>Feature sequence001 1280 117 gene locus_tag LOCUS_00010 1280 117 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_00010 2051 1311 gene locus_tag LOCUS_00020 2051 1311 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064452.1 protein_id gnl|my_center|LOCUS_00020 3301 2072 gene locus_tag LOCUS_00030 gene thrC 3301 2072 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_00030 3813 3355 gene locus_tag LOCUS_00040 3813 3355 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162467599.1 protein_id gnl|my_center|LOCUS_00040 4810 3836 gene locus_tag LOCUS_00050 gene ilvA 4810 3836 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_00050 6002 4848 gene locus_tag LOCUS_00060 6002 4848 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728380.1 protein_id gnl|my_center|LOCUS_00060 7223 6123 gene locus_tag LOCUS_00070 7223 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8299 7301 gene locus_tag LOCUS_00080 8299 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978822.1 protein_id gnl|my_center|LOCUS_00080 9816 8296 gene locus_tag LOCUS_00090 gene araG 9816 8296 CDS product L-arabinose ABC transporter ATP-binding protein AraG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046694981.1 protein_id gnl|my_center|LOCUS_00090 10774 9806 gene locus_tag LOCUS_00100 10774 9806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11620 10823 gene locus_tag LOCUS_00110 11620 10823 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079517.1 protein_id gnl|my_center|LOCUS_00110 12670 11648 gene locus_tag LOCUS_00120 12670 11648 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_00120 13319 12687 gene locus_tag LOCUS_00130 13319 12687 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_00130 13714 14391 gene locus_tag LOCUS_00140 13714 14391 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_00140 15605 14475 gene locus_tag LOCUS_00150 15605 14475 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943290.1 protein_id gnl|my_center|LOCUS_00150 16212 16982 gene locus_tag LOCUS_00160 16212 16982 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048211.1 protein_id gnl|my_center|LOCUS_00160 16999 18144 gene locus_tag LOCUS_00170 16999 18144 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460569.1 protein_id gnl|my_center|LOCUS_00170 18156 18377 gene locus_tag LOCUS_00180 18156 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18410 19615 gene locus_tag LOCUS_00190 18410 19615 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681416.1 protein_id gnl|my_center|LOCUS_00190 20500 20060 gene locus_tag LOCUS_00200 20500 20060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 20942 20505 gene locus_tag LOCUS_00210 20942 20505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21838 21389 gene locus_tag LOCUS_00220 21838 21389 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986684.1 protein_id gnl|my_center|LOCUS_00220 22564 22061 gene locus_tag LOCUS_00230 22564 22061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22624 23058 gene locus_tag LOCUS_00240 22624 23058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 23098 23427 gene locus_tag LOCUS_00250 23098 23427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 23424 23900 gene locus_tag LOCUS_00260 23424 23900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 24640 24080 gene locus_tag LOCUS_00270 24640 24080 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681169.1 protein_id gnl|my_center|LOCUS_00270 25364 24876 gene locus_tag LOCUS_00280 25364 24876 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428667.1 protein_id gnl|my_center|LOCUS_00280 26425 25451 gene locus_tag LOCUS_00290 26425 25451 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027561.1 protein_id gnl|my_center|LOCUS_00290 27534 26545 gene locus_tag LOCUS_00300 27534 26545 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333876.1 protein_id gnl|my_center|LOCUS_00300 28593 27550 gene locus_tag LOCUS_00310 28593 27550 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_00310 29613 28627 gene locus_tag LOCUS_00320 gene rbsC 29613 28627 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419501.1 protein_id gnl|my_center|LOCUS_00320 31108 29606 gene locus_tag LOCUS_00330 31108 29606 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392224.1 protein_id gnl|my_center|LOCUS_00330 32511 31378 gene locus_tag LOCUS_00340 32511 31378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 33569 32595 gene locus_tag LOCUS_00350 33569 32595 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200719.1 protein_id gnl|my_center|LOCUS_00350 34595 33582 gene locus_tag LOCUS_00360 34595 33582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 35568 34588 gene locus_tag LOCUS_00370 35568 34588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_00370 36954 35572 gene locus_tag LOCUS_00380 36954 35572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 38128 36989 gene locus_tag LOCUS_00390 38128 36989 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972914.1 protein_id gnl|my_center|LOCUS_00390 39601 38411 gene locus_tag LOCUS_00400 39601 38411 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943945.1 protein_id gnl|my_center|LOCUS_00400 40246 39605 gene locus_tag LOCUS_00410 40246 39605 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459534.1 protein_id gnl|my_center|LOCUS_00410 40692 40321 gene locus_tag LOCUS_00420 gene perR 40692 40321 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830391.1 protein_id gnl|my_center|LOCUS_00420 41095 40859 gene locus_tag LOCUS_00430 41095 40859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 42105 41092 gene locus_tag LOCUS_00440 42105 41092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 43123 42107 gene locus_tag LOCUS_00450 43123 42107 CDS product bifunctional glycosyltransferase family 2/GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918104.1 protein_id gnl|my_center|LOCUS_00450 44744 43467 gene locus_tag LOCUS_00460 44744 43467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 45673 44915 gene locus_tag LOCUS_00470 45673 44915 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836810.1 protein_id gnl|my_center|LOCUS_00470 46664 45870 gene locus_tag LOCUS_00480 46664 45870 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000547992.1 protein_id gnl|my_center|LOCUS_00480 46838 48118 gene locus_tag LOCUS_00490 46838 48118 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680050.1 protein_id gnl|my_center|LOCUS_00490 48111 48554 gene locus_tag LOCUS_00500 48111 48554 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680049.1 protein_id gnl|my_center|LOCUS_00500 48573 50630 gene locus_tag LOCUS_00510 48573 50630 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986666.1 protein_id gnl|my_center|LOCUS_00510 >Feature sequence002 834 256 gene locus_tag LOCUS_00520 gene yedF 834 256 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986892.1 protein_id gnl|my_center|LOCUS_00520 936 1199 gene locus_tag LOCUS_00530 936 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 1279 1674 gene locus_tag LOCUS_00540 1279 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 1671 2183 gene locus_tag LOCUS_00550 1671 2183 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432371.1 protein_id gnl|my_center|LOCUS_00550 2224 2757 gene locus_tag LOCUS_00560 2224 2757 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902280.1 protein_id gnl|my_center|LOCUS_00560 3153 4742 gene locus_tag LOCUS_00570 gene asnB 3153 4742 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905297.1 protein_id gnl|my_center|LOCUS_00570 5446 4883 gene locus_tag LOCUS_00580 gene pgsA 5446 4883 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_00580 5685 6887 gene locus_tag LOCUS_00590 5685 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 7024 8262 gene locus_tag LOCUS_00600 7024 8262 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897308.1 protein_id gnl|my_center|LOCUS_00600 8296 9567 gene locus_tag LOCUS_00610 8296 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 9753 10283 gene locus_tag LOCUS_00620 gene infC 9753 10283 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965658.1 protein_id gnl|my_center|LOCUS_00620 10306 10503 gene locus_tag LOCUS_00630 gene rpmI 10306 10503 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_00630 10518 10874 gene locus_tag LOCUS_00640 gene rplT 10518 10874 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_00640 10987 11757 gene locus_tag LOCUS_00650 10987 11757 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002327792.1 protein_id gnl|my_center|LOCUS_00650 12346 11762 gene locus_tag LOCUS_00660 12346 11762 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121269.1 protein_id gnl|my_center|LOCUS_00660 12918 12349 gene locus_tag LOCUS_00670 12918 12349 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398496.1 protein_id gnl|my_center|LOCUS_00670 13253 14299 gene locus_tag LOCUS_00680 13253 14299 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_00680 14469 15326 gene locus_tag LOCUS_00690 gene mreC 14469 15326 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_00690 15328 15849 gene locus_tag LOCUS_00700 15328 15849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 15846 18467 gene locus_tag LOCUS_00710 15846 18467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 18715 19782 gene locus_tag LOCUS_00720 18715 19782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 19825 21270 gene locus_tag LOCUS_00730 19825 21270 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_00730 21263 21817 gene locus_tag LOCUS_00740 21263 21817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 22130 21903 gene locus_tag LOCUS_00750 22130 21903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 23848 22301 gene locus_tag LOCUS_00760 23848 22301 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029268.1 protein_id gnl|my_center|LOCUS_00760 25127 23838 gene locus_tag LOCUS_00770 25127 23838 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357478.1 protein_id gnl|my_center|LOCUS_00770 25588 25124 gene locus_tag LOCUS_00780 25588 25124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 28148 25716 gene locus_tag LOCUS_00790 28148 25716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 28350 29009 gene locus_tag LOCUS_00800 gene nth 28350 29009 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_00800 29013 30275 gene locus_tag LOCUS_00810 gene obgE 29013 30275 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_00810 30286 30570 gene locus_tag LOCUS_00820 30286 30570 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_00820 31406 30567 gene locus_tag LOCUS_00830 31406 30567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 31591 32733 gene locus_tag LOCUS_00840 31591 32733 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679466.1 protein_id gnl|my_center|LOCUS_00840 32738 33103 gene locus_tag LOCUS_00850 gene rsfS 32738 33103 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_00850 >Feature sequence003 33 108 gene locus_tag LOCUS_t00010 33 108 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1464 688 gene locus_tag LOCUS_00860 1464 688 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088270774.1 protein_id gnl|my_center|LOCUS_00860 2635 1469 gene locus_tag LOCUS_00870 2635 1469 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_00870 4110 2650 gene locus_tag LOCUS_00880 4110 2650 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459733.1 protein_id gnl|my_center|LOCUS_00880 4957 4121 gene locus_tag LOCUS_00890 4957 4121 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944134.1 protein_id gnl|my_center|LOCUS_00890 6111 4963 gene locus_tag LOCUS_00900 gene fba 6111 4963 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_00900 7285 6113 gene locus_tag LOCUS_00910 gene nagA 7285 6113 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_00910 8108 7287 gene locus_tag LOCUS_00920 8108 7287 CDS product glucosamine-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921804.1 protein_id gnl|my_center|LOCUS_00920 8792 8127 gene locus_tag LOCUS_00930 8792 8127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564604.1 protein_id gnl|my_center|LOCUS_00930 10311 8812 gene locus_tag LOCUS_00940 10311 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 11504 10416 gene locus_tag LOCUS_00950 11504 10416 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011921803.1 protein_id gnl|my_center|LOCUS_00950 12363 11572 gene locus_tag LOCUS_00960 12363 11572 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775424.1 protein_id gnl|my_center|LOCUS_00960 13124 12339 gene locus_tag LOCUS_00970 13124 12339 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014636209.1 protein_id gnl|my_center|LOCUS_00970 13540 14430 gene locus_tag LOCUS_00980 13540 14430 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565426.1 protein_id gnl|my_center|LOCUS_00980 15399 14554 gene locus_tag LOCUS_00990 15399 14554 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_00990 15510 16919 gene locus_tag LOCUS_01000 15510 16919 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891898.1 protein_id gnl|my_center|LOCUS_01000 18354 17008 gene locus_tag LOCUS_01010 18354 17008 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948912.1 protein_id gnl|my_center|LOCUS_01010 22130 18906 gene locus_tag LOCUS_01020 22130 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 23267 22362 gene locus_tag LOCUS_01030 23267 22362 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673283.1 protein_id gnl|my_center|LOCUS_01030 24513 23392 gene locus_tag LOCUS_01040 24513 23392 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673282.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01040 26002 24629 gene locus_tag LOCUS_01050 26002 24629 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680926.1 protein_id gnl|my_center|LOCUS_01050 26800 26015 gene locus_tag LOCUS_01060 26800 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680928.1 protein_id gnl|my_center|LOCUS_01060 28147 26828 gene locus_tag LOCUS_01070 28147 26828 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680929.1 protein_id gnl|my_center|LOCUS_01070 29482 28151 gene locus_tag LOCUS_01080 29482 28151 CDS product glycine/betaine/sarcosine/D-proline family reductase selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956677.1 transl_except (pos:complement(28430..28432),aa:Sec) note codon on position 351 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01080 30125 29523 gene locus_tag LOCUS_01090 30125 29523 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680931.1 protein_id gnl|my_center|LOCUS_01090 31652 30168 gene locus_tag LOCUS_01100 31652 30168 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680934.1 protein_id gnl|my_center|LOCUS_01100 32001 32798 gene locus_tag LOCUS_01110 32001 32798 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861491.1 protein_id gnl|my_center|LOCUS_01110 >Feature sequence004 452 922 gene locus_tag LOCUS_01120 452 922 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963585.1 protein_id gnl|my_center|LOCUS_01120 2388 1030 gene locus_tag LOCUS_01130 2388 1030 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_01130 4233 2392 gene locus_tag LOCUS_01140 4233 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 4958 4230 gene locus_tag LOCUS_01150 4958 4230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942799.1 protein_id gnl|my_center|LOCUS_01150 5311 5703 gene locus_tag LOCUS_01160 5311 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 6969 5680 gene locus_tag LOCUS_01170 6969 5680 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458888.1 protein_id gnl|my_center|LOCUS_01170 7660 6962 gene locus_tag LOCUS_01180 7660 6962 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426384.1 protein_id gnl|my_center|LOCUS_01180 8700 8023 gene locus_tag LOCUS_01190 8700 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 9394 9317 gene locus_tag LOCUS_t00020 9394 9317 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9719 9468 gene locus_tag LOCUS_01200 9719 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 9854 11167 gene locus_tag LOCUS_01210 9854 11167 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_01210 11264 11869 gene locus_tag LOCUS_01220 11264 11869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 11920 12555 gene locus_tag LOCUS_01230 11920 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 12716 15274 gene locus_tag LOCUS_01240 gene polA 12716 15274 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393341.1 protein_id gnl|my_center|LOCUS_01240 15261 15878 gene locus_tag LOCUS_01250 gene coaE 15261 15878 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888527.1 protein_id gnl|my_center|LOCUS_01250 15875 16441 gene locus_tag LOCUS_01260 15875 16441 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_01260 16434 18023 gene locus_tag LOCUS_01270 16434 18023 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_01270 18103 18651 gene locus_tag LOCUS_01280 gene lspA 18103 18651 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_01280 18660 19637 gene locus_tag LOCUS_01290 18660 19637 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371731.1 protein_id gnl|my_center|LOCUS_01290 19641 20294 gene locus_tag LOCUS_01300 19641 20294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 20415 20729 gene locus_tag LOCUS_01310 20415 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 20805 22913 gene locus_tag LOCUS_01320 20805 22913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 22935 25286 gene locus_tag LOCUS_01330 22935 25286 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860930.1 protein_id gnl|my_center|LOCUS_01330 25367 25816 gene locus_tag LOCUS_01340 25367 25816 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392153.1 protein_id gnl|my_center|LOCUS_01340 25823 26503 gene locus_tag LOCUS_01350 25823 26503 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359320.1 protein_id gnl|my_center|LOCUS_01350 26504 28111 gene locus_tag LOCUS_01360 26504 28111 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966495.1 protein_id gnl|my_center|LOCUS_01360 28014 29450 gene locus_tag LOCUS_01370 28014 29450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence005 1263 424 gene locus_tag LOCUS_01380 gene soj 1263 424 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_01380 2917 1625 gene locus_tag LOCUS_01390 2917 1625 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_01390 3421 3693 gene locus_tag LOCUS_01400 3421 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 4022 4639 gene locus_tag LOCUS_01410 4022 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 5654 4896 gene locus_tag LOCUS_01420 5654 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 6531 5644 gene locus_tag LOCUS_01430 6531 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 7520 6528 gene locus_tag LOCUS_01440 7520 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8698 7610 gene locus_tag LOCUS_01450 8698 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 9957 9019 gene locus_tag LOCUS_01460 9957 9019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 11004 10276 gene locus_tag LOCUS_01470 11004 10276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 13349 11493 gene locus_tag LOCUS_01480 13349 11493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 15276 13723 gene locus_tag LOCUS_01490 15276 13723 CDS product hydantoinase/oxoprolinase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989476.1 protein_id gnl|my_center|LOCUS_01490 16370 15279 gene locus_tag LOCUS_01500 16370 15279 CDS product DUF917 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721245.1 protein_id gnl|my_center|LOCUS_01500 17665 16454 gene locus_tag LOCUS_01510 17665 16454 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721244.1 protein_id gnl|my_center|LOCUS_01510 19499 17916 gene locus_tag LOCUS_01520 19499 17916 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989475.1 protein_id gnl|my_center|LOCUS_01520 20902 19817 gene