>Feature sequence01 2139 1345 gene locus_tag LOCUS_00010 2139 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 3535 2150 gene locus_tag LOCUS_00020 gene glcD 3535 2150 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398865.1 protein_id gnl|my_center|LOCUS_00020 10238 3522 gene locus_tag LOCUS_00030 10238 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 10408 10620 gene locus_tag LOCUS_00040 10408 10620 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942507.1 protein_id gnl|my_center|LOCUS_00040 10631 11701 gene locus_tag LOCUS_00050 10631 11701 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545833.1 protein_id gnl|my_center|LOCUS_00050 11704 12456 gene locus_tag LOCUS_00060 11704 12456 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940604.1 protein_id gnl|my_center|LOCUS_00060 12473 13018 gene locus_tag LOCUS_00070 12473 13018 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_00070 14501 13737 gene locus_tag LOCUS_00080 14501 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 16197 14557 gene locus_tag LOCUS_00090 16197 14557 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_00090 16499 18256 gene locus_tag LOCUS_00100 16499 18256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 19957 18407 gene locus_tag LOCUS_00110 19957 18407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 20305 22116 gene locus_tag LOCUS_00120 20305 22116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 23042 22239 gene locus_tag LOCUS_00130 gene tpiA 23042 22239 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_00130 23365 24066 gene locus_tag LOCUS_00140 23365 24066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 24056 24703 gene locus_tag LOCUS_00150 24056 24703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 25913 24687 gene locus_tag LOCUS_00160 25913 24687 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261528.1 protein_id gnl|my_center|LOCUS_00160 26632 25910 gene locus_tag LOCUS_00170 26632 25910 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_00170 27072 26629 gene locus_tag LOCUS_00180 27072 26629 CDS product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418359.1 protein_id gnl|my_center|LOCUS_00180 28163 27069 gene locus_tag LOCUS_00190 28163 27069 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261525.1 protein_id gnl|my_center|LOCUS_00190 28202 28807 gene locus_tag LOCUS_00200 28202 28807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 29011 29541 gene locus_tag LOCUS_00210 29011 29541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29759 30016 gene locus_tag LOCUS_00220 29759 30016 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074022.1 protein_id gnl|my_center|LOCUS_00220 30009 30263 gene locus_tag LOCUS_00230 30009 30263 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074023.1 protein_id gnl|my_center|LOCUS_00230 30260 30661 gene locus_tag LOCUS_00240 30260 30661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30658 32250 gene locus_tag LOCUS_00250 30658 32250 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208349.1 protein_id gnl|my_center|LOCUS_00250 32282 32698 gene locus_tag LOCUS_00260 32282 32698 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765450.1 protein_id gnl|my_center|LOCUS_00260 32704 33216 gene locus_tag LOCUS_00270 32704 33216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 33216 35348 gene locus_tag LOCUS_00280 33216 35348 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479011.1 protein_id gnl|my_center|LOCUS_00280 35842 36921 gene locus_tag LOCUS_00290 35842 36921 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000273200.1 protein_id gnl|my_center|LOCUS_00290 36918 37817 gene locus_tag LOCUS_00300 36918 37817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 37817 38707 gene locus_tag LOCUS_00310 37817 38707 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_00310 38719 39009 gene locus_tag LOCUS_00320 38719 39009 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428433.1 protein_id gnl|my_center|LOCUS_00320 39002 39913 gene locus_tag LOCUS_00330 39002 39913 CDS product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799666.1 protein_id gnl|my_center|LOCUS_00330 39903 40871 gene locus_tag LOCUS_00340 39903 40871 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296671.1 protein_id gnl|my_center|LOCUS_00340 40965 42350 gene locus_tag LOCUS_00350 40965 42350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 43423 42440 gene locus_tag LOCUS_00360 43423 42440 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_00360 44390 43416 gene locus_tag LOCUS_00370 44390 43416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 44913 44503 gene locus_tag LOCUS_00380 44913 44503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45526 45167 gene locus_tag LOCUS_00390 45526 45167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 45667 47013 gene locus_tag LOCUS_00400 gene fliI 45667 47013 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082899.1 protein_id gnl|my_center|LOCUS_00400 48359 47031 gene locus_tag LOCUS_00410 48359 47031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 51158 48489 gene locus_tag LOCUS_00420 gene ppdK 51158 48489 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460835.1 protein_id gnl|my_center|LOCUS_00420 51720 51490 gene locus_tag LOCUS_00430 51720 51490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 52886 51849 gene locus_tag LOCUS_00440 52886 51849 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_00440 53047 53526 gene locus_tag LOCUS_00450 53047 53526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 53949 54926 gene locus_tag LOCUS_00460 53949 54926 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020707.1 protein_id gnl|my_center|LOCUS_00460 54919 55956 gene locus_tag LOCUS_00470 54919 55956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 56239 56904 gene locus_tag LOCUS_00480 56239 56904 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016483.1 protein_id gnl|my_center|LOCUS_00480 56929 57429 gene locus_tag LOCUS_00490 56929 57429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 57602 58858 gene locus_tag LOCUS_00500 57602 58858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 58936 59730 gene locus_tag LOCUS_00510 58936 59730 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047685.1 protein_id gnl|my_center|LOCUS_00510 59935 61089 gene locus_tag LOCUS_00520 gene ftsZ 59935 61089 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171980.1 protein_id gnl|my_center|LOCUS_00520 61630 61172 gene locus_tag LOCUS_00530 61630 61172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 62193 61627 gene locus_tag LOCUS_00540 62193 61627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 63343 62384 gene locus_tag LOCUS_00550 gene fba 63343 62384 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_00550 63907 63641 gene locus_tag LOCUS_00560 63907 63641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 64454 64137 gene locus_tag LOCUS_00570 gene sugE 64454 64137 CDS product quaternary ammonium compound efflux SMR transporter SugE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171053.1 protein_id gnl|my_center|LOCUS_00570 65541 64753 gene locus_tag LOCUS_00580 65541 64753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65852 65781 gene locus_tag LOCUS_t00010 65852 65781 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 67862 65931 gene locus_tag LOCUS_00590 67862 65931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 69514 68039 gene locus_tag LOCUS_00600 69514 68039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70299 69529 gene locus_tag LOCUS_00610 gene udp 70299 69529 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001182060.1 protein_id gnl|my_center|LOCUS_00610 70767 70309 gene locus_tag LOCUS_00620 70767 70309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 72704 70788 gene locus_tag LOCUS_00630 72704 70788 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367282.1 protein_id gnl|my_center|LOCUS_00630 73627 72803 gene locus_tag LOCUS_00640 gene rsmI 73627 72803 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700659.1 protein_id gnl|my_center|LOCUS_00640 74699 73695 gene locus_tag LOCUS_00650 gene rpoD 74699 73695 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283055.1 protein_id gnl|my_center|LOCUS_00650 76060 74810 gene locus_tag LOCUS_00660 gene waaA 76060 74810 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444132.1 protein_id gnl|my_center|LOCUS_00660 76143 78290 gene locus_tag LOCUS_00670 76143 78290 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021647.1 protein_id gnl|my_center|LOCUS_00670 79020 78283 gene locus_tag LOCUS_00680 79020 78283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 79107 79182 gene locus_tag LOCUS_t00020 79107 79182 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 80789 79347 gene locus_tag LOCUS_00690 80789 79347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 81902 80865 gene locus_tag LOCUS_00700 81902 80865 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640144.1 protein_id gnl|my_center|LOCUS_00700 82144 81911 gene locus_tag LOCUS_00710 82144 81911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 82829 82035 gene locus_tag LOCUS_00720 82829 82035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 83190 82969 gene locus_tag LOCUS_00730 83190 82969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 83365 83829 gene locus_tag LOCUS_00740 83365 83829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 83834 84397 gene locus_tag LOCUS_00750 83834 84397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 84390 84866 gene locus_tag LOCUS_00760 84390 84866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 85145 85495 gene locus_tag LOCUS_00770 85145 85495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 85516 86457 gene locus_tag LOCUS_00780 85516 86457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00780 86459 86671 gene locus_tag LOCUS_00790 86459 86671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 86652 87260 gene locus_tag LOCUS_00800 86652 87260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 87308 87730 gene locus_tag LOCUS_00810 87308 87730 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_00810 87727 89373 gene locus_tag LOCUS_00820 87727 89373 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_00820 92893 89699 gene locus_tag LOCUS_00830 92893 89699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 94133 92937 gene locus_tag LOCUS_00840 94133 92937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 95279 94611 gene locus_tag LOCUS_00850 95279 94611 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289153.1 protein_id gnl|my_center|LOCUS_00850 95530 97146 gene locus_tag LOCUS_00860 gene nadB 95530 97146 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_00860 97136 97966 gene locus_tag LOCUS_00870 gene nadC 97136 97966 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_00870 98618 98037 gene locus_tag LOCUS_00880 gene rubY 98618 98037 CDS product rubrerythrin RubY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965865.1 protein_id gnl|my_center|LOCUS_00880 98779 98949 gene locus_tag LOCUS_00890 98779 98949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 99992 98946 gene locus_tag LOCUS_00900 gene ugpC 99992 98946 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_00900 101165 100002 gene locus_tag LOCUS_00910 101165 100002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 101362 101715 gene locus_tag LOCUS_00920 101362 101715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 102191 101745 gene locus_tag LOCUS_00930 gene aroQ 102191 101745 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_00930 102479 102736 gene locus_tag LOCUS_00940 102479 102736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 103394 102750 gene locus_tag LOCUS_00950 103394 102750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 103658 104662 gene locus_tag LOCUS_00960 gene rfaE1 103658 104662 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_00960 104689 105246 gene locus_tag LOCUS_00970 104689 105246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 105236 106549 gene locus_tag LOCUS_00980 105236 106549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 106616 107740 gene locus_tag LOCUS_00990 106616 107740 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_00990 108027 109355 gene locus_tag LOCUS_01000 gene miaB 108027 109355 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_01000 110369 109368 gene locus_tag LOCUS_01010 gene hemW 110369 109368 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922247.1 protein_id gnl|my_center|LOCUS_01010 110619 111803 gene locus_tag LOCUS_01020 110619 111803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 111848 112222 gene locus_tag LOCUS_01030 111848 112222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 112236 112880 gene locus_tag LOCUS_01040 gene fliP 112236 112880 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088559.1 protein_id gnl|my_center|LOCUS_01040 112895 113383 gene locus_tag LOCUS_01050 112895 113383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 113386 113751 gene locus_tag LOCUS_01060 113386 113751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 113754 114533 gene locus_tag LOCUS_01070 gene fliR 113754 114533 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039843.1 protein_id gnl|my_center|LOCUS_01070 115190 114639 gene locus_tag LOCUS_01080 115190 114639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 115373 115582 gene locus_tag LOCUS_01090 115373 115582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 115612 115899 gene locus_tag LOCUS_01100 115612 115899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 116729 115986 gene locus_tag LOCUS_01110 116729 115986 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048437.1 protein_id gnl|my_center|LOCUS_01110 116780 117256 gene locus_tag LOCUS_01120 gene ndk 116780 117256 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_01120 117293 118069 gene locus_tag LOCUS_01130 117293 118069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 118468 118160 gene locus_tag LOCUS_01140 118468 118160 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869619.1 protein_id gnl|my_center|LOCUS_01140 118929 120317 gene locus_tag LOCUS_01150 118929 120317 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546227.1 protein_id gnl|my_center|LOCUS_01150 121710 120400 gene locus_tag LOCUS_01160 gene eno 121710 120400 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_01160 123156 121789 gene locus_tag LOCUS_01170 123156 121789 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289277.1 protein_id gnl|my_center|LOCUS_01170 123623 123698 gene locus_tag LOCUS_t00030 123623 123698 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 125098 124349 gene locus_tag LOCUS_01180 125098 124349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 125421 125347 gene locus_tag LOCUS_t00040 125421 125347 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 126503 125805 gene locus_tag LOCUS_01190 126503 125805 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_01190 127671 126496 gene locus_tag LOCUS_01200 gene coaBC 127671 126496 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965027.1 protein_id gnl|my_center|LOCUS_01200 128225 127665 gene locus_tag LOCUS_01210 gene gmk 128225 127665 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257738.1 protein_id gnl|my_center|LOCUS_01210 129573 128230 gene locus_tag LOCUS_01220 129573 128230 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871908.1 protein_id gnl|my_center|LOCUS_01220 130539 129622 gene locus_tag LOCUS_01230 130539 129622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 130629 130952 gene locus_tag LOCUS_01240 gene trxA 130629 130952 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_01240 131100 136445 gene locus_tag LOCUS_01250 131100 136445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 136539 138917 gene locus_tag LOCUS_01260 gene feoB 136539 138917 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_01260 139008 139081 gene locus_tag LOCUS_t00050 139008 139081 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 140303 139566 gene locus_tag LOCUS_01270 140303 139566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 141271 140816 gene locus_tag LOCUS_01280 141271 140816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 143050 141338 gene locus_tag LOCUS_01290 143050 141338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 143604 143074 gene locus_tag LOCUS_01300 143604 143074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 144158 143607 gene locus_tag LOCUS_01310 144158 143607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 144275 145579 gene locus_tag LOCUS_01320 144275 145579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 146128 145568 gene locus_tag LOCUS_01330 146128 145568 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428485.1 protein_id gnl|my_center|LOCUS_01330 146441 146202 gene locus_tag LOCUS_01340 146441 146202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 146726 148264 gene locus_tag LOCUS_01350 146726 148264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 148540 148322 gene locus_tag LOCUS_01360 148540 148322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 148678 149385 gene locus_tag LOCUS_01370 148678 149385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 149653 152817 gene locus_tag LOCUS_01380 149653 152817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 152819 155950 gene locus_tag LOCUS_01390 152819 155950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 155962 157032 gene locus_tag LOCUS_01400 155962 157032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 157036 159048 gene locus_tag LOCUS_01410 157036 159048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 159127 159630 gene locus_tag LOCUS_01420 159127 159630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 159640 160920 gene locus_tag LOCUS_01430 159640 160920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 161070 161660 gene locus_tag LOCUS_01440 161070 161660 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640644.1 protein_id gnl|my_center|LOCUS_01440 161653 162711 gene locus_tag LOCUS_01450 161653 162711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 162708 163643 gene locus_tag LOCUS_01460 162708 163643 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814554.1 protein_id gnl|my_center|LOCUS_01460 164199 164112 gene locus_tag LOCUS_t00060 164199 164112 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 164742 164218 gene locus_tag LOCUS_01470 164742 164218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 164782 166056 gene locus_tag LOCUS_01480 gene aroA 164782 166056 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545275.1 protein_id gnl|my_center|LOCUS_01480 168646 166049 gene locus_tag LOCUS_01490 168646 166049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 168817 170049 gene locus_tag LOCUS_01500 168817 170049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 170405 170058 gene locus_tag LOCUS_01510 170405 170058 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459853.1 protein_id gnl|my_center|LOCUS_01510 170917 170489 gene locus_tag LOCUS_01520 170917 170489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 174735 171004 gene locus_tag LOCUS_01530 174735 171004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 175769 174900 gene locus_tag LOCUS_01540 175769 174900 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973816.1 protein_id gnl|my_center|LOCUS_01540 175836 176075 gene locus_tag LOCUS_01550 175836 176075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 176174 176743 gene locus_tag LOCUS_01560 176174 176743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 177111 178520 gene locus_tag LOCUS_01570 gene atpD 177111 178520 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_01570 178525 178917 gene locus_tag LOCUS_01580 178525 178917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 178922 179497 gene locus_tag LOCUS_01590 178922 179497 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582606.1 protein_id gnl|my_center|LOCUS_01590 179494 180024 gene locus_tag LOCUS_01600 179494 180024 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016599.1 protein_id gnl|my_center|LOCUS_01600 180375 180698 gene locus_tag LOCUS_01610 180375 180698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 182308 180761 gene locus_tag LOCUS_01620 182308 180761 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_01620 182351 183346 gene locus_tag LOCUS_01630 182351 183346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 183412 183780 gene locus_tag LOCUS_01640 183412 183780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 183949 185046 gene locus_tag LOCUS_01650 183949 185046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 186223 185522 gene locus_tag LOCUS_01660 gene fabG 186223 185522 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072711.1 protein_id gnl|my_center|LOCUS_01660 186972 186223 gene locus_tag LOCUS_01670 186972 186223 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903177.1 protein_id gnl|my_center|LOCUS_01670 187209 186985 gene locus_tag LOCUS_01680 187209 186985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 187895 187209 gene locus_tag LOCUS_01690 187895 187209 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_01690 188062 188793 gene locus_tag LOCUS_01700 188062 188793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 188887 189747 gene locus_tag LOCUS_01710 188887 189747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 189765 190580 gene locus_tag LOCUS_01720 gene minD 189765 190580 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_01720 190582 191109 gene locus_tag LOCUS_01730 190582 191109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 192966 191164 gene locus_tag LOCUS_01740 192966 191164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 193256 193573 gene locus_tag LOCUS_01750 gene rpsJ 193256 193573 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057588.1 protein_id gnl|my_center|LOCUS_01750 193778 194413 gene locus_tag LOCUS_01760 gene rplC 193778 194413 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140089.1 protein_id gnl|my_center|LOCUS_01760 194620 195246 gene locus_tag LOCUS_01770 gene rplD 194620 195246 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810159.1 protein_id gnl|my_center|LOCUS_01770 195246 195542 gene locus_tag LOCUS_01780 195246 195542 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262338.1 protein_id gnl|my_center|LOCUS_01780 195672 196499 gene locus_tag LOCUS_01790 gene rplB 195672 196499 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393934.1 protein_id gnl|my_center|LOCUS_01790 196614 196895 gene locus_tag LOCUS_01800 gene rpsS 196614 196895 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140906.1 protein_id gnl|my_center|LOCUS_01800 196983 197324 gene locus_tag LOCUS_01810 gene rplV 196983 197324 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974262.1 protein_id gnl|my_center|LOCUS_01810 197350 198084 gene locus_tag LOCUS_01820 gene rpsC 197350 198084 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_01820 198132 198551 gene locus_tag LOCUS_01830 198132 198551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 198615 198812 gene locus_tag LOCUS_01840 198615 198812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 198805 199050 gene locus_tag LOCUS_01850 gene rpsQ 198805 199050 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143906.1 protein_id gnl|my_center|LOCUS_01850 199142 199510 gene locus_tag LOCUS_01860 gene rplN 199142 199510 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_01860 199596 199934 gene locus_tag LOCUS_01870 gene rplX 199596 199934 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_01870 199986 200543 gene locus_tag LOCUS_01880 gene rplE 199986 200543 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_01880 200607 200813 gene locus_tag LOCUS_01890 200607 200813 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143902.1 protein_id gnl|my_center|LOCUS_01890 200998 201393 gene locus_tag LOCUS_01900 gene rpsH 200998 201393 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_01900 202001 203098 gene locus_tag LOCUS_01910 202001 203098 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880449.1 protein_id gnl|my_center|LOCUS_01910 203106 203867 gene locus_tag LOCUS_01920 203106 203867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 203941 204315 gene locus_tag LOCUS_01930 203941 204315 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_01930 204342 204479 gene locus_tag LOCUS_01940 204342 204479 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_01940 204494 205033 gene locus_tag LOCUS_01950 204494 205033 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_01950 205055 205591 gene locus_tag LOCUS_01960 205055 205591 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_01960 205618 206802 gene locus_tag LOCUS_01970 205618 206802 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_01970 207897 206962 gene locus_tag LOCUS_01980 gene pdxA 207897 206962 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173758.1 protein_id gnl|my_center|LOCUS_01980 209203 207890 gene locus_tag LOCUS_01990 209203 207890 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392247.1 protein_id gnl|my_center|LOCUS_01990 209535 209200 gene locus_tag LOCUS_02000 209535 209200 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125933.1 protein_id gnl|my_center|LOCUS_02000 209697 210389 gene locus_tag LOCUS_02010 209697 210389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 210533 212338 gene locus_tag LOCUS_02020 gene thrS 210533 212338 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_02020 212413 213279 gene locus_tag LOCUS_02030 212413 213279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 214390 213554 gene locus_tag LOCUS_02040 214390 213554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 216258 214390 gene locus_tag LOCUS_02050 gene malQ 216258 214390 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016706.1 protein_id gnl|my_center|LOCUS_02050 217088 216777 gene locus_tag LOCUS_02060 217088 216777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 217274 218599 gene locus_tag LOCUS_02070 gene murA 217274 218599 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143118.1 protein_id gnl|my_center|LOCUS_02070 218583 218921 gene locus_tag LOCUS_02080 218583 218921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 221584 219044 gene locus_tag LOCUS_02090 221584 219044 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142062.1 protein_id gnl|my_center|LOCUS_02090 222099 223403 gene locus_tag LOCUS_02100 222099 223403 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_02100 223712 224605 gene locus_tag LOCUS_02110 223712 224605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 224589 225014 gene locus_tag LOCUS_02120 224589 225014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 225105 226532 gene locus_tag LOCUS_02130 225105 226532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 227241 226483 gene locus_tag LOCUS_02140 227241 226483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 228687 227581 gene locus_tag LOCUS_02150 228687 227581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 228974 230083 gene locus_tag LOCUS_02160 228974 230083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 230070 230546 gene locus_tag LOCUS_02170 230070 230546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 230911 230984 gene locus_tag LOCUS_t00070 230911 230984 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence02 1320 601 gene locus_tag LOCUS_02180 gene bioD 1320 601 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880330.1 protein_id gnl|my_center|LOCUS_02180 2193 1333 gene locus_tag LOCUS_02190 gene xerD 2193 1333 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_02190 2773 2285 gene locus_tag LOCUS_02200 2773 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 3208 3408 gene locus_tag LOCUS_02210 3208 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5207 3405 gene locus_tag LOCUS_02220 gene lepA 5207 3405 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142757.1 protein_id gnl|my_center|LOCUS_02220 6572 10843 gene locus_tag LOCUS_02230 6572 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 13723 12206 gene locus_tag LOCUS_02240 13723 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 15096 13840 gene locus_tag LOCUS_02250 15096 13840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 15195 16631 gene locus_tag LOCUS_02260 15195 16631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 16869 17882 gene locus_tag LOCUS_02270 16869 17882 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_02270 18143 18874 gene locus_tag LOCUS_02280 18143 18874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 18862 20160 gene locus_tag LOCUS_02290 18862 20160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 20349 20161 gene locus_tag LOCUS_02300 20349 