 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_21200 2219 2977 gene locus_tag LOCUS_21210 2219 2977 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766156.1 protein_id gnl|my_center|LOCUS_21210 3873 3028 gene locus_tag LOCUS_21220 gene prmA 3873 3028 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_21220 4033 5235 gene locus_tag LOCUS_21230 4033 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795094.1 protein_id gnl|my_center|LOCUS_21230 5267 6883 gene locus_tag LOCUS_21240 5267 6883 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence80 1354 173 gene locus_tag LOCUS_21250 1354 173 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760698.1 protein_id gnl|my_center|LOCUS_21250 1829 1593 gene locus_tag LOCUS_21260 1829 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 2234 1908 gene locus_tag LOCUS_21270 2234 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3445 2231 gene locus_tag LOCUS_21280 3445 2231 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_21280 3985 3542 gene locus_tag LOCUS_21290 3985 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 4533 3982 gene locus_tag LOCUS_21300 4533 3982 CDS product Panacea domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004308669.1 protein_id gnl|my_center|LOCUS_21300 5846 4797 gene locus_tag LOCUS_21310 5846 4797 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_21310 6439 5873 gene locus_tag LOCUS_21320 6439 5873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 6753 6457 gene locus_tag LOCUS_21330 6753 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence81 990 214 gene locus_tag LOCUS_21340 990 214 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203087.1 protein_id gnl|my_center|LOCUS_21340 2016 1003 gene locus_tag LOCUS_21350 gene murB 2016 1003 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788761.1 protein_id gnl|my_center|LOCUS_21350 2852 2022 gene locus_tag LOCUS_21360 2852 2022 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762407.1 protein_id gnl|my_center|LOCUS_21360 3038 4057 gene locus_tag LOCUS_21370 gene pheS 3038 4057 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_21370 4151 5350 gene locus_tag LOCUS_21380 4151 5350 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_21380 6486 5353 gene locus_tag LOCUS_21390 6486 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 6673 6599 gene locus_tag LOCUS_t00470 6673 6599 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence82 629 198 gene locus_tag LOCUS_21400 629 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 981 908 gene locus_tag LOCUS_t00480 981 908 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2204 1167 gene locus_tag LOCUS_21410 gene thiL 2204 1167 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761224.1 protein_id gnl|my_center|LOCUS_21410 2974 2210 gene locus_tag LOCUS_21420 2974 2210 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761225.1 protein_id gnl|my_center|LOCUS_21420 4082 2976 gene locus_tag LOCUS_21430 gene lpxK 4082 2976 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292736.1 protein_id gnl|my_center|LOCUS_21430 5856 4090 gene locus_tag LOCUS_21440 gene sppA 5856 4090 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence83 173 98 gene locus_tag LOCUS_t00490 173 98 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1484 321 gene locus_tag LOCUS_21450 gene nspC 1484 321 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107393.1 protein_id gnl|my_center|LOCUS_21450 3932 1524 gene locus_tag LOCUS_21460 3932 1524 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_21460 5306 3942 gene locus_tag LOCUS_21470 5306 3942 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815306.1 protein_id gnl|my_center|LOCUS_21470 5604 5332 gene locus_tag LOCUS_21480 5604 5332 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053740.1 protein_id gnl|my_center|LOCUS_21480 5768 5853 gene locus_tag LOCUS_t00500 5768 5853 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence84 887 54 gene locus_tag LOCUS_21490 887 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 4208 897 gene locus_tag LOCUS_21500 4208 897 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_21500 5362 4238 gene locus_tag LOCUS_21510 5362 4238 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109306.1 protein_id gnl|my_center|LOCUS_21510 5567 5349 gene locus_tag LOCUS_21520 5567 5349 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence85 82 300 gene locus_tag LOCUS_21530 82 300 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040293447.1 protein_id gnl|my_center|LOCUS_21530 308 2839 gene locus_tag LOCUS_21540 308 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 >Feature sequence86 279 1310 gene locus_tag LOCUS_21550 279 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3642 1447 gene locus_tag LOCUS_21560 3642 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 5496 4057 gene locus_tag LOCUS_21570 5496 4057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 >Feature sequence87 427 2697 gene locus_tag LOCUS_21580 427 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 3862 3104 gene locus_tag LOCUS_21590 3862 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 3861 4991 gene locus_tag LOCUS_21600 3861 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence88 1745 417 gene locus_tag LOCUS_21610 gene der 1745 417 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760766.1 protein_id gnl|my_center|LOCUS_21610 2686 1769 gene locus_tag LOCUS_21620 gene era 2686 1769 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_21620 3739 2735 gene locus_tag LOCUS_21630 3739 2735 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_21630 4623 4051 gene locus_tag LOCUS_21640 4623 4051 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence89 205 876 gene locus_tag LOCUS_21650 205 876 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010537055.1 protein_id gnl|my_center|LOCUS_21650 1211 993 gene locus_tag LOCUS_21660 1211 993 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789734.1 protein_id gnl|my_center|LOCUS_21660 1451 2305 gene locus_tag LOCUS_21670 gene map 1451 2305 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_21670 2321 3343 gene locus_tag LOCUS_21680 gene tsaD 2321 3343 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787941.1 protein_id gnl|my_center|LOCUS_21680 3365 3868 gene locus_tag LOCUS_21690 3365 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3973 4233 gene locus_tag LOCUS_21700 gene rpmB 3973 4233 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765736.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence90 1471 104 gene locus_tag LOCUS_21710 1471 104 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_21710 1684 2436 gene locus_tag LOCUS_21720 1684 2436 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760890.1 protein_id gnl|my_center|LOCUS_21720 2730 2488 gene locus_tag LOCUS_21730 2730 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3003 2731 gene locus_tag LOCUS_21740 3003 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21740 3195 3656 gene locus_tag LOCUS_21750 3195 3656 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_21750 4000 3680 gene locus_tag LOCUS_21760 4000 3680 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_21760 >Feature sequence91 1315 263 gene locus_tag LOCUS_21770 1315 263 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203014.1 protein_id gnl|my_center|LOCUS_21770 1778 1320 gene locus_tag LOCUS_21780 1778 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 2122 1775 gene locus_tag LOCUS_21790 2122 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 >Feature sequence92 1388 66 gene locus_tag LOCUS_21800 1388 66 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292596.1 protein_id gnl|my_center|LOCUS_21800 2303 1467 gene locus_tag LOCUS_21810 2303 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 2979 2482 gene locus_tag LOCUS_21820 2979 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 >Feature sequence93 1175 123 gene locus_tag LOCUS_21830 1175 123 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202672.1 protein_id gnl|my_center|LOCUS_21830 3351 1240 gene locus_tag LOCUS_21840 3351 1240 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013856.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence94 1008 187 gene locus_tag LOCUS_21850 gene lptB 1008 187 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_21850 1190 1933 gene locus_tag LOCUS_21860 1190 1933 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_21860 1930 2694 gene locus_tag LOCUS_21870 1930 2694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_21870 3006 2821 gene locus_tag LOCUS_21880 3006 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 >Feature sequence95 <2818 1604 gene locus_tag LOCUS_21890 <2818 1604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015038874.1:BREX system Lon protease-like protein BrxL