locus_tag LOCUS_01530 20902 19817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 21923 20991 gene locus_tag LOCUS_01540 21923 20991 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536791.1 protein_id gnl|my_center|LOCUS_01540 22981 21920 gene locus_tag LOCUS_01550 22981 21920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969639.1 protein_id gnl|my_center|LOCUS_01550 24506 22998 gene locus_tag LOCUS_01560 24506 22998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905892.1 protein_id gnl|my_center|LOCUS_01560 25348 24521 gene locus_tag LOCUS_01570 25348 24521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 27007 25493 gene locus_tag LOCUS_01580 27007 25493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence006 559 197 gene locus_tag LOCUS_01590 gene rplS 559 197 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965066.1 protein_id gnl|my_center|LOCUS_01590 1503 745 gene locus_tag LOCUS_01600 1503 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2292 1555 gene locus_tag LOCUS_01610 gene trmD 2292 1555 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392485.1 protein_id gnl|my_center|LOCUS_01610 2800 2282 gene locus_tag LOCUS_01620 gene rimM 2800 2282 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384687.1 protein_id gnl|my_center|LOCUS_01620 3089 2859 gene locus_tag LOCUS_01630 3089 2859 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362589.1 protein_id gnl|my_center|LOCUS_01630 3354 3112 gene locus_tag LOCUS_01640 gene rpsP 3354 3112 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965062.1 protein_id gnl|my_center|LOCUS_01640 4763 3417 gene locus_tag LOCUS_01650 gene ffh 4763 3417 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723861.1 protein_id gnl|my_center|LOCUS_01650 5088 4753 gene locus_tag LOCUS_01660 5088 4753 CDS product putative DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965060.1 protein_id gnl|my_center|LOCUS_01660 5849 5196 gene locus_tag LOCUS_01670 5849 5196 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357824.1 protein_id gnl|my_center|LOCUS_01670 7230 5872 gene locus_tag LOCUS_01680 7230 5872 CDS product Trk family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888508.1 protein_id gnl|my_center|LOCUS_01680 8140 7241 gene locus_tag LOCUS_01690 gene ftsY 8140 7241 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035249530.1 protein_id gnl|my_center|LOCUS_01690 11721 8155 gene locus_tag LOCUS_01700 gene smc 11721 8155 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_01700 12477 11725 gene locus_tag LOCUS_01710 gene rnc 12477 11725 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440969.1 protein_id gnl|my_center|LOCUS_01710 12886 12665 gene locus_tag LOCUS_01720 gene acpP 12886 12665 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_01720 13973 12960 gene locus_tag LOCUS_01730 gene plsX 13973 12960 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_01730 14349 14167 gene locus_tag LOCUS_01740 gene rpmF 14349 14167 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362601.1 protein_id gnl|my_center|LOCUS_01740 14867 14352 gene locus_tag LOCUS_01750 14867 14352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 16184 14973 gene locus_tag LOCUS_01760 16184 14973 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956840.1 protein_id gnl|my_center|LOCUS_01760 17216 16218 gene locus_tag LOCUS_01770 gene pta 17216 16218 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_01770 17401 18591 gene locus_tag LOCUS_01780 17401 18591 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965048.1 protein_id gnl|my_center|LOCUS_01780 18651 19700 gene locus_tag LOCUS_01790 18651 19700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 19785 20297 gene locus_tag LOCUS_01800 gene arr 19785 20297 CDS product NAD(+)--rifampin ADP-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811445.1 protein_id gnl|my_center|LOCUS_01800 20479 21216 gene locus_tag LOCUS_01810 20479 21216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 21224 21655 gene locus_tag LOCUS_01820 21224 21655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 22331 21813 gene locus_tag LOCUS_01830 22331 21813 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458874.1 protein_id gnl|my_center|LOCUS_01830 23236 22406 gene locus_tag LOCUS_01840 23236 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 23721 23233 gene locus_tag LOCUS_01850 gene coaD 23721 23233 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728846.1 protein_id gnl|my_center|LOCUS_01850 24272 23718 gene locus_tag LOCUS_01860 gene rsmD 24272 23718 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence007 808 89 gene locus_tag LOCUS_01870 808 89 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107264.1 protein_id gnl|my_center|LOCUS_01870 1365 805 gene locus_tag LOCUS_01880 1365 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 1777 1391 gene locus_tag LOCUS_01890 1777 1391 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940310.1 protein_id gnl|my_center|LOCUS_01890 3029 2070 gene locus_tag LOCUS_01900 gene mmuM 3029 2070 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246467.1 protein_id gnl|my_center|LOCUS_01900 3882 3202 gene locus_tag LOCUS_01910 3882 3202 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582682.1 protein_id gnl|my_center|LOCUS_01910 5423 3870 gene locus_tag LOCUS_01920 5423 3870 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905274.1 protein_id gnl|my_center|LOCUS_01920 6234 5425 gene locus_tag LOCUS_01930 gene phnE 6234 5425 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905273.1 protein_id gnl|my_center|LOCUS_01930 7067 6246 gene locus_tag LOCUS_01940 gene phnE 7067 6246 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131699.1 protein_id gnl|my_center|LOCUS_01940 7828 7064 gene locus_tag LOCUS_01950 gene phnC 7828 7064 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905272.1 protein_id gnl|my_center|LOCUS_01950 7973 7815 gene locus_tag LOCUS_01960 7973 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 9169 8063 gene locus_tag LOCUS_01970 9169 8063 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905271.1 protein_id gnl|my_center|LOCUS_01970 10177 9416 gene locus_tag LOCUS_01980 10177 9416 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948077.1 protein_id gnl|my_center|LOCUS_01980 10568 10477 gene locus_tag LOCUS_t00030 10568 10477 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11032 11598 gene locus_tag LOCUS_01990 11032 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 11869 11787 gene locus_tag LOCUS_t00040 11869 11787 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12033 16718 gene locus_tag LOCUS_02000 12033 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986914.1 protein_id gnl|my_center|LOCUS_02000 16731 17858 gene locus_tag LOCUS_02010 16731 17858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986915.1 protein_id gnl|my_center|LOCUS_02010 17855 18910 gene locus_tag LOCUS_02020 17855 18910 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986916.1 protein_id gnl|my_center|LOCUS_02020 19098 20084 gene locus_tag LOCUS_02030 19098 20084 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461077.1 protein_id gnl|my_center|LOCUS_02030 20226 20687 gene locus_tag LOCUS_02040 20226 20687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 20866 21549 gene locus_tag LOCUS_02050 20866 21549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 22515 21760 gene locus_tag LOCUS_02060 22515 21760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 22730 22512 gene locus_tag LOCUS_02070 22730 22512 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776166.1 protein_id gnl|my_center|LOCUS_02070 >Feature sequence008 2649 160 gene locus_tag LOCUS_02080 2649 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 3395 2646 gene locus_tag LOCUS_02090 3395 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 5196 3427 gene locus_tag LOCUS_02100 5196 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 6301 5183 gene locus_tag LOCUS_02110 6301 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 8385 6322 gene locus_tag LOCUS_02120 8385 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 11337 8410 gene locus_tag LOCUS_02130 11337 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 11741 11334 gene locus_tag LOCUS_02140 11741 11334 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_02140 12508 11759 gene locus_tag LOCUS_02150 12508 11759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 13605 12505 gene locus_tag LOCUS_02160 13605 12505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 14358 13633 gene locus_tag LOCUS_02170 14358 13633 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_02170 16928 14382 gene locus_tag LOCUS_02180 16928 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 17379 16957 gene locus_tag LOCUS_02190 17379 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 17887 17408 gene locus_tag LOCUS_02200 17887 17408 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_02200 18062 17913 gene locus_tag LOCUS_02210 18062 17913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 18460 18101 gene locus_tag LOCUS_02220 18460 18101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_02220 19039 18560 gene locus_tag LOCUS_02230 19039 18560 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_02230 20822 19074 gene locus_tag LOCUS_02240 20822 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 21340 20909 gene locus_tag LOCUS_02250 21340 20909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 21755 21321 gene locus_tag LOCUS_02260 21755 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence009 619 353 gene locus_tag LOCUS_02270 619 353 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_02270 2362 641 gene locus_tag LOCUS_02280 gene ptsP 2362 641 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174207.1 protein_id gnl|my_center|LOCUS_02280 3047 2376 gene locus_tag LOCUS_02290 3047 2376 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_02290 4145 3114 gene locus_tag LOCUS_02300 4145 3114 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024502148.1 protein_id gnl|my_center|LOCUS_02300 5598 4237 gene locus_tag LOCUS_02310 5598 4237 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098119.1 protein_id gnl|my_center|LOCUS_02310 5919 5650 gene locus_tag LOCUS_02320 5919 5650 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454867.1 protein_id gnl|my_center|LOCUS_02320 6788 6054 gene locus_tag LOCUS_02330 6788 6054 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_02330 7231 6785 gene locus_tag LOCUS_02340 7231 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 7420 8157 gene locus_tag LOCUS_02350 7420 8157 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254139.1 protein_id gnl|my_center|LOCUS_02350 8170 9300 gene locus_tag LOCUS_02360 gene nagA 8170 9300 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292242.1 protein_id gnl|my_center|LOCUS_02360 10105 10401 gene locus_tag LOCUS_02370 10105 10401 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963453.1 protein_id gnl|my_center|LOCUS_02370 10403 10996 gene locus_tag LOCUS_02380 gene recR 10403 10996 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722062.1 protein_id gnl|my_center|LOCUS_02380 11171 12166 gene locus_tag LOCUS_02390 11171 12166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 12442 12729 gene locus_tag LOCUS_02400 12442 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 14684 12756 gene locus_tag LOCUS_02410 14684 12756 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048250.1 protein_id gnl|my_center|LOCUS_02410 14975 16288 gene locus_tag LOCUS_02420 14975 16288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 16327 17598 gene locus_tag LOCUS_02430 gene rsmF 16327 17598 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228642.1 protein_id gnl|my_center|LOCUS_02430 17897 18934 gene locus_tag LOCUS_02440 17897 18934 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393756.1 protein_id gnl|my_center|LOCUS_02440 18955 20433 gene locus_tag LOCUS_02450 gene malQ 18955 20433 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_02450 21553 20702 gene locus_tag LOCUS_02460 21553 20702 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974993.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence010 1834 974 gene locus_tag LOCUS_02470 gene aroE 1834 974 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973723.1 protein_id gnl|my_center|LOCUS_02470 3927 1954 gene locus_tag LOCUS_02480 3927 1954 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016921.1 protein_id gnl|my_center|LOCUS_02480 4923 3946 gene locus_tag LOCUS_02490 4923 3946 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257500.1 protein_id gnl|my_center|LOCUS_02490 5903 4920 gene locus_tag LOCUS_02500 5903 4920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_02500 6770 5913 gene locus_tag LOCUS_02510 6770 5913 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_02510 7674 6790 gene locus_tag LOCUS_02520 7674 6790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000928488.1 protein_id gnl|my_center|LOCUS_02520 9375 7777 gene locus_tag LOCUS_02530 9375 7777 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_02530 10324 9434 gene locus_tag LOCUS_02540 10324 9434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 11236 10346 gene locus_tag LOCUS_02550 11236 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 12025 11252 gene locus_tag LOCUS_02560 12025 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 13604 14395 gene locus_tag LOCUS_02570 13604 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 15873 14548 gene locus_tag LOCUS_02580 15873 14548 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_02580 17452 15917 gene locus_tag LOCUS_02590 gene abgT 17452 15917 CDS product p-aminobenzoyl-glutamate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096863.1 protein_id gnl|my_center|LOCUS_02590 17710 18648 gene locus_tag LOCUS_02600 17710 18648 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246430.1 protein_id gnl|my_center|LOCUS_02600 20231 18954 gene locus_tag LOCUS_02610 20231 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 <21820 20903 gene locus_tag LOCUS_02620 <21820 20903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965254.1:recombinase family protein >Feature sequence011 484 792 gene locus_tag LOCUS_02630 gene rpsJ 484 792 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_02630 810 1436 gene locus_tag LOCUS_02640 gene rplC 810 1436 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_02640 1451 2071 gene locus_tag LOCUS_02650 gene rplD 1451 2071 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357518.1 protein_id gnl|my_center|LOCUS_02650 2071 2367 gene locus_tag LOCUS_02660 gene rplW 2071 2367 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966410.1 protein_id gnl|my_center|LOCUS_02660 2379 3212 gene locus_tag LOCUS_02670 gene rplB 2379 3212 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_02670 3231 3512 gene locus_tag LOCUS_02680 gene rpsS 3231 3512 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_02680 3528 3914 gene locus_tag LOCUS_02690 gene rplV 3528 3914 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810154.1 protein_id gnl|my_center|LOCUS_02690 3926 4570 gene locus_tag LOCUS_02700 gene rpsC 3926 4570 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966406.1 protein_id gnl|my_center|LOCUS_02700 4585 5022 gene locus_tag LOCUS_02710 gene rplP 4585 5022 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_02710 5012 5212 gene locus_tag LOCUS_02720 gene rpmC 5012 5212 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_02720 5234 5491 gene locus_tag LOCUS_02730 gene rpsQ 5234 5491 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_02730 5510 5878 gene locus_tag LOCUS_02740 gene rplN 5510 5878 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357295.1 protein_id gnl|my_center|LOCUS_02740 5894 6211 gene locus_tag LOCUS_02750 gene rplX 5894 6211 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_02750 6229 6846 gene locus_tag LOCUS_02760 gene rplE 6229 6846 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_02760 6863 7048 gene locus_tag LOCUS_02770 6863 7048 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421149.1 protein_id gnl|my_center|LOCUS_02770 7072 7470 gene locus_tag LOCUS_02780 gene rpsH 7072 7470 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357687.1 protein_id gnl|my_center|LOCUS_02780 7549 8088 gene locus_tag LOCUS_02790 gene rplF 7549 8088 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966397.1 protein_id gnl|my_center|LOCUS_02790 8111 8479 gene locus_tag LOCUS_02800 gene rplR 8111 8479 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421141.1 protein_id gnl|my_center|LOCUS_02800 8490 8993 gene locus_tag LOCUS_02810 gene rpsE 8490 8993 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966395.1 protein_id gnl|my_center|LOCUS_02810 9006 9185 gene locus_tag LOCUS_02820 gene rpmD 9006 9185 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_02820 9198 9638 gene locus_tag LOCUS_02830 gene rplO 9198 9638 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356221.1 protein_id gnl|my_center|LOCUS_02830 9638 10909 gene locus_tag LOCUS_02840 gene secY 9638 10909 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810127.1 protein_id gnl|my_center|LOCUS_02840 10920 11546 gene locus_tag LOCUS_02850 10920 11546 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_02850 11543 12319 gene locus_tag LOCUS_02860 gene map 11543 12319 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_02860 12306 12581 gene locus_tag LOCUS_02870 12306 12581 CDS product KOW domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895197.1 protein_id gnl|my_center|LOCUS_02870 12593 12814 gene locus_tag LOCUS_02880 gene infA 12593 12814 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_02880 13052 13420 gene locus_tag LOCUS_02890 gene rpsM 13052 13420 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_02890 13436 13840 gene locus_tag LOCUS_02900 gene rpsK 13436 13840 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_02900 13855 14484 gene locus_tag LOCUS_02910 gene rpsD 13855 14484 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421121.1 protein_id gnl|my_center|LOCUS_02910 14543 15484 gene locus_tag LOCUS_02920 14543 15484 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357472.1 protein_id gnl|my_center|LOCUS_02920 15508 15999 gene locus_tag LOCUS_02930 gene rplQ 15508 15999 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966384.1 protein_id gnl|my_center|LOCUS_02930 17200 16316 gene locus_tag LOCUS_02940 17200 16316 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359214.1 protein_id gnl|my_center|LOCUS_02940 18699 17383 gene locus_tag LOCUS_02950 18699 17383 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_02950 18953 19477 gene locus_tag LOCUS_02960 18953 19477 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_02960 20042 19623 gene locus_tag LOCUS_02970 20042 19623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence012 337 522 gene locus_tag LOCUS_02980 337 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 952 1512 gene locus_tag LOCUS_02990 952 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1509 2495 gene locus_tag LOCUS_03000 gene dusB 1509 2495 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966475.1 protein_id gnl|my_center|LOCUS_03000 2767 3234 gene locus_tag LOCUS_03010 gene greA 2767 3234 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_03010 3245 4756 gene locus_tag LOCUS_03020 gene lysS 3245 4756 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966473.1 protein_id gnl|my_center|LOCUS_03020 4905 5831 gene locus_tag LOCUS_03030 4905 5831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 7193 6420 gene locus_tag LOCUS_03040 7193 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 7343 8563 gene locus_tag LOCUS_03050 7343 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 8565 9530 gene locus_tag LOCUS_03060 8565 