20161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 20679 21230 gene locus_tag LOCUS_02310 20679 21230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 21309 21692 gene locus_tag LOCUS_02320 21309 21692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 21790 22098 gene locus_tag LOCUS_02330 21790 22098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 22442 22158 gene locus_tag LOCUS_02340 22442 22158 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459031.1 protein_id gnl|my_center|LOCUS_02340 23047 22604 gene locus_tag LOCUS_02350 gene flgC 23047 22604 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986962.1 protein_id gnl|my_center|LOCUS_02350 23426 23079 gene locus_tag LOCUS_02360 23426 23079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 24164 23448 gene locus_tag LOCUS_02370 gene flgG 24164 23448 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_02370 24889 24191 gene locus_tag LOCUS_02380 24889 24191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 25128 26342 gene locus_tag LOCUS_02390 25128 26342 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_02390 26420 26977 gene locus_tag LOCUS_02400 26420 26977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 27794 26967 gene locus_tag LOCUS_02410 gene whiG 27794 26967 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_02410 28246 29493 gene locus_tag LOCUS_02420 28246 29493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 30227 29631 gene locus_tag LOCUS_02430 30227 29631 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389340.1 protein_id gnl|my_center|LOCUS_02430 30306 32945 gene locus_tag LOCUS_02440 gene clpB 30306 32945 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_02440 34408 33353 gene locus_tag LOCUS_02450 gene aroC 34408 33353 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583418.1 protein_id gnl|my_center|LOCUS_02450 35011 34535 gene locus_tag LOCUS_02460 35011 34535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 36533 35145 gene locus_tag LOCUS_02470 36533 35145 CDS product AdeC/AdeK/OprM family multidrug efflux complex outer membrane factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268788.1 protein_id gnl|my_center|LOCUS_02470 36606 37064 gene locus_tag LOCUS_02480 36606 37064 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226875.1 protein_id gnl|my_center|LOCUS_02480 37087 38208 gene locus_tag LOCUS_02490 37087 38208 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090320.1 protein_id gnl|my_center|LOCUS_02490 38212 39084 gene locus_tag LOCUS_02500 38212 39084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 39833 39081 gene locus_tag LOCUS_02510 39833 39081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 40577 39852 gene locus_tag LOCUS_02520 40577 39852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 40730 42082 gene locus_tag LOCUS_02530 gene gdhA 40730 42082 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721354.1 protein_id gnl|my_center|LOCUS_02530 43464 42181 gene locus_tag LOCUS_02540 43464 42181 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861451.1 protein_id gnl|my_center|LOCUS_02540 45367 43457 gene locus_tag LOCUS_02550 45367 43457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 45520 46299 gene locus_tag LOCUS_02560 45520 46299 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836388.1 protein_id gnl|my_center|LOCUS_02560 46378 47670 gene locus_tag LOCUS_02570 46378 47670 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_02570 48864 47896 gene locus_tag LOCUS_02580 48864 47896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 49194 49718 gene locus_tag LOCUS_02590 49194 49718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 49790 51010 gene locus_tag LOCUS_02600 49790 51010 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039963.1 protein_id gnl|my_center|LOCUS_02600 50988 52178 gene locus_tag LOCUS_02610 50988 52178 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107236.1 protein_id gnl|my_center|LOCUS_02610 52383 52300 gene locus_tag LOCUS_t00080 52383 52300 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 53354 53863 gene locus_tag LOCUS_02620 53354 53863 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_02620 53952 55421 gene locus_tag LOCUS_02630 53952 55421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 55794 56759 gene locus_tag LOCUS_02640 gene fabD 55794 56759 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_02640 57088 57819 gene locus_tag LOCUS_02650 gene fabG 57088 57819 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124607.1 protein_id gnl|my_center|LOCUS_02650 58032 58262 gene locus_tag LOCUS_02660 58032 58262 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388176.1 protein_id gnl|my_center|LOCUS_02660 58378 59628 gene locus_tag LOCUS_02670 gene fabF 58378 59628 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_02670 59778 60455 gene locus_tag LOCUS_02680 59778 60455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 61930 60914 gene locus_tag LOCUS_02690 61930 60914 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880686.1 protein_id gnl|my_center|LOCUS_02690 62989 61934 gene locus_tag LOCUS_02700 gene plsX 62989 61934 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_02700 63472 63077 gene locus_tag LOCUS_02710 63472 63077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 63993 63502 gene locus_tag LOCUS_02720 63993 63502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 64265 64014 gene locus_tag LOCUS_02730 64265 64014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 65856 64423 gene locus_tag LOCUS_02740 gene ffh 65856 64423 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_02740 67175 66816 gene locus_tag LOCUS_02750 67175 66816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 67569 67426 gene locus_tag LOCUS_02760 67569 67426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 67833 68651 gene locus_tag LOCUS_02770 67833 68651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 68667 69371 gene locus_tag LOCUS_02780 68667 69371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 69368 70729 gene locus_tag LOCUS_02790 69368 70729 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021695.1 protein_id gnl|my_center|LOCUS_02790 72307 70739 gene locus_tag LOCUS_02800 72307 70739 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_02800 73446 72442 gene locus_tag LOCUS_02810 73446 72442 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931799.1 protein_id gnl|my_center|LOCUS_02810 73938 73477 gene locus_tag LOCUS_02820 73938 73477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 74108 75460 gene locus_tag LOCUS_02830 74108 75460 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705601.1 protein_id gnl|my_center|LOCUS_02830 76910 75576 gene locus_tag LOCUS_02840 gene der 76910 75576 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003727996.1 protein_id gnl|my_center|LOCUS_02840 77834 77247 gene locus_tag LOCUS_02850 77834 77247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 78847 77828 gene locus_tag LOCUS_02860 78847 77828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 78913 79716 gene locus_tag LOCUS_02870 78913 79716 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860835.1 protein_id gnl|my_center|LOCUS_02870 79777 80586 gene locus_tag LOCUS_02880 79777 80586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 81478 80558 gene locus_tag LOCUS_02890 81478 80558 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964409.1 protein_id gnl|my_center|LOCUS_02890 82170 81475 gene locus_tag LOCUS_02900 82170 81475 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948716.1 protein_id gnl|my_center|LOCUS_02900 82410 82775 gene locus_tag LOCUS_02910 82410 82775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 82863 83225 gene locus_tag LOCUS_02920 82863 83225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 83455 84633 gene locus_tag LOCUS_02930 83455 84633 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844987.1 protein_id gnl|my_center|LOCUS_02930 84637 87756 gene locus_tag LOCUS_02940 84637 87756 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976147.1 protein_id gnl|my_center|LOCUS_02940 87759 89219 gene locus_tag LOCUS_02950 87759 89219 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_02950 90021 89326 gene locus_tag LOCUS_02960 gene cruD 90021 89326 CDS product hydroxychlorobactene glucoside lauroyltransferase CruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932647.1 protein_id gnl|my_center|LOCUS_02960 91035 90310 gene locus_tag LOCUS_02970 gene rplA 91035 90310 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_02970 91509 91084 gene locus_tag LOCUS_02980 gene rplK 91509 91084 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_02980 92259 91621 gene locus_tag LOCUS_02990 gene nusG 92259 91621 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_02990 92506 92282 gene locus_tag LOCUS_03000 92506 92282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 92609 92537 gene locus_tag LOCUS_t00090 92609 92537 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 92930 92763 gene locus_tag LOCUS_03010 gene rpmG 92930 92763 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_03010 93758 93144 gene locus_tag LOCUS_03020 93758 93144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 94532 94062 gene locus_tag LOCUS_03030 gene coaD 94532 94062 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_03030 95909 94875 gene locus_tag LOCUS_03040 95909 94875 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964788.1 protein_id gnl|my_center|LOCUS_03040 96007 95933 gene locus_tag LOCUS_t00100 96007 95933 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 96622 96041 gene locus_tag LOCUS_03050 96622 96041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 97250 96624 gene locus_tag LOCUS_03060 97250 96624 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_03060 97393 97848 gene locus_tag LOCUS_03070 97393 97848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 98046 98858 gene locus_tag LOCUS_03080 98046 98858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 99741 99322 gene locus_tag LOCUS_03090 99741 99322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 100244 99963 gene locus_tag LOCUS_03100 100244 99963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 100350 101324 gene locus_tag LOCUS_03110 100350 101324 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_03110 101324 101860 gene locus_tag LOCUS_03120 101324 101860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 101890 102252 gene locus_tag LOCUS_03130 gene queD 101890 102252 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_03130 102268 103107 gene locus_tag LOCUS_03140 gene uppP 102268 103107 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392108.1 protein_id gnl|my_center|LOCUS_03140 104651 103104 gene locus_tag LOCUS_03150 104651 103104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 104880 105911 gene locus_tag LOCUS_03160 104880 105911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 105911 108493 gene locus_tag LOCUS_03170 105911 108493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 108497 110296 gene locus_tag LOCUS_03180 108497 110296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 110419 110766 gene locus_tag LOCUS_03190 gene panD 110419 110766 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000490184.1 protein_id gnl|my_center|LOCUS_03190 111532 111032 gene locus_tag LOCUS_03200 111532 111032 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124633.1 protein_id gnl|my_center|LOCUS_03200 111976 111650 gene locus_tag LOCUS_03210 111976 111650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 114297 112135 gene locus_tag LOCUS_03220 114297 112135 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_03220 114704 114363 gene locus_tag LOCUS_03230 114704 114363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 115140 114724 gene locus_tag LOCUS_03240 115140 114724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 115785 115150 gene locus_tag LOCUS_03250 115785 115150 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583586.1 protein_id gnl|my_center|LOCUS_03250 116292 117044 gene locus_tag LOCUS_03260 116292 117044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 118001 118258 gene locus_tag LOCUS_03270 118001 118258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 118504 118313 gene locus_tag LOCUS_03280 118504 118313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 119829 118591 gene locus_tag LOCUS_03290 gene hisS 119829 118591 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460333.1 protein_id gnl|my_center|LOCUS_03290 121699 119876 gene locus_tag LOCUS_03300 121699 119876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 122531 121686 gene locus_tag LOCUS_03310 gene rsmA 122531 121686 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986025.1 protein_id gnl|my_center|LOCUS_03310 122623 123942 gene locus_tag LOCUS_03320 122623 123942 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921243.1 protein_id gnl|my_center|LOCUS_03320 125002 123998 gene locus_tag LOCUS_03330 125002 123998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 125740 125168 gene locus_tag LOCUS_03340 125740 125168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 126698 125763 gene locus_tag LOCUS_03350 126698 125763 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_03350 127688 126714 gene locus_tag LOCUS_03360 127688 126714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 128553 127657 gene locus_tag LOCUS_03370 128553 127657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 131025 129256 gene locus_tag LOCUS_03380 gene mutL 131025 129256 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_03380 132044 131040 gene locus_tag LOCUS_03390 132044 131040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_03390 132166 133041 gene locus_tag LOCUS_03400 132166 133041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 133492 135582 gene locus_tag LOCUS_03410 gene fusA 133492 135582 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_03410 135703 137364 gene locus_tag LOCUS_03420 135703 137364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 137681 138538 gene locus_tag LOCUS_03430 137681 138538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 139587 138637 gene locus_tag LOCUS_03440 139587 138637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 141222 139678 gene locus_tag LOCUS_03450 141222 139678 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_03450 142215 141226 gene locus_tag LOCUS_03460 142215 141226 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545031.1 protein_id gnl|my_center|LOCUS_03460 142701 142243 gene locus_tag LOCUS_03470 142701 142243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 142792 144168 gene locus_tag LOCUS_03480 142792 144168 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096703.1 protein_id gnl|my_center|LOCUS_03480 144223 145509 gene locus_tag LOCUS_03490 144223 145509 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768329.1 protein_id gnl|my_center|LOCUS_03490 145525 146580 gene locus_tag LOCUS_03500 gene thrC 145525 146580 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880238.1 protein_id gnl|my_center|LOCUS_03500 146991 146611 gene locus_tag LOCUS_03510 146991 146611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 147130 147318 gene locus_tag LOCUS_03520 147130 147318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 147497 148657 gene locus_tag LOCUS_03530 147497 148657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 149425 149132 gene locus_tag LOCUS_03540 149425 149132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 150017 149403 gene locus_tag LOCUS_03550 150017 149403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 150907 150029 gene locus_tag LOCUS_03560 150907 150029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 151755 150904 gene locus_tag LOCUS_03570 gene truB 151755 150904 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986789.1 protein_id gnl|my_center|LOCUS_03570 152107 151763 gene locus_tag LOCUS_03580 gene rbfA 152107 151763 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261259.1 protein_id gnl|my_center|LOCUS_03580 154657 152132 gene locus_tag LOCUS_03590 gene infB 154657 152132 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388357.1 protein_id gnl|my_center|LOCUS_03590 154892 154647 gene locus_tag LOCUS_03600 154892 154647 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_03600 155985 154903 gene locus_tag LOCUS_03610 gene prfA 155985 154903 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056003.1 protein_id gnl|my_center|LOCUS_03610 157228 156107 gene locus_tag LOCUS_03620 gene recF 157228 156107 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243515.1 protein_id gnl|my_center|LOCUS_03620 157326 157577 gene locus_tag LOCUS_03630 157326 157577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 157592 158656 gene locus_tag LOCUS_03640 157592 158656 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_03640 158795 159709 gene locus_tag LOCUS_03650 158795 159709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 161769 159799 gene locus_tag LOCUS_03660 161769 159799 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942516.1 protein_id gnl|my_center|LOCUS_03660 161955 163328 gene locus_tag LOCUS_03670 gene gltP 161955 163328 CDS product glutamate/aspartate:proton symporter GltP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209033.1 protein_id gnl|my_center|LOCUS_03670 163334 166168 gene locus_tag LOCUS_03680 gene ileS 163334 166168 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_03680 166360 166536 gene locus_tag LOCUS_03690 166360 166536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 166665 167900 gene locus_tag LOCUS_03700 166665 167900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 169194 168046 gene locus_tag LOCUS_03710 169194 168046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 169943 169191 gene locus_tag LOCUS_03720 169943 169191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 171813 169930 gene locus_tag LOCUS_03730 gene ftsH 171813 169930 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_03730 172522 172133 gene locus_tag LOCUS_03740 172522 172133 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141140.1 protein_id gnl|my_center|LOCUS_03740 172972 172526 gene locus_tag LOCUS_03750 172972 172526 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141140.1 protein_id gnl|my_center|LOCUS_03750 173639 172992 gene locus_tag LOCUS_03760 173639 172992 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141141.1 protein_id gnl|my_center|LOCUS_03760 174914 173706 gene locus_tag LOCUS_03770 174914 173706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 175731 175000 gene locus_tag LOCUS_03780 175731 175000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 176431 175808 gene locus_tag LOCUS_03790 176431 175808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 177180 176701 gene locus_tag LOCUS_03800 177180 176701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 177355 178731 gene locus_tag LOCUS_03810 gene cysS 177355 178731 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022540.1 protein_id gnl|my_center|LOCUS_03810 178770 180446 gene locus_tag LOCUS_03820 178770 180446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 180436 182028 gene locus_tag LOCUS_03830 gene murJ 180436 182028 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058183.1 protein_id gnl|my_center|LOCUS_03830 182942 182091 gene locus_tag LOCUS_03840 182942 182091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 183004 184380 gene locus_tag LOCUS_03850 183004 184380 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391765.1 protein_id gnl|my_center|LOCUS_03850 185062 184370 gene locus_tag LOCUS_03860 185062 184370 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_03860 185156 186913 gene locus_tag LOCUS_03870 185156 186913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 186916 188460 gene locus_tag LOCUS_03880 186916 188460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 188457 189107 gene locus_tag LOCUS_03890 gene degU 188457 189107 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_03890 189130 189738 gene locus_tag LOCUS_03900 189130 189738 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104866.1 protein_id gnl|my_center|LOCUS_03900 189781 190311 gene locus_tag LOCUS_03910 189781 190311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 190875 190447 gene locus_tag LOCUS_03920 190875 190447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence03 396 3284 gene locus_tag LOCUS_03930 396 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 3777 3307 gene locus_tag LOCUS_03940 gene ybaK 3777 3307 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000710860.1 protein_id gnl|my_center|LOCUS_03940 4332 3784 gene locus_tag LOCUS_03950 4332 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 4767 4351 gene locus_tag LOCUS_03960 4767 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4864 6021 gene locus_tag LOCUS_03970 gene yqhD 4864 6021 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098716.1 protein_id gnl|my_center|LOCUS_03970 7583 6090 gene locus_tag LOCUS_03980 7583 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 8604 7936 gene locus_tag LOCUS_03990 8604 7936 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987124.1 protein_id gnl|my_center|LOCUS_03990 9147 8611 gene locus_tag LOCUS_04000 9147 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 10005 9343 gene locus_tag LOCUS_04010 10005 9343 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 protein_id gnl|my_center|LOCUS_04010 10070 11113 gene locus_tag LOCUS_04020 gene ribD 10070 11113 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896839.1 protein_id gnl|my_center|LOCUS_04020 11135 12466 gene locus_tag LOCUS_04030 gene amrB 11135 12466 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_04030 12932 12438 gene locus_tag LOCUS_04040 12932 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 14890 13022 gene locus_tag LOCUS_04050 14890 13022 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141608.1 protein_id gnl|my_center|LOCUS_04050 14935 15825 gene locus_tag LOCUS_04060 14935 15825 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_04060 15902 16870 gene locus_tag LOCUS_04070 gene gshB 15902 16870 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_04070 17889 16882 gene locus_tag LOCUS_04080 17889 16882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 19004 17973 gene locus_tag LOCUS_04090 gene tsaD 19004 17973 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860650.1 protein_id gnl|my_center|LOCUS_04090 19040 20341 gene locus_tag LOCUS_04100 gene obgE 19040 20341 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020750251.1 protein_id gnl|my_center|LOCUS_04100 20364 21731 gene locus_tag LOCUS_04110 gene mgtE 20364 21731 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432938.1 protein_id gnl|my_center|LOCUS_04110 21800 23209 gene locus_tag LOCUS_04120 21800 23209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 23229 24236 gene locus_tag LOCUS_04130 23229 24236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 24264 24845 gene locus_tag LOCUS_04140 24264 24845 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074256.1 protein_id gnl|my_center|LOCUS_04140 24964 25611 gene locus_tag LOCUS_04150 24964 25611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 25711 25636 gene locus_tag LOCUS_t00110 25711 25636 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25850 25770 gene locus_tag LOCUS_t00120 25850 25770 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26307 28145 gene locus_tag LOCUS_04160 gene msbA 26307 28145 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_04160 28142 28477 gene locus_tag LOCUS_04170 28142 28477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 28597 29514 gene locus_tag LOCUS_04180 28597 29514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 30076 29504 gene locus_tag LOCUS_04190 gene coaE 30076 29504 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 protein_id gnl|my_center|LOCUS_04190 30804 30073 gene locus_tag LOCUS_04200 30804 30073 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640595.1 protein_id gnl|my_center|LOCUS_04200 31208 30786 gene locus_tag LOCUS_04210 31208 30786 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495810.1 protein_id gnl|my_center|LOCUS_04210 31257 31394 gene locus_tag LOCUS_04220 31257 31394 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868015.1 protein_id gnl|my_center|LOCUS_04220 31766 31842 gene locus_tag LOCUS_t00130 31766 31842 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 31920 33023 gene locus_tag LOCUS_04230 gene yidC 31920 33023 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142228.1 protein_id gnl|my_center|LOCUS_04230 33035 34078 gene locus_tag LOCUS_04240 gene queA 33035 34078 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_04240 35506 34103 gene locus_tag LOCUS_04250 35506 34103 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_04250 36895 35510 gene locus_tag LOCUS_04260 36895 35510 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038455.1 protein_id gnl|my_center|LOCUS_04260 37700 36963 gene locus_tag LOCUS_04270 37700 36963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 39199 37700 gene locus_tag LOCUS_04280 39199 37700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 40816 39212 gene locus_tag LOCUS_04290 gene pyrG 40816 39212 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227612.1 protein_id gnl|my_center|LOCUS_04290 41159 40878 gene locus_tag LOCUS_04300 gene gatC 41159 40878 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219442.1 protein_id gnl|my_center|LOCUS_04300 41298 42146 gene locus_tag LOCUS_04310 41298 42146 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_04310 42143 43159 gene locus_tag LOCUS_04320 42143 43159 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546828.1 protein_id gnl|my_center|LOCUS_04320 44980 43241 gene locus_tag LOCUS_04330 gene argS 44980 43241 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086459.1 protein_id gnl|my_center|LOCUS_04330 45088 46398 gene locus_tag LOCUS_04340 45088 46398 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_04340 46476 48002 gene locus_tag LOCUS_04350 gene gpmI 46476 48002 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_04350 48022 50997 gene locus_tag LOCUS_04360 48022 50997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 51106 51309 gene locus_tag LOCUS_04370 gene rpmE 51106 51309 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003151132.1 protein_id gnl|my_center|LOCUS_04370 51393 52118 gene locus_tag LOCUS_04380 gene thyX 51393 52118 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459086.1 protein_id gnl|my_center|LOCUS_04380 52226 52301 gene locus_tag LOCUS_t00140 52226 52301 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 53754 52237 gene locus_tag LOCUS_04390 53754 52237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 54308 53763 gene locus_tag LOCUS_04400 54308 53763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 54727 54320 gene locus_tag LOCUS_04410 54727 54320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 54855 55055 gene locus_tag LOCUS_04420 54855 55055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 55067 55234 gene locus_tag LOCUS_04430 55067 55234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 55348 55500 gene locus_tag LOCUS_04440 55348 55500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 55493 55810 gene locus_tag LOCUS_04450 55493 55810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 55822 57267 gene locus_tag LOCUS_04460 55822 57267 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922059.1 protein_id gnl|my_center|LOCUS_04460 57413 57997 gene locus_tag LOCUS_04470 57413 57997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 58078 59139 gene locus_tag LOCUS_04480 58078 59139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 59143 59955 gene locus_tag LOCUS_04490 59143 59955 CDS product PD-(D/E)XK nuclease-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986876.1 protein_id gnl|my_center|LOCUS_04490 59961 60908 gene locus_tag LOCUS_04500 59961 60908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 60892 61683 gene locus_tag LOCUS_04510 60892 61683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 61676 62389 gene locus_tag LOCUS_04520 61676 62389 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004086866.1 protein_id gnl|my_center|LOCUS_04520 62403 63635 gene locus_tag LOCUS_04530 62403 63635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 63651 64085 gene locus_tag LOCUS_04540 63651 64085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 64090 64974 gene locus_tag LOCUS_04550 64090 64974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 64968 65399 gene locus_tag LOCUS_04560 64968 65399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 65396 65929 gene locus_tag LOCUS_04570 65396 65929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 