9530 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_03060 10422 9883 gene locus_tag LOCUS_03070 10422 9883 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004255233.1 protein_id gnl|my_center|LOCUS_03070 12056 10419 gene locus_tag LOCUS_03080 12056 10419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 12788 12135 gene locus_tag LOCUS_03090 12788 12135 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283908.1 protein_id gnl|my_center|LOCUS_03090 13992 12766 gene locus_tag LOCUS_03100 gene tyrS 13992 12766 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048264.1 protein_id gnl|my_center|LOCUS_03100 14188 15924 gene locus_tag LOCUS_03110 14188 15924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 16078 16692 gene locus_tag LOCUS_03120 16078 16692 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943393.1 protein_id gnl|my_center|LOCUS_03120 16658 17056 gene locus_tag LOCUS_03130 16658 17056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 17415 18353 gene locus_tag LOCUS_03140 17415 18353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 18426 19259 gene locus_tag LOCUS_03150 18426 19259 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943967.1 protein_id gnl|my_center|LOCUS_03150 >Feature sequence013 379 203 gene locus_tag LOCUS_03160 379 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1437 697 gene locus_tag LOCUS_03170 1437 697 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869224.1 protein_id gnl|my_center|LOCUS_03170 3227 1434 gene locus_tag LOCUS_03180 gene nuoF 3227 1434 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_03180 3697 3224 gene locus_tag LOCUS_03190 3697 3224 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869222.1 protein_id gnl|my_center|LOCUS_03190 4040 3759 gene locus_tag LOCUS_03200 4040 3759 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869227.1 protein_id gnl|my_center|LOCUS_03200 5903 4101 gene locus_tag LOCUS_03210 5903 4101 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_03210 6383 5907 gene locus_tag LOCUS_03220 6383 5907 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_03220 6795 7700 gene locus_tag LOCUS_03230 6795 7700 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028976.1 protein_id gnl|my_center|LOCUS_03230 8356 7661 gene locus_tag LOCUS_03240 8356 7661 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986474.1 protein_id gnl|my_center|LOCUS_03240 8471 9697 gene locus_tag LOCUS_03250 8471 9697 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_03250 9759 11666 gene locus_tag LOCUS_03260 9759 11666 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986480.1 protein_id gnl|my_center|LOCUS_03260 11656 13143 gene locus_tag LOCUS_03270 11656 13143 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870282.1 protein_id gnl|my_center|LOCUS_03270 13133 14050 gene locus_tag LOCUS_03280 13133 14050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 14318 15388 gene locus_tag LOCUS_03290 14318 15388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 15481 16167 gene locus_tag LOCUS_03300 15481 16167 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_03300 16164 16814 gene locus_tag LOCUS_03310 16164 16814 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227690.1 protein_id gnl|my_center|LOCUS_03310 16933 17505 gene locus_tag LOCUS_03320 gene mobB 16933 17505 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460721.1 protein_id gnl|my_center|LOCUS_03320 17822 18712 gene locus_tag LOCUS_03330 17822 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 <19517 18964 gene locus_tag LOCUS_03340 <19517 18964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861114.1:ATP-binding protein >Feature sequence014 715 77 gene locus_tag LOCUS_03350 715 77 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110319.1 protein_id gnl|my_center|LOCUS_03350 899 1120 gene locus_tag LOCUS_03360 899 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 2750 4525 gene locus_tag LOCUS_03370 2750 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 4544 6325 gene locus_tag LOCUS_03380 gene hflX 4544 6325 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048095.1 protein_id gnl|my_center|LOCUS_03380 6322 6999 gene locus_tag LOCUS_03390 6322 6999 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111910.1 protein_id gnl|my_center|LOCUS_03390 7083 7244 gene locus_tag LOCUS_03400 7083 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 7351 7884 gene locus_tag LOCUS_03410 7351 7884 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461289.1 protein_id gnl|my_center|LOCUS_03410 7940 8203 gene locus_tag LOCUS_03420 7940 8203 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460321.1 protein_id gnl|my_center|LOCUS_03420 8200 8628 gene locus_tag LOCUS_03430 gene ruvX 8200 8628 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440635.1 protein_id gnl|my_center|LOCUS_03430 8647 8928 gene locus_tag LOCUS_03440 8647 8928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 8985 9275 gene locus_tag LOCUS_03450 gene yqfC 8985 9275 CDS product sporulation protein YqfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226191.1 protein_id gnl|my_center|LOCUS_03450 9333 10475 gene locus_tag LOCUS_03460 9333 10475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10484 11500 gene locus_tag LOCUS_03470 10484 11500 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_03470 11519 13642 gene locus_tag LOCUS_03480 11519 13642 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964604.1 protein_id gnl|my_center|LOCUS_03480 13639 14085 gene locus_tag LOCUS_03490 gene ybeY 13639 14085 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_03490 14082 14495 gene locus_tag LOCUS_03500 14082 14495 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_03500 14492 15379 gene locus_tag LOCUS_03510 gene era 14492 15379 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416645.1 protein_id gnl|my_center|LOCUS_03510 15715 15572 gene locus_tag LOCUS_03520 15715 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 15833 16564 gene locus_tag LOCUS_03530 gene recO 15833 16564 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228390.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence015 7 1035 gene locus_tag LOCUS_03540 7 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 1086 1235 gene locus_tag LOCUS_03550 1086 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2511 1441 gene locus_tag LOCUS_03560 2511 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 2607 2798 gene locus_tag LOCUS_03570 2607 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3900 3274 gene locus_tag LOCUS_03580 3900 3274 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359170.1 protein_id gnl|my_center|LOCUS_03580 5286 3904 gene locus_tag LOCUS_03590 5286 3904 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422669.1 protein_id gnl|my_center|LOCUS_03590 7054 5279 gene locus_tag LOCUS_03600 7054 5279 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033047490.1 protein_id gnl|my_center|LOCUS_03600 7399 7055 gene locus_tag LOCUS_03610 7399 7055 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367214.1 protein_id gnl|my_center|LOCUS_03610 8366 7380 gene locus_tag LOCUS_03620 8366 7380 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_03620 8984 8382 gene locus_tag LOCUS_03630 8984 8382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 9509 9015 gene locus_tag LOCUS_03640 9509 9015 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_03640 11506 9590 gene locus_tag LOCUS_03650 11506 9590 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_03650 11811 11503 gene locus_tag LOCUS_03660 11811 11503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 12719 12090 gene locus_tag LOCUS_03670 gene upp 12719 12090 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_03670 13309 12866 gene locus_tag LOCUS_03680 gene rpiB 13309 12866 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_03680 13758 13306 gene locus_tag LOCUS_03690 13758 13306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 14801 13758 gene locus_tag LOCUS_03700 14801 13758 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393872.1 protein_id gnl|my_center|LOCUS_03700 15885 14809 gene locus_tag LOCUS_03710 gene prfA 15885 14809 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947982.1 protein_id gnl|my_center|LOCUS_03710 16706 15879 gene locus_tag LOCUS_03720 gene prmC 16706 15879 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_03720 17764 16703 gene locus_tag LOCUS_03730 17764 16703 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_03730 17918 18652 gene locus_tag LOCUS_03740 17918 18652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence016 274 492 gene locus_tag LOCUS_03750 274 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 553 1095 gene locus_tag LOCUS_03760 553 1095 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279620.1 protein_id gnl|my_center|LOCUS_03760 1254 1682 gene locus_tag LOCUS_03770 1254 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1679 3511 gene locus_tag LOCUS_03780 gene ftsH 1679 3511 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_03780 3544 4050 gene locus_tag LOCUS_03790 3544 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4069 4902 gene locus_tag LOCUS_03800 4069 4902 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769562.1 protein_id gnl|my_center|LOCUS_03800 5594 5268 gene locus_tag LOCUS_03810 5594 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03810 5700 5503 gene locus_tag LOCUS_03820 5700 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 5900 5697 gene locus_tag LOCUS_03830 5900 5697 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814946.1 protein_id gnl|my_center|LOCUS_03830 6080 6625 gene locus_tag LOCUS_03840 6080 6625 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483406.1 protein_id gnl|my_center|LOCUS_03840 7826 7290 gene locus_tag LOCUS_03850 7826 7290 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966606.1 protein_id gnl|my_center|LOCUS_03850 8184 7984 gene locus_tag LOCUS_03860 gene rpmE 8184 7984 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_03860 10184 8370 gene locus_tag LOCUS_03870 10184 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 10626 10916 gene locus_tag LOCUS_03880 10626 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 10924 11241 gene locus_tag LOCUS_03890 10924 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 11267 11554 gene locus_tag LOCUS_03900 11267 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 11659 12516 gene locus_tag LOCUS_03910 11659 12516 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_03910 12503 12676 gene locus_tag LOCUS_03920 12503 12676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 13076 13783 gene locus_tag LOCUS_03930 13076 13783 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051244.1 protein_id gnl|my_center|LOCUS_03930 14156 15595 gene locus_tag LOCUS_03940 14156 15595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 15592 16893 gene locus_tag LOCUS_03950 15592 16893 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459130.1 protein_id gnl|my_center|LOCUS_03950 17028 17441 gene locus_tag LOCUS_03960 17028 17441 CDS product DUF3788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022471380.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence017 1114 227 gene locus_tag LOCUS_03970 1114 227 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814617.1 protein_id gnl|my_center|LOCUS_03970 2077 1118 gene locus_tag LOCUS_03980 2077 1118 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_03980 2262 3422 gene locus_tag LOCUS_03990 2262 3422 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391945.1 protein_id gnl|my_center|LOCUS_03990 3482 4177 gene locus_tag LOCUS_04000 3482 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4200 4958 gene locus_tag LOCUS_04010 4200 4958 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047750.1 protein_id gnl|my_center|LOCUS_04010 5088 5939 gene locus_tag LOCUS_04020 5088 5939 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972136.1 protein_id gnl|my_center|LOCUS_04020 5952 6626 gene locus_tag LOCUS_04030 5952 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 7128 6748 gene locus_tag LOCUS_04040 7128 6748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 7063 7350 gene locus_tag LOCUS_04050 7063 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 7907 7347 gene locus_tag LOCUS_04060 7907 7347 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814293.1 protein_id gnl|my_center|LOCUS_04060 8142 8435 gene locus_tag LOCUS_04070 gene citD 8142 8435 CDS product citrate lyase acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566181.1 protein_id gnl|my_center|LOCUS_04070 8432 9319 gene locus_tag LOCUS_04080 gene citE 8432 9319 CDS product citrate (pro-3S)-lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355998.1 protein_id gnl|my_center|LOCUS_04080 9323 10858 gene locus_tag LOCUS_04090 gene citF 9323 10858 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026596.1 protein_id gnl|my_center|LOCUS_04090 10860 11822 gene locus_tag LOCUS_04100 gene citC 10860 11822 CDS product [citrate (pro-3S)-lyase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704362.1 protein_id gnl|my_center|LOCUS_04100 11797 13098 gene locus_tag LOCUS_04110 gene citG 11797 13098 CDS product triphosphoribosyl-dephospho-CoA synthase CitG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668027.1 protein_id gnl|my_center|LOCUS_04110 14700 13270 gene locus_tag LOCUS_04120 14700 13270 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_04120 16071 14707 gene locus_tag LOCUS_04130 gene trkA 16071 14707 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_04130 17610 16642 gene locus_tag LOCUS_04140 17610 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence018 1123 2730 gene locus_tag LOCUS_04150 1123 2730 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048336.1 protein_id gnl|my_center|LOCUS_04150 2741 3721 gene locus_tag LOCUS_04160 2741 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3725 5536 gene locus_tag LOCUS_04170 3725 5536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 5554 6117 gene locus_tag LOCUS_04180 5554 6117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 6119 6820 gene locus_tag LOCUS_04190 6119 6820 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774180.1 protein_id gnl|my_center|LOCUS_04190 6824 9334 gene locus_tag LOCUS_04200 6824 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 9380 11083 gene locus_tag LOCUS_04210 9380 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 12632 11442 gene locus_tag LOCUS_04220 12632 11442 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986283.1 protein_id gnl|my_center|LOCUS_04220 13776 12880 gene locus_tag LOCUS_04230 13776 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 14432 13773 gene locus_tag LOCUS_04240 14432 13773 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770252.1 protein_id gnl|my_center|LOCUS_04240 14601 15152 gene locus_tag LOCUS_04250 14601 15152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 17488 15797 gene locus_tag LOCUS_04260 gene glgA 17488 15797 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence019 1666 677 gene locus_tag LOCUS_04270 1666 677 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887976.1 protein_id gnl|my_center|LOCUS_04270 2339 1659 gene locus_tag LOCUS_04280 2339 1659 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272034.1 protein_id gnl|my_center|LOCUS_04280 2661 3698 gene locus_tag LOCUS_04290 2661 3698 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_04290 3990 4367 gene locus_tag LOCUS_04300 3990 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 4423 4509 gene locus_tag LOCUS_t00050 4423 4509 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5116 5322 gene locus_tag LOCUS_04310 5116 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 5578 5399 gene locus_tag LOCUS_04320 5578 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 6916 6197 gene locus_tag LOCUS_04330 gene phnF 6916 6197 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002194085.1 protein_id gnl|my_center|LOCUS_04330 7048 8103 gene locus_tag LOCUS_04340 7048 8103 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703584.1 protein_id gnl|my_center|LOCUS_04340 8120 9415 gene locus_tag LOCUS_04350 8120 9415 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034798928.1 protein_id gnl|my_center|LOCUS_04350 9457 10557 gene locus_tag LOCUS_04360 9457 10557 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728810.1 protein_id gnl|my_center|LOCUS_04360 10625 12133 gene locus_tag LOCUS_04370 gene gguA 10625 12133 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583992.1 protein_id gnl|my_center|LOCUS_04370 12130 13086 gene locus_tag LOCUS_04380 12130 13086 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860722.1 protein_id gnl|my_center|LOCUS_04380 13097 14407 gene locus_tag LOCUS_04390 13097 14407 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886532.1 protein_id gnl|my_center|LOCUS_04390 14541 15479 gene locus_tag LOCUS_04400 14541 15479 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876792.1 protein_id gnl|my_center|LOCUS_04400 15875 15612 gene locus_tag LOCUS_04410 15875 15612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 >Feature sequence020 1368 577 gene locus_tag LOCUS_04420 1368 577 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391560.1 protein_id gnl|my_center|LOCUS_04420 2345 1386 gene locus_tag LOCUS_04430 2345 1386 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674237.1 protein_id gnl|my_center|LOCUS_04430 3359 2379 gene locus_tag LOCUS_04440 3359 2379 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774051.1 protein_id gnl|my_center|LOCUS_04440 4887 3385 gene locus_tag LOCUS_04450 4887 3385 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392150.1 protein_id gnl|my_center|LOCUS_04450 6057 5011 gene locus_tag LOCUS_04460 6057 5011 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392149.1 protein_id gnl|my_center|LOCUS_04460 6362 7333 gene locus_tag LOCUS_04470 6362 7333 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392152.1 protein_id gnl|my_center|LOCUS_04470 7376 8428 gene locus_tag LOCUS_04480 7376 8428 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094661859.1 protein_id gnl|my_center|LOCUS_04480 9377 8694 gene locus_tag LOCUS_04490 9377 8694 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209520.1 protein_id gnl|my_center|LOCUS_04490 9992 9423 gene locus_tag LOCUS_04500 gene hxlB 9992 9423 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246343.1 protein_id gnl|my_center|LOCUS_04500 10698 10003 gene locus_tag LOCUS_04510 gene rpe 10698 10003 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939801.1 protein_id gnl|my_center|LOCUS_04510 11642 10695 gene locus_tag LOCUS_04520 11642 10695 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 protein_id gnl|my_center|LOCUS_04520 12409 11843 gene locus_tag LOCUS_04530 12409 11843 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_04530 14293 12551 gene locus_tag LOCUS_04540 14293 12551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 15517 14360 gene locus_tag LOCUS_04550 15517 14360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 16172 15504 gene locus_tag LOCUS_04560 16172 15504 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_04560 >Feature sequence021 <1 1706 gene locus_tag LOCUS_04570 <1 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS 1710 3647 gene locus_tag LOCUS_04580 gene mutL 1710 3647 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_04580 3655 4599 gene locus_tag LOCUS_04590 gene miaA 3655 4599 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392629.1 protein_id gnl|my_center|LOCUS_04590 4602 4850 gene locus_tag LOCUS_04600 gene hfq 4602 4850 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965139.1 protein_id gnl|my_center|LOCUS_04600 4854 6146 gene locus_tag LOCUS_04610 4854 6146 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986378.1 protein_id gnl|my_center|LOCUS_04610 6757 6143 gene locus_tag LOCUS_04620 gene lexA 6757 6143 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_04620 6862 7236 gene locus_tag LOCUS_04630 6862 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 8292 7243 gene locus_tag LOCUS_04640 8292 7243 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811557.1 protein_id gnl|my_center|LOCUS_04640 8808 8371 gene locus_tag LOCUS_04650 gene rnhA 8808 8371 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392156.1 protein_id gnl|my_center|LOCUS_04650 9059 9132 gene locus_tag LOCUS_t00060 9059 9132 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 9203 9928 gene locus_tag LOCUS_04660 9203 9928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 10256 10029 gene locus_tag LOCUS_04670 10256 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04670 13054 10424 gene locus_tag LOCUS_04680 13054 10424 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_04680 14339 13404 gene locus_tag LOCUS_04690 14339 13404 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812947.1 protein_id gnl|my_center|LOCUS_04690 15973 14429 gene locus_tag LOCUS_04700 gene rny 15973 14429 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428216.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence022 1892 378 gene locus_tag LOCUS_04710 1892 378 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256402.1 protein_id gnl|my_center|LOCUS_04710 2298 2957 gene locus_tag LOCUS_04720 2298 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2982 4178 gene locus_tag LOCUS_04730 2982 4178 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902657.1 protein_id gnl|my_center|LOCUS_04730 4191 4532 gene locus_tag LOCUS_04740 4191 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4660 6219 gene locus_tag LOCUS_04750 gene fdrA 4660 6219 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_04750 6229 7656 gene locus_tag LOCUS_04760 6229 7656 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393611.1 protein_id gnl|my_center|LOCUS_04760 7788 8588 gene locus_tag LOCUS_04770 7788 8588 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_04770 9001 9438 gene locus_tag LOCUS_04780 9001 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 9435 10268 gene locus_tag LOCUS_04790 9435 10268 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_04790 10282 10767 gene locus_tag LOCUS_04800 10282 10767 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_04800 10784 13096 gene locus_tag LOCUS_04810 10784 13096 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869170.1 protein_id gnl|my_center|LOCUS_04810 13268 14482 gene locus_tag LOCUS_04820 13268 14482 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080841.1 protein_id gnl|my_center|LOCUS_04820 14626 15564 gene locus_tag LOCUS_04830 14626 15564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence023 1635 1711 gene locus_tag LOCUS_t00070 1635 1711 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1717 1791 gene locus_tag LOCUS_t00080 1717 1791 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1806 1882 gene locus_tag LOCUS_t00090 1806 1882 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1893 1969 gene locus_tag LOCUS_t00100 1893 1969 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1985 2060 gene locus_tag LOCUS_t00110 1985 2060 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2082 2166 gene locus_tag LOCUS_t00120 2082 2166 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2176 2262 gene locus_tag LOCUS_t00130 2176 2262 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2788 3837 gene locus_tag LOCUS_04840 2788 3837 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052107.1 protein_id gnl|my_center|LOCUS_04840 3870 4487 gene locus_tag LOCUS_04850 3870 4487 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068188.1 protein_id gnl|my_center|LOCUS_04850 5346 5188 gene locus_tag LOCUS_04860 5346 5188 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_04860 7256 5403 gene locus_tag LOCUS_04870 7256 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 7674 10274 gene locus_tag LOCUS_04880 7674 10274 CDS product TetM/TetW/TetO/TetS family tetracycline resistance ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814361.1 protein_id gnl|my_center|LOCUS_04880 10247 11002 gene locus_tag LOCUS_04890 10247 11002 CDS product YlmH/Sll1252 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358628.1 protein_id gnl|my_center|LOCUS_04890 12988 11510 gene locus_tag LOCUS_04900 gene spoIVA 12988 11510 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986845.1 protein_id gnl|my_center|LOCUS_04900 14510 13176 gene locus_tag LOCUS_04910 gene der 14510 13176 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_04910 14777 14852 gene locus_tag LOCUS_t00140 14777 14852 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14858 14934 gene locus_tag LOCUS_t00150 14858 14934 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <16010 15000 gene locus_tag LOCUS_04920 <16010 15000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002324544.1:site-specific resolvase TndX >Feature sequence024 233 652 gene locus_tag LOCUS_04930 233 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943965.1 protein_id gnl|my_center|LOCUS_04930 2277 1114 gene locus_tag LOCUS_04940 gene grdD 2277 1114 CDS product glycine/sarcosine/betaine reductase complex component C subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430750.1 protein_id gnl|my_center|LOCUS_04940 3823 2291 gene locus_tag LOCUS_04950 gene grdC 3823 2291 CDS product glycine/sarcosine/betaine reductase complex component C subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897537.1 protein_id gnl|my_center|LOCUS_04950 4403 3933 gene locus_tag LOCUS_04960 gene grdA 4403 3933 CDS product glycine/sarcosine/betaine reductase complex selenoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013361326.1 transl_except (pos:complement(4272..4274),aa:Sec) note codon on position 44 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_04960 4824 4507 gene locus_tag LOCUS_04970 4824 4507 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416870.1 protein_id gnl|my_center|LOCUS_04970 5781 4843 gene locus_tag LOCUS_04980 gene trxB 5781 4843 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_04980 7136 5820 gene locus_tag LOCUS_04990 gene grdB 7136 5820 CDS product glycine reductase complex selenoprotein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084480926.1 transl_except (pos:complement(6087..6089),aa:Sec) note codon on position 350 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_04990 8432 7152 gene locus_tag LOCUS_05000 8432 7152 CDS product glycine/sarcosine/betaine reductase component B subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416871.1 protein_id gnl|my_center|LOCUS_05000 8906 8535 gene locus_tag LOCUS_05010 8906 8535 CDS product GrdX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897539.1 protein_id gnl|my_center|LOCUS_05010 9470 9374 gene locus_tag LOCUS_t00160 9470 9374 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 11427 9526 gene locus_tag LOCUS_05020 gene selB 11427 9526 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048014.1 protein_id gnl|my_center|LOCUS_05020 12824 11424 gene locus_tag LOCUS_05030 gene selA 12824 11424 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940143.1 protein_id gnl|my_center|LOCUS_05030 13215 14114 gene locus_tag LOCUS_05040 13215 14114 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813638.1 protein_id gnl|my_center|LOCUS_05040 14178 14468 gene locus_tag LOCUS_05050 14178 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 15173 14640 gene locus_tag LOCUS_05060 15173 14640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 15400 15476 gene locus_tag LOCUS_t00170 15400 15476 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15669 15742 gene locus_tag LOCUS_t00180 15669 15742 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 1413 364 gene locus_tag LOCUS_05070 1413 364 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208631126.1 protein_id gnl|my_center|LOCUS_05070 2476 1418 gene locus_tag LOCUS_05080 2476 1418 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404019.1 protein_id gnl|my_center|LOCUS_05080 3610 2621 gene locus_tag LOCUS_05090 3610 2621 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_05090 4028 5521 gene locus_tag LOCUS_05100 gene gguA 4028 5521 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582800.1 protein_id gnl|my_center|LOCUS_05100 5532 6503 gene locus_tag LOCUS_05110 5532 6503 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582801.1 protein_id gnl|my_center|LOCUS_05110 6582 7745 gene locus_tag LOCUS_05120 6582 7745 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_05120 7877 8359 gene locus_tag LOCUS_05130 7877 8359 CDS product RbsD/FucU domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993892.1 protein_id gnl|my_center|LOCUS_05130 8400 10193 gene locus_tag LOCUS_05140 gene fucI 8400 10193 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107686.1 protein_id gnl|my_center|LOCUS_05140 10272 11756 gene locus_tag LOCUS_05150 10272 11756 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258145.1 protein_id gnl|my_center|LOCUS_05150 11753 12628 gene locus_tag LOCUS_05160 gene srlD 11753 12628 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_05160 12638 13765 gene locus_tag LOCUS_05170 12638 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 13818 15083 gene locus_tag LOCUS_05180 13818 15083 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853188.1 protein_id gnl|my_center|LOCUS_05180 >Feature sequence026 1006 269 gene locus_tag LOCUS_05190 1006 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2019 1540 gene locus_tag LOCUS_05200 2019 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2837 2601 gene locus_tag LOCUS_05210 2837 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4132 3780 gene locus_tag LOCUS_tm00010 4132 3780 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 4629 4162 gene locus_tag LOCUS_05220 gene smpB 4629 4162 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_05220 6975 4660 gene locus_tag LOCUS_05230 gene rnr 6975 4660 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_05230 7291 7052 gene locus_tag LOCUS_05240 7291 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 8947 7403 gene locus_tag LOCUS_05250 gene gpmI 8947 7403 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948029.1 protein_id gnl|my_center|LOCUS_05250 9710 8958 gene locus_tag LOCUS_05260 gene tpiA 9710 8958 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_05260 10925 9738 gene locus_tag LOCUS_05270 10925 9738 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_05270 11122 11904 gene locus_tag LOCUS_05280 11122 11904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 12865 12113 gene locus_tag LOCUS_05290 12865 12113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 13920 12862 gene locus_tag LOCUS_05300 13920 12862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 14153 14671 gene locus_tag LOCUS_05310 14153 14671 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814119.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence027 317 1483 gene locus_tag LOCUS_05320 317 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2637 1882 gene locus_tag LOCUS_05330 2637 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2845 3513 gene locus_tag LOCUS_05340 gene hypB 2845 3513 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356857.1 protein_id gnl|my_center|LOCUS_05340 3556 6336 gene locus_tag LOCUS_05350 3556 6336 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948194.1 protein_id gnl|my_center|LOCUS_05350 6329 6673 gene locus_tag LOCUS_05360 6329 6673 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359645.1 protein_id gnl|my_center|LOCUS_05360 6714 7748 gene locus_tag LOCUS_05370 6714 7748 CDS product DUF5692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948196.1 protein_id gnl|my_center|LOCUS_05370 8477 9058 gene locus_tag LOCUS_05380 8477 9058 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583215.1 protein_id gnl|my_center|LOCUS_05380 9468 10409 gene locus_tag LOCUS_05390 9468 10409 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732701.1 protein_id gnl|my_center|LOCUS_05390 10406 11425 gene locus_tag LOCUS_05400 10406 11425 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968147.1 protein_id gnl|my_center|LOCUS_05400 11419 12192 gene locus_tag LOCUS_05410 11419 12192 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680085.1 protein_id gnl|my_center|LOCUS_05410 14446 12533 gene locus_tag LOCUS_05420 gene thrS 14446 12533 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048136.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence028 1574 558 gene locus_tag LOCUS_05430 1574 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 2940 1738 gene locus_tag LOCUS_05440 2940 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 4137 2965 gene locus_tag LOCUS_05450 4137 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5005 4538 gene locus_tag LOCUS_05460 5005 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 5611 6117 gene locus_tag LOCUS_05470 5611 6117 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964725.1 protein_id gnl|my_center|LOCUS_05470 8018 6849 gene locus_tag LOCUS_05480 8018 6849 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016536.1 protein_id gnl|my_center|LOCUS_05480 8208 7999 gene locus_tag LOCUS_05490 8208 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 9963 8233 gene locus_tag LOCUS_05500 9963 8233 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966678.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05500 10239 9985 gene locus_tag LOCUS_05510 10239 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 10349 11611 gene locus_tag LOCUS_05520 gene nhaC 10349 11611 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002484996.1 protein_id gnl|my_center|LOCUS_05520 11710 13773 gene locus_tag LOCUS_05530 11710 13773 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966678.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence029 462 644 gene locus_tag LOCUS_05540 462 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2506 716 gene locus_tag LOCUS_05550 gene nuoF 2506 716 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_05550 2908 2540 gene locus_tag LOCUS_05560 2908 2540 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_05560 3460 2912 gene locus_tag LOCUS_05570 3460 2912 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_05570 4182 3457 gene locus_tag LOCUS_05580 4182 3457 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_05580 4517 4182 gene locus_tag LOCUS_05590 4517 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_05590 5838 4552 gene locus_tag LOCUS_05600 5838 4552 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_05600 6294 5860 gene locus_tag LOCUS_05610 6294 5860 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869443.1 protein_id gnl|my_center|LOCUS_05610 6643 6287 gene locus_tag LOCUS_05620 6643 6287 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_05620 7161 6667 gene locus_tag LOCUS_05630 7161 6667 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868903.1 protein_id gnl|my_center|LOCUS_05630 8865 7471 gene locus_tag LOCUS_05640 8865 7471 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_05640 9257 10480 gene locus_tag LOCUS_05650 9257 10480 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_05650 11567 11355 gene locus_tag LOCUS_05660 11567 11355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 11787 11587 gene locus_tag LOCUS_05670 11787 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 11732 12079 gene locus_tag LOCUS_05680 11732 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 12072 13076 gene locus_tag LOCUS_05690 12072 13076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05690 13133 13939 gene locus_tag LOCUS_05700 13133 13939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05700 >Feature sequence030 1535 3 gene locus_tag LOCUS_05710 gene nupO 1535 3 CDS product guanosine ABC transporter ATP-binding protein NupO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228830.1 protein_id gnl|my_center|LOCUS_05710 1827 1549 gene locus_tag LOCUS_05720 1827 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05720 2476 1748 gene locus_tag LOCUS_05730 2476 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 2793 2479 gene locus_tag LOCUS_05740 2793 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2920 3006 gene locus_tag LOCUS_t00190 2920 3006 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3723 6230 gene locus_tag LOCUS_05750 3723 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 6233 6898 gene locus_tag LOCUS_05760 6233 6898 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020493338.1 protein_id gnl|my_center|LOCUS_05760 8122 7301 gene locus_tag LOCUS_05770 8122 7301 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681808.1 protein_id gnl|my_center|LOCUS_05770 9863 8514 gene locus_tag LOCUS_05780 9863 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 11042 10425 gene locus_tag LOCUS_05790 11042 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 11307 11975 gene locus_tag LOCUS_05800 gene rgbR 11307 11975 CDS product two-component system response regulator RgbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438019.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05800 13179 13838 gene locus_tag LOCUS_05810 13179 13838 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964814.1 protein_id gnl|my_center|LOCUS_05810 13835 14287 gene locus_tag LOCUS_05820 13835 14287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence031 1324 113 gene locus_tag LOCUS_05830 gene tuf 1324 113 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393939.1 protein_id gnl|my_center|LOCUS_05830 1498 1425 gene locus_tag LOCUS_t00200 1498 1425 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2777 1701 gene locus_tag LOCUS_05840 gene tsaD 2777 1701 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393644.1 protein_id gnl|my_center|LOCUS_05840 3475 2774 gene locus_tag LOCUS_05850 3475 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4214 3477 gene locus_tag LOCUS_05860 4214 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 4371 5351 gene locus_tag LOCUS_05870 4371 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 5897 6046 gene locus_tag LOCUS_05880 gene rpmG 5897 6046 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421192.1 protein_id gnl|my_center|LOCUS_05880 6061 6288 gene locus_tag LOCUS_05890 6061 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 6301 6816 gene locus_tag LOCUS_05900 gene nusG 6301 6816 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_05900 6937 7362 gene locus_tag LOCUS_05910 gene rplK 6937 7362 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_05910 7381 8070 gene locus_tag LOCUS_05920 gene rplA 7381 8070 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_05920 8270 8794 gene locus_tag LOCUS_05930 gene rplJ 8270 8794 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421187.1 protein_id gnl|my_center|LOCUS_05930 8828 9208 gene locus_tag LOCUS_05940 gene rplL 8828 9208 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_05940 9563 9967 gene locus_tag LOCUS_05950 9563 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 11060 10431 gene locus_tag LOCUS_05960 11060 10431 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694124.1 protein_id gnl|my_center|LOCUS_05960 11340 11044 gene locus_tag LOCUS_05970 11340 11044 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101717.1 protein_id gnl|my_center|LOCUS_05970 12214 11318 gene locus_tag LOCUS_05980 12214 11318 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066795.1 protein_id gnl|my_center|LOCUS_05980 12330 12521 gene locus_tag LOCUS_05990 12330 12521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 12596 13384 gene locus_tag LOCUS_06000 12596 13384 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680889.1 protein_id gnl|my_center|LOCUS_06000 13912 13559 gene locus_tag LOCUS_06010 13912 13559 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789114.