65950 66429 gene locus_tag LOCUS_04580 65950 66429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 66442 67092 gene locus_tag LOCUS_04590 66442 67092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 67085 67432 gene locus_tag LOCUS_04600 67085 67432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 67422 67904 gene locus_tag LOCUS_04610 67422 67904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 67917 68144 gene locus_tag LOCUS_04620 67917 68144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 68134 68379 gene locus_tag LOCUS_04630 68134 68379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 68393 68701 gene locus_tag LOCUS_04640 68393 68701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 68682 68876 gene locus_tag LOCUS_04650 68682 68876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 68878 69123 gene locus_tag LOCUS_04660 68878 69123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 69107 69331 gene locus_tag LOCUS_04670 69107 69331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 69497 69982 gene locus_tag LOCUS_04680 69497 69982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 69982 70287 gene locus_tag LOCUS_04690 69982 70287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 70353 70772 gene locus_tag LOCUS_04700 70353 70772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 70765 72033 gene locus_tag LOCUS_04710 70765 72033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 72030 72401 gene locus_tag LOCUS_04720 72030 72401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 72413 72949 gene locus_tag LOCUS_04730 72413 72949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 72942 74378 gene locus_tag LOCUS_04740 72942 74378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 74382 76088 gene locus_tag LOCUS_04750 74382 76088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 76085 76279 gene locus_tag LOCUS_04760 76085 76279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 76426 77073 gene locus_tag LOCUS_04770 76426 77073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 77116 78144 gene locus_tag LOCUS_04780 77116 78144 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047642.1 protein_id gnl|my_center|LOCUS_04780 78216 78755 gene locus_tag LOCUS_04790 78216 78755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 78756 79058 gene locus_tag LOCUS_04800 78756 79058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 79070 79486 gene locus_tag LOCUS_04810 79070 79486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 79483 79851 gene locus_tag LOCUS_04820 79483 79851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 79878 80453 gene locus_tag LOCUS_04830 79878 80453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 80537 80965 gene locus_tag LOCUS_04840 80537 80965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 81172 84492 gene locus_tag LOCUS_04850 81172 84492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 84496 85101 gene locus_tag LOCUS_04860 84496 85101 CDS product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692874.1 protein_id gnl|my_center|LOCUS_04860 85098 85967 gene locus_tag LOCUS_04870 85098 85967 CDS product DUF2163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971293.1 protein_id gnl|my_center|LOCUS_04870 85981 86469 gene locus_tag LOCUS_04880 85981 86469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 86474 89413 gene locus_tag LOCUS_04890 86474 89413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 89431 90798 gene locus_tag LOCUS_04900 89431 90798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 91109 92146 gene locus_tag LOCUS_04910 91109 92146 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_04910 92115 92435 gene locus_tag LOCUS_04920 92115 92435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 92455 92736 gene locus_tag LOCUS_04930 92455 92736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 92729 93229 gene locus_tag LOCUS_04940 92729 93229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 93267 93512 gene locus_tag LOCUS_04950 93267 93512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 93604 94134 gene locus_tag LOCUS_04960 93604 94134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 94131 94439 gene locus_tag LOCUS_04970 94131 94439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 94454 95008 gene locus_tag LOCUS_04980 94454 95008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 95449 95264 gene locus_tag LOCUS_04990 95449 95264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 96478 95531 gene locus_tag LOCUS_05000 gene thrB 96478 95531 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392818.1 protein_id gnl|my_center|LOCUS_05000 96588 97910 gene locus_tag LOCUS_05010 96588 97910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 97903 99216 gene locus_tag LOCUS_05020 97903 99216 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_05020 100665 99298 gene locus_tag LOCUS_05030 100665 99298 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941459.1 protein_id gnl|my_center|LOCUS_05030 100867 100712 gene locus_tag LOCUS_05040 100867 100712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 101018 101407 gene locus_tag LOCUS_05050 101018 101407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 102294 101410 gene locus_tag LOCUS_05060 102294 101410 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_05060 102336 103796 gene locus_tag LOCUS_05070 102336 103796 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_05070 103852 104403 gene locus_tag LOCUS_05080 103852 104403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 104614 105297 gene locus_tag LOCUS_05090 gene rpsE 104614 105297 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174069.1 protein_id gnl|my_center|LOCUS_05090 105330 105521 gene locus_tag LOCUS_05100 gene rpmD 105330 105521 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421137.1 protein_id gnl|my_center|LOCUS_05100 105603 106055 gene locus_tag LOCUS_05110 gene rplO 105603 106055 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_05110 106055 107392 gene locus_tag LOCUS_05120 gene secY 106055 107392 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055954.1 protein_id gnl|my_center|LOCUS_05120 107645 108235 gene locus_tag LOCUS_05130 107645 108235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 108244 109290 gene locus_tag LOCUS_05140 108244 109290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 109401 111380 gene locus_tag LOCUS_05150 109401 111380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 111548 111832 gene locus_tag LOCUS_05160 111548 111832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 111992 113440 gene locus_tag LOCUS_05170 111992 113440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 113459 114661 gene locus_tag LOCUS_05180 113459 114661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 114792 114706 gene locus_tag LOCUS_t00150 114792 114706 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 116211 115192 gene locus_tag LOCUS_05190 gene csaB 116211 115192 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391759.1 protein_id gnl|my_center|LOCUS_05190 117158 116208 gene locus_tag LOCUS_05200 117158 116208 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094977.1 protein_id gnl|my_center|LOCUS_05200 117772 117164 gene locus_tag LOCUS_05210 gene eda 117772 117164 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_05210 117831 119777 gene locus_tag LOCUS_05220 117831 119777 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 protein_id gnl|my_center|LOCUS_05220 119780 122173 gene locus_tag LOCUS_05230 gene recG 119780 122173 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141278.1 protein_id gnl|my_center|LOCUS_05230 122395 123738 gene locus_tag LOCUS_05240 122395 123738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 123999 124436 gene locus_tag LOCUS_05250 gene rpiB 123999 124436 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_05250 124446 124847 gene locus_tag LOCUS_05260 gene rsfS 124446 124847 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172029.1 protein_id gnl|my_center|LOCUS_05260 124932 126005 gene locus_tag LOCUS_05270 124932 126005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 126005 126424 gene locus_tag LOCUS_05280 126005 126424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 127763 126510 gene locus_tag LOCUS_05290 127763 126510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 130274 127983 gene locus_tag LOCUS_05300 130274 127983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 131549 130284 gene locus_tag LOCUS_05310 gene serS 131549 130284 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963350.1 protein_id gnl|my_center|LOCUS_05310 131701 132009 gene locus_tag LOCUS_05320 131701 132009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 132996 131995 gene locus_tag LOCUS_05330 132996 131995 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454234.1 protein_id gnl|my_center|LOCUS_05330 133162 134061 gene locus_tag LOCUS_05340 133162 134061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 134203 135843 gene locus_tag LOCUS_05350 134203 135843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 136053 135880 gene locus_tag LOCUS_05360 136053 135880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 136230 137066 gene locus_tag LOCUS_05370 gene udk 136230 137066 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289751.1 protein_id gnl|my_center|LOCUS_05370 137515 137156 gene locus_tag LOCUS_05380 137515 137156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 138976 137705 gene locus_tag LOCUS_05390 138976 137705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 139174 140613 gene locus_tag LOCUS_05400 gene pyk 139174 140613 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_05400 140927 141211 gene locus_tag LOCUS_05410 140927 141211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 141645 142826 gene locus_tag LOCUS_05420 141645 142826 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120312.1 protein_id gnl|my_center|LOCUS_05420 142829 144085 gene locus_tag LOCUS_05430 142829 144085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 145167 144082 gene locus_tag LOCUS_05440 145167 144082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 145269 147257 gene locus_tag LOCUS_05450 gene uvrB 145269 147257 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141853.1 protein_id gnl|my_center|LOCUS_05450 148002 147250 gene locus_tag LOCUS_05460 148002 147250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 149221 148067 gene locus_tag LOCUS_05470 149221 148067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 149753 149223 gene locus_tag LOCUS_05480 gene hpt 149753 149223 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016283.1 protein_id gnl|my_center|LOCUS_05480 151089 149743 gene locus_tag LOCUS_05490 gene tilS 151089 149743 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048376.1 protein_id gnl|my_center|LOCUS_05490 152455 151091 gene locus_tag LOCUS_05500 152455 151091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 152765 152460 gene locus_tag LOCUS_05510 152765 152460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 153181 152780 gene locus_tag LOCUS_05520 gene ruvX 153181 152780 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221192.1 protein_id gnl|my_center|LOCUS_05520 154787 153174 gene locus_tag LOCUS_05530 154787 153174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 155059 154784 gene locus_tag LOCUS_05540 155059 154784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 155175 155807 gene locus_tag LOCUS_05550 155175 155807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 155810 156598 gene locus_tag LOCUS_05560 gene lgt 155810 156598 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124613.1 protein_id gnl|my_center|LOCUS_05560 156641 157825 gene locus_tag LOCUS_05570 156641 157825 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393028.1 protein_id gnl|my_center|LOCUS_05570 158468 157836 gene locus_tag LOCUS_05580 158468 157836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 158888 158469 gene locus_tag LOCUS_05590 158888 158469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 159139 159477 gene locus_tag LOCUS_05600 159139 159477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 159477 159974 gene locus_tag LOCUS_05610 159477 159974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 159993 160691 gene locus_tag LOCUS_05620 159993 160691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 160758 162143 gene locus_tag LOCUS_05630 160758 162143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 162178 163095 gene locus_tag LOCUS_05640 gene cysK 162178 163095 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965533.1 protein_id gnl|my_center|LOCUS_05640 163263 164486 gene locus_tag LOCUS_05650 163263 164486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 164645 165718 gene locus_tag LOCUS_05660 164645 165718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 167446 165797 gene locus_tag LOCUS_05670 gene groL 167446 165797 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142891.1 protein_id gnl|my_center|LOCUS_05670 167780 167496 gene locus_tag LOCUS_05680 gene groES 167780 167496 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174076.1 protein_id gnl|my_center|LOCUS_05680 171328 167897 gene locus_tag LOCUS_05690 171328 167897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 171418 171876 gene locus_tag LOCUS_05700 171418 171876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 >Feature sequence04 476 871 gene locus_tag LOCUS_05710 476 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 2175 868 gene locus_tag LOCUS_05720 2175 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 3479 2172 gene locus_tag LOCUS_05730 3479 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3913 3479 gene locus_tag LOCUS_05740 3913 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 4037 4420 gene locus_tag LOCUS_05750 4037 4420 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434285.1 protein_id gnl|my_center|LOCUS_05750 4708 7728 gene locus_tag LOCUS_05760 4708 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 9350 7725 gene locus_tag LOCUS_05770 9350 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 9439 9825 gene locus_tag LOCUS_05780 9439 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 10069 9857 gene locus_tag LOCUS_05790 10069 9857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 10135 10467 gene locus_tag LOCUS_05800 10135 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 10519 11806 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttatagtttcctttcgaaagtatttattgtataat 12196 11864 gene locus_tag LOCUS_05810 gene cas2 12196 11864 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040666777.1 protein_id gnl|my_center|LOCUS_05810 13077 12193 gene locus_tag LOCUS_05820 gene cas1 13077 12193 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_05820 16153 13067 gene locus_tag LOCUS_05830 gene cas9 16153 13067 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_05830 18022 16973 gene locus_tag LOCUS_05840 gene aroF 18022 16973 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_05840 18722 18123 gene locus_tag LOCUS_05850 18722 18123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 19834 18725 gene locus_tag LOCUS_05860 19834 18725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 20538 19939 gene locus_tag LOCUS_05870 20538 19939 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_05870 21270 20605 gene locus_tag LOCUS_05880 21270 20605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 21800 21258 gene locus_tag LOCUS_05890 gene rimI 21800 21258 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434429.1 protein_id gnl|my_center|LOCUS_05890 21901 22896 gene locus_tag LOCUS_05900 21901 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 22970 23770 gene locus_tag LOCUS_05910 22970 23770 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963856.1 protein_id gnl|my_center|LOCUS_05910 23775 24101 gene locus_tag LOCUS_05920 23775 24101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 24137 24982 gene locus_tag LOCUS_05930 24137 24982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 26186 25608 gene locus_tag LOCUS_05940 gene rdgB 26186 25608 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172548.1 protein_id gnl|my_center|LOCUS_05940 26914 26186 gene locus_tag LOCUS_05950 26914 26186 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460415.1 protein_id gnl|my_center|LOCUS_05950 28172 28525 gene locus_tag LOCUS_05960 28172 28525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 28664 29170 gene locus_tag LOCUS_05970 28664 29170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 29262 29894 gene locus_tag LOCUS_05980 29262 29894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 29987 32626 gene locus_tag LOCUS_05990 gene secA 29987 32626 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_05990 34299 32764 gene locus_tag LOCUS_06000 gene lysS 34299 32764 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067015.1 protein_id gnl|my_center|LOCUS_06000 35297 36631 gene locus_tag LOCUS_06010 gene mnmE 35297 36631 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_06010 37294 36632 gene locus_tag LOCUS_06020 37294 36632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 37682 37359 gene locus_tag LOCUS_06030 37682 37359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 38299 37760 gene locus_tag LOCUS_06040 38299 37760 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785730.1 protein_id gnl|my_center|LOCUS_06040 39495 38296 gene locus_tag LOCUS_06050 39495 38296 CDS product DUF4127 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_06050 39670 40338 gene locus_tag LOCUS_06060 39670 40338 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102162.1 protein_id gnl|my_center|LOCUS_06060 41455 41171 gene locus_tag LOCUS_06070 41455 41171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 42776 41478 gene locus_tag LOCUS_06080 42776 41478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 42920 43267 gene locus_tag LOCUS_06090 42920 43267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 43280 43768 gene locus_tag LOCUS_06100 43280 43768 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296548.1 protein_id gnl|my_center|LOCUS_06100 43877 44182 gene locus_tag LOCUS_06110 43877 44182 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047981.1 protein_id gnl|my_center|LOCUS_06110 44879 44292 gene locus_tag LOCUS_06120 44879 44292 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_06120 45121 44912 gene locus_tag LOCUS_06130 45121 44912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 46115 45213 gene locus_tag LOCUS_06140 gene era 46115 45213 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460854.1 protein_id gnl|my_center|LOCUS_06140 46219 48288 gene locus_tag LOCUS_06150 46219 48288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 48309 49475 gene locus_tag LOCUS_06160 48309 49475 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722711.1 protein_id gnl|my_center|LOCUS_06160 49922 49518 gene locus_tag LOCUS_06170 49922 49518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 51943 49925 gene locus_tag LOCUS_06180 51943 49925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 52936 52016 gene locus_tag LOCUS_06190 52936 52016 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546439.1 protein_id gnl|my_center|LOCUS_06190 53200 53358 gene locus_tag LOCUS_06200 53200 53358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 54630 53434 gene locus_tag LOCUS_06210 gene hydF 54630 53434 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433974.1 protein_id gnl|my_center|LOCUS_06210 55009 54740 gene locus_tag LOCUS_06220 gene rpsO 55009 54740 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804659.1 protein_id gnl|my_center|LOCUS_06220 55570 55124 gene locus_tag LOCUS_06230 55570 55124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 55717 56466 gene locus_tag LOCUS_06240 gene dapB 55717 56466 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922354.1 protein_id gnl|my_center|LOCUS_06240 56491 57507 gene locus_tag LOCUS_06250 56491 57507 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_06250 57691 57840 gene locus_tag LOCUS_06260 57691 57840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 57853 58116 gene locus_tag LOCUS_06270 57853 58116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 58443 58826 gene locus_tag LOCUS_06280 58443 58826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 58984 59190 gene locus_tag LOCUS_06290 58984 59190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 59206 59706 gene locus_tag LOCUS_06300 59206 59706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 59706 61220 gene locus_tag LOCUS_06310 59706 61220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 61284 62210 gene locus_tag LOCUS_06320 61284 62210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889358.1 protein_id gnl|my_center|LOCUS_06320 62300 62572 gene locus_tag LOCUS_06330 62300 62572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 62562 63161 gene locus_tag LOCUS_06340 62562 63161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 63225 63863 gene locus_tag LOCUS_06350 63225 63863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 64223 64666 gene locus_tag LOCUS_06360 64223 64666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 64690 65049 gene locus_tag LOCUS_06370 64690 65049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 65178 65591 gene locus_tag LOCUS_06380 65178 65591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 65581 67248 gene locus_tag LOCUS_06390 65581 67248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 67331 67789 gene locus_tag LOCUS_06400 67331 67789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 67867 69156 gene locus_tag LOCUS_06410 67867 69156 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007302.1 protein_id gnl|my_center|LOCUS_06410 69174 69416 gene locus_tag LOCUS_06420 69174 69416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 69536 71143 gene locus_tag LOCUS_06430 69536 71143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 71371 71835 gene locus_tag LOCUS_06440 71371 71835 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356382.1 protein_id gnl|my_center|LOCUS_06440 71835 72368 gene locus_tag LOCUS_06450 71835 72368 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392868.1 protein_id gnl|my_center|LOCUS_06450 72693 72322 gene locus_tag LOCUS_06460 72693 72322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 73161 72745 gene locus_tag LOCUS_06470 73161 72745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 73442 73209 gene locus_tag LOCUS_06480 73442 73209 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_06480 73507 74187 gene locus_tag LOCUS_06490 73507 74187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 75591 74983 gene locus_tag LOCUS_06500 gene plsY 75591 74983 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531489.1 protein_id gnl|my_center|LOCUS_06500 75733 76638 gene locus_tag LOCUS_06510 75733 76638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 76674 77342 gene locus_tag LOCUS_06520 76674 77342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 77362 78978 gene locus_tag LOCUS_06530 77362 78978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 78981 79805 gene locus_tag LOCUS_06540 78981 79805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 79943 80941 gene locus_tag LOCUS_06550 79943 80941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 81713 80988 gene locus_tag LOCUS_06560 81713 80988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 83474 81903 gene locus_tag LOCUS_06570 83474 81903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 83738 84595 gene locus_tag LOCUS_06580 83738 84595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 85346 84846 gene locus_tag LOCUS_06590 85346 84846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 85945 85490 gene locus_tag LOCUS_06600 gene speD 85945 85490 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583813.1 protein_id gnl|my_center|LOCUS_06600 86211 86906 gene locus_tag LOCUS_06610 86211 86906 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 protein_id gnl|my_center|LOCUS_06610 87668 86934 gene locus_tag LOCUS_06620 87668 86934 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_06620 87711 88766 gene locus_tag LOCUS_06630 gene ispG 87711 88766 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_06630 88852 89172 gene locus_tag LOCUS_06640 88852 89172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 89258 89818 gene locus_tag LOCUS_06650 89258 89818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 89822 91747 gene locus_tag LOCUS_06660 89822 91747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 91882 93324 gene locus_tag LOCUS_06670 gene gatB 91882 93324 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_06670 93317 94381 gene locus_tag LOCUS_06680 93317 94381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 94381 95934 gene locus_tag LOCUS_06690 94381 95934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 96272 95931 gene locus_tag LOCUS_06700 96272 95931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 97404 96370 gene locus_tag LOCUS_06710 gene pheS 97404 96370 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143121.1 protein_id gnl|my_center|LOCUS_06710 98043 97423 gene locus_tag LOCUS_06720 98043 97423 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965570.1 protein_id gnl|my_center|LOCUS_06720 98863 98048 gene locus_tag LOCUS_06730 gene kdsA 98863 98048 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_06730 99160 98915 gene locus_tag LOCUS_06740 99160 98915 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_06740 99252 100085 gene locus_tag LOCUS_06750 99252 100085 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928880.1 protein_id gnl|my_center|LOCUS_06750 100162 101523 gene locus_tag LOCUS_06760 100162 101523 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460069.1 protein_id gnl|my_center|LOCUS_06760 101909 101559 gene locus_tag LOCUS_06770 101909 101559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 104848 102290 gene locus_tag LOCUS_06780 gene gyrA 104848 102290 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143075.1 protein_id gnl|my_center|LOCUS_06780 107323 105770 gene locus_tag LOCUS_06790 107323 105770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 107816 108352 gene locus_tag LOCUS_06800 107816 108352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 108771 109193 gene locus_tag LOCUS_06810 108771 109193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 109817 109731 gene locus_tag LOCUS_t00160 109817 109731 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 110568 109843 gene locus_tag LOCUS_06820 gene bluB 110568 109843 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631426.1 protein_id gnl|my_center|LOCUS_06820 110700 110981 gene locus_tag LOCUS_06830 110700 110981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 111773 111126 gene locus_tag LOCUS_06840 111773 111126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 114258 111778 gene locus_tag LOCUS_06850 gene pheT 114258 111778 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016058.1 protein_id gnl|my_center|LOCUS_06850 114919 115545 gene locus_tag LOCUS_06860 gene tmk 114919 115545 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939417.1 protein_id gnl|my_center|LOCUS_06860 116177 115542 gene locus_tag LOCUS_06870 116177 115542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 116939 116187 gene locus_tag LOCUS_06880 gene map 116939 116187 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000582539.1 protein_id gnl|my_center|LOCUS_06880 117622 116963 gene locus_tag LOCUS_06890 117622 116963 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583365.1 protein_id gnl|my_center|LOCUS_06890 118728 118078 gene locus_tag LOCUS_06900 118728 118078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 119835 118786 gene locus_tag LOCUS_06910 119835 118786 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583663.1 protein_id gnl|my_center|LOCUS_06910 121984 119954 gene locus_tag LOCUS_06920 121984 119954 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546396.1 protein_id gnl|my_center|LOCUS_06920 122719 122069 gene locus_tag LOCUS_06930 122719 122069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 123446 122796 gene locus_tag LOCUS_06940 123446 122796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 124360 123446 gene locus_tag LOCUS_06950 gene ftsY 124360 123446 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007650.1 protein_id gnl|my_center|LOCUS_06950 124657 125886 gene locus_tag LOCUS_06960 124657 125886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 127146 125914 gene locus_tag LOCUS_06970 127146 125914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 127893 127231 gene locus_tag LOCUS_06980 127893 