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence032 2 75 gene locus_tag LOCUS_t00210 2 75 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 144 1028 gene locus_tag LOCUS_06020 144 1028 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_06020 2765 1233 gene locus_tag LOCUS_06030 2765 1233 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392093.1 protein_id gnl|my_center|LOCUS_06030 3800 2919 gene locus_tag LOCUS_06040 3800 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 4523 3801 gene locus_tag LOCUS_06050 4523 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5725 4574 gene locus_tag LOCUS_06060 gene rodA 5725 4574 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948344.1 protein_id gnl|my_center|LOCUS_06060 6865 5729 gene locus_tag LOCUS_06070 6865 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 8445 7018 gene locus_tag LOCUS_06080 8445 7018 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_06080 8556 9065 gene locus_tag LOCUS_06090 8556 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 10087 9143 gene locus_tag LOCUS_06100 10087 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 10672 10151 gene locus_tag LOCUS_06110 10672 10151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 11305 10676 gene locus_tag LOCUS_06120 11305 10676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 12163 11459 gene locus_tag LOCUS_06130 12163 11459 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966938.1 protein_id gnl|my_center|LOCUS_06130 12692 12156 gene locus_tag LOCUS_06140 12692 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 13244 13921 gene locus_tag LOCUS_06150 13244 13921 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence033 1356 490 gene locus_tag LOCUS_06160 1356 490 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428643.1 protein_id gnl|my_center|LOCUS_06160 2602 1349 gene locus_tag LOCUS_06170 gene aroA 2602 1349 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_06170 3620 2604 gene locus_tag LOCUS_06180 gene aroF 3620 2604 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439427.1 protein_id gnl|my_center|LOCUS_06180 4891 3617 gene locus_tag LOCUS_06190 4891 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 6021 4876 gene locus_tag LOCUS_06200 gene aroC 6021 4876 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861346.1 protein_id gnl|my_center|LOCUS_06200 7031 6018 gene locus_tag LOCUS_06210 gene aroB 7031 6018 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_06210 8106 7021 gene locus_tag LOCUS_06220 8106 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 9278 8127 gene locus_tag LOCUS_06230 9278 8127 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986546.1 protein_id gnl|my_center|LOCUS_06230 9696 11150 gene locus_tag LOCUS_06240 9696 11150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 12271 11213 gene locus_tag LOCUS_06250 12271 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 12469 12287 gene locus_tag LOCUS_06260 12469 12287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 12955 12880 gene locus_tag LOCUS_t00220 12955 12880 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13585 13136 gene locus_tag LOCUS_06270 13585 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence034 865 122 gene locus_tag LOCUS_06280 865 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 1653 862 gene locus_tag LOCUS_06290 1653 862 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028995.1 protein_id gnl|my_center|LOCUS_06290 2510 1650 gene locus_tag LOCUS_06300 2510 1650 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948769.1 protein_id gnl|my_center|LOCUS_06300 3748 2507 gene locus_tag LOCUS_06310 3748 2507 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948768.1 protein_id gnl|my_center|LOCUS_06310 4356 3745 gene locus_tag LOCUS_06320 4356 3745 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947813.1 protein_id gnl|my_center|LOCUS_06320 5134 4358 gene locus_tag LOCUS_06330 5134 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 5870 5127 gene locus_tag LOCUS_06340 5870 5127 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460538.1 protein_id gnl|my_center|LOCUS_06340 6420 5851 gene locus_tag LOCUS_06350 6420 5851 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405093.1 protein_id gnl|my_center|LOCUS_06350 6776 8101 gene locus_tag LOCUS_06360 6776 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 8221 8889 gene locus_tag LOCUS_06370 8221 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 9381 10787 gene locus_tag LOCUS_06380 9381 10787 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_06380 10822 11550 gene locus_tag LOCUS_06390 10822 11550 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_06390 12005 11784 gene locus_tag LOCUS_06400 gene acpP 12005 11784 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_06400 12192 13286 gene locus_tag LOCUS_06410 12192 13286 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392768.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence035 1426 8 gene locus_tag LOCUS_06420 1426 8 CDS product sodium/glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006194892.1 protein_id gnl|my_center|LOCUS_06420 2626 1454 gene locus_tag LOCUS_06430 2626 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 4126 2762 gene locus_tag LOCUS_06440 4126 2762 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110230.1 protein_id gnl|my_center|LOCUS_06440 4797 4123 gene locus_tag LOCUS_06450 4797 4123 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264517.1 protein_id gnl|my_center|LOCUS_06450 5253 5870 gene locus_tag LOCUS_06460 5253 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 6168 6653 gene locus_tag LOCUS_06470 6168 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 6657 8039 gene locus_tag LOCUS_06480 6657 8039 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_06480 9635 8370 gene locus_tag LOCUS_06490 9635 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 9935 11164 gene locus_tag LOCUS_06500 gene arcA 9935 11164 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385506.1 protein_id gnl|my_center|LOCUS_06500 11212 12204 gene locus_tag LOCUS_06510 gene argF 11212 12204 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682235.1 protein_id gnl|my_center|LOCUS_06510 12231 13325 gene locus_tag LOCUS_06520 12231 13325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462288.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence036 1168 125 gene locus_tag LOCUS_06530 gene recA 1168 125 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965121.1 protein_id gnl|my_center|LOCUS_06530 2512 1256 gene locus_tag LOCUS_06540 2512 1256 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948020.1 protein_id gnl|my_center|LOCUS_06540 3086 2532 gene locus_tag LOCUS_06550 gene pgsA 3086 2532 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362543.1 protein_id gnl|my_center|LOCUS_06550 4431 3124 gene locus_tag LOCUS_06560 gene rimO 4431 3124 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_06560 6947 4428 gene locus_tag LOCUS_06570 6947 4428 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272342.1 protein_id gnl|my_center|LOCUS_06570 7174 7485 gene locus_tag LOCUS_06580 7174 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 7492 7713 gene locus_tag LOCUS_06590 7492 7713 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066331.1 protein_id gnl|my_center|LOCUS_06590 8262 7795 gene locus_tag LOCUS_06600 8262 7795 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_06600 8707 8288 gene locus_tag LOCUS_06610 8707 8288 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462228.1 protein_id gnl|my_center|LOCUS_06610 10997 8700 gene locus_tag LOCUS_06620 10997 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 12509 11001 gene locus_tag LOCUS_06630 gene atpA 12509 11001 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966151.1 protein_id gnl|my_center|LOCUS_06630 13205 12522 gene locus_tag LOCUS_06640 13205 12522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence037 3614 4723 gene locus_tag LOCUS_06650 gene dnaN 3614 4723 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947896.1 protein_id gnl|my_center|LOCUS_06650 4858 5496 gene locus_tag LOCUS_06660 4858 5496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6962 5679 gene locus_tag LOCUS_06670 gene dnaA 6962 5679 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_06670 7679 7813 gene locus_tag LOCUS_06680 7679 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 8246 8596 gene locus_tag LOCUS_06690 gene rnpA 8246 8596 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359393.1 protein_id gnl|my_center|LOCUS_06690 8917 9831 gene locus_tag LOCUS_06700 8917 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 9828 10817 gene locus_tag LOCUS_06710 9828 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 11237 12508 gene locus_tag LOCUS_06720 gene mnmE 11237 12508 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence038 1165 2082 gene locus_tag LOCUS_06730 1165 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3234 2527 gene locus_tag LOCUS_06740 gene deoD 3234 2527 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160304.1 protein_id gnl|my_center|LOCUS_06740 4580 3240 gene locus_tag LOCUS_06750 gene rmuC 4580 3240 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_06750 5418 4627 gene locus_tag LOCUS_06760 gene truA 5418 4627 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_06760 5837 5415 gene locus_tag LOCUS_06770 5837 5415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 6656 5856 gene locus_tag LOCUS_06780 6656 5856 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860635.1 protein_id gnl|my_center|LOCUS_06780 7497 6649 gene locus_tag LOCUS_06790 7497 6649 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048350.1 protein_id gnl|my_center|LOCUS_06790 8294 7482 gene locus_tag LOCUS_06800 8294 7482 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393906.1 protein_id gnl|my_center|LOCUS_06800 8444 8809 gene locus_tag LOCUS_06810 8444 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 10462 9164 gene locus_tag LOCUS_06820 10462 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 11220 10459 gene locus_tag LOCUS_06830 gene larB 11220 10459 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435015.1 protein_id gnl|my_center|LOCUS_06830 11524 12012 gene locus_tag LOCUS_06840 11524 12012 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393622.1 protein_id gnl|my_center|LOCUS_06840 12025 12510 gene locus_tag LOCUS_06850 gene moaC 12025 12510 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417293.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence039 1517 648 gene locus_tag LOCUS_06860 gene folD 1517 648 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_06860 2461 1502 gene locus_tag LOCUS_06870 2461 1502 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272419.1 protein_id gnl|my_center|LOCUS_06870 2880 2461 gene locus_tag LOCUS_06880 gene nusB 2880 2461 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358828.1 protein_id gnl|my_center|LOCUS_06880 3123 2899 gene locus_tag LOCUS_06890 3123 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3713 3138 gene locus_tag LOCUS_06900 3713 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4253 3831 gene locus_tag LOCUS_06910 4253 3831 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358935.1 protein_id gnl|my_center|LOCUS_06910 4897 4358 gene locus_tag LOCUS_06920 4897 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5478 4894 gene locus_tag LOCUS_06930 5478 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 5651 5475 gene locus_tag LOCUS_06940 5651 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 6804 5656 gene locus_tag LOCUS_06950 6804 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 7193 6801 gene locus_tag LOCUS_06960 gene spoIIIAD 7193 6801 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_06960 7393 7196 gene locus_tag LOCUS_06970 gene spoIIIAC 7393 7196 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_06970 7903 7412 gene locus_tag LOCUS_06980 7903 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 8790 7903 gene locus_tag LOCUS_06990 gene spoIIIAA 8790 7903 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272423.1 protein_id gnl|my_center|LOCUS_06990 9546 8968 gene locus_tag LOCUS_07000 9546 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 10705 9866 gene locus_tag LOCUS_07010 gene pgeF 10705 9866 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392375.1 protein_id gnl|my_center|LOCUS_07010 11162 10707 gene locus_tag LOCUS_07020 gene nrdR 11162 10707 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_07020 11494 11252 gene locus_tag LOCUS_07030 11494 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 11933 11697 gene locus_tag LOCUS_07040 11933 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 <12985 11993 gene locus_tag LOCUS_07050 <12985 11993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808755.1:methyltransferase domain-containing protein >Feature sequence040 480 890 gene locus_tag LOCUS_07060 gene dtd 480 890 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_07060 951 1595 gene locus_tag LOCUS_07070 951 1595 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_07070 1589 3073 gene locus_tag LOCUS_07080 1589 3073 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_07080 4942 3668 gene locus_tag LOCUS_07090 4942 3668 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963605.1 protein_id gnl|my_center|LOCUS_07090 5667 5065 gene locus_tag LOCUS_07100 gene mocA 5667 5065 CDS product molybdenum cofactor cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890188.1 protein_id gnl|my_center|LOCUS_07100 7025 5664 gene locus_tag LOCUS_07110 gene hydA 7025 5664 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387141.1 protein_id gnl|my_center|LOCUS_07110 7460 9151 gene locus_tag LOCUS_07120 gene ade 7460 9151 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439445.1 protein_id gnl|my_center|LOCUS_07120 9165 11447 gene locus_tag LOCUS_07130 gene xdhA 9165 11447 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_07130 11463 12344 gene locus_tag LOCUS_07140 gene xdhB 11463 12344 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393457.1 protein_id gnl|my_center|LOCUS_07140 12344 12841 gene locus_tag LOCUS_07150 12344 12841 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393456.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence041 99 311 gene locus_tag LOCUS_07160 99 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 490 308 gene locus_tag LOCUS_07170 490 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1791 496 gene locus_tag LOCUS_07180 1791 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2902 1778 gene locus_tag LOCUS_07190 2902 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 4593 2899 gene locus_tag LOCUS_07200 4593 2899 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048527824.1 protein_id gnl|my_center|LOCUS_07200 6005 4872 gene locus_tag LOCUS_07210 6005 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 9015 6019 gene locus_tag LOCUS_07220 9015 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 9176 9868 gene locus_tag LOCUS_07230 gene yunB 9176 9868 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_07230 9922 10785 gene locus_tag LOCUS_07240 9922 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 11811 11074 gene locus_tag LOCUS_07250 gene sigF 11811 11074 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_07250 12265 11804 gene locus_tag LOCUS_07260 gene spoIIAB 12265 11804 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357714.1 protein_id gnl|my_center|LOCUS_07260 12578 12237 gene locus_tag LOCUS_07270 gene spoIIAA 12578 12237 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965605.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence042 89 325 gene locus_tag LOCUS_07280 89 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 515 1084 gene locus_tag LOCUS_07290 515 1084 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291442.1 protein_id gnl|my_center|LOCUS_07290 1918 1103 gene locus_tag LOCUS_07300 1918 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3838 1940 gene locus_tag LOCUS_07310 3838 1940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459544.1 protein_id gnl|my_center|LOCUS_07310 5576 3831 gene locus_tag LOCUS_07320 5576 3831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_07320 6489 6253 gene locus_tag LOCUS_07330 6489 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6903 6700 gene locus_tag LOCUS_07340 6903 6700 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_07340 7142 6948 gene locus_tag LOCUS_07350 7142 6948 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_07350 7481 7840 gene locus_tag LOCUS_07360 7481 7840 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395974.1 protein_id gnl|my_center|LOCUS_07360 7907 9538 gene locus_tag LOCUS_07370 7907 9538 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004440884.1 protein_id gnl|my_center|LOCUS_07370 9631 11562 gene locus_tag LOCUS_07380 gene recG 9631 11562 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228555.1 protein_id gnl|my_center|LOCUS_07380 11618 12028 gene locus_tag LOCUS_07390 11618 12028 CDS product ester cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971103.1 protein_id gnl|my_center|LOCUS_07390 12272 12727 gene locus_tag LOCUS_07400 12272 12727 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627840.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence043 1370 756 gene locus_tag LOCUS_07410 1370 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07410 1390 1692 gene locus_tag LOCUS_07420 1390 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1945 1787 gene locus_tag LOCUS_07430 1945 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1950 2480 gene locus_tag LOCUS_07440 1950 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2520 3755 gene locus_tag LOCUS_07450 gene rhaA 2520 3755 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244294.1 protein_id gnl|my_center|LOCUS_07450 3765 4748 gene locus_tag LOCUS_07460 3765 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4883 5755 gene locus_tag LOCUS_07470 gene srlD 4883 5755 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_07470 5766 6929 gene locus_tag LOCUS_07480 5766 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 6967 8223 gene locus_tag LOCUS_07490 6967 8223 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815633.1 protein_id gnl|my_center|LOCUS_07490 9304 8510 gene locus_tag LOCUS_07500 9304 8510 CDS product carbon-nitrogen family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101003.1 protein_id gnl|my_center|LOCUS_07500 11596 9323 gene locus_tag LOCUS_07510 11596 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 12658 11963 gene locus_tag LOCUS_07520 12658 11963 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence044 502 77 gene locus_tag LOCUS_07530 502 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 704 507 gene locus_tag LOCUS_07540 704 507 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001843884.1 protein_id gnl|my_center|LOCUS_07540 874 1779 gene locus_tag LOCUS_07550 874 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3208 2081 gene locus_tag LOCUS_07560 3208 2081 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_07560 5025 3352 gene locus_tag LOCUS_07570 gene lonB 5025 3352 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357503.1 protein_id gnl|my_center|LOCUS_07570 6811 5414 gene locus_tag LOCUS_07580 6811 5414 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_07580 8197 6920 gene locus_tag LOCUS_07590 gene clpX 8197 6920 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_07590 8788 8201 gene locus_tag LOCUS_07600 gene clpP 8788 8201 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417102.1 protein_id gnl|my_center|LOCUS_07600 10216 8834 gene locus_tag LOCUS_07610 gene tig 10216 8834 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_07610 10692 11192 gene locus_tag LOCUS_07620 10692 11192 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_07620 11189 11686 gene locus_tag LOCUS_07630 gene queF 11189 11686 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001986050.1 protein_id gnl|my_center|LOCUS_07630 12072 12272 gene locus_tag LOCUS_07640 12072 12272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07640 >Feature sequence045 554 1633 gene locus_tag LOCUS_07650 gene mglB 554 1633 CDS product galactose/glucose ABC transporter substrate-binding protein MglB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881084.1 protein_id gnl|my_center|LOCUS_07650 1744 3249 gene locus_tag LOCUS_07660 gene mglA 1744 3249 CDS product galactose/methyl galactoside ABC transporter ATP-binding protein MglA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255020.1 protein_id gnl|my_center|LOCUS_07660 3262 4263 gene locus_tag LOCUS_07670 gene mglC 3262 4263 CDS product galactose/methyl galactoside ABC transporter permease MglC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340252.1 protein_id gnl|my_center|LOCUS_07670 4288 5307 gene locus_tag LOCUS_07680 4288 5307 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582593.1 protein_id gnl|my_center|LOCUS_07680 5414 7075 gene locus_tag LOCUS_07690 5414 7075 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641784.1 protein_id gnl|my_center|LOCUS_07690 7346 8629 gene locus_tag LOCUS_07700 gene galK 7346 8629 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456582.1 protein_id gnl|my_center|LOCUS_07700 8633 9631 gene locus_tag LOCUS_07710 gene galE 8633 9631 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966243.1 protein_id gnl|my_center|LOCUS_07710 9638 11131 gene locus_tag LOCUS_07720 gene galT 9638 11131 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966244.1 protein_id gnl|my_center|LOCUS_07720 11205 12380 gene locus_tag LOCUS_07730 11205 12380 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence046 769 227 gene locus_tag LOCUS_07740 gene hpt 769 227 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356260.1 protein_id gnl|my_center|LOCUS_07740 2128 773 gene locus_tag LOCUS_07750 gene tilS 2128 773 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_07750 2264 3352 gene locus_tag LOCUS_07760 gene ychF 2264 3352 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_07760 4247 3948 gene locus_tag LOCUS_07770 4247 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 5488 4208 gene locus_tag LOCUS_07780 5488 4208 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_07780 5735 6283 gene locus_tag LOCUS_07790 5735 6283 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774866.1 protein_id gnl|my_center|LOCUS_07790 6280 6789 gene locus_tag LOCUS_07800 6280 6789 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963792.1 protein_id gnl|my_center|LOCUS_07800 6832 7539 gene locus_tag LOCUS_07810 6832 7539 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_07810 7796 7617 gene locus_tag LOCUS_07820 7796 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 7933 8424 gene locus_tag LOCUS_07830 7933 8424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 8361 8549 gene locus_tag LOCUS_07840 8361 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 8739 8951 gene locus_tag LOCUS_07850 8739 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 10743 9262 gene locus_tag LOCUS_07860 10743 9262 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_07860 10977 11495 gene locus_tag LOCUS_07870 10977 11495 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_07870 11488 12297 gene locus_tag LOCUS_07880 11488 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence047 1437 3224 gene locus_tag LOCUS_07890 gene pepF 1437 3224 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_07890 3252 3566 gene locus_tag LOCUS_07900 3252 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3602 4900 gene locus_tag LOCUS_07910 3602 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5158 5715 gene locus_tag LOCUS_07920 5158 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 6123 5806 gene locus_tag LOCUS_07930 6123 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 6451 6161 gene locus_tag LOCUS_07940 6451 6161 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_07940 7244 6465 gene locus_tag LOCUS_07950 7244 6465 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_07950 7908 7255 gene locus_tag LOCUS_07960 7908 7255 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303625.1 protein_id gnl|my_center|LOCUS_07960 8918 8037 gene locus_tag LOCUS_07970 8918 8037 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948208.1 protein_id gnl|my_center|LOCUS_07970 9237 10571 gene locus_tag LOCUS_07980 9237 10571 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_07980 10694 11632 gene locus_tag LOCUS_07990 10694 11632 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643925.1 protein_id gnl|my_center|LOCUS_07990 <12370 11830 gene locus_tag LOCUS_08000 <12370 11830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583959.1:epoxyqueuosine reductase QueH >Feature sequence048 198 428 gene locus_tag LOCUS_08010 198 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 1017 604 gene locus_tag LOCUS_08020 1017 604 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964881.1 protein_id gnl|my_center|LOCUS_08020 1553 1017 gene locus_tag LOCUS_08030 1553 1017 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860885.1 protein_id gnl|my_center|LOCUS_08030 2591 1944 gene locus_tag LOCUS_08040 gene rpe 2591 1944 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_08040 3417 2584 gene locus_tag LOCUS_08050 gene rsgA 3417 2584 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113935.1 protein_id gnl|my_center|LOCUS_08050 5317 3461 gene locus_tag LOCUS_08060 gene pknB 5317 3461 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392429.1 protein_id gnl|my_center|LOCUS_08060 6039 5314 gene locus_tag LOCUS_08070 6039 5314 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564704.1 protein_id gnl|my_center|LOCUS_08070 7100 6036 gene locus_tag LOCUS_08080 gene rlmN 7100 6036 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965033.1 protein_id gnl|my_center|LOCUS_08080 8400 7093 gene locus_tag LOCUS_08090 gene rsmB 8400 7093 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001249665.1 protein_id gnl|my_center|LOCUS_08090 9329 8397 gene locus_tag LOCUS_08100 gene fmt 9329 8397 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_08100 9814 9326 gene locus_tag LOCUS_08110 gene def 9814 9326 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_08110 12188 9921 gene locus_tag LOCUS_08120 gene priA 12188 9921 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232079.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence049 1 189 gene locus_tag LOCUS_08130 1 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 461 153 gene locus_tag LOCUS_08140 461 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1155 505 gene locus_tag LOCUS_08150 1155 505 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_08150 1797 1159 gene locus_tag LOCUS_08160 1797 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2552 1902 gene locus_tag LOCUS_08170 2552 1902 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_08170 2962 3189 gene locus_tag LOCUS_08180 2962 3189 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_08180 3186 5066 gene locus_tag LOCUS_08190 3186 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6166 5285 gene locus_tag LOCUS_08200 6166 5285 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082369.1 protein_id gnl|my_center|LOCUS_08200 7155 6163 gene locus_tag LOCUS_08210 gene hflK 7155 6163 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_08210 8284 7454 gene locus_tag LOCUS_08220 8284 7454 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_08220 9045 8281 gene locus_tag LOCUS_08230 9045 8281 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_08230 9959 9042 gene locus_tag LOCUS_08240 9959 9042 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943615.1 protein_id gnl|my_center|LOCUS_08240 10883 9999 gene locus_tag LOCUS_08250 10883 9999 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874373.1 protein_id gnl|my_center|LOCUS_08250 12224 11325 gene locus_tag LOCUS_08260 12224 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 >Feature sequence050 1607 213 gene locus_tag LOCUS_08270 1607 213 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048415.1 protein_id gnl|my_center|LOCUS_08270 2132 1650 gene locus_tag LOCUS_08280 2132 1650 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_08280 2998 2129 gene locus_tag LOCUS_08290 2998 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08290 5327 3003 gene locus_tag LOCUS_08300 5327 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08300 5659 6894 gene locus_tag LOCUS_08310 5659 6894 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970214.1 protein_id gnl|my_center|LOCUS_08310 8246 7131 gene locus_tag LOCUS_08320 8246 7131 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_08320 9288 8266 gene locus_tag LOCUS_08330 9288 8266 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_08330 9793 10950 gene locus_tag LOCUS_08340 gene codB 9793 10950 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986589.1 protein_id gnl|my_center|LOCUS_08340 11201 12139 gene locus_tag LOCUS_08350 gene arcC 11201 12139 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869022.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence051 1659 799 gene locus_tag LOCUS_08360 gene rsmI 1659 799 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_08360 2330 1683 gene locus_tag LOCUS_08370 2330 1683 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087456344.1 protein_id gnl|my_center|LOCUS_08370 2567 3487 gene locus_tag LOCUS_08380 2567 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 4082 3567 gene locus_tag LOCUS_08390 4082 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5757 4441 gene locus_tag LOCUS_08400 5757 4441 CDS product nucleobase:cation symporter-2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893433.1 protein_id gnl|my_center|LOCUS_08400 7118 6348 gene locus_tag LOCUS_08410 7118 6348 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966271.1 protein_id gnl|my_center|LOCUS_08410 8081 7122 gene locus_tag LOCUS_08420 gene gpsA 8081 7122 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_08420 9820 8078 gene locus_tag LOCUS_08430 9820 8078 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438014.1 protein_id gnl|my_center|LOCUS_08430 10560 9910 gene locus_tag LOCUS_08440 10560 9910 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_08440 11365 10664 gene locus_tag LOCUS_08450 11365 10664 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001006715.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence052 616 347 gene locus_tag LOCUS_08460 616 347 CDS product zinc-ribbon domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815560.1 protein_id gnl|my_center|LOCUS_08460 1523 963 gene locus_tag LOCUS_08470 1523 963 CDS product TIGR01440 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228042.1 protein_id gnl|my_center|LOCUS_08470 1832 4297 gene locus_tag LOCUS_08480 gene feoB 1832 4297 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_08480 4456 4986 gene locus_tag LOCUS_08490 gene raiA 4456 4986 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_08490 5291 7591 gene locus_tag LOCUS_08500 5291 7591 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_08500 7602 8111 gene locus_tag LOCUS_08510 gene nrdG 7602 8111 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_08510 9378 8434 gene locus_tag LOCUS_08520 gene arcC 9378 8434 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869022.1 protein_id gnl|my_center|LOCUS_08520 10793 9396 gene locus_tag LOCUS_08530 gene hydA 10793 9396 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_08530 11852 10812 gene locus_tag LOCUS_08540 gene ltaE 11852 10812 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence053 23 646 gene locus_tag LOCUS_08550 23 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 690 1346 gene locus_tag LOCUS_08560 690 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1990 1343 gene locus_tag LOCUS_08570 1990 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2939 1995 gene locus_tag LOCUS_08580 2939 1995 CDS product ROK family glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014942.1 protein_id gnl|my_center|LOCUS_08580 3920 3006 gene locus_tag LOCUS_08590 gene hprK 3920 3006 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964404.1 protein_id gnl|my_center|LOCUS_08590 4725 3925 gene locus_tag LOCUS_08600 4725 3925 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000221392.1 protein_id gnl|my_center|LOCUS_08600 6617 4779 gene locus_tag LOCUS_08610 gene uvrC 6617 4779 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391800.1 protein_id gnl|my_center|LOCUS_08610 6805 6632 gene locus_tag LOCUS_08620 6805 6632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 7270 6932 gene locus_tag LOCUS_08630 7270 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 9785 7407 gene locus_tag LOCUS_08640 gene malP 9785 7407 CDS product maltodextrin phosphorylase MalP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858869.1 protein_id gnl|my_center|LOCUS_08640 10134 10601 gene locus_tag LOCUS_08650 10134 10601 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861494.1 protein_id gnl|my_center|LOCUS_08650 11486 10728 gene locus_tag LOCUS_08660 11486 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence054 138 1868 gene locus_tag LOCUS_08670 138 1868 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_08670 1888 2886 gene locus_tag LOCUS_08680 1888 2886 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114445.1 protein_id gnl|my_center|LOCUS_08680 2917 3945 gene locus_tag LOCUS_08690 2917 3945 CDS product succinylglutamate desuccinylase/aspartoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071748.1 protein_id gnl|my_center|LOCUS_08690 4003 5622 gene locus_tag LOCUS_08700 4003 5622 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_08700 5690 6610 gene locus_tag LOCUS_08710 gene gsiC 5690 6610 CDS product glutathione ABC transporter permease GsiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813715.1 protein_id gnl|my_center|LOCUS_08710 6625 7461 gene locus_tag LOCUS_08720 6625 7461 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583225.1 protein_id gnl|my_center|LOCUS_08720 7473 8462 gene locus_tag LOCUS_08730 7473 8462 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_08730 8455 9444 gene locus_tag LOCUS_08740 8455 9444 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459112.1 protein_id gnl|my_center|LOCUS_08740 9556 10728 gene locus_tag LOCUS_08750 gene pepQ 9556 10728 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249918.1 protein_id gnl|my_center|LOCUS_08750 11014 11562 gene locus_tag LOCUS_08760 11014 11562 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000581032.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence055 <1 805 gene locus_tag LOCUS_08770 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460924.1:class I SAM-dependent methyltransferase 838 2034 gene locus_tag LOCUS_08780 838 2034 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461416.1 protein_id gnl|my_center|LOCUS_08780 2036 2557 gene locus_tag LOCUS_08790 2036 2557 CDS product nucleoside-triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816401.1 protein_id gnl|my_center|LOCUS_08790 4759 2882 gene locus_tag LOCUS_08800 4759 2882 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458920.1 protein_id gnl|my_center|LOCUS_08800 4950 5513 gene locus_tag LOCUS_08810 4950 5513 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181706.1 protein_id gnl|my_center|LOCUS_08810 6330 5779 gene locus_tag LOCUS_08820 6330 5779 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391311.1 protein_id gnl|my_center|LOCUS_08820 6442 7020 gene locus_tag LOCUS_08830 6442 7020 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121269.1 protein_id gnl|my_center|LOCUS_08830 8363 7617 gene locus_tag LOCUS_08840 8363 7617 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202637.1 protein_id gnl|my_center|LOCUS_08840 9350 8376 gene locus_tag LOCUS_08850 9350 8376 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288289.1 protein_id gnl|my_center|LOCUS_08850 9792 9457 gene locus_tag LOCUS_08860 9792 9457 CDS product cyclophilin-like fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681342.1 protein_id gnl|my_center|LOCUS_08860 10214 9975 gene locus_tag LOCUS_08870 10214 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 10480 11385 gene locus_tag LOCUS_08880 10480 11385 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence056 <1 689 gene locus_tag LOCUS_08890 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933862.1:glycosyltransferase family 2 protein 2481 832 gene locus_tag LOCUS_08900 2481 832 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_08900 3155 2478 gene locus_tag LOCUS_08910 3155 2478 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000638639.1 protein_id gnl|my_center|LOCUS_08910 3820 3152 gene locus_tag LOCUS_08920 gene phoU 3820 3152 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941756.1 protein_id gnl|my_center|LOCUS_08920 4569 3820 gene locus_tag LOCUS_08930 gene pstB 4569 3820 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_08930 5472 4573 gene locus_tag LOCUS_08940 gene pstA 5472 4573 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_08940 6320 5469 gene locus_tag LOCUS_08950 gene pstC 6320 5469 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_08950 7376 6399 gene locus_tag LOCUS_08960 7376 6399 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_08960 7685 8590 gene locus_tag LOCUS_08970 7685 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 8679 10355 gene locus_tag LOCUS_08980 8679 10355 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986398.1 protein_id gnl|my_center|LOCUS_08980 10348 11523 gene locus_tag LOCUS_08990 10348 11523 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence057 <1 598 gene locus_tag LOCUS_09000 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002263032.1:DeoR/GlpR family DNA-binding transcription regulator 752 1483 gene locus_tag LOCUS_09010 752 1483 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_09010 2612 1488 gene locus_tag LOCUS_09020 2612 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2706 3224 gene locus_tag LOCUS_09030 2706 3224 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458839.1 protein_id gnl|my_center|LOCUS_09030 4475 3438 gene locus_tag LOCUS_09040 4475 3438 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680857.1 protein_id gnl|my_center|LOCUS_09040 6233 4590 gene locus_tag LOCUS_09050 6233 4590 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939525.1 protein_id gnl|my_center|LOCUS_09050 9086 6585 gene locus_tag LOCUS_09060 9086 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 10516 9083 gene locus_tag LOCUS_09070 10516 9083 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_09070 11489 10602 gene locus_tag LOCUS_09080 11489 10602 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence058 1770 256 gene locus_tag LOCUS_09090 1770 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2002 2871 gene locus_tag LOCUS_09100 2002 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3293 2808 gene locus_tag LOCUS_09110 3293 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 3547 4161 gene locus_tag LOCUS_09120 3547 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 4347 5273 gene locus_tag LOCUS_09130 4347 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 5667 5473 gene locus_tag LOCUS_09140 5667 5473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 5967 5731 gene locus_tag LOCUS_09150 5967 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 6315 7307 gene locus_tag LOCUS_09160 6315 7307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 9287 7950 gene locus_tag LOCUS_09170 gene mgtE 9287 7950 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_09170 9392 9712 gene locus_tag LOCUS_09180 9392 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 11111 9852 gene locus_tag LOCUS_09190 11111 9852 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047697.