127231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 128039 128383 gene locus_tag LOCUS_06990 128039 128383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 129149 128340 gene locus_tag LOCUS_07000 129149 128340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 129317 130093 gene locus_tag LOCUS_07010 129317 130093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 130093 131004 gene locus_tag LOCUS_07020 130093 131004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 131006 131665 gene locus_tag LOCUS_07030 131006 131665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 131735 133384 gene locus_tag LOCUS_07040 131735 133384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 <139503 134929 gene locus_tag LOCUS_07050 <139503 134929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein >Feature sequence05 1859 3001 gene locus_tag LOCUS_07060 gene folP 1859 3001 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948526.1 protein_id gnl|my_center|LOCUS_07060 3492 3223 gene locus_tag LOCUS_07070 3492 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 3930 3571 gene locus_tag LOCUS_07080 3930 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4264 3950 gene locus_tag LOCUS_07090 4264 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4694 4329 gene locus_tag LOCUS_07100 4694 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4783 6123 gene locus_tag LOCUS_07110 4783 6123 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582440.1 protein_id gnl|my_center|LOCUS_07110 6141 6851 gene locus_tag LOCUS_07120 gene pdxJ 6141 6851 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004969731.1 protein_id gnl|my_center|LOCUS_07120 6865 7179 gene locus_tag LOCUS_07130 6865 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 7182 7796 gene locus_tag LOCUS_07140 7182 7796 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357537.1 protein_id gnl|my_center|LOCUS_07140 8393 7845 gene locus_tag LOCUS_07150 8393 7845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 8511 9347 gene locus_tag LOCUS_07160 gene speB 8511 9347 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209826.1 protein_id gnl|my_center|LOCUS_07160 9347 11326 gene locus_tag LOCUS_07170 gene ligA 9347 11326 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_07170 11341 11790 gene locus_tag LOCUS_07180 11341 11790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 11801 12544 gene locus_tag LOCUS_07190 11801 12544 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530175.1 protein_id gnl|my_center|LOCUS_07190 12784 13839 gene locus_tag LOCUS_07200 12784 13839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 13932 16976 gene locus_tag LOCUS_07210 13932 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 20217 17089 gene locus_tag LOCUS_07220 20217 17089 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073740.1 protein_id gnl|my_center|LOCUS_07220 20270 21361 gene locus_tag LOCUS_07230 20270 21361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 22860 21784 gene locus_tag LOCUS_07240 gene aroB 22860 21784 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583419.1 protein_id gnl|my_center|LOCUS_07240 23348 22842 gene locus_tag LOCUS_07250 23348 22842 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357579.1 protein_id gnl|my_center|LOCUS_07250 24910 23345 gene locus_tag LOCUS_07260 gene metG 24910 23345 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_07260 25887 25054 gene locus_tag LOCUS_07270 25887 25054 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048320.1 protein_id gnl|my_center|LOCUS_07270 26941 25976 gene locus_tag LOCUS_07280 26941 25976 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965110.1 protein_id gnl|my_center|LOCUS_07280 26981 27310 gene locus_tag LOCUS_07290 26981 27310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 27477 28958 gene locus_tag LOCUS_07300 27477 28958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 31755 29269 gene locus_tag LOCUS_07310 gene leuS 31755 29269 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_07310 31859 32773 gene locus_tag LOCUS_07320 31859 32773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 32757 33227 gene locus_tag LOCUS_07330 32757 33227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 33224 34141 gene locus_tag LOCUS_07340 33224 34141 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861614.1 protein_id gnl|my_center|LOCUS_07340 34138 34524 gene locus_tag LOCUS_07350 34138 34524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 34830 34597 gene locus_tag LOCUS_07360 gene rpsR 34830 34597 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462317.1 protein_id gnl|my_center|LOCUS_07360 35123 34893 gene locus_tag LOCUS_07370 35123 34893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 35556 35149 gene locus_tag LOCUS_07380 35556 35149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 35895 35596 gene locus_tag LOCUS_07390 gene rpsF 35895 35596 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244064.1 protein_id gnl|my_center|LOCUS_07390 36794 35961 gene locus_tag LOCUS_07400 gene dapF 36794 35961 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944873.1 protein_id gnl|my_center|LOCUS_07400 37047 37137 gene locus_tag LOCUS_t00170 37047 37137 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 37575 37901 gene locus_tag LOCUS_07410 37575 37901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 38047 38421 gene locus_tag LOCUS_07420 38047 38421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 38431 39075 gene locus_tag LOCUS_07430 38431 39075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 39115 39801 gene locus_tag LOCUS_07440 39115 39801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 39896 40318 gene locus_tag LOCUS_07450 39896 40318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 41082 40351 gene locus_tag LOCUS_07460 41082 40351 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814489.1 protein_id gnl|my_center|LOCUS_07460 41248 41571 gene locus_tag LOCUS_07470 41248 41571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 41898 42131 gene locus_tag LOCUS_07480 41898 42131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 42100 44199 gene locus_tag LOCUS_07490 42100 44199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 44313 45686 gene locus_tag LOCUS_07500 44313 45686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 45741 47534 gene locus_tag LOCUS_07510 45741 47534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 47590 48336 gene locus_tag LOCUS_07520 47590 48336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 50166 48835 gene locus_tag LOCUS_07530 50166 48835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 50477 50166 gene locus_tag LOCUS_07540 50477 50166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 50696 51925 gene locus_tag LOCUS_07550 50696 51925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 52072 56592 gene locus_tag LOCUS_07560 52072 56592 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626303.1 protein_id gnl|my_center|LOCUS_07560 57220 56603 gene locus_tag LOCUS_07570 57220 56603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07570 57554 57153 gene locus_tag LOCUS_07580 57554 57153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07580 59786 57666 gene locus_tag LOCUS_07590 59786 57666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 61243 59786 gene locus_tag LOCUS_07600 61243 59786 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480516.1 protein_id gnl|my_center|LOCUS_07600 61800 61255 gene locus_tag LOCUS_07610 61800 61255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 64196 61800 gene locus_tag LOCUS_07620 64196 61800 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_07620 64341 64931 gene locus_tag LOCUS_07630 64341 64931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 66123 65143 gene locus_tag LOCUS_07640 66123 65143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 66964 66227 gene locus_tag LOCUS_07650 gene pgeF 66964 66227 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_07650 67065 67703 gene locus_tag LOCUS_07660 gene aqpZ 67065 67703 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207869.1 protein_id gnl|my_center|LOCUS_07660 67789 68964 gene locus_tag LOCUS_07670 67789 68964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 68976 69560 gene locus_tag LOCUS_07680 68976 69560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 69561 70535 gene locus_tag LOCUS_07690 69561 70535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 70540 71685 gene locus_tag LOCUS_07700 70540 71685 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_07700 72346 71705 gene locus_tag LOCUS_07710 72346 71705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 74931 72436 gene locus_tag LOCUS_07720 gene pcrA 74931 72436 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542538.1 protein_id gnl|my_center|LOCUS_07720 75015 75614 gene locus_tag LOCUS_07730 75015 75614 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_07730 75646 76815 gene locus_tag LOCUS_07740 75646 76815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 76824 77357 gene locus_tag LOCUS_07750 76824 77357 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080176.1 protein_id gnl|my_center|LOCUS_07750 77362 78162 gene locus_tag LOCUS_07760 77362 78162 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_07760 78328 78576 gene locus_tag LOCUS_07770 78328 78576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 78598 79527 gene locus_tag LOCUS_07780 gene rsmH 78598 79527 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_07780 79575 80048 gene locus_tag LOCUS_07790 79575 80048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 80174 81409 gene locus_tag LOCUS_07800 80174 81409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 81681 81433 gene locus_tag LOCUS_07810 81681 81433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 82005 81700 gene locus_tag LOCUS_07820 82005 81700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 84207 87347 gene locus_tag LOCUS_07830 84207 87347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence06 161 232 gene locus_tag LOCUS_t00180 161 232 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 262 347 gene locus_tag LOCUS_t00190 262 347 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1299 739 gene locus_tag LOCUS_07840 1299 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 2671 1373 gene locus_tag LOCUS_07850 2671 1373 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_07850 3131 2652 gene locus_tag LOCUS_07860 3131 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3243 4052 gene locus_tag LOCUS_07870 3243 4052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_07870 4074 4793 gene locus_tag LOCUS_07880 4074 4793 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_07880 4809 6062 gene locus_tag LOCUS_07890 4809 6062 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 protein_id gnl|my_center|LOCUS_07890 6081 6266 gene locus_tag LOCUS_07900 6081 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 6287 7267 gene locus_tag LOCUS_07910 6287 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 7760 7377 gene locus_tag LOCUS_07920 7760 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 8304 7771 gene locus_tag LOCUS_07930 8304 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 8437 9201 gene locus_tag LOCUS_07940 8437 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 9314 9517 gene locus_tag LOCUS_07950 9314 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 11239 9638 gene locus_tag LOCUS_07960 11239 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 11382 11705 gene locus_tag LOCUS_07970 11382 11705 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667543.1 protein_id gnl|my_center|LOCUS_07970 12365 11778 gene locus_tag LOCUS_07980 12365 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765473.1 protein_id gnl|my_center|LOCUS_07980 12675 13124 gene locus_tag LOCUS_07990 12675 13124 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694080.1 protein_id gnl|my_center|LOCUS_07990 13192 13479 gene locus_tag LOCUS_08000 13192 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 13848 13776 gene locus_tag LOCUS_t00200 13848 13776 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14749 14090 gene locus_tag LOCUS_08010 14749 14090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 15526 14828 gene locus_tag LOCUS_08020 gene degU 15526 14828 CDS product two-component system response regulator DegU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219701.1 protein_id gnl|my_center|LOCUS_08020 15806 16873 gene locus_tag LOCUS_08030 15806 16873 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_08030 17788 16895 gene locus_tag LOCUS_08040 17788 16895 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_08040 17929 18804 gene locus_tag LOCUS_08050 17929 18804 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101364.1 protein_id gnl|my_center|LOCUS_08050 18877 19839 gene locus_tag LOCUS_08060 18877 19839 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_08060 19931 20092 gene locus_tag LOCUS_08070 19931 20092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 21555 20161 gene locus_tag LOCUS_08080 21555 20161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 22187 21630 gene locus_tag LOCUS_08090 gene pth 22187 21630 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163947.1 protein_id gnl|my_center|LOCUS_08090 22320 22895 gene locus_tag LOCUS_08100 22320 22895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 23271 23038 gene locus_tag LOCUS_08110 23271 23038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 24139 23594 gene locus_tag LOCUS_08120 24139 23594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 24275 24745 gene locus_tag LOCUS_08130 gene ruvC 24275 24745 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256932.1 protein_id gnl|my_center|LOCUS_08130 24823 25311 gene locus_tag LOCUS_08140 24823 25311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 25465 25950 gene locus_tag LOCUS_08150 25465 25950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 25968 27023 gene locus_tag LOCUS_08160 gene mtnA 25968 27023 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_08160 27413 27042 gene locus_tag LOCUS_08170 27413 27042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 27639 27980 gene locus_tag LOCUS_08180 27639 27980 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719341.1 protein_id gnl|my_center|LOCUS_08180 28126 29223 gene locus_tag LOCUS_08190 28126 29223 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_08190 29662 29588 gene locus_tag LOCUS_t00210 29662 29588 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 30065 30817 gene locus_tag LOCUS_08200 30065 30817 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964597.1 protein_id gnl|my_center|LOCUS_08200 30789 32192 gene locus_tag LOCUS_08210 30789 32192 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583871.1 protein_id gnl|my_center|LOCUS_08210 32482 34182 gene locus_tag LOCUS_08220 32482 34182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 34196 35917 gene locus_tag LOCUS_08230 34196 35917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 36658 35930 gene locus_tag LOCUS_08240 36658 35930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 36724 36942 gene locus_tag LOCUS_08250 36724 36942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 38339 36987 gene locus_tag LOCUS_08260 gene accC 38339 36987 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230253.1 protein_id gnl|my_center|LOCUS_08260 38862 38401 gene locus_tag LOCUS_08270 gene accB 38862 38401 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262775.1 protein_id gnl|my_center|LOCUS_08270 39446 38889 gene locus_tag LOCUS_08280 gene efp 39446 38889 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810907.1 protein_id gnl|my_center|LOCUS_08280 40281 39535 gene locus_tag LOCUS_08290 40281 39535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 40373 41377 gene locus_tag LOCUS_08300 gene rsgA 40373 41377 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113932.1 protein_id gnl|my_center|LOCUS_08300 41361 42239 gene locus_tag LOCUS_08310 41361 42239 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_08310 42239 42712 gene locus_tag LOCUS_08320 42239 42712 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_08320 43216 46392 gene locus_tag LOCUS_08330 43216 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 46796 46449 gene locus_tag LOCUS_08340 46796 46449 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214610.1 protein_id gnl|my_center|LOCUS_08340 47333 47055 gene locus_tag LOCUS_08350 47333 47055 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 protein_id gnl|my_center|LOCUS_08350 47559 48902 gene locus_tag LOCUS_08360 47559 48902 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929048.1 protein_id gnl|my_center|LOCUS_08360 48920 49450 gene locus_tag LOCUS_08370 48920 49450 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_08370 49497 50576 gene locus_tag LOCUS_08380 49497 50576 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881061.1 protein_id gnl|my_center|LOCUS_08380 50676 51248 gene locus_tag LOCUS_08390 50676 51248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 52929 51529 gene locus_tag LOCUS_08400 52929 51529 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_08400 53030 54094 gene locus_tag LOCUS_08410 53030 54094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 54299 55819 gene locus_tag LOCUS_08420 gene rny 54299 55819 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_08420 55866 56690 gene locus_tag LOCUS_08430 55866 56690 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904102.1 protein_id gnl|my_center|LOCUS_08430 56687 57547 gene locus_tag LOCUS_08440 56687 57547 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_08440 57565 58200 gene locus_tag LOCUS_08450 57565 58200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 58190 58792 gene locus_tag LOCUS_08460 58190 58792 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_08460 60450 58801 gene locus_tag LOCUS_08470 gene ilvD 60450 58801 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_08470 61373 60447 gene locus_tag LOCUS_08480 gene nagA 61373 60447 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_08480 62927 61455 gene locus_tag LOCUS_08490 62927 61455 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245326.1 protein_id gnl|my_center|LOCUS_08490 64704 62944 gene locus_tag LOCUS_08500 64704 62944 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_08500 64817 66208 gene locus_tag LOCUS_08510 64817 66208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 67020 66205 gene locus_tag LOCUS_08520 gene proC 67020 66205 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_08520 67116 67268 gene locus_tag LOCUS_08530 gene rpmH 67116 67268 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831329.1 protein_id gnl|my_center|LOCUS_08530 67318 67674 gene locus_tag LOCUS_08540 gene rnpA 67318 67674 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_08540 67668 68192 gene locus_tag LOCUS_08550 67668 68192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 68476 68552 gene locus_tag LOCUS_t00220 68476 68552 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 69017 68628 gene locus_tag LOCUS_08560 69017 68628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 69162 69710 gene locus_tag LOCUS_08570 69162 69710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 70158 69865 gene locus_tag LOCUS_08580 70158 69865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 71162 70185 gene locus_tag LOCUS_08590 71162 70185 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027982.1 protein_id gnl|my_center|LOCUS_08590 71589 71167 gene locus_tag LOCUS_08600 71589 71167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 71678 73267 gene locus_tag LOCUS_08610 71678 73267 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863284.1 protein_id gnl|my_center|LOCUS_08610 73948 75312 gene locus_tag LOCUS_08620 gene glnA 73948 75312 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393265.1 protein_id gnl|my_center|LOCUS_08620 75682 75392 gene locus_tag LOCUS_08630 75682 75392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 75860 78388 gene locus_tag LOCUS_08640 gene gyrB 75860 78388 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_08640 79316 79134 gene locus_tag LOCUS_08650 79316 79134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 80177 79491 gene locus_tag LOCUS_08660 80177 79491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 80310 80645 gene locus_tag LOCUS_08670 80310 80645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 81042 80812 gene locus_tag LOCUS_08680 81042 80812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 81157 81085 gene locus_tag LOCUS_t00230 81157 81085 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 1141 137 gene locus_tag LOCUS_08690 1141 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1415 2284 gene locus_tag LOCUS_08700 1415 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2839 2402 gene locus_tag LOCUS_08710 gene dtd 2839 2402 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545012.1 protein_id gnl|my_center|LOCUS_08710 3876 2860 gene locus_tag LOCUS_08720 gene rlmN 3876 2860 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266908.1 protein_id gnl|my_center|LOCUS_08720 4529 3855 gene locus_tag LOCUS_08730 4529 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7068 4630 gene locus_tag LOCUS_08740 7068 4630 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_08740 8212 7205 gene locus_tag LOCUS_08750 8212 7205 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392663.1 protein_id gnl|my_center|LOCUS_08750 9245 8409 gene locus_tag LOCUS_08760 9245 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 10119 9238 gene locus_tag LOCUS_08770 10119 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 10546 10121 gene locus_tag LOCUS_08780 10546 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 11357 10716 gene locus_tag LOCUS_08790 11357 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 11503 13512 gene locus_tag LOCUS_08800 11503 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14353 13481 gene locus_tag LOCUS_08810 14353 13481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 14480 15088 gene locus_tag LOCUS_08820 14480 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 15091 16512 gene locus_tag LOCUS_08830 gene gcvPB 15091 16512 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468434.1 protein_id gnl|my_center|LOCUS_08830 16505 17668 gene locus_tag LOCUS_08840 16505 17668 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965722.1 protein_id gnl|my_center|LOCUS_08840 17712 18548 gene locus_tag LOCUS_08850 17712 18548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 18514 19401 gene locus_tag LOCUS_08860 gene miaA 18514 19401 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_08860 19462 22914 gene locus_tag LOCUS_08870 19462 22914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 23101 25713 gene locus_tag LOCUS_08880 gene clpB 23101 25713 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_08880 26009 27853 gene locus_tag LOCUS_08890 gene glmS 26009 27853 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142212.1 protein_id gnl|my_center|LOCUS_08890 27853 28011 gene locus_tag LOCUS_08900 27853 28011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 28131 29405 gene locus_tag LOCUS_08910 gene metK 28131 29405 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163127.1 protein_id gnl|my_center|LOCUS_08910 29478 30113 gene locus_tag LOCUS_08920 29478 30113 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022504.1 protein_id gnl|my_center|LOCUS_08920 31209 30106 gene locus_tag LOCUS_08930 31209 30106 CDS product YibE/F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965731.1 protein_id gnl|my_center|LOCUS_08930 32291 31224 gene locus_tag LOCUS_08940 gene ruvB 32291 31224 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058086.1 protein_id gnl|my_center|LOCUS_08940 32365 33534 gene locus_tag LOCUS_08950 gene dapL 32365 33534 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144094.1 protein_id gnl|my_center|LOCUS_08950 33595 37140 gene locus_tag LOCUS_08960 33595 37140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 37153 38595 gene locus_tag LOCUS_08970 37153 38595 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_08970 38627 39001 gene locus_tag LOCUS_08980 gene gloA 38627 39001 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017084654.1 protein_id gnl|my_center|LOCUS_08980 39004 39654 gene locus_tag LOCUS_08990 39004 39654 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_08990 39658 41409 gene locus_tag LOCUS_09000 39658 41409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 43181 41502 gene locus_tag LOCUS_09010 43181 41502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 45471 43249 gene locus_tag LOCUS_09020 45471 43249 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929091.1 protein_id gnl|my_center|LOCUS_09020 45558 45854 gene locus_tag LOCUS_09030 45558 45854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 46257 47558 gene locus_tag LOCUS_09040 46257 47558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 47703 48446 gene locus_tag LOCUS_09050 47703 48446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 48553 49911 gene locus_tag LOCUS_09060 48553 49911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 49922 50938 gene locus_tag LOCUS_09070 gene lpxK 49922 50938 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927066.1 protein_id gnl|my_center|LOCUS_09070 51149 51580 gene locus_tag LOCUS_09080 51149 51580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 52161 51577 gene locus_tag LOCUS_09090 52161 51577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 52384 52602 gene locus_tag LOCUS_09100 52384 52602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 52706 55375 gene locus_tag LOCUS_09110 52706 55375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 55437 56294 gene locus_tag LOCUS_09120 55437 56294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 56287 56919 gene locus_tag LOCUS_09130 gene lepB 56287 56919 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_09130 57338 56970 gene locus_tag LOCUS_09140 57338 56970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 57713 57928 gene locus_tag LOCUS_09150 gene infA 57713 57928 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118443.1 protein_id gnl|my_center|LOCUS_09150 58287 58652 gene locus_tag LOCUS_09160 gene rpsM 58287 58652 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_09160 58752 59138 gene locus_tag LOCUS_09170 gene rpsK 58752 59138 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545788.1 protein_id gnl|my_center|LOCUS_09170 59512 60114 gene locus_tag LOCUS_09180 gene rpsD 59512 60114 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 protein_id gnl|my_center|LOCUS_09180 60218 61213 gene locus_tag LOCUS_09190 60218 61213 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567511.1 protein_id gnl|my_center|LOCUS_09190 61259 61687 gene locus_tag LOCUS_09200 gene rplQ 61259 61687 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894521.1 protein_id gnl|my_center|LOCUS_09200 61690 62460 gene locus_tag LOCUS_09210 gene truA 61690 62460 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399657.1 protein_id gnl|my_center|LOCUS_09210 62485 62922 gene locus_tag LOCUS_09220 gene rplM 62485 62922 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_09220 62922 63317 gene locus_tag LOCUS_09230 gene rpsI 62922 63317 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901602.1 protein_id gnl|my_center|LOCUS_09230 64273 63419 gene locus_tag LOCUS_09240 64273 63419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 64537 64863 gene locus_tag LOCUS_09250 64537 64863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 65725 64883 gene locus_tag LOCUS_09260 gene folD 65725 64883 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475808.1 protein_id gnl|my_center|LOCUS_09260 66486 65734 gene locus_tag LOCUS_09270 66486 65734 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392713.1 protein_id gnl|my_center|LOCUS_09270 67567 66476 gene locus_tag LOCUS_09280 67567 66476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546406.1 protein_id gnl|my_center|LOCUS_09280 68106 67600 gene locus_tag LOCUS_09290 gene rplI 68106 67600 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_09290 68223 68690 gene locus_tag LOCUS_09300 68223 68690 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793479.1 protein_id gnl|my_center|LOCUS_09300 69179 68754 gene locus_tag LOCUS_09310 69179 68754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence08 1575 1105 gene locus_tag LOCUS_09320 1575 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3090 1588 gene locus_tag LOCUS_09330 3090 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3778 3083 gene locus_tag LOCUS_09340 3778 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4998 3964 gene