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence059 <1 1982 gene locus_tag LOCUS_09200 <1 1982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391556.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 1975 4389 gene locus_tag LOCUS_09210 gene gyrA 1975 4389 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361457.1 protein_id gnl|my_center|LOCUS_09210 4449 5060 gene locus_tag LOCUS_09220 4449 5060 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_09220 5092 6816 gene locus_tag LOCUS_09230 gene rqcH 5092 6816 CDS product tRNA modification protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886504.1 protein_id gnl|my_center|LOCUS_09230 6899 7852 gene locus_tag LOCUS_09240 6899 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 7887 8501 gene locus_tag LOCUS_09250 7887 8501 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641531.1 protein_id gnl|my_center|LOCUS_09250 8486 8959 gene locus_tag LOCUS_09260 8486 8959 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357651.1 protein_id gnl|my_center|LOCUS_09260 10000 9179 gene locus_tag LOCUS_09270 10000 9179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_09270 10739 9990 gene locus_tag LOCUS_09280 10739 9990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357525.1 protein_id gnl|my_center|LOCUS_09280 11241 10903 gene locus_tag LOCUS_09290 11241 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence060 743 156 gene locus_tag LOCUS_09300 743 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1179 3005 gene locus_tag LOCUS_09310 1179 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4456 3074 gene locus_tag LOCUS_09320 gene asnS 4456 3074 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432161.1 protein_id gnl|my_center|LOCUS_09320 4614 5633 gene locus_tag LOCUS_09330 4614 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 6335 5796 gene locus_tag LOCUS_09340 6335 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 6726 6352 gene locus_tag LOCUS_09350 6726 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7973 6732 gene locus_tag LOCUS_09360 7973 6732 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345604.1 protein_id gnl|my_center|LOCUS_09360 8340 9161 gene locus_tag LOCUS_09370 8340 9161 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965364.1 protein_id gnl|my_center|LOCUS_09370 9161 10477 gene locus_tag LOCUS_09380 9161 10477 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_09380 10486 11145 gene locus_tag LOCUS_09390 10486 11145 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810750.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence061 582 1772 gene locus_tag LOCUS_09400 582 1772 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_09400 3848 2646 gene locus_tag LOCUS_09410 3848 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4642 3995 gene locus_tag LOCUS_09420 4642 3995 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_09420 4761 6098 gene locus_tag LOCUS_09430 4761 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 7142 6504 gene locus_tag LOCUS_09440 7142 6504 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357537.1 protein_id gnl|my_center|LOCUS_09440 8003 7260 gene locus_tag LOCUS_09450 8003 7260 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964066.1 protein_id gnl|my_center|LOCUS_09450 10829 8007 gene locus_tag LOCUS_09460 gene uvrA 10829 8007 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence062 729 244 gene locus_tag LOCUS_09470 729 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1131 790 gene locus_tag LOCUS_09480 1131 790 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890395.1 protein_id gnl|my_center|LOCUS_09480 1271 1846 gene locus_tag LOCUS_09490 1271 1846 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811525.1 protein_id gnl|my_center|LOCUS_09490 2138 3613 gene locus_tag LOCUS_09500 2138 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3827 4606 gene locus_tag LOCUS_09510 3827 4606 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986756.1 protein_id gnl|my_center|LOCUS_09510 4695 4786 gene locus_tag LOCUS_t00230 4695 4786 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4987 6291 gene locus_tag LOCUS_09520 4987 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 7692 6475 gene locus_tag LOCUS_09530 7692 6475 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461660.1 protein_id gnl|my_center|LOCUS_09530 7873 8784 gene locus_tag LOCUS_09540 7873 8784 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338796.1 protein_id gnl|my_center|LOCUS_09540 8822 10858 gene locus_tag LOCUS_09550 8822 10858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence063 4007 2946 gene locus_tag LOCUS_09560 gene ispG 4007 2946 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_09560 5049 4009 gene locus_tag LOCUS_09570 gene rseP 5049 4009 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810655.1 protein_id gnl|my_center|LOCUS_09570 6147 5059 gene locus_tag LOCUS_09580 gene dxr 6147 5059 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919783.1 protein_id gnl|my_center|LOCUS_09580 7049 6240 gene locus_tag LOCUS_09590 7049 6240 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434000.1 protein_id gnl|my_center|LOCUS_09590 7778 7059 gene locus_tag LOCUS_09600 7778 7059 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531758.1 protein_id gnl|my_center|LOCUS_09600 8339 8133 gene locus_tag LOCUS_09610 8339 8133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 8890 8339 gene locus_tag LOCUS_09620 gene frr 8890 8339 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986799.1 protein_id gnl|my_center|LOCUS_09620 9841 9131 gene locus_tag LOCUS_09630 gene pyrH 9841 9131 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_09630 10838 9942 gene locus_tag LOCUS_09640 gene tsf 10838 9942 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733232.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence064 722 1396 gene locus_tag LOCUS_09650 722 1396 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943969.1 protein_id gnl|my_center|LOCUS_09650 1393 2607 gene locus_tag LOCUS_09660 1393 2607 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814514.1 protein_id gnl|my_center|LOCUS_09660 3141 7052 gene locus_tag LOCUS_09670 3141 7052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 7728 7174 gene locus_tag LOCUS_09680 7728 7174 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357340.1 protein_id gnl|my_center|LOCUS_09680 9324 7804 gene locus_tag LOCUS_09690 9324 7804 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456912.1 protein_id gnl|my_center|LOCUS_09690 10257 9337 gene locus_tag LOCUS_09700 10257 9337 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_09700 <10948 10260 gene locus_tag LOCUS_09710 <10948 10260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723915.1:ABC transporter permease >Feature sequence065 1005 625 gene locus_tag LOCUS_09720 1005 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 1277 1002 gene locus_tag LOCUS_09730 1277 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2451 1402 gene locus_tag LOCUS_09740 2451 1402 CDS product endonuclease subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387048.1 protein_id gnl|my_center|LOCUS_09740 3055 2636 gene locus_tag LOCUS_09750 3055 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4392 3196 gene locus_tag LOCUS_09760 4392 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 6165 4414 gene locus_tag LOCUS_09770 6165 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 6653 6459 gene locus_tag LOCUS_09780 6653 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 7167 8936 gene locus_tag LOCUS_09790 7167 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 9106 9738 gene locus_tag LOCUS_09800 gene pth 9106 9738 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence066 <1 830 gene locus_tag LOCUS_09810 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393024.1:exodeoxyribonuclease VII large subunit 796 1020 gene locus_tag LOCUS_09820 796 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1017 1904 gene locus_tag LOCUS_09830 1017 1904 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_09830 1922 3772 gene locus_tag LOCUS_09840 gene dxs 1922 3772 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393020.1 protein_id gnl|my_center|LOCUS_09840 3769 4608 gene locus_tag LOCUS_09850 3769 4608 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438136.1 protein_id gnl|my_center|LOCUS_09850 4671 5477 gene locus_tag LOCUS_09860 4671 5477 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_09860 5522 5974 gene locus_tag LOCUS_09870 5522 5974 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986439.1 protein_id gnl|my_center|LOCUS_09870 5981 7684 gene locus_tag LOCUS_09880 gene recN 5981 7684 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_09880 7832 9061 gene locus_tag LOCUS_09890 gene spoIVB 7832 9061 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398697.1 protein_id gnl|my_center|LOCUS_09890 9365 10138 gene locus_tag LOCUS_09900 9365 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence067 902 297 gene locus_tag LOCUS_09910 902 297 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305518.1 protein_id gnl|my_center|LOCUS_09910 1178 1483 gene locus_tag LOCUS_09920 1178 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 2035 2277 gene locus_tag LOCUS_09930 2035 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4390 2399 gene locus_tag LOCUS_09940 4390 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5017 4418 gene locus_tag LOCUS_09950 5017 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 7926 5041 gene locus_tag LOCUS_09960 7926 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 9598 8123 gene locus_tag LOCUS_09970 9598 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 <10851 9676 gene locus_tag LOCUS_09980 <10851 9676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941639.1:ATP-binding protein >Feature sequence068 2424 1660 gene locus_tag LOCUS_09990 2424 1660 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405060.1 protein_id gnl|my_center|LOCUS_09990 3645 2428 gene locus_tag LOCUS_10000 gene glmU 3645 2428 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048387.1 protein_id gnl|my_center|LOCUS_10000 5001 3823 gene locus_tag LOCUS_10010 5001 3823 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_10010 5484 5221 gene locus_tag LOCUS_10020 5484 5221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 5739 5527 gene locus_tag LOCUS_10030 5739 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6370 5828 gene locus_tag LOCUS_10040 6370 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 8566 6605 gene locus_tag LOCUS_10050 8566 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8765 10618 gene locus_tag LOCUS_10060 8765 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence069 928 239 gene locus_tag LOCUS_10070 928 239 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127552.1 protein_id gnl|my_center|LOCUS_10070 1912 962 gene locus_tag LOCUS_10080 1912 962 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_10080 2919 1912 gene locus_tag LOCUS_10090 2919 1912 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_10090 3724 2933 gene locus_tag LOCUS_10100 3724 2933 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_10100 4760 3828 gene locus_tag LOCUS_10110 4760 3828 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_10110 6538 4910 gene locus_tag LOCUS_10120 6538 4910 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016360.1 protein_id gnl|my_center|LOCUS_10120 6942 8714 gene locus_tag LOCUS_10130 6942 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10130 8711 8887 gene locus_tag LOCUS_10140 8711 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 8891 10246 gene locus_tag LOCUS_10150 gene atoC 8891 10246 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125298.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence070 2514 316 gene locus_tag LOCUS_10160 2514 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2867 2511 gene locus_tag LOCUS_10170 2867 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3193 3636 gene locus_tag LOCUS_10180 3193 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4087 3938 gene locus_tag LOCUS_10190 4087 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5215 4100 gene locus_tag LOCUS_10200 5215 4100 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_10200 5640 6167 gene locus_tag LOCUS_10210 5640 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 6201 7394 gene locus_tag LOCUS_10220 6201 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 7498 7779 gene locus_tag LOCUS_10230 7498 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 7792 8334 gene locus_tag LOCUS_10240 7792 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 8339 9760 gene locus_tag LOCUS_10250 8339 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 9757 9936 gene locus_tag LOCUS_10260 9757 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence071 1135 428 gene locus_tag LOCUS_10270 1135 428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_10270 1970 1137 gene locus_tag LOCUS_10280 1970 1137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003488339.1 protein_id gnl|my_center|LOCUS_10280 2973 1963 gene locus_tag LOCUS_10290 2973 1963 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_10290 3868 2984 gene locus_tag LOCUS_10300 3868 2984 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262676.1 protein_id gnl|my_center|LOCUS_10300 5078 3954 gene locus_tag LOCUS_10310 5078 3954 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399632.1 protein_id gnl|my_center|LOCUS_10310 5734 6744 gene locus_tag LOCUS_10320 gene speB 5734 6744 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894987.1 protein_id gnl|my_center|LOCUS_10320 6901 8331 gene locus_tag LOCUS_10330 gene glnA 6901 8331 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_10330 8397 9302 gene locus_tag LOCUS_10340 8397 9302 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925921.1 protein_id gnl|my_center|LOCUS_10340 9350 10069 gene locus_tag LOCUS_10350 9350 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 10066 10302 gene locus_tag LOCUS_10360 10066 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10360 10224 10487 gene locus_tag LOCUS_10370 10224 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10370 >Feature sequence072 134 460 gene locus_tag LOCUS_10380 134 460 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002292340.1 protein_id gnl|my_center|LOCUS_10380 464 1381 gene locus_tag LOCUS_10390 gene holB 464 1381 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097115.1 protein_id gnl|my_center|LOCUS_10390 1388 2461 gene locus_tag LOCUS_10400 1388 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2517 2687 gene locus_tag LOCUS_10410 2517 2687 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_10410 2818 4188 gene locus_tag LOCUS_10420 2818 4188 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022042.1 protein_id gnl|my_center|LOCUS_10420 5182 4277 gene locus_tag LOCUS_10430 5182 4277 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_10430 6104 5226 gene locus_tag LOCUS_10440 6104 5226 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818717.1 protein_id gnl|my_center|LOCUS_10440 6321 7067 gene locus_tag LOCUS_10450 6321 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 7260 7667 gene locus_tag LOCUS_10460 7260 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 8785 7817 gene locus_tag LOCUS_10470 gene gapA 8785 7817 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 protein_id gnl|my_center|LOCUS_10470 9572 9006 gene locus_tag LOCUS_10480 9572 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 10588 9572 gene locus_tag LOCUS_10490 10588 9572 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence073 1489 662 gene locus_tag LOCUS_10500 1489 662 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432157.1 protein_id gnl|my_center|LOCUS_10500 2598 1486 gene locus_tag LOCUS_10510 2598 1486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272316.1 protein_id gnl|my_center|LOCUS_10510 3162 2620 gene locus_tag LOCUS_10520 3162 2620 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_10520 3411 4661 gene locus_tag LOCUS_10530 3411 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 4670 6028 gene locus_tag LOCUS_10540 gene radA 4670 6028 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_10540 6063 6139 gene locus_tag LOCUS_t00240 6063 6139 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6509 6946 gene locus_tag LOCUS_10550 6509 6946 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966530.1 protein_id gnl|my_center|LOCUS_10550 7254 7946 gene locus_tag LOCUS_10560 7254 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7999 8649 gene locus_tag LOCUS_10570 7999 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 8654 9682 gene locus_tag LOCUS_10580 8654 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 9679 10404 gene locus_tag LOCUS_10590 9679 10404 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705455.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence074 1894 1421 gene locus_tag LOCUS_10600 1894 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3019 1988 gene locus_tag LOCUS_10610 3019 1988 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_10610 3521 6646 gene locus_tag LOCUS_10620 3521 6646 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943878.1 protein_id gnl|my_center|LOCUS_10620 7000 8373 gene locus_tag LOCUS_10630 7000 8373 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808893.1 protein_id gnl|my_center|LOCUS_10630 8473 10131 gene locus_tag LOCUS_10640 8473 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence075 2058 673 gene locus_tag LOCUS_10650 2058 673 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_10650 2456 3139 gene locus_tag LOCUS_10660 2456 3139 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_10660 3129 4583 gene locus_tag LOCUS_10670 3129 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 4580 5626 gene locus_tag LOCUS_10680 4580 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5623 7209 gene locus_tag LOCUS_10690 5623 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 7202 8314 gene locus_tag LOCUS_10700 gene mnmA 7202 8314 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282936.1 protein_id gnl|my_center|LOCUS_10700 8314 9225 gene locus_tag LOCUS_10710 8314 9225 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039523.1 protein_id gnl|my_center|LOCUS_10710 10066 9287 gene locus_tag LOCUS_10720 gene murI 10066 9287 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966524.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence076 2233 164 gene locus_tag LOCUS_10730 gene fusA 2233 164 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_10730 2791 2321 gene locus_tag LOCUS_10740 gene rpsG 2791 2321 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810168.1 protein_id gnl|my_center|LOCUS_10740 3184 2807 gene locus_tag LOCUS_10750 gene rpsL 3184 2807 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966418.1 protein_id gnl|my_center|LOCUS_10750 4122 3412 gene locus_tag LOCUS_10760 4122 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 7668 4132 gene locus_tag LOCUS_10770 gene rpoC 7668 4132 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_10770 <10188 7699 gene locus_tag LOCUS_10780 <10188 7699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048357.1:DNA-directed RNA polymerase subunit beta >Feature sequence077 319 528 gene locus_tag LOCUS_10790 319 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 680 1219 gene locus_tag LOCUS_10800 680 1219 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229892.1 protein_id gnl|my_center|LOCUS_10800 1334 2089 gene locus_tag LOCUS_10810 1334 2089 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387194.1 protein_id gnl|my_center|LOCUS_10810 2553 2155 gene locus_tag LOCUS_10820 2553 2155 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068146.1 protein_id gnl|my_center|LOCUS_10820 2727 2960 gene locus_tag LOCUS_10830 2727 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2972 3220 gene locus_tag LOCUS_10840 2972 3220 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_10840 3239 3790 gene locus_tag LOCUS_10850 3239 3790 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_10850 3907 5199 gene locus_tag LOCUS_10860 3907 5199 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814309.1 protein_id gnl|my_center|LOCUS_10860 5781 6650 gene locus_tag LOCUS_10870 5781 6650 CDS product DUF1002 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850516.1 protein_id gnl|my_center|LOCUS_10870 7345 6944 gene locus_tag LOCUS_10880 7345 6944 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012359.1 protein_id gnl|my_center|LOCUS_10880 7933 7352 gene locus_tag LOCUS_10890 7933 7352 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862458.1 protein_id gnl|my_center|LOCUS_10890 8922 7936 gene locus_tag LOCUS_10900 8922 7936 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459548.1 protein_id gnl|my_center|LOCUS_10900 10067 8919 gene locus_tag LOCUS_10910 10067 8919 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814424.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence078 1180 164 gene locus_tag LOCUS_10920 1180 164 CDS product alpha-hydroxy-acid oxidizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546010.1 protein_id gnl|my_center|LOCUS_10920 1345 2712 gene locus_tag LOCUS_10930 1345 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2833 3699 gene locus_tag LOCUS_10940 2833 3699 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_10940 3774 4790 gene locus_tag LOCUS_10950 3774 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 4802 5041 gene locus_tag LOCUS_10960 4802 5041 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809987.1 protein_id gnl|my_center|LOCUS_10960 5031 5915 gene locus_tag LOCUS_10970 5031 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 6017 6502 gene locus_tag LOCUS_10980 6017 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 7300 6761 gene locus_tag LOCUS_10990 gene lepB 7300 6761 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_10990 7494 7297 gene locus_tag LOCUS_11000 7494 7297 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562948.1 protein_id gnl|my_center|LOCUS_11000 8373 7495 gene locus_tag LOCUS_11010 8373 7495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 8555 9421 gene locus_tag LOCUS_11020 8555 9421 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641280.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence079 1694 141 gene locus_tag LOCUS_11030 1694 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 2777 1713 gene locus_tag LOCUS_11040 2777 1713 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_11040 3083 4438 gene locus_tag LOCUS_11050 3083 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 4567 5955 gene locus_tag LOCUS_11060 gene cysS 4567 5955 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966454.1 protein_id gnl|my_center|LOCUS_11060 6532 6972 gene locus_tag LOCUS_11070 6532 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 7021 8880 gene locus_tag LOCUS_11080 7021 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 9276 9836 gene locus_tag LOCUS_11090 9276 9836 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence080 309 1064 gene locus_tag LOCUS_11100 309 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 1069 1779 gene locus_tag LOCUS_11110 gene sigE 1069 1779 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399432.1 protein_id gnl|my_center|LOCUS_11110 2299 1919 gene locus_tag LOCUS_11120 2299 1919 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860967.1 protein_id gnl|my_center|LOCUS_11120 2764 2492 gene locus_tag LOCUS_11130 2764 2492 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 protein_id gnl|my_center|LOCUS_11130 4330 2873 gene locus_tag LOCUS_11140 gene mazG 4330 2873 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458939.1 protein_id gnl|my_center|LOCUS_11140 5469 4327 gene locus_tag LOCUS_11150 gene ispF 5469 4327 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869748.1 protein_id gnl|my_center|LOCUS_11150 5717 5466 gene locus_tag LOCUS_11160 5717 5466 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966486.1 protein_id gnl|my_center|LOCUS_11160 5818 6036 gene locus_tag LOCUS_11170 5818 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 7457 6048 gene locus_tag LOCUS_11180 7457 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 <9869 7515 gene locus_tag LOCUS_11190 <9869 7515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966492.1:transcription-repair coupling factor >Feature sequence081 815 165 gene locus_tag LOCUS_11200 815 165 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_11200 1487 825 gene locus_tag LOCUS_11210 1487 825 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459567.1 protein_id gnl|my_center|LOCUS_11210 1659 1492 gene locus_tag LOCUS_11220 1659 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2007 1696 gene locus_tag LOCUS_11230 gene trxA 2007 1696 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_11230 3209 2106 gene locus_tag LOCUS_11240 3209 2106 CDS product NAD/NADP-dependent octopine/nopaline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684567.1 protein_id gnl|my_center|LOCUS_11240 3655 3221 gene locus_tag LOCUS_11250 3655 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 4323 3709 gene locus_tag LOCUS_11260 4323 3709 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993359.1 protein_id gnl|my_center|LOCUS_11260 4509 4925 gene locus_tag LOCUS_11270 4509 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 5111 6376 gene locus_tag LOCUS_11280 gene lysA 5111 6376 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462285.1 protein_id gnl|my_center|LOCUS_11280 6647 7015 gene locus_tag LOCUS_11290 6647 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 7045 8271 gene locus_tag LOCUS_11300 7045 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 8334 8837 gene locus_tag LOCUS_11310 8334 8837 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence082 2202 1258 gene locus_tag LOCUS_11320 gene pyrB 2202 1258 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_11320 3660 2236 gene locus_tag LOCUS_11330 3660 2236 CDS product cytosine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459893.1 protein_id gnl|my_center|LOCUS_11330 4401 3739 gene locus_tag LOCUS_11340 gene pcp 4401 3739 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869192.1 protein_id gnl|my_center|LOCUS_11340 6458 4866 gene locus_tag LOCUS_11350 6458 4866 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_11350 6747 7475 gene locus_tag LOCUS_11360 6747 7475 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_11360 7491 9506 gene locus_tag LOCUS_11370 7491 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence083 367 510 gene locus_tag LOCUS_11380 367 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 690 1142 gene locus_tag LOCUS_11390 gene spoVAC 690 1142 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944604.1 protein_id gnl|my_center|LOCUS_11390 1153 2184 gene locus_tag LOCUS_11400 gene spoVAD 1153 2184 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_11400 2198 2554 gene locus_tag LOCUS_11410 gene spoVAE 2198 2554 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811048.1 protein_id gnl|my_center|LOCUS_11410 4486 2846 gene locus_tag LOCUS_11420 4486 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4851 5480 gene locus_tag LOCUS_11430 4851 5480 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_11430 5551 6318 gene locus_tag LOCUS_11440 5551 6318 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014519040.1 protein_id gnl|my_center|LOCUS_11440 6369 6722 gene locus_tag LOCUS_11450 6369 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 7405 7208 gene locus_tag LOCUS_11460 7405 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 7735 8808 gene locus_tag LOCUS_11470 7735 8808 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052806.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence084 303 100 gene locus_tag LOCUS_11480 303 100 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037754.1 protein_id gnl|my_center|LOCUS_11480 680 393 gene locus_tag LOCUS_11490 680 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 925 677 gene locus_tag LOCUS_11500 925 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1935 937 gene locus_tag LOCUS_11510 1935 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 3181 2000 gene locus_tag LOCUS_11520 gene thiI 3181 2000 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_11520 4479 3340 gene locus_tag LOCUS_11530 4479 3340 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391743.1 protein_id gnl|my_center|LOCUS_11530 5306 4566 gene locus_tag LOCUS_11540 5306 4566 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184045.1 protein_id gnl|my_center|LOCUS_11540 5561 6028 gene locus_tag LOCUS_11550 5561 6028 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391707.1 protein_id gnl|my_center|LOCUS_11550 6025 7011 gene locus_tag LOCUS_11560 6025 7011 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391708.1 protein_id gnl|my_center|LOCUS_11560 7040 9460 gene locus_tag LOCUS_11570 gene clpC 7040 9460 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence085 100 327 gene locus_tag LOCUS_11580 100 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 422 1645 gene locus_tag LOCUS_11590 422 1645 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902269.1 protein_id gnl|my_center|LOCUS_11590 1781 2659 gene locus_tag LOCUS_11600 1781 2659 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815198.1 protein_id gnl|my_center|LOCUS_11600 2672 3703 gene locus_tag LOCUS_11610 2672 3703 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018191.1 protein_id gnl|my_center|LOCUS_11610 3696 4538 gene locus_tag LOCUS_11620 3696 4538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211990.1 protein_id gnl|my_center|LOCUS_11620 4531 5229 gene locus_tag LOCUS_11630 4531 5229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_11630 5321 6697 gene locus_tag LOCUS_11640 5321 6697 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437109.1 protein_id gnl|my_center|LOCUS_11640 6853 7296 gene locus_tag LOCUS_11650 6853 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 7966 7430 gene locus_tag LOCUS_11660 7966 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 8474 8010 gene locus_tag LOCUS_11670 8474 8010 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869483.1 protein_id gnl|my_center|LOCUS_11670 8790 9269 gene locus_tag LOCUS_11680 8790 9269 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_11680 9649 9266 gene locus_tag LOCUS_11690 9649 9266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence086 1609 224 gene locus_tag LOCUS_11700 1609 224 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_11700 4163 2001 gene locus_tag LOCUS_11710 4163 2001 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895217.1 protein_id gnl|my_center|LOCUS_11710 5973 4195 gene locus_tag LOCUS_11720 5973 4195 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_11720 8350 5990 gene locus_tag LOCUS_11730 8350 5990 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903830.1 protein_id gnl|my_center|LOCUS_11730 8999 8343 gene locus_tag LOCUS_11740 8999 8343 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_11740 9149 9403 gene locus_tag LOCUS_11750 gene spoIIID 9149 9403 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence087 46 546 gene locus_tag LOCUS_11760 46 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 567 2747 gene locus_tag LOCUS_11770 567 2747 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893708.1 protein_id gnl|my_center|LOCUS_11770 2792 4228 gene locus_tag LOCUS_11780 2792 4228 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965428.1 protein_id gnl|my_center|LOCUS_11780 4250 5266 gene locus_tag LOCUS_11790 gene mraY 4250 5266 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427000.1 protein_id gnl|my_center|LOCUS_11790 5501 6865 gene locus_tag LOCUS_11800 gene murD 5501 6865 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_11800 6890 8011 gene locus_tag LOCUS_11810 gene spoVE 6890 8011 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_11810 8137 9369 gene locus_tag LOCUS_11820 gene murA 8137 9369 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392365.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence088 584 1726 gene locus_tag LOCUS_11830 584 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1827 2501 gene locus_tag LOCUS_11840 1827 2501 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_11840 2508 3272 gene locus_tag LOCUS_11850 2508 3272 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_11850 3289 3924 gene locus_tag LOCUS_11860 gene scpB 3289 3924 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392873.1 protein_id gnl|my_center|LOCUS_11860 4016 4600 gene locus_tag LOCUS_11870 4016 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4573 5022 gene locus_tag LOCUS_11880 gene ytfJ 4573 5022 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392871.1 protein_id gnl|my_center|LOCUS_11880 5019 6146 gene locus_tag LOCUS_11890 5019 6146 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_11890 6280 6999 gene locus_tag LOCUS_11900 6280 6999 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_11900 7198 7608 gene locus_tag LOCUS_11910 7198 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 7651 8019 gene locus_tag LOCUS_11920 7651 8019 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_11920 8147 9343 gene locus_tag LOCUS_11930 8147 9343 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence089 928 1665 gene locus_tag LOCUS_11940 928 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11940 1635 1841 gene locus_tag LOCUS_11950 1635 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11950 1831 2028 gene locus_tag LOCUS_11960 1831 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2125 3291 gene locus_tag LOCUS_11970 2125 3291 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_11970 3483 3391 gene locus_tag LOCUS_t00250 3483 3391 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3616 3528 gene locus_tag LOCUS_t00260 3616 3528 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4696 3998 gene locus_tag LOCUS_11980 4696 3998 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870390.1 protein_id gnl|my_center|LOCUS_11980 5506 4712 gene locus_tag LOCUS_11990 5506 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5701 7404 gene locus_tag LOCUS_12000 gene argS 5701 7404 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_12000 7468 8739 gene locus_tag LOCUS_12010 gene serS 7468 8739 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947906.1 protein_id gnl|my_center|LOCUS_12010 8742 9176 gene locus_tag LOCUS_12020 8742 9176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence090 3 800 gene locus_tag LOCUS_12030 3 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 972 1889 gene locus_tag LOCUS_12040 gene murB 972 1889 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_12040 1886 2758 gene locus_tag LOCUS_12050 gene rapZ 1886 2758 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048306.1 protein_id gnl|my_center|LOCUS_12050 2762 3715 gene locus_tag LOCUS_12060 gene whiA 2762 3715 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963835.1 protein_id gnl|my_center|LOCUS_12060 3718 7146 gene locus_tag LOCUS_12070 3718 7146 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436251.1 protein_id gnl|my_center|LOCUS_12070 7146 8528 gene locus_tag LOCUS_12080 gene rlmD 7146 8528 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233892.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence091 1129 752 gene locus_tag LOCUS_12090 1129 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1803 1234 gene locus_tag LOCUS_12100 1803 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2071 1853 gene locus_tag LOCUS_12110 2071 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 3390 2095 gene locus_tag LOCUS_12120 3390 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4546 3410 gene locus_tag LOCUS_12130 4546 3410 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944368.1 protein_id gnl|my_center|LOCUS_12130 4537 4716 gene locus_tag LOCUS_12140 4537 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 6700 4811 gene locus_tag LOCUS_12150 6700 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 7469 6807 gene locus_tag LOCUS_12160 7469 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 8699 7869 gene locus_tag LOCUS_12170 8699 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 9133 8726 gene locus_tag LOCUS_12180 9133 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence092 1607 174 gene locus_tag LOCUS_12190 1607 174 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_12190 2230 3465 gene locus_tag LOCUS_12200 2230 3465 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869387.1 protein_id gnl|my_center|LOCUS_12200 3608 4492 gene locus_tag LOCUS_12210 3608 4492 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583298.1 protein_id gnl|my_center|LOCUS_12210 4506 5582 gene locus_tag LOCUS_12220 4506 5582 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_12220 5586 6428 gene locus_tag LOCUS_12230 5586 6428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262678.1 protein_id gnl|my_center|LOCUS_12230 6431 7141 gene locus_tag LOCUS_12240 6431 7141 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081214215.1 protein_id gnl|my_center|LOCUS_12240 8873 7464 gene locus_tag LOCUS_12250 8873 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 >Feature sequence093 1383 463 gene locus_tag LOCUS_12260 gene rsiV 1383 463 CDS product anti-sigma-V factor RsiV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398482.1 protein_id gnl|my_center|LOCUS_12260 1872 1387 gene locus_tag LOCUS_12270 1872 1387 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436663.1 protein_id gnl|my_center|LOCUS_12270 2129 3400 gene locus_tag LOCUS_12280 gene hisS 2129 3400 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_12280 3431 5227 gene locus_tag LOCUS_12290 gene aspS 3431 5227 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965567.1 protein_id gnl|my_center|LOCUS_12290 5382 5822 gene locus_tag LOCUS_12300 5382 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5986 7224 gene locus_tag LOCUS_12310 gene glyA 5986 7224 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981400.1 protein_id gnl|my_center|LOCUS_12310 7461 8939 gene locus_tag LOCUS_12320 7461 8939 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence094 1391 867 gene locus_tag LOCUS_12330 1391 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 1995 1438 gene locus_tag LOCUS_12340 1995 1438 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_12340 2389 2066 gene locus_tag LOCUS_12350 2389 2066 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272202.1 protein_id gnl|my_center|LOCUS_12350 3327 2644 gene locus_tag LOCUS_12360 3327 2644 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869386.1 protein_id gnl|my_center|LOCUS_12360 5420 3324 gene locus_tag LOCUS_12370 5420 3324 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_12370 7229 5772 gene locus_tag LOCUS_12380 7229 5772 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_12380 7442 8119 gene locus_tag LOCUS_12390 gene sfsA 7442 8119 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_12390 8307 9023 gene locus_tag LOCUS