locus_tag LOCUS_09350 4998 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 5138 6208 gene locus_tag LOCUS_09360 5138 6208 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385426.1 protein_id gnl|my_center|LOCUS_09360 6201 7064 gene locus_tag LOCUS_09370 6201 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7642 7124 gene locus_tag LOCUS_09380 7642 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 7820 8287 gene locus_tag LOCUS_09390 7820 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 9538 8291 gene locus_tag LOCUS_09400 9538 8291 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_09400 9639 10871 gene locus_tag LOCUS_09410 9639 10871 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393158.1 protein_id gnl|my_center|LOCUS_09410 11079 12140 gene locus_tag LOCUS_09420 11079 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 12137 12652 gene locus_tag LOCUS_09430 gene rimM 12137 12652 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_09430 12649 13359 gene locus_tag LOCUS_09440 gene trmD 12649 13359 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 protein_id gnl|my_center|LOCUS_09440 13441 13713 gene locus_tag LOCUS_09450 13441 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 15602 13710 gene locus_tag LOCUS_09460 gene mnmG 15602 13710 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056385.1 protein_id gnl|my_center|LOCUS_09460 15671 16810 gene locus_tag LOCUS_09470 gene proB 15671 16810 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_09470 16824 18074 gene locus_tag LOCUS_09480 16824 18074 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023992.1 protein_id gnl|my_center|LOCUS_09480 18084 18839 gene locus_tag LOCUS_09490 18084 18839 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140409.1 protein_id gnl|my_center|LOCUS_09490 19428 18904 gene locus_tag LOCUS_09500 19428 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 20580 19618 gene locus_tag LOCUS_09510 20580 19618 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_09510 21909 20671 gene locus_tag LOCUS_09520 gene glyA 21909 20671 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981400.1 protein_id gnl|my_center|LOCUS_09520 22057 23520 gene locus_tag LOCUS_09530 gene gatA 22057 23520 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141527.1 protein_id gnl|my_center|LOCUS_09530 24155 23568 gene locus_tag LOCUS_09540 24155 23568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 26108 24270 gene locus_tag LOCUS_09550 gene dnaK 26108 24270 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_09550 28509 26473 gene locus_tag LOCUS_09560 28509 26473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 31730 28905 gene locus_tag LOCUS_09570 31730 28905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 33085 31805 gene locus_tag LOCUS_09580 33085 31805 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721679.1 protein_id gnl|my_center|LOCUS_09580 34169 33156 gene locus_tag LOCUS_09590 34169 33156 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048184.1 protein_id gnl|my_center|LOCUS_09590 34959 34162 gene locus_tag LOCUS_09600 34959 34162 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_09600 35158 34970 gene locus_tag LOCUS_09610 35158 34970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 36017 35169 gene locus_tag LOCUS_09620 36017 35169 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_09620 37157 36108 gene locus_tag LOCUS_09630 37157 36108 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020716.1 protein_id gnl|my_center|LOCUS_09630 37284 39509 gene locus_tag LOCUS_09640 37284 39509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 52398 39637 gene locus_tag LOCUS_09650 52398 39637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 53811 52813 gene locus_tag LOCUS_09660 53811 52813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 53903 55294 gene locus_tag LOCUS_09670 53903 55294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 55403 57058 gene locus_tag LOCUS_09680 55403 57058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 59910 58582 gene locus_tag LOCUS_09690 gene trmFO 59910 58582 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001991958.1 protein_id gnl|my_center|LOCUS_09690 60907 60011 gene locus_tag LOCUS_09700 60907 60011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 62261 60891 gene locus_tag LOCUS_09710 gene gltA 62261 60891 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_09710 62389 64755 gene locus_tag LOCUS_09720 62389 64755 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965637.1 protein_id gnl|my_center|LOCUS_09720 65078 64752 gene locus_tag LOCUS_09730 65078 64752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 65256 66230 gene locus_tag LOCUS_09740 65256 66230 CDS product ATP-grasp fold amidoligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038419670.1 protein_id gnl|my_center|LOCUS_09740 66275 67438 gene locus_tag LOCUS_09750 66275 67438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 69910 68894 gene locus_tag LOCUS_09760 69910 68894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence09 1604 993 gene locus_tag LOCUS_09770 1604 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1848 2651 gene locus_tag LOCUS_09780 1848 2651 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975629.1 protein_id gnl|my_center|LOCUS_09780 2661 2924 gene locus_tag LOCUS_09790 2661 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2936 4279 gene locus_tag LOCUS_09800 gene trkA 2936 4279 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021494.1 protein_id gnl|my_center|LOCUS_09800 4276 5745 gene locus_tag LOCUS_09810 4276 5745 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021495.1 protein_id gnl|my_center|LOCUS_09810 5934 7328 gene locus_tag LOCUS_09820 5934 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 7325 8482 gene locus_tag LOCUS_09830 7325 8482 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_09830 8499 9203 gene locus_tag LOCUS_09840 8499 9203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_09840 9217 10446 gene locus_tag LOCUS_09850 9217 10446 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_09850 10532 10744 gene locus_tag LOCUS_09860 10532 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 11586 10741 gene locus_tag LOCUS_09870 gene aroE 11586 10741 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812076.1 protein_id gnl|my_center|LOCUS_09870 13918 11579 gene locus_tag LOCUS_09880 gene topA 13918 11579 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143190.1 protein_id gnl|my_center|LOCUS_09880 15041 13953 gene locus_tag LOCUS_09890 gene dprA 15041 13953 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_09890 15810 15028 gene locus_tag LOCUS_09900 15810 15028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 16801 15827 gene locus_tag LOCUS_09910 16801 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 17400 16798 gene locus_tag LOCUS_09920 17400 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 17529 18422 gene locus_tag LOCUS_09930 gene dapA 17529 18422 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460382.1 protein_id gnl|my_center|LOCUS_09930 18495 19799 gene locus_tag LOCUS_09940 gene secD 18495 19799 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144152.1 protein_id gnl|my_center|LOCUS_09940 19835 20821 gene locus_tag LOCUS_09950 gene secF 19835 20821 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144153.1 protein_id gnl|my_center|LOCUS_09950 21952 20909 gene locus_tag LOCUS_09960 21952 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 22328 21954 gene locus_tag LOCUS_09970 22328 21954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 22675 22331 gene locus_tag LOCUS_09980 22675 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 24007 22859 gene locus_tag LOCUS_09990 24007 22859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 24067 24366 gene locus_tag LOCUS_10000 24067 24366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 24429 24773 gene locus_tag LOCUS_10010 24429 24773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 24784 27309 gene locus_tag LOCUS_10020 24784 27309 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545608.1 protein_id gnl|my_center|LOCUS_10020 27328 29187 gene locus_tag LOCUS_10030 27328 29187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 29174 29506 gene locus_tag LOCUS_10040 29174 29506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 29532 29765 gene locus_tag LOCUS_10050 29532 29765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 30439 29762 gene locus_tag LOCUS_10060 30439 29762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 31466 30507 gene locus_tag LOCUS_10070 31466 30507 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_10070 34644 31597 gene locus_tag LOCUS_10080 34644 31597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 35371 34727 gene locus_tag LOCUS_10090 35371 34727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 38265 35368 gene locus_tag LOCUS_10100 38265 35368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 38800 38366 gene locus_tag LOCUS_10110 38800 38366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 40774 38870 gene locus_tag LOCUS_10120 40774 38870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 41916 40954 gene locus_tag LOCUS_10130 41916 40954 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_10130 42197 43756 gene locus_tag LOCUS_10140 42197 43756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 44563 43811 gene locus_tag LOCUS_10150 44563 43811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 44775 45743 gene locus_tag LOCUS_10160 gene prfB 44775 45743 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152557459.1 protein_id gnl|my_center|LOCUS_10160 45822 46799 gene locus_tag LOCUS_10170 45822 46799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 47414 46776 gene locus_tag LOCUS_10180 47414 46776 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920655.1 protein_id gnl|my_center|LOCUS_10180 47484 48410 gene locus_tag LOCUS_10190 47484 48410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 48414 48665 gene locus_tag LOCUS_10200 48414 48665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 48643 49344 gene locus_tag LOCUS_10210 gene rph 48643 49344 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545252.1 protein_id gnl|my_center|LOCUS_10210 49380 49748 gene locus_tag LOCUS_10220 49380 49748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 49741 50277 gene locus_tag LOCUS_10230 49741 50277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 51205 50618 gene locus_tag LOCUS_10240 51205 50618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 52016 51456 gene locus_tag LOCUS_10250 52016 51456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 52156 53793 gene locus_tag LOCUS_10260 gene ilvB 52156 53793 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816359.1 protein_id gnl|my_center|LOCUS_10260 54401 53811 gene locus_tag LOCUS_10270 54401 53811 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_10270 55109 54447 gene locus_tag LOCUS_10280 55109 54447 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880770.1 protein_id gnl|my_center|LOCUS_10280 56209 55109 gene locus_tag LOCUS_10290 gene flhB 56209 55109 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_10290 56907 56254 gene locus_tag LOCUS_10300 gene deoC 56907 56254 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028213.1 protein_id gnl|my_center|LOCUS_10300 57787 56924 gene locus_tag LOCUS_10310 gene metF 57787 56924 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_10310 60133 57860 gene locus_tag LOCUS_10320 60133 57860 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166989.1 protein_id gnl|my_center|LOCUS_10320 60244 60897 gene locus_tag LOCUS_10330 60244 60897 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776485.1 protein_id gnl|my_center|LOCUS_10330 60913 61620 gene locus_tag LOCUS_10340 60913 61620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 61844 62398 gene locus_tag LOCUS_10350 61844 62398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 62432 64951 gene locus_tag LOCUS_10360 62432 64951 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_10360 65062 65766 gene locus_tag LOCUS_10370 65062 65766 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780363.1 protein_id gnl|my_center|LOCUS_10370 65866 66870 gene locus_tag LOCUS_10380 65866 66870 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_10380 67209 68699 gene locus_tag LOCUS_10390 67209 68699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence10 2086 395 gene locus_tag LOCUS_10400 gene glgP 2086 395 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_10400 3507 2269 gene locus_tag LOCUS_10410 3507 2269 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_10410 5592 3709 gene locus_tag LOCUS_10420 5592 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5774 6448 gene locus_tag LOCUS_10430 5774 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 6509 7648 gene locus_tag LOCUS_10440 6509 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 9468 7684 gene locus_tag LOCUS_10450 9468 7684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 10289 9465 gene locus_tag LOCUS_10460 10289 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 11370 10597 gene locus_tag LOCUS_10470 11370 10597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 11511 11906 gene locus_tag LOCUS_10480 11511 11906 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_10480 11899 12408 gene locus_tag LOCUS_10490 11899 12408 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_10490 12536 14146 gene locus_tag LOCUS_10500 12536 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 14139 14804 gene locus_tag LOCUS_10510 14139 14804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_10510 14818 16362 gene locus_tag LOCUS_10520 14818 16362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 16597 16292 gene locus_tag LOCUS_10530 16597 16292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 17026 16685 gene locus_tag LOCUS_10540 17026 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 17206 17490 gene locus_tag LOCUS_10550 17206 17490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 17594 18247 gene locus_tag LOCUS_10560 17594 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 18458 19240 gene locus_tag LOCUS_10570 18458 19240 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_10570 20422 19319 gene locus_tag LOCUS_10580 gene wecB 20422 19319 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203393.1 protein_id gnl|my_center|LOCUS_10580 20550 20783 gene locus_tag LOCUS_10590 20550 20783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 20791 22392 gene locus_tag LOCUS_10600 gene hcp 20791 22392 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545464.1 protein_id gnl|my_center|LOCUS_10600 22924 22454 gene locus_tag LOCUS_10610 gene rpsG 22924 22454 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_10610 23310 22924 gene locus_tag LOCUS_10620 gene rpsL 23310 22924 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125816.1 protein_id gnl|my_center|LOCUS_10620 24552 23548 gene locus_tag LOCUS_10630 24552 23548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 25121 24627 gene locus_tag LOCUS_10640 25121 24627 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_10640 25197 25820 gene locus_tag LOCUS_10650 25197 25820 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475891.1 protein_id gnl|my_center|LOCUS_10650 27433 25817 gene locus_tag LOCUS_10660 27433 25817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 29014 27467 gene locus_tag LOCUS_10670 29014 27467 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126017.1 protein_id gnl|my_center|LOCUS_10670 30047 29019 gene locus_tag LOCUS_10680 30047 29019 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130134.1 protein_id gnl|my_center|LOCUS_10680 30247 30831 gene locus_tag LOCUS_10690 30247 30831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 31955 30984 gene locus_tag LOCUS_10700 gene dusB 31955 30984 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056835.1 protein_id gnl|my_center|LOCUS_10700 34056 31945 gene locus_tag LOCUS_10710 34056 31945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 34386 34228 gene locus_tag LOCUS_10720 34386 34228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 34685 35182 gene locus_tag LOCUS_10730 gene infC 34685 35182 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125947.1 protein_id gnl|my_center|LOCUS_10730 35464 35538 gene locus_tag LOCUS_t00240 35464 35538 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 36636 36019 gene locus_tag LOCUS_10740 gene ruvA 36636 36019 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426582.1 protein_id gnl|my_center|LOCUS_10740 38034 36640 gene locus_tag LOCUS_10750 gene dnaA 38034 36640 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_10750 38794 38042 gene locus_tag LOCUS_10760 38794 38042 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548298.1 protein_id gnl|my_center|LOCUS_10760 40401 38794 gene locus_tag LOCUS_10770 40401 38794 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951270.1 protein_id gnl|my_center|LOCUS_10770 40690 40409 gene locus_tag LOCUS_10780 40690 40409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 41092 41164 gene locus_tag LOCUS_t00250 41092 41164 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 41206 42057 gene locus_tag LOCUS_10790 41206 42057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 42057 42527 gene locus_tag LOCUS_10800 gene rlmH 42057 42527 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704775.1 protein_id gnl|my_center|LOCUS_10800 42584 44467 gene locus_tag LOCUS_10810 42584 44467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 44467 44988 gene locus_tag LOCUS_10820 44467 44988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 45756 45061 gene locus_tag LOCUS_10830 45756 45061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 46602 45871 gene locus_tag LOCUS_10840 46602 45871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 47535 46621 gene locus_tag LOCUS_10850 47535 46621 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141225.1 protein_id gnl|my_center|LOCUS_10850 48272 47610 gene locus_tag LOCUS_10860 48272 47610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 48430 49188 gene locus_tag LOCUS_10870 48430 49188 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143994.1 protein_id gnl|my_center|LOCUS_10870 49337 50914 gene locus_tag LOCUS_10880 49337 50914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 52232 51081 gene locus_tag LOCUS_10890 52232 51081 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_10890 53357 52239 gene locus_tag LOCUS_10900 gene murG 53357 52239 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232184.1 protein_id gnl|my_center|LOCUS_10900 54534 53350 gene locus_tag LOCUS_10910 gene spoVE 54534 53350 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_10910 55864 54512 gene locus_tag LOCUS_10920 gene murD 55864 54512 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860115.1 protein_id gnl|my_center|LOCUS_10920 56846 55866 gene locus_tag LOCUS_10930 gene mraY 56846 55866 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232192.1 protein_id gnl|my_center|LOCUS_10930 58171 56843 gene locus_tag LOCUS_10940 58171 56843 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949036.1 protein_id gnl|my_center|LOCUS_10940 58357 58707 gene locus_tag LOCUS_10950 gene rplU 58357 58707 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140827.1 protein_id gnl|my_center|LOCUS_10950 58746 59000 gene locus_tag LOCUS_10960 gene rpmA 58746 59000 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095207.1 protein_id gnl|my_center|LOCUS_10960 59161 59316 gene locus_tag LOCUS_10970 59161 59316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 59479 60345 gene locus_tag LOCUS_10980 gene accD 59479 60345 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_10980 60356 61306 gene locus_tag LOCUS_10990 60356 61306 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228903.1 protein_id gnl|my_center|LOCUS_10990 61312 62241 gene locus_tag LOCUS_11000 gene prmA 61312 62241 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861555.1 protein_id gnl|my_center|LOCUS_11000 62238 62663 gene locus_tag LOCUS_11010 62238 62663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 62656 63390 gene locus_tag LOCUS_11020 gene kdsB 62656 63390 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_11020 63722 64474 gene locus_tag LOCUS_11030 63722 64474 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_11030 64736 64811 gene locus_tag LOCUS_t00260 64736 64811 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 66733 65219 gene locus_tag LOCUS_11040 66733 65219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 67383 67069 gene locus_tag LOCUS_11050 67383 67069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 67702 67385 gene locus_tag LOCUS_11060 67702 67385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence11 133 60 gene locus_tag LOCUS_t00270 133 60 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1045 299 gene locus_tag LOCUS_11070 1045 299 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167121746.1 protein_id gnl|my_center|LOCUS_11070 2857 1310 gene locus_tag LOCUS_11080 2857 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3805 3065 gene locus_tag LOCUS_11090 3805 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 4271 4059 gene locus_tag LOCUS_11100 4271 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11100 4604 4308 gene locus_tag LOCUS_11110 4604 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11110 5620 4676 gene locus_tag LOCUS_11120 gene trxB 5620 4676 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_11120 6174 5635 gene locus_tag LOCUS_11130 6174 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 7602 6214 gene locus_tag LOCUS_11140 7602 6214 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_11140 9278 7722 gene locus_tag LOCUS_11150 9278 7722 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932603.1 protein_id gnl|my_center|LOCUS_11150 10872 9280 gene locus_tag LOCUS_11160 10872 9280 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197175.1 protein_id gnl|my_center|LOCUS_11160 11761 10889 gene locus_tag LOCUS_11170 gene glyQ 11761 10889 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460838.1 protein_id gnl|my_center|LOCUS_11170 12301 11981 gene locus_tag LOCUS_11180 12301 11981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 14420 12429 gene locus_tag LOCUS_11190 gene glyS 14420 12429 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_11190 14578 15330 gene locus_tag LOCUS_11200 14578 15330 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_11200 15330 16694 gene locus_tag LOCUS_11210 15330 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 16687 17163 gene locus_tag LOCUS_11220 gene tsaE 16687 17163 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_11220 17153 17776 gene locus_tag LOCUS_11230 gene tsaB 17153 17776 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832485.1 protein_id gnl|my_center|LOCUS_11230 18702 17836 gene locus_tag LOCUS_11240 18702 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 19261 18707 gene locus_tag LOCUS_11250 19261 18707 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251187.1 protein_id gnl|my_center|LOCUS_11250 19935 19267 gene locus_tag LOCUS_11260 gene queC 19935 19267 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_11260 20908 19928 gene locus_tag LOCUS_11270 20908 19928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 22593 21169 gene locus_tag LOCUS_11280 22593 21169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 23029 27498 gene locus_tag LOCUS_11290 23029 27498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 27841 27491 gene locus_tag LOCUS_11300 27841 27491 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583880.1 protein_id gnl|my_center|LOCUS_11300 28746 27838 gene locus_tag LOCUS_11310 gene queF 28746 27838 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100411.1 protein_id gnl|my_center|LOCUS_11310 30061 28739 gene locus_tag LOCUS_11320 30061 28739 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_11320 30593 30180 gene locus_tag LOCUS_11330 30593 30180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 30938 31013 gene locus_tag LOCUS_t00280 30938 31013 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 31730 31134 gene locus_tag LOCUS_11340 31730 31134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 31885 32262 gene locus_tag LOCUS_11350 31885 32262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 32265 33656 gene locus_tag LOCUS_11360 32265 33656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 37702 34511 gene locus_tag LOCUS_11370 37702 34511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 38047 37883 gene locus_tag LOCUS_11380 38047 37883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 38929 38348 gene locus_tag LOCUS_11390 38929 38348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 39070 39903 gene locus_tag LOCUS_11400 39070 39903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 39907 40377 gene locus_tag LOCUS_11410 39907 40377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 41732 40374 gene locus_tag LOCUS_11420 41732 40374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 42031 41858 gene locus_tag LOCUS_11430 42031 41858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 42251 42418 gene locus_tag LOCUS_11440 42251 42418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 42444 44231 gene locus_tag LOCUS_11450 42444 44231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 44358 44834 gene locus_tag LOCUS_11460 44358 44834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 44855 45526 gene locus_tag LOCUS_11470 44855 45526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 45869 45555 gene locus_tag LOCUS_11480 45869 45555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 46369 46082 gene locus_tag LOCUS_11490 46369 46082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 46788 46369 gene locus_tag LOCUS_11500 46788 46369 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693848.1 protein_id gnl|my_center|LOCUS_11500 47054 47920 gene locus_tag LOCUS_11510 47054 47920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 49649 47988 gene locus_tag LOCUS_11520 49649 47988 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674608.1 protein_id gnl|my_center|LOCUS_11520 50258 49782 gene locus_tag LOCUS_11530 50258 49782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 50406 51614 gene locus_tag LOCUS_11540 50406 51614 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003544617.1 protein_id gnl|my_center|LOCUS_11540 52054 51695 gene locus_tag LOCUS_11550 52054 51695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 52152 53909 gene locus_tag LOCUS_11560 52152 53909 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_11560 54878 53931 gene locus_tag LOCUS_11570 54878 53931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 54970 55641 gene locus_tag LOCUS_11580 54970 55641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 55878 55663 gene locus_tag LOCUS_11590 55878 55663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 56664 56344 gene locus_tag LOCUS_11600 56664 56344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence12 264 177 gene locus_tag LOCUS_t00290 264 177 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 493 1212 gene locus_tag LOCUS_11610 493 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 9462 1213 gene locus_tag LOCUS_11620 9462 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 11107 9692 gene locus_tag LOCUS_11630 11107 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 12481 13851 gene locus_tag LOCUS_11640 12481 13851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 13865 14218 gene locus_tag LOCUS_11650 13865 14218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 14238 14660 gene locus_tag LOCUS_11660 14238 14660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 15681 14647 gene locus_tag LOCUS_11670 15681 14647 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837191.1 protein_id gnl|my_center|LOCUS_11670 17335 15683 gene locus_tag LOCUS_11680 17335 15683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 18305 17409 gene locus_tag LOCUS_11690 18305 17409 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693993.1 protein_id gnl|my_center|LOCUS_11690 19784 18387 gene locus_tag LOCUS_11700 19784 18387 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494970.1 protein_id gnl|my_center|LOCUS_11700 20472 19777 gene locus_tag LOCUS_11710 20472 19777 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434299.1 protein_id gnl|my_center|LOCUS_11710 20740 20537 gene locus_tag LOCUS_11720 20740 20537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 20861 22177 gene locus_tag LOCUS_11730 20861 22177 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869229.1 protein_id gnl|my_center|LOCUS_11730 22947 22174 gene locus_tag LOCUS_11740 22947 22174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 23103 24209 gene locus_tag LOCUS_11750 gene gcvT 23103 24209 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_11750 24228 24611 gene locus_tag LOCUS_11760 gene gcvH 24228 24611 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_11760 24611 25861 gene locus_tag LOCUS_11770 gene gcvPA 24611 25861 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990102.1 protein_id gnl|my_center|LOCUS_11770 26241 26588 gene locus_tag LOCUS_11780 26241 26588 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096609.1 protein_id gnl|my_center|LOCUS_11780 26699 28201 gene locus_tag LOCUS_11790 26699 28201 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_11790 28161 28805 gene locus_tag LOCUS_11800 28161 28805 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142403.1 protein_id gnl|my_center|LOCUS_11800 30032 28977 gene locus_tag LOCUS_11810 30032 28977 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143107.1 protein_id gnl|my_center|LOCUS_11810 30535 30167 gene locus_tag LOCUS_11820 gene rplR 30535 30167 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904133.1 protein_id gnl|my_center|LOCUS_11820 30917 30594 gene locus_tag LOCUS_11830 30917 30594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 31479 30940 gene locus_tag LOCUS_11840 gene rplF 31479 30940 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810135.1 protein_id gnl|my_center|LOCUS_11840 32934 31726 gene locus_tag LOCUS_11850 gene tuf 32934 31726 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057587.1 protein_id gnl|my_center|LOCUS_11850 34384 33149 gene locus_tag LOCUS_11860 gene nusA 34384 33149 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460395.1 protein_id gnl|my_center|LOCUS_11860 34814 34458 gene locus_tag LOCUS_11870 34814 34458 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_11870 35367 34885 gene locus_tag LOCUS_11880 35367 34885 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_11880 37285 35513 gene locus_tag LOCUS_11890 37285 35513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 37877 38410 gene locus_tag LOCUS_11900 gene cobO 37877 38410 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_11900 38639 39133 gene locus_tag LOCUS_11910 gene nuoE 38639 39133 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_11910 39135 40997 gene locus_tag LOCUS_11920 gene nuoF 39135 40997 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393387.1 protein_id gnl|my_center|LOCUS_11920 41031 42782 gene locus_tag LOCUS_11930 41031 42782 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_11930 43408 42926 gene locus_tag LOCUS_11940 43408 42926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 43676 45640 gene locus_tag LOCUS_11950 43676 45640 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941814.1 protein_id gnl|my_center|LOCUS_11950 45718 46407 gene locus_tag LOCUS_11960 gene bioD 45718 46407 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986727.1 protein_id gnl|my_center|LOCUS_11960 46410 47750 gene locus_tag LOCUS_11970 gene bioA 46410 47750 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_11970 48061 50961 gene locus_tag LOCUS_11980 48061 50961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 51056 52336 gene locus_tag LOCUS_11990 51056 52336 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456066.1 protein_id gnl|my_center|LOCUS_11990 52660 52457 gene locus_tag LOCUS_12000 52660 52457 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_12000 52734 52892 gene locus_tag LOCUS_12010 52734 52892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 53248 53018 gene locus_tag LOCUS_12020 53248 53018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 53545 53339 gene locus_tag LOCUS_12030 53545 53339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 53715 56189 gene locus_tag LOCUS_12040 53715 56189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 56788 56273 gene locus_tag LOCUS_12050 56788 56273 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_12050 56937 57026 gene locus_tag LOCUS_t00300 56937 57026 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 58388 57291 gene locus_tag LOCUS_12060 gene ychF 58388 57291 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_12060 59616 58477 gene locus_tag LOCUS_12070 59616 58477 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001088659.1 protein_id gnl|my_center|LOCUS_12070 60100 59594 gene locus_tag LOCUS_12080 gene folK 60100 59594 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002984757.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence13 254 1570 gene locus_tag LOCUS_12090 254 1570 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243401.1 protein_id gnl|my_center|LOCUS_12090 2505 1681 gene locus_tag LOCUS_12100 2505 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 5330 2604 gene locus_tag LOCUS_12110 5330 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 5613 5383 gene locus_tag LOCUS_12120 5613 5383 CDS product transcriptional coactivator p15/PC4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538231.1 protein_id gnl|my_center|LOCUS_12120 5702 6991 gene locus_tag LOCUS_12130 gene purB 5702 6991 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057666.1 protein_id gnl|my_center|LOCUS_12130 7054 7302 gene locus_tag LOCUS_12140 7054 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 7329 9050 gene locus_tag LOCUS_12150 7329 9050 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_12150 9057 10220 gene locus_tag LOCUS_12160 9057 10220 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081668.1 protein_id gnl|my_center|LOCUS_12160 10247 10507 gene locus_tag LOCUS_12170 10247 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 10543 12009 gene locus_tag LOCUS_12180 10543 12009 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678778.1 protein_id gnl|my_center|LOCUS_12180 12637 12092 gene locus_tag LOCUS_12190 12637 12092 CDS product isochorismatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946639.1 protein_id gnl|my_center|LOCUS_12190 13891 12650 gene locus_tag LOCUS_12200 13891 12650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 14806 13898 gene locus_tag LOCUS_12210 14806 13898 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140650.1 protein_id gnl|my_center|LOCUS_12210 15476 14799 gene locus_tag LOCUS_12220 gene ftsE 15476 14799 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361935.1 protein_id gnl|my_center|LOCUS_12220 16460 15492 gene locus_tag LOCUS_12230 16460 15492 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_12230 16755 17942 gene locus_tag LOCUS_12240 16755 17942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 18099 19880 gene locus_tag LOCUS_12250 gene aspS 18099 19880 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454140.1 protein_id gnl|my_center|LOCUS_12250 19944 20834 gene locus_tag LOCUS_12260 19944 20834 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965112.1 protein_id gnl|my_center|LOCUS_12260 21321 20845 gene locus_tag LOCUS_12270 gene ispF 21321 20845 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425513.1 protein_id gnl|my_center|LOCUS_12270 21953 21333 gene locus_tag LOCUS_12280 21953 21333 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583168.1 protein_id gnl|my_center|LOCUS_12280 22375 22211 gene locus_tag LOCUS_12290 22375 22211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 22545 24860 gene locus_tag LOCUS_12300 22545 24860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 24916 25506 gene locus_tag LOCUS_12310 gene nadD 24916 25506 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_12310 25487 26080 gene locus_tag LOCUS_12320 gene yqeK 25487 26080 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964575.1 protein_id gnl|my_center|LOCUS_12320 26158 28854 gene locus_tag LOCUS_12330 26158 28854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 29352 28993 gene locus_tag LOCUS_12340 gene aroH 29352 28993 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460212.1 protein_id gnl|my_center|LOCUS_12340 30290 29364 gene locus_tag LOCUS_12350 gene fmt 30290 29364 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965030.1 protein_id gnl|my_center|LOCUS_12350 30846 30277 gene locus_tag LOCUS_12360 gene def 30846 30277 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965029.1 protein_id gnl|my_center|LOCUS_12360 30937 31107 gene locus_tag LOCUS_12370 30937 31107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 31780 31094 gene locus_tag LOCUS_12380 31780 31094 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942366.1 protein_id gnl|my_center|LOCUS_12380 32945 31773 gene locus_tag LOCUS_12390 32945 31773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 34239 32980 gene locus_tag LOCUS_12400 gene purD 34239 32980 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583768.1 protein_id gnl|my_center|LOCUS_12400 34372 34617 gene locus_tag LOCUS_12410 34372 34617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 34798 35610 gene locus_tag LOCUS_12420 gene rfbF 34798 35610 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257101.1 protein_id gnl|my_center|LOCUS_12420 35610 36527 gene locus_tag LOCUS_12430 35610 36527 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_12430 36520 37608 gene locus_tag LOCUS_12440 gene rfbG 36520 37608 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202465.1 protein_id gnl|my_center|LOCUS_12440 37596 38855 gene locus_tag LOCUS_12450 37596 38855 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208594.1 protein_id gnl|my_center|LOCUS_12450 38886 39782 gene locus_tag LOCUS_12460 38886 39782 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987005.1 protein_id gnl|my_center|LOCUS_12460 39742 40863 gene locus_tag LOCUS_12470 39742 40863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 40897 41787 gene locus_tag LOCUS_12480 40897 41787 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023669.1 protein_id gnl|my_center|LOCUS_12480 41788 42462 gene locus_tag LOCUS_12490 41788 42462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12490 42452 42925 gene locus_tag LOCUS_12500 42452 42925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12500 42927 44708 gene locus_tag LOCUS_12510 gene msbA 42927 44708 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_12510 44885 46555 gene locus_tag LOCUS_12520 44885 46555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 46571 47677 gene locus_tag LOCUS_12530 46571 47677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 47981 48532 gene locus_tag LOCUS_12540 47981 48532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 49537 48533 gene locus_tag LOCUS_12550 49537 48533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 49666 50940 gene locus_tag LOCUS_12560 gene creD 49666 50940 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_12560 50964 51296 gene locus_tag LOCUS_12570 50964 51296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 51425 54883 gene locus_tag LOCUS_12580 51425 54883 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_12580 55044 55772 gene locus_tag LOCUS_12590 55044 55772 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_12590 55769 56614 gene locus_tag LOCUS_12600 55769 56614 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence14 6188 3609 gene locus_tag LOCUS_12610 6188 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 14374 6374 gene locus_tag LOCUS_12620 14374 6374 CDS product EntS/YbdA MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111741559.1 protein_id gnl|my_center|LOCUS_12620 15934 14486 gene locus_tag LOCUS_12630 15934 14486 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023666.1 protein_id gnl|my_center|LOCUS_12630 17678 16368 gene locus_tag LOCUS_12640 gene rimO 17678 16368 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_12640 18952 17741 gene locus_tag LOCUS_12650 18952 17741 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_12650 19767 18952 gene locus_tag LOCUS_12660 19767 18952 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920701.1 protein_id gnl|my_center|LOCUS_12660 21024 19786 gene locus_tag LOCUS_12670 21024 19786 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583240.1 protein_id gnl|my_center|LOCUS_12670 23054 21042 gene locus_tag LOCUS_12680 gene pilB 23054 21042 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_12680 24911 23064 gene locus_tag LOCUS_12690 24911 23064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 25561 24941 gene locus_tag LOCUS_12700 25561 24941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 26703 25831 gene locus_tag LOCUS_12710 26703 25831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 27520 26783 gene locus_tag LOCUS_12720 gene bioC 27520 26783 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931743.1 protein_id gnl|my_center|LOCUS_12720 28170 27511 gene locus_tag LOCUS_12730 28170 27511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12730 29267 28128 gene locus_tag LOCUS_12740 gene bioF 29267 28128 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693580.1 protein_id gnl|my_center|LOCUS_12740 30184 29312 gene locus_tag LOCUS_12750 30184 29312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 30423 31055 gene locus_tag LOCUS_12760 30423 31055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 31200 31970 gene locus_tag LOCUS_12770 31200 31970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 32176 32448 gene locus_tag LOCUS_12780 32176 32448 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043904.1 protein_id gnl|my_center|LOCUS_12780 32931 32488 gene locus_tag LOCUS_12790 gene rsmD 32931 32488 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460510.1 protein_id gnl|my_center|LOCUS_12790 33086 34393 gene locus_tag LOCUS_12800 33086 34393 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811677.1 protein_id gnl|my_center|LOCUS_12800 34390 34665 gene locus_tag LOCUS_12810 34390 34665 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811676.1 protein_id gnl|my_center|LOCUS_12810 34690 35070 gene locus_tag LOCUS_12820 34690 35070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 35703 35260 gene locus_tag LOCUS_12830 35703 35260 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_12830 35794 37890 gene locus_tag LOCUS_12840 35794 37890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 37883 38734 gene locus_tag LOCUS_12850 37883 38734 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426509.1 protein_id gnl|my_center|LOCUS_12850 39662 38715 gene locus_tag LOCUS_12860 39662 38715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 39826 40479 gene locus_tag LOCUS_12870 39826 40479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 41362 40784 gene locus_tag LOCUS_12880 gene yihA 41362 40784 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422605.1 protein_id gnl|my_center|LOCUS_12880 41616 41359 gene locus_tag LOCUS_12890 41616 41359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 43421 41619 gene locus_tag LOCUS_12900 43421 41619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 43504 44418 gene locus_tag LOCUS_12910 gene xerD 43504 44418 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393010.1 protein_id gnl|my_center|LOCUS_12910 45016 45837 gene locus_tag LOCUS_12920 45016 45837 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432043.1 protein_id gnl|my_center|LOCUS_12920 47046 45907 gene locus_tag LOCUS_12930 47046 45907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 47137 49026 gene locus_tag LOCUS_12940 gene dnaG 47137 49026 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_12940 49019 50119 gene locus_tag LOCUS_12950 gene rpoD 49019 50119 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816337.1 protein_id gnl|my_center|LOCUS_12950 50435 51121 gene locus_tag LOCUS_12960 50435 51121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 52635 51151 gene locus_tag LOCUS_12970 52635 51151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 53308 52778 gene locus_tag LOCUS_12980 53308 52778 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_12980 53967 53521 gene locus_tag LOCUS_12990 53967 53521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence15 453 878 gene locus_tag LOCUS_13000 453 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1180 3825 gene locus_tag LOCUS_13010 gene alaS 1180 3825 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393146.1 protein_id gnl|my_center|LOCUS_13010 5228 4197 gene locus_tag LOCUS_13020 5228 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6370 5246 gene locus_tag LOCUS_13030 6370 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7742 6462 gene locus_tag LOCUS_13040 7742 6462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8174 7926 gene locus_tag LOCUS_13050 8174 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8492 9646 gene locus_tag LOCUS_13060 8492 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9727 10131 gene locus_tag LOCUS_13070 9727 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 11025 10309 gene locus_tag LOCUS_13080 11025 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 11125 11521 gene locus_tag LOCUS_tm00010 11125 11521 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 13501 11951 gene locus_tag LOCUS_13090 13501 11951 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942126.1 protein_id gnl|my_center|LOCUS_13090 13586 14644 gene locus_tag LOCUS_13100 13586 14644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 16171 14645 gene locus_tag LOCUS_13110 16171 14645 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_13110 19323 16168 gene locus_tag LOCUS_13120 19323 16168 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263726.1 protein_id gnl|my_center|LOCUS_13120 20604 19450 gene locus_tag LOCUS_13130 20604 19450 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263944.1 protein_id gnl|my_center|LOCUS_13130 20758 21744 gene locus_tag LOCUS_13140 20758 21744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 21841 23727 gene locus_tag LOCUS_13150 21841 23727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 23982 23719 gene locus_tag LOCUS_13160 23982 23719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 24111 24875 gene locus_tag LOCUS_13170 24111 24875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 24951 27644 gene locus_tag LOCUS_13180 24951 27644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 28141 27689 gene locus_tag LOCUS_13190 gene fabZ 28141 27689 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221796.1 protein_id gnl|my_center|LOCUS_13190 28972 28151 gene locus_tag LOCUS_13200 gene lpxC 28972 28151 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883290.1 protein_id gnl|my_center|LOCUS_13200 30060 28972 gene locus_tag LOCUS_13210 gene lpxD 30060 28972 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387804.1 protein_id gnl|my_center|LOCUS_13210 30558 30085 gene locus_tag LOCUS_13220 30558 30085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 31710 30640 gene locus_tag LOCUS_13230 31710 30640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 32524 31730 gene locus_tag LOCUS_13240 gene zupT 32524 31730 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851840.1 protein_id gnl|my_center|LOCUS_13240 32705 35134 gene locus_tag LOCUS_13250 32705 35134 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990137.1 protein_id gnl|my_center|LOCUS_13250 35840 35085 gene locus_tag LOCUS_13260 gene pyrF 35840 35085 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156274057.1 protein_id gnl|my_center|LOCUS_13260 36761 40954 gene locus_tag LOCUS_13270 36761 40954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 41474 41301 gene locus_tag LOCUS_13280 41474 41301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 41760 42575 gene locus_tag LOCUS_13290 gene lpxA 41760 42575 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_13290 42568 43674 gene locus_tag LOCUS_13300 42568 43674 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_13300 43889 44233 gene locus_tag LOCUS_13310 43889 44233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 44328 44519 gene locus_tag LOCUS_13320 44328 44519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 46278 44596 gene locus_tag LOCUS_13330 46278 44596 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_13330 46903 47499 gene locus_tag LOCUS_13340 46903 47499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 47496 48077 gene locus_tag LOCUS_13350 47496 48077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 48131 49159 gene locus_tag LOCUS_13360 48131 49159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 50302 50505 gene locus_tag LOCUS_13370 50302 50505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 50575 50958 gene locus_tag LOCUS_13380 50575 50958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 50972 51757 gene locus_tag LOCUS_13390 50972 51757 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_13390 51778 52884 gene locus_tag LOCUS_13400 51778 52884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 52888 54300 gene locus_tag LOCUS_13410 52888 54300 CDS product peptidoglycan O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000881300.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence16 2268 469 gene locus_tag LOCUS_13420 gene typA 2268 469 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_13420 2448 2966 gene locus_tag LOCUS_13430 2448 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3747 2953 gene locus_tag LOCUS_13440 gene folE2 3747 2953 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_13440 3927 4763 gene locus_tag LOCUS_13450 gene nifU 3927 4763 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_13450 4765 5976 gene locus_tag LOCUS_13460 gene nifS 4765 5976 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_13460 6113 7039 gene locus_tag LOCUS_13470 6113 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 7424 7056 gene locus_tag LOCUS_13480 7424 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 7944 7411 gene locus_tag LOCUS_13490 gene ybeY 7944 7411 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016624.1 protein_id gnl|my_center|LOCUS_13490 10030 7913 gene locus_tag LOCUS_13500 10030 7913 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_13500 11113 10154 gene locus_tag LOCUS_13510 11113 10154 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_13510 11178 12812 gene locus_tag LOCUS_13520 11178 12812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 12883 14388 gene locus_tag LOCUS_13530 12883 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 14385 15161 gene locus_tag LOCUS_13540 14385 15161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 15566 15219 gene locus_tag LOCUS_13550 15566 15219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 16498 15626 gene locus_tag LOCUS_13560 16498 15626 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459554.1 protein_id gnl|my_center|LOCUS_13560 17418 16501 gene locus_tag LOCUS_13570 gene cdaA 17418 16501 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347896.1 protein_id gnl|my_center|LOCUS_13570 18752 17415 gene locus_tag LOCUS_13580 gene lysA 18752 17415 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125257.1 protein_id gnl|my_center|LOCUS_13580 19953 19735 gene locus_tag LOCUS_13590 19953 19735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 20827 19946 gene locus_tag LOCUS_13600 20827 19946 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949138.1 protein_id gnl|my_center|LOCUS_13600 21516 20827 gene locus_tag LOCUS_13610 21516 20827 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_13610 21584 22915 gene locus_tag LOCUS_13620 21584 22915 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_13620 24464 22998 gene locus_tag LOCUS_13630 24464 22998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 25393 24476 gene locus_tag LOCUS_13640 25393 24476 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_13640 25511 26809 gene locus_tag LOCUS_13650 25511 26809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 27696 26806 gene locus_tag LOCUS_13660 27696 26806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 29686 27704 gene locus_tag LOCUS_13670 29686 27704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 29979 29905 gene locus_tag LOCUS_t00310 29979 29905 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 33647 30318 gene locus_tag LOCUS_13680 33647 30318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 39568 33701 gene locus_tag LOCUS_13690 39568 33701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 39812 40825 gene locus_tag LOCUS_13700 39812 40825 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143077.1 protein_id gnl|my_center|LOCUS_13700 41025 41100 gene locus_tag LOCUS_t00320 41025 41100 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 42553 41060 gene locus_tag LOCUS_13710 42553 41060 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_13710 42761 42582 gene locus_tag LOCUS_13720 42761 42582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 42933 42748 gene locus_tag LOCUS_13730 42933 42748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 43911 43039 gene locus_tag LOCUS_13740 43911 43039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 44356 44042 gene locus_tag LOCUS_13750 44356 44042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 44525 45559 gene locus_tag LOCUS_13760 44525 45559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 45930 45556 gene locus_tag LOCUS_13770 45930 45556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 47142 45988 gene locus_tag LOCUS_13780 47142 45988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 47271 47453 gene locus_tag LOCUS_13790 47271 47453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 47644 51195 gene locus_tag LOCUS_13800 47644 51195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 51311 51238 gene locus_tag LOCUS_t00330 51311 51238 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence17 435 5423 gene locus_tag LOCUS_13810 435 5423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 6595 7500 gene locus_tag LOCUS_13820 6595 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 8030 7506 gene locus_tag LOCUS_13830 8030 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 8164 9540 gene locus_tag LOCUS_13840 gene dnaB 8164 9540 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_13840 10582 11316 gene locus_tag LOCUS_13850 10582 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969721.1 protein_id gnl|my_center|LOCUS_13850 11316 12296 gene locus_tag LOCUS_13860 11316 12296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 12299 13978 gene locus_tag LOCUS_13870 12299 13978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 13975 14898 gene locus_tag LOCUS_13880 13975 14898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 15078 15626 gene locus_tag LOCUS_13890 15078 15626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 16393 17301 gene locus_tag LOCUS_13900 16393 17301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 18015 20375 gene locus_tag LOCUS_13910 18015 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 21389 20388 gene locus_tag LOCUS_13920 21389 20388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 21846 22967 gene locus_tag LOCUS_13930 gene dnaN 21846 22967 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_13930 22982 23386 gene locus_tag LOCUS_13940 22982 23386 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431999.1 protein_id gnl|my_center|LOCUS_13940 23387 24232 gene locus_tag LOCUS_13950 23387 24232 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249125.1 protein_id gnl|my_center|LOCUS_13950 24501 26411 gene locus_tag LOCUS_13960 24501 26411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 26508 27458 gene locus_tag LOCUS_13970 26508 27458 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_13970 27999 27805 gene locus_tag LOCUS_13980 27999 27805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 28129 31041 gene locus_tag LOCUS_13990 28129 31041 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_13990 31711 31061 gene locus_tag LOCUS_14000 gene cysE 31711 31061 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_14000 32951 31728 gene locus_tag LOCUS_14010 gene tyrS 32951 31728 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_14010 33381 33037 gene locus_tag LOCUS_14020 33381 33037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 34045 33410 gene locus_tag LOCUS_14030 34045 33410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 35496 34231 gene locus_tag LOCUS_14040 35496 34231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 36193 35576 gene locus_tag LOCUS_14050 36193 35576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 36949 36203 gene locus_tag LOCUS_14060 36949 36203 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681784.1 protein_id gnl|my_center|LOCUS_14060 37365 36946 gene locus_tag LOCUS_14070 gene tadA 37365 36946 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000439010.1 protein_id gnl|my_center|LOCUS_14070 39055 37328 gene locus_tag LOCUS_14080 39055 37328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 39785 39072 gene locus_tag LOCUS_14090 39785 39072 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 protein_id gnl|my_center|LOCUS_14090 40553 40014 gene locus_tag LOCUS_14100 40553 40014 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_14100 40704 41681 gene locus_tag LOCUS_14110 40704 41681 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_14110 43091 43750 gene locus_tag LOCUS_14120 43091 43750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 43728 44414 gene locus_tag LOCUS_14130 43728 44414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 44512 44967 gene locus_tag LOCUS_14140 44512 44967 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_14140 45142 47079 gene locus_tag LOCUS_14150 45142 47079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 47712 47119 gene locus_tag LOCUS_14160 47712 47119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 48397 47816 gene locus_tag LOCUS_14170 48397 47816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 48476 48835 gene locus_tag LOCUS_14180 48476 48835 CDS product ribonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929467.1 protein_id gnl|my_center|LOCUS_14180 48941 49015 gene locus_tag LOCUS_t00340 48941 49015 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence18 50 937 gene locus_tag LOCUS_14190 50 937 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296670.1 protein_id gnl|my_center|LOCUS_14190 2159 981 gene locus_tag LOCUS_14200 2159 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3533 2175 gene locus_tag LOCUS_14210 3533 2175 CDS product UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-diaminopimelate--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972056.1 protein_id gnl|my_center|LOCUS_14210 5267 3663 gene locus_tag LOCUS_14220 5267 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5947 5279 gene locus_tag LOCUS_14230 5947 5279 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140815.1 protein_id gnl|my_center|LOCUS_14230 6117 6722 gene locus_tag LOCUS_14240 6117 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 6706 7392 gene locus_tag LOCUS_14250 6706 7392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 8278 7472 gene locus_tag LOCUS_14260 8278 7472 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496701.1 protein_id gnl|my_center|LOCUS_14260 8374 9048 gene locus_tag LOCUS_14270 8374 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 9106 10671 gene locus_tag LOCUS_14280 9106 10671 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546639.1 protein_id gnl|my_center|LOCUS_14280 10826 11179 gene locus_tag LOCUS_14290 gene rplS 10826 11179 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140830.1 protein_id gnl|my_center|LOCUS_14290 11166 12017 gene locus_tag LOCUS_14300 gene ylqF 11166 12017 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861161.1 protein_id gnl|my_center|LOCUS_14300 12019 12660 gene locus_tag LOCUS_14310 12019 12660 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626801.1 protein_id gnl|my_center|LOCUS_14310 13040 12657 gene locus_tag LOCUS_14320 13040 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 14759 13098 gene locus_tag LOCUS_14330 14759 13098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 15058 16062 gene locus_tag LOCUS_14340 15058 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 17849 16128 gene locus_tag LOCUS_14350 gene ade 17849 16128 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964205.1 protein_id gnl|my_center|LOCUS_14350 20304 18019 gene locus_tag LOCUS_14360 20304 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 21199 20399 gene locus_tag LOCUS_14370 21199 20399 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_14370 21505 21266 gene locus_tag LOCUS_14380 21505 21266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 21614 22246 gene locus_tag LOCUS_14390 21614 22246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 22239 22889 gene locus_tag LOCUS_14400 gene upp 22239 22889 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583176.1 protein_id gnl|my_center|LOCUS_14400 22996 25404 gene locus_tag LOCUS_14410 22996 25404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 26251 25451 gene locus_tag LOCUS_14420 26251 25451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 26453 28171 gene locus_tag LOCUS_14430 26453 28171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 28171 29565 gene locus_tag LOCUS_14440 28171 29565 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964872.1 protein_id gnl|my_center|LOCUS_14440 30379 29582 gene locus_tag LOCUS_14450 30379 29582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 31494 30379 gene locus_tag LOCUS_14460 gene lptG 31494 30379 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098949.1 protein_id gnl|my_center|LOCUS_14460 32219 31494 gene locus_tag LOCUS_14470 gene lptB 32219 31494 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996178.1 protein_id gnl|my_center|LOCUS_14470 33585 32572 gene locus_tag LOCUS_14480 gene trpS 33585 32572 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942477.1 protein_id gnl|my_center|LOCUS_14480 33792 35546 gene locus_tag LOCUS_14490 33792 35546 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880932.1 protein_id gnl|my_center|LOCUS_14490 35546 36514 gene locus_tag LOCUS_14500 35546 36514 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081376.1 protein_id gnl|my_center|LOCUS_14500 36517 37584 gene locus_tag LOCUS_14510 36517 37584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584053.1 protein_id gnl|my_center|LOCUS_14510 37581 38297 gene locus_tag LOCUS_14520 37581 38297 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677254.1 protein_id gnl|my_center|LOCUS_14520 38314 38970 gene locus_tag LOCUS_14530 38314 38970 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143753.1 protein_id gnl|my_center|LOCUS_14530 38972 39289 gene locus_tag LOCUS_14540 38972 39289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 39378 40250 gene locus_tag LOCUS_14550 39378 40250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 40872 40282 gene locus_tag LOCUS_14560 40872 40282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 41103 40876 gene locus_tag LOCUS_14570 41103 40876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 42867 41122 gene locus_tag LOCUS_14580 42867 41122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 42978 43886 gene locus_tag LOCUS_14590 gene nadA 42978 43886 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964343.1 protein_id gnl|my_center|LOCUS_14590 43886 44635 gene locus_tag LOCUS_14600 gene rlmB 43886 44635 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002494715.1 protein_id gnl|my_center|LOCUS_14600 44704 45711 gene locus_tag LOCUS_14610 gene rpoD 44704 45711 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_14610 46862 45792 gene locus_tag LOCUS_14620 46862 45792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 47737 46868 gene locus_tag LOCUS_14630 gene ispH 47737 46868 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544912.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence19 263 1099 gene locus_tag LOCUS_14640 263 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2238 1114 gene locus_tag LOCUS_14650 gene tgt 2238 1114 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_14650 2711 2238 gene locus_tag LOCUS_14660 gene ndk 2711 2238 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723912.1 protein_id gnl|my_center|LOCUS_14660 5553 2761 gene locus_tag LOCUS_14670 5553 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 8692 5666 gene locus_tag LOCUS_14680 8692 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 10036 8726 gene locus_tag LOCUS_14690 10036 8726 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_14690 11074 10142 gene locus_tag LOCUS_14700 11074 10142 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_14700 12602 11091 gene locus_tag LOCUS_14710 gene atpA 12602 11091 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_14710 13146 12613 gene locus_tag LOCUS_14720 13146 12613 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425856.1 protein_id gnl|my_center|LOCUS_14720 13643 13146 gene locus_tag LOCUS_14730 13643 13146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 14062 13643 gene locus_tag LOCUS_14740 14062 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 14316 14083 gene locus_tag LOCUS_14750 14316 14083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 15041 14352 gene locus_tag LOCUS_14760 gene atpB 15041 14352 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142904.1 protein_id gnl|my_center|LOCUS_14760 15142 15858 gene locus_tag LOCUS_14770 15142 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 15873 17663 gene locus_tag LOCUS_14780 15873 17663 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_14780 17686 18873 gene locus_tag LOCUS_14790 17686 18873 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_14790 19029 19619 gene locus_tag LOCUS_14800 gene purN 19029 19619 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080015.1 protein_id gnl|my_center|LOCUS_14800 19610 20353 gene locus_tag LOCUS_14810 19610 20353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 20456 21691 gene locus_tag LOCUS_14820 gene glgC 20456 21691 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_14820 21862 22464 gene locus_tag LOCUS_14830 21862 22464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 22445 23092 gene locus_tag LOCUS_14840 22445 23092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 23654 23070 gene locus_tag LOCUS_14850 23654 23070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 24267 23665 gene locus_tag LOCUS_14860 24267 23665 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_14860 25611 24370 gene locus_tag LOCUS_14870 25611 24370 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083007.1 protein_id gnl|my_center|LOCUS_14870 27440 25656 gene locus_tag LOCUS_14880 27440 25656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 28006 27524 gene locus_tag LOCUS_14890 28006 27524 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_14890 29312 28011 gene locus_tag LOCUS_14900 29312 28011 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545541.1 protein_id gnl|my_center|LOCUS_14900 29436 31031 gene locus_tag LOCUS_14910 29436 31031 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_14910 31740 31048 gene locus_tag LOCUS_14920 31740 31048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 32570 31740 gene locus_tag LOCUS_14930 32570 31740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 34373 32580 gene locus_tag LOCUS_14940 34373 32580 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530082.1 protein_id gnl|my_center|LOCUS_14940 35770 34397 gene locus_tag LOCUS_14950 35770 34397 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_14950 36499 35861 gene locus_tag LOCUS_14960 36499 35861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 37851 36613 gene locus_tag LOCUS_14970 37851 36613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 38449 37922 gene locus_tag LOCUS_14980 gene scpB 38449 37922 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056690.1 protein_id gnl|my_center|LOCUS_14980 39230 38424 gene locus_tag LOCUS_14990 39230 38424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 42727 39236 gene locus_tag LOCUS_15000 gene smc 42727 39236 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_15000 47734 43121 gene locus_tag LOCUS_15010 47734 43121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence20 221 430 gene locus_tag LOCUS_15020 gene rpmI 221 430 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142779.1 protein_id gnl|my_center|LOCUS_15020 440 781 gene locus_tag LOCUS_15030 gene rplT 440 781 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583668.1 protein_id gnl|my_center|LOCUS_15030 1706 834 gene locus_tag LOCUS_15040 gene rfbA 1706 834 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676112.1 protein_id gnl|my_center|LOCUS_15040 2542 1703 gene locus_tag LOCUS_15050 gene rfbD 2542 1703 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877394.1 protein_id gnl|my_center|LOCUS_15050 3545 2553 gene locus_tag LOCUS_15060 gene rfbB 3545 2553 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_15060 4153 3542 gene locus_tag LOCUS_15070 gene rfbC 4153 3542 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_15070 4812 4276 gene locus_tag LOCUS_15080 4812 4276 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694080.1 protein_id gnl|my_center|LOCUS_15080 5680 5195 gene locus_tag LOCUS_15090 5680 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6027 6920 gene locus_tag LOCUS_15100 gene thiL 6027 6920 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931893.1 protein_id gnl|my_center|LOCUS_15100 6924 7571 gene locus_tag LOCUS_15110 gene ispD 6924 7571 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583828.1 protein_id gnl|my_center|LOCUS_15110 8362 7577 gene locus_tag LOCUS_15120 gene larE 8362 7577 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896918.1 protein_id gnl|my_center|LOCUS_15120 9260 8352 gene locus_tag LOCUS_15130 9260 8352 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941934.1 protein_id gnl|my_center|LOCUS_15130 10037 9279 gene locus_tag LOCUS_15140 10037 9279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 10723 10040 gene locus_tag LOCUS_15150 gene larB 10723 10040 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_15150 11493 10777 gene locus_tag LOCUS_15160 gene tatC 11493 10777 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694099.1 protein_id gnl|my_center|LOCUS_15160 11735 11502 gene locus_tag LOCUS_15170 11735 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 13041 11761 gene locus_tag LOCUS_15180 13041 11761 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_15180 14264 13044 gene locus_tag LOCUS_15190 14264 13044 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891610.1 protein_id gnl|my_center|LOCUS_15190 18856 14627 gene locus_tag LOCUS_15200 18856 14627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 19059 20327 gene locus_tag LOCUS_15210 gene ahcY 19059 20327 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_15210 20453 21085 gene locus_tag LOCUS_15220 20453 21085 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_15220 21905 21219 gene locus_tag LOCUS_15230 21905 21219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 22048 22809 gene locus_tag LOCUS_15240 22048 22809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 23136 26453 gene locus_tag LOCUS_15250 gene rpoB 23136 26453 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243626.1 protein_id gnl|my_center|LOCUS_15250 26507 28216 gene locus_tag LOCUS_15260 gene rpoC1 26507 28216 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144261.1 protein_id gnl|my_center|LOCUS_15260 28256 32107 gene locus_tag LOCUS_15270 28256 32107 CDS product DNA-directed RNA polymerase subunit beta'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056487.1 protein_id gnl|my_center|LOCUS_15270 32268 32432 gene locus_tag LOCUS_15280 32268 32432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 32526 33032 gene locus_tag LOCUS_15290 32526 33032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 33123 33521 gene locus_tag LOCUS_15300 33123 33521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 33521 34231 gene locus_tag LOCUS_15310 33521 34231 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405201.1 protein_id gnl|my_center|LOCUS_15310 34761 34414 gene locus_tag LOCUS_15320 34761 34414 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000968855.1 protein_id gnl|my_center|LOCUS_15320 35026 35490 gene locus_tag LOCUS_15330 gene ribE 35026 35490 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_15330 35524 36414 gene locus_tag LOCUS_15340 gene murQ 35524 36414 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477926.1 protein_id gnl|my_center|LOCUS_15340 36466 37467 gene locus_tag LOCUS_15350 36466 37467 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674327.1 protein_id gnl|my_center|LOCUS_15350 37467 38402 gene locus_tag LOCUS_15360 37467 38402 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_15360 38642 38956 gene locus_tag LOCUS_15370 38642 38956 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459471.1 protein_id gnl|my_center|LOCUS_15370 39948 38977 gene locus_tag LOCUS_15380 39948 38977 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000544125.1 protein_id gnl|my_center|LOCUS_15380 40648 40052 gene locus_tag LOCUS_15390 gene recR 40648 40052 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_15390 40980 40648 gene locus_tag LOCUS_15400 40980 40648 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_15400 41080 41814 gene locus_tag LOCUS_15410 41080 41814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 41980 43095 gene locus_tag LOCUS_15420 41980 43095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 44496 43105 gene locus_tag LOCUS_15430 44496 43105 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_15430 45242 44529 gene locus_tag LOCUS_15440 45242 44529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 46520 45243 gene locus_tag LOCUS_15450 gene glmU 46520 45243 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence21 794 1858 gene locus_tag LOCUS_15460 794 1858 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_15460 1967 3568 gene locus_tag LOCUS_15470 1967 3568 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_15470 3553 3828 gene locus_tag LOCUS_15480 3553 3828 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564140.1 protein_id gnl|my_center|LOCUS_15480 3924 4139 gene locus_tag LOCUS_15490 3924 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 5453 4146 gene locus_tag LOCUS_15500 5453 4146 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_15500 6410 5478 gene locus_tag LOCUS_15510 6410 5478 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_15510 7326 6421 gene locus_tag LOCUS_15520 7326 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 7491 7901 gene locus_tag LOCUS_15530 7491 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 8194 8538 gene locus_tag LOCUS_15540 8194 8538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 8609 10255 gene locus_tag LOCUS_15550 8609 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 10769 11806 gene locus_tag LOCUS_15560 10769 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 11818 12588 gene locus_tag LOCUS_15570 11818 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 12595 14694 gene locus_tag LOCUS_15580 gene flhA 12595 14694 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870057.1 protein_id gnl|my_center|LOCUS_15580 15563 14697 gene locus_tag LOCUS_15590 15563 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 16503 15547 gene locus_tag LOCUS_15600 16503 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 17533 16544 gene locus_tag LOCUS_15610 17533 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 18766 17558 gene locus_tag LOCUS_15620 18766 17558 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880177.1 protein_id gnl|my_center|LOCUS_15620 19416 18769 gene locus_tag LOCUS_15630 19416 18769 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881107.1 protein_id gnl|my_center|LOCUS_15630 21956 19620 gene locus_tag LOCUS_15640 21956 19620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 22118 22990 gene locus_tag LOCUS_15650 22118 22990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 23370 23591 gene locus_tag LOCUS_15660 23370 23591 CDS product type II toxin-antitoxin system Y4mF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875278.1 protein_id gnl|my_center|LOCUS_15660 23602 24840 gene locus_tag LOCUS_15670 23602 24840 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_15670 25072 25611 gene locus_tag LOCUS_15680 25072 25611 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949169.1 protein_id gnl|my_center|LOCUS_15680 25734 27245 gene locus_tag LOCUS_15690 25734 27245 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_15690 27246 28103 gene locus_tag LOCUS_15700 27246 28103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 28093 28677 gene locus_tag LOCUS_15710 28093 28677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016489.1 protein_id gnl|my_center|LOCUS_15710 28674 29090 gene locus_tag LOCUS_15720 28674 29090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 29091 29405 gene locus_tag LOCUS_15730 29091 29405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 29395 30552 gene locus_tag LOCUS_15740 29395 30552 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611766.1 protein_id gnl|my_center|LOCUS_15740 30564 32105 gene locus_tag LOCUS_15750 30564 32105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 32080 35121 gene locus_tag LOCUS_15760 32080 35121 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_15760 35178 35402 gene locus_tag LOCUS_15770 35178 35402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 35541 35756 gene locus_tag LOCUS_15780 35541 35756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 35756 35956 gene locus_tag LOCUS_15790 35756 35956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 35940 36173 gene locus_tag LOCUS_15800 35940 36173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 36905 36228 gene locus_tag LOCUS_15810 36905 36228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 37801 36908 gene locus_tag LOCUS_15820 37801 36908 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_15820 38245 37847 gene locus_tag LOCUS_15830 38245 37847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 38805 38245 gene locus_tag LOCUS_15840 38805 38245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 39533 38802 gene locus_tag LOCUS_15850 39533 38802 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938438.1 protein_id gnl|my_center|LOCUS_15850 41374 39551 gene locus_tag LOCUS_15860 41374 39551 CDS product Mu transposase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938439.1 protein_id gnl|my_center|LOCUS_15860 41802 41467 gene locus_tag LOCUS_15870 41802 41467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 41869 42078 gene locus_tag LOCUS_15880 41869 42078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 42480 42405 gene locus_tag LOCUS_t00350 42480 42405 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 42723 43925 gene locus_tag LOCUS_15890 42723 43925 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001036339.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence22 444 370 gene locus_tag LOCUS_t00360 444 370 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 823 596 gene locus_tag LOCUS_15900 823 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 916 846 gene locus_tag LOCUS_t00370 916 846 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1811 1275 gene locus_tag LOCUS_15910 1811 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 4618 1934 gene locus_tag LOCUS_15920 gene adhE 4618 1934 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_15920 4778 5509 gene locus_tag LOCUS_15930 4778 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 5948 5664 gene locus_tag LOCUS_15940 5948 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 7017 6550 gene locus_tag LOCUS_15950 7017 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 8293 7028 gene locus_tag LOCUS_15960 8293 7028 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392817.1 protein_id gnl|my_center|LOCUS_15960 9792 8296 gene locus_tag LOCUS_15970 9792 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 10259 9777 gene locus_tag LOCUS_15980 10259 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 10361 11629 gene locus_tag LOCUS_15990 10361 11629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 14488 11675 gene locus_tag LOCUS_16000 14488 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 14633 15472 gene locus_tag LOCUS_16010 14633 15472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 15462 16037 gene locus_tag LOCUS_16020 15462 16037 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990735.1 protein_id gnl|my_center|LOCUS_16020 16104 16475 gene locus_tag LOCUS_16030 16104 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 16958 16497 gene locus_tag LOCUS_16040 16958 16497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 17503 16955 gene locus_tag LOCUS_16050 17503 16955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 17609 17691 gene locus_tag LOCUS_t00380 17609 17691 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 19372 17672 gene locus_tag LOCUS_16060 19372 17672 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_16060 19535 19356 gene locus_tag LOCUS_16070 19535 19356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 21009 19528 gene locus_tag LOCUS_16080 21009 19528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 22039 21167 gene locus_tag LOCUS_16090 22039 21167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 22547 22290 gene locus_tag LOCUS_16100 22547 22290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 22698 22988 gene locus_tag LOCUS_16110 22698 22988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 23026 23433 gene locus_tag LOCUS_16120 23026 23433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 23423 23626 gene locus_tag LOCUS_16130 23423 23626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 23763 24371 gene locus_tag LOCUS_16140 23763 24371 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_16140 25205 24363 gene locus_tag LOCUS_16150 25205 24363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259390.1 protein_id gnl|my_center|LOCUS_16150 26004 25207 gene locus_tag LOCUS_16160 26004 25207 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259391.1 protein_id gnl|my_center|LOCUS_16160 29363 26190 gene locus_tag LOCUS_16170 29363 26190 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_16170 30093 29554 gene locus_tag LOCUS_16180 30093 29554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 31059 30721 gene locus_tag LOCUS_16190 31059 30721 CDS product DUF559 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565727.1 protein_id gnl|my_center|LOCUS_16190 32595 31267 gene locus_tag LOCUS_16200 32595 31267 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437980.1 protein_id gnl|my_center|LOCUS_16200 32865 32632 gene locus_tag LOCUS_16210 32865 32632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 34043 32931 gene locus_tag LOCUS_16220 gene glf 34043 32931 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228271.1 protein_id gnl|my_center|LOCUS_16220 35087 34044 gene locus_tag LOCUS_16230 35087 34044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 36075 35077 gene locus_tag LOCUS_16240 36075 35077 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880036.1 protein_id gnl|my_center|LOCUS_16240 36979 36065 gene locus_tag LOCUS_16250 36979 36065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 38686 37049 gene locus_tag LOCUS_16260 38686 37049 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_16260 39434 38955 gene locus_tag LOCUS_16270 39434 38955 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674579.1 protein_id gnl|my_center|LOCUS_16270 40671 39424 gene locus_tag LOCUS_16280 40671 39424 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_16280 41216 40875 gene locus_tag LOCUS_16290 41216 40875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 42006 41260 gene locus_tag LOCUS_16300 42006 41260 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_16300 42697 42269 gene locus_tag LOCUS_16310 42697 42269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 43177 42716 gene locus_tag LOCUS_16320 43177 42716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 43514 43789 gene locus_tag LOCUS_16330 43514 43789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 44012 43937 gene locus_tag LOCUS_t00390 44012 43937 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence23 1383 1952 gene locus_tag LOCUS_16340 1383 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1973 4927 gene locus_tag LOCUS_16350 1973 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5958 4933 gene locus_tag LOCUS_16360 5958 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 6996 7574 gene locus_tag LOCUS_16370 gene grpE 6996 7574 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454752.1 protein_id gnl|my_center|LOCUS_16370 7617 8753 gene locus_tag LOCUS_16380 gene dnaJ 7617 8753 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_16380 8746 10194 gene locus_tag LOCUS_16390 8746 10194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 10191 10760 gene locus_tag LOCUS_16400 10191 10760 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016124554.1 protein_id gnl|my_center|LOCUS_16400 11475 10813 gene locus_tag LOCUS_16410 gene nusB 11475 10813 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141336.1 protein_id gnl|my_center|LOCUS_16410 13290 11533 gene locus_tag LOCUS_16420 13290 11533 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356645.1 protein_id gnl|my_center|LOCUS_16420 13432 14094 gene locus_tag LOCUS_16430 13432 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 15663 14188 gene locus_tag LOCUS_16440 15663 14188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 16847 15744 gene locus_tag LOCUS_16450 16847 15744 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966322.1 protein_id gnl|my_center|LOCUS_16450 17459 16935 gene locus_tag LOCUS_16460 17459 16935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 18298 17459 gene locus_tag LOCUS_16470 18298 17459 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_16470 19101 18289 gene locus_tag LOCUS_16480 19101 18289 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794285.1 protein_id gnl|my_center|LOCUS_16480 19238 19879 gene locus_tag LOCUS_16490 19238 19879 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_16490 19887 20903 gene locus_tag LOCUS_16500 19887 20903 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939581.1 protein_id gnl|my_center|LOCUS_16500 20912 21664 gene locus_tag LOCUS_16510 20912 21664 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948734.1 protein_id gnl|my_center|LOCUS_16510 21725 22039 gene locus_tag LOCUS_16520 21725 22039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 22092 23009 gene locus_tag LOCUS_16530 22092 23009 CDS product DUF2971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948766.1 protein_id gnl|my_center|LOCUS_16530 23700 23014 gene locus_tag LOCUS_16540 23700 23014 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902990.1 protein_id gnl|my_center|LOCUS_16540 24355 23702 gene locus_tag LOCUS_16550 24355 23702 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861637.1 protein_id gnl|my_center|LOCUS_16550 26034 24391 gene locus_tag LOCUS_16560 26034 24391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 26152 26457 gene locus_tag LOCUS_16570 gene trxA 26152 26457 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700525.1 protein_id gnl|my_center|LOCUS_16570 27072 26527 gene locus_tag LOCUS_16580 27072 26527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 28121 27177 gene locus_tag LOCUS_16590 28121 27177 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_16590 29324 28335 gene locus_tag LOCUS_16600 gene galE 29324 28335 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 protein_id gnl|my_center|LOCUS_16600 31018 29546 gene locus_tag LOCUS_16610 gene gltX 31018 29546 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880773.1 protein_id gnl|my_center|LOCUS_16610 31834 31202 gene locus_tag LOCUS_16620 31834 31202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 35693 31827 gene locus_tag LOCUS_16630 35693 31827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 35859 36065 gene locus_tag LOCUS_16640 35859 36065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 36187 37848 gene locus_tag LOCUS_16650 gene uvrC 36187 37848 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143581.1 protein_id gnl|my_center|LOCUS_16650 40236 39124 gene locus_tag LOCUS_16660 40236 39124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 40444 42198 gene locus_tag LOCUS_16670 40444 42198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence24 362 289 gene locus_tag LOCUS_t00400 362 289 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1120 701 gene locus_tag LOCUS_16680 1120 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 1603 1226 gene locus_tag LOCUS_16690 gene rplL 1603 1226 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806889.1 protein_id gnl|my_center|LOCUS_16690 2213 1692 gene locus_tag LOCUS_16700 gene rplJ 2213 1692 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940186.1 protein_id gnl|my_center|LOCUS_16700 3612 2683 gene locus_tag LOCUS_16710 3612 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 4507 3638 gene locus_tag LOCUS_16720 gene panC 4507 3638 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_16720 5360 4509 gene locus_tag LOCUS_16730 gene panB 5360 4509 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_16730 6739 5360 gene locus_tag LOCUS_16740 6739 5360 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144150.1 protein_id gnl|my_center|LOCUS_16740 7538 6744 gene locus_tag LOCUS_16750 gene pxpA 7538 6744 CDS product 5-oxoprolinase subunit PpxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234423.1 protein_id gnl|my_center|LOCUS_16750 9442 7619 gene locus_tag LOCUS_16760 9442 7619 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 protein_id gnl|my_center|LOCUS_16760 9547 9912 gene locus_tag LOCUS_16770 9547 9912 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_16770 11137 9968 gene locus_tag LOCUS_16780 11137 9968 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459619.1 protein_id gnl|my_center|LOCUS_16780 11616 11134 gene locus_tag LOCUS_16790 11616 11134 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_16790 12281 11658 gene locus_tag LOCUS_16800 gene serB 12281 11658 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_16800 13891 12293 gene locus_tag LOCUS_16810 gene serA 13891 12293 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_16810 15062 13911 gene locus_tag LOCUS_16820 15062 13911 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147561507.1 protein_id gnl|my_center|LOCUS_16820 16171 15218 gene locus_tag LOCUS_16830 16171 15218 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_16830 17318 16272 gene locus_tag LOCUS_16840 17318 16272 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140373.1 protein_id gnl|my_center|LOCUS_16840 18335 17328 gene locus_tag LOCUS_16850 18335 17328 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_16850 18408 19385 gene locus_tag LOCUS_16860 18408 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 19451 20476 gene locus_tag LOCUS_16870 gene ilvC 19451 20476 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942554.1 protein_id gnl|my_center|LOCUS_16870 20496 21338 gene locus_tag LOCUS_16880 20496 21338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 21341 22015 gene locus_tag LOCUS_16890 gene tmk 21341 22015 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_16890 22020 22691 gene locus_tag LOCUS_16900 gene tmk 22020 22691 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_16900 22933 23205 gene locus_tag LOCUS_16910 22933 23205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 24008 23202 gene locus_tag LOCUS_16920 24008 23202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 24447 23998 gene locus_tag LOCUS_16930 gene trmL 24447 23998 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393380.1 protein_id gnl|my_center|LOCUS_16930 25048 24434 gene locus_tag LOCUS_16940 gene pgsA 25048 24434 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965120.1 protein_id gnl|my_center|LOCUS_16940 26070 25072 gene locus_tag LOCUS_16950 26070 25072 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_16950 27038 26166 gene locus_tag LOCUS_16960 27038 26166 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125497.1 protein_id gnl|my_center|LOCUS_16960 28424 27072 gene locus_tag LOCUS_16970 gene dacB 28424 27072 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108699.1 protein_id gnl|my_center|LOCUS_16970 29248 28412 gene locus_tag LOCUS_16980 29248 28412 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204714.1 protein_id gnl|my_center|LOCUS_16980 29913 29200 gene locus_tag LOCUS_16990 29913 29200 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938961.1 protein_id gnl|my_center|LOCUS_16990 30045 31382 gene locus_tag LOCUS_17000 gene tig 30045 31382 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830810.1 protein_id gnl|my_center|LOCUS_17000 31426 32019 gene locus_tag LOCUS_17010 gene clpP 31426 32019 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125965.1 protein_id gnl|my_center|LOCUS_17010 32045 33352 gene locus_tag LOCUS_17020 gene clpX 32045 33352 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144180.1 protein_id gnl|my_center|LOCUS_17020 33384 36245 gene locus_tag LOCUS_17030 gene polA 33384 36245 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_17030 36230 36640 gene locus_tag LOCUS_17040 36230 36640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 37463 36648 gene locus_tag LOCUS_17050 37463 36648 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111875.1 protein_id gnl|my_center|LOCUS_17050 38227 37460 gene locus_tag LOCUS_17060 38227 37460 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_17060 38279 39016 gene locus_tag LOCUS_17070 38279 39016 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_17070 39051 40055 gene locus_tag LOCUS_17080 39051 40055 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_17080 41939 40200 gene locus_tag LOCUS_17090 41939 40200 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460410.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence25 958 1230 gene locus_tag LOCUS_17100 958 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1307 3883 gene locus_tag LOCUS_17110 1307 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 19136 4137 gene locus_tag LOCUS_17120 19136 4137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 19515 21272 gene locus_tag LOCUS_17130 19515 21272 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941814.1 protein_id gnl|my_center|LOCUS_17130 22720 21476 gene locus_tag LOCUS_17140 22720 21476 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143607.1 protein_id gnl|my_center|LOCUS_17140 22881 23816 gene locus_tag LOCUS_17150 22881 23816 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963403.1 protein_id gnl|my_center|LOCUS_17150 24119 23787 gene locus_tag LOCUS_17160 24119 23787 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_17160 24401 24210 gene locus_tag LOCUS_17170 24401 24210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 24724 25776 gene locus_tag LOCUS_17180 gene mnmA 24724 25776 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965531.1 protein_id gnl|my_center|LOCUS_17180 25829 27247 gene locus_tag LOCUS_17190 gene hydG 25829 27247 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964665.1 protein_id gnl|my_center|LOCUS_17190 28181 27237 gene locus_tag LOCUS_17200 28181 27237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 28296 28862 gene locus_tag LOCUS_17210 28296 28862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 29361 28909 gene locus_tag LOCUS_17220 gene smpB 29361 28909 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220025.1 protein_id gnl|my_center|LOCUS_17220 29984 29385 gene locus_tag LOCUS_17230 29984 29385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 29887 32604 gene locus_tag LOCUS_17240 gene mutS 29887 32604 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_17240 32691 33110 gene locus_tag LOCUS_17250 32691 33110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 33172 34545 gene locus_tag LOCUS_17260 gene radA 33172 34545 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_17260 34868 34551 gene locus_tag LOCUS_17270 34868 34551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 34994 35719 gene locus_tag LOCUS_17280 34994 35719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 <36324 35791 gene locus_tag LOCUS_17290 <36324 35791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003360478.1:type I glyceraldehyde-3-phosphate dehydrogenase >Feature sequence26 46 2082 gene locus_tag LOCUS_17300 46 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 2085 4136 gene locus_tag LOCUS_17310 2085 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 4137 5099 gene locus_tag LOCUS_17320 4137 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 5090 5833 gene locus_tag LOCUS_17330 gene kdsB 5090 5833 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030749.1 protein_id gnl|my_center|LOCUS_17330 5826 7463 gene locus_tag LOCUS_17340 5826 7463 CDS product aldolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461003.1 protein_id gnl|my_center|LOCUS_17340 8460 7744 gene locus_tag LOCUS_17350 gene moeB 8460 7744 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393468.1 protein_id gnl|my_center|LOCUS_17350 9122 8469 gene locus_tag LOCUS_17360 9122 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 9219 9800 gene locus_tag LOCUS_17370 9219 9800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 9895 10176 gene locus_tag LOCUS_17380 9895 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 10353 11531 gene locus_tag LOCUS_17390 10353 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 11536 12477 gene locus_tag LOCUS_17400 11536 12477 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143758.1 protein_id gnl|my_center|LOCUS_17400 13268 12831 gene locus_tag LOCUS_17410 gene dut 13268 12831 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 protein_id gnl|my_center|LOCUS_17410 13825 13346 gene locus_tag LOCUS_17420 13825 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 14676 14047 gene locus_tag LOCUS_17430 14676 14047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 15454 14822 gene locus_tag LOCUS_17440 15454 14822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 17584 15458 gene locus_tag LOCUS_17450 17584 15458 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583490.1 protein_id gnl|my_center|LOCUS_17450 17748 18152 gene locus_tag LOCUS_17460 17748 18152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 18508 18239 gene locus_tag LOCUS_17470 gene rpsT 18508 18239 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902954.1 protein_id gnl|my_center|LOCUS_17470 18793 20514 gene locus_tag LOCUS_17480 18793 20514 CDS product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867884.1 protein_id gnl|my_center|LOCUS_17480 20921 21715 gene locus_tag LOCUS_17490 20921 21715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 21795 22409 gene locus_tag LOCUS_17500 21795 22409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 22700 22428 gene locus_tag LOCUS_17510 22700 22428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 23229 22762 gene locus_tag LOCUS_17520 23229 22762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 23473 24867 gene locus_tag LOCUS_17530 gene murC 23473 24867 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_17530 24857 25747 gene locus_tag LOCUS_17540 gene murB 24857 25747 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_17540 25723 26673 gene locus_tag LOCUS_17550 25723 26673 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583317.1 protein_id gnl|my_center|LOCUS_17550 26673 27548 gene locus_tag LOCUS_17560 26673 27548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 27563 28975 gene locus_tag LOCUS_17570 27563 28975 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582596.1 protein_id gnl|my_center|LOCUS_17570 30155 33226 gene locus_tag LOCUS_17580 30155 33226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence27 701 63 gene locus_tag LOCUS_17590 701 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 864 1889 gene locus_tag LOCUS_17600 864 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2328 1870 gene locus_tag LOCUS_17610 2328 1870 CDS product YhcH/YjgK/YiaL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 protein_id gnl|my_center|LOCUS_17610 3154 2330 gene locus_tag LOCUS_17620 3154 2330 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870186.1 protein_id gnl|my_center|LOCUS_17620 3870 3157 gene locus_tag LOCUS_17630 3870 3157 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003702613.1 protein_id gnl|my_center|LOCUS_17630 4920 3886 gene locus_tag LOCUS_17640 4920 3886 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_17640 6544 5168 gene locus_tag LOCUS_17650 6544 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 7745 6618 gene locus_tag LOCUS_17660 gene lpxB 7745 6618 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947101.1 protein_id gnl|my_center|LOCUS_17660 8554 7748 gene locus_tag LOCUS_17670 gene lpxI 8554 7748 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546653.1 protein_id gnl|my_center|LOCUS_17670 9236 8607 gene locus_tag LOCUS_17680 9236 8607 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926557.1 protein_id gnl|my_center|LOCUS_17680 11493 9238 gene locus_tag LOCUS_17690 11493 9238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 12581 11520 gene locus_tag LOCUS_17700 12581 11520 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928605.1 protein_id gnl|my_center|LOCUS_17700 12862 15315 gene locus_tag LOCUS_17710 12862 15315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 15302 15892 gene locus_tag LOCUS_17720 15302 15892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 16710 15916 gene locus_tag LOCUS_17730 gene surE 16710 15916 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_17730 17151 17014 gene locus_tag LOCUS_17740 17151 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 17498 18157 gene locus_tag LOCUS_17750 gene sdaAB 17498 18157 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963992.1 protein_id gnl|my_center|LOCUS_17750 18159 19043 gene locus_tag LOCUS_17760 gene sdaAA 18159 19043 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460513.1 protein_id gnl|my_center|LOCUS_17760 19149 19367 gene locus_tag LOCUS_17770 19149 19367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 19434 20231 gene locus_tag LOCUS_17780 19434 20231 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519040.1 protein_id gnl|my_center|LOCUS_17780 20888 20550 gene locus_tag LOCUS_17790 20888 20550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 22133 20982 gene locus_tag LOCUS_17800 gene anmK 22133 20982 CDS product anhydro-N-acetylmuramic acid kinase AnmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276045.1 protein_id gnl|my_center|LOCUS_17800 22762 23700 gene locus_tag LOCUS_17810 22762 23700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 23693 24622 gene locus_tag LOCUS_17820 23693 24622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 25199 24642 gene locus_tag LOCUS_17830 25199 24642 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964885.1 protein_id gnl|my_center|LOCUS_17830 26382 25180 gene locus_tag LOCUS_17840 26382 25180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 26550 27278 gene locus_tag LOCUS_17850 26550 27278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 27268 28218 gene locus_tag LOCUS_17860 27268 28218 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681095.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence28 1297 149 gene locus_tag LOCUS_17870 1297 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1613 1437 gene locus_tag LOCUS_17880 1613 1437 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_17880 2853 1681 gene locus_tag LOCUS_17890 2853 1681 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811028.1 protein_id gnl|my_center|LOCUS_17890 3442 2906 gene locus_tag LOCUS_17900 3442 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 4490 3576 gene locus_tag LOCUS_17910 4490 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 4751 5233 gene locus_tag LOCUS_17920 4751 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 7589 5445 gene locus_tag LOCUS_17930 gene pnp 7589 5445 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_17930 8270 7773 gene locus_tag LOCUS_17940 8270 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 8601 8305 gene locus_tag LOCUS_17950 8601 8305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 10076 8721 gene locus_tag LOCUS_17960 10076 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 11530 10157 gene locus_tag LOCUS_17970 11530 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 12346 11657 gene locus_tag LOCUS_17980 12346 11657 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_17980 12509 14800 gene locus_tag LOCUS_17990 12509 14800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 14840 16495 gene locus_tag LOCUS_18000 gene recN 14840 16495 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699855.1 protein_id gnl|my_center|LOCUS_18000 17648 16563 gene locus_tag LOCUS_18010 17648 16563 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768231.1 protein_id gnl|my_center|LOCUS_18010 17776 19086 gene locus_tag LOCUS_18020 17776 19086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 19257 20441 gene locus_tag LOCUS_18030 19257 20441 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_18030 22157 20514 gene locus_tag LOCUS_18040 22157 20514 CDS product aldolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461003.1 protein_id gnl|my_center|LOCUS_18040 22830 22159 gene locus_tag LOCUS_18050 22830 22159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 24850 22823 gene locus_tag LOCUS_18060 24850 22823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence29 1798 2484 gene locus_tag LOCUS_18070 1798 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2556 2996 gene locus_tag LOCUS_18080 2556 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 3018 4610 gene locus_tag LOCUS_18090 3018 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4682 5365 gene locus_tag LOCUS_18100 4682 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 5440 6669 gene locus_tag LOCUS_18110 5440 6669 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_18110 6941 7714 gene locus_tag LOCUS_18120 gene rpsB 6941 7714 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080936.1 protein_id gnl|my_center|LOCUS_18120 7795 8658 gene locus_tag LOCUS_18130 gene tsf 7795 8658 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231929.1 protein_id gnl|my_center|LOCUS_18130 9416 8751 gene locus_tag LOCUS_18140 9416 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 12259 9431 gene locus_tag LOCUS_18150 gene uvrA 12259 9431 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436266.1 protein_id gnl|my_center|LOCUS_18150 13441 12740 gene locus_tag LOCUS_18160 13441 12740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 15502 13472 gene locus_tag LOCUS_18170 15502 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 16485 15532 gene locus_tag LOCUS_18180 16485 15532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 18275 16479 gene locus_tag LOCUS_18190 18275 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 18500 19327 gene locus_tag LOCUS_18200 18500 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 19342 19845 gene locus_tag LOCUS_18210 19342 19845 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462102.1 protein_id gnl|my_center|LOCUS_18210 19893 20942 gene locus_tag LOCUS_18220 19893 20942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence30 1249 296 gene locus_tag LOCUS_18230 1249 296 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410273.1 protein_id gnl|my_center|LOCUS_18230 1868 1242 gene locus_tag LOCUS_18240 1868 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2954 1869 gene locus_tag LOCUS_18250 gene gmd 2954 1869 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167740.1 protein_id gnl|my_center|LOCUS_18250 3981 3016 gene locus_tag LOCUS_18260 3981 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_18260 4959 3982 gene locus_tag LOCUS_18270 4959 3982 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_18270 5963 4959 gene locus_tag LOCUS_18280 5963 4959 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143105.1 protein_id gnl|my_center|LOCUS_18280 7477 7142 gene locus_tag LOCUS_18290 7477 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 7761 7489 gene locus_tag LOCUS_18300 7761 7489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 8834 8019 gene locus_tag LOCUS_18310 8834 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 10181 8877 gene locus_tag LOCUS_18320 10181 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 11499 10417 gene locus_tag LOCUS_18330 11499 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 14345 11694 gene locus_tag LOCUS_18340 gene valS 14345 11694 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_18340 16191 14467 gene locus_tag LOCUS_18350 16191 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 17322 16516 gene locus_tag LOCUS_18360 gene fabI 17322 16516 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971127.1 protein_id gnl|my_center|LOCUS_18360 17505 19388 gene locus_tag LOCUS_18370 17505 19388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence31 703 74 gene locus_tag LOCUS_18380 703 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 1680 742 gene locus_tag LOCUS_18390 1680 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 1860 2522 gene locus_tag LOCUS_18400 gene pnuC 1860 2522 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003026840.1 protein_id gnl|my_center|LOCUS_18400 3302 2646 gene locus_tag LOCUS_18410 3302 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3987 3475 gene locus_tag LOCUS_18420 3987 3475 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965803.1 protein_id gnl|my_center|LOCUS_18420 6275 4245 gene locus_tag LOCUS_18430 6275 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6305 7654 gene locus_tag LOCUS_18440 gene rlmD 6305 7654 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583073.1 protein_id gnl|my_center|LOCUS_18440 8891 7656 gene locus_tag LOCUS_18450 8891 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 9103 12636 gene locus_tag LOCUS_18460 gene nifJ 9103 12636 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence32 1386 922 gene locus_tag LOCUS_18470 1386 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 2108 1386 gene locus_tag LOCUS_18480 2108 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 3197 2229 gene locus_tag LOCUS_18490 3197 2229 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830802.1 protein_id gnl|my_center|LOCUS_18490 3370 3197 gene locus_tag LOCUS_18500 3370 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 3527 3862 gene locus_tag LOCUS_18510 3527 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4657 3875 gene locus_tag LOCUS_18520 4657 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 4787 5170 gene locus_tag LOCUS_18530 4787 5170 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_18530 5139 5414 gene locus_tag LOCUS_18540 5139 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 5843 5466 gene locus_tag LOCUS_18550 5843 5466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 7624 6467 gene locus_tag LOCUS_18560 7624 6467 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_18560 11023 7643 gene locus_tag LOCUS_18570 gene mfd 11023 7643 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_18570 11084 11626 gene locus_tag LOCUS_18580 11084 11626 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231473.1 protein_id gnl|my_center|LOCUS_18580 >Feature sequence33 393 31 gene locus_tag LOCUS_18590 393 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1773 937 gene locus_tag LOCUS_18600 1773 937 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107747.1 protein_id gnl|my_center|LOCUS_18600 2823 1789 gene locus_tag LOCUS_18610 2823 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 3438 2860 gene locus_tag LOCUS_18620 3438 2860 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_18620 6602 4092 gene locus_tag LOCUS_18630 6602 4092 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_18630 8523 6913 gene locus_tag LOCUS_18640 8523 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 8669 9841 gene locus_tag LOCUS_18650 8669 9841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 10553 9822 gene locus_tag LOCUS_18660 10553 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence34 1007 2131 gene locus_tag LOCUS_18670 gene alr 1007 2131 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002182683.1 protein_id gnl|my_center|LOCUS_18670 2139 3377 gene locus_tag LOCUS_18680 gene lpdA 2139 3377 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545965.1 protein_id gnl|my_center|LOCUS_18680 3374 4222 gene locus_tag LOCUS_18690 gene lipA 3374 4222 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_18690 4340 5068 gene locus_tag LOCUS_18700 gene pyrH 4340 5068 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703168.1 protein_id gnl|my_center|LOCUS_18700 5092 5658 gene locus_tag LOCUS_18710 gene frr 5092 5658 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231927.1 protein_id gnl|my_center|LOCUS_18710 5658 6530 gene locus_tag LOCUS_18720 5658 6530 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141396.1 protein_id gnl|my_center|LOCUS_18720 6530 7228 gene locus_tag LOCUS_18730 gene rnc 6530 7228 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797266.1 protein_id gnl|my_center|LOCUS_18730 7228 7878 gene locus_tag LOCUS_18740 gene rpe 7228 7878 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989821.1 protein_id gnl|my_center|LOCUS_18740 8991 7864 gene locus_tag LOCUS_18750 8991 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 9264 9437 gene locus_tag LOCUS_18760 9264 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 9656 9985 gene locus_tag LOCUS_18770 9656 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 10073 10150 gene locus_tag LOCUS_t00410 10073 10150 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10195 10267 gene locus_tag LOCUS_t00420 10195 10267 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence35 3349 1100 gene locus_tag LOCUS_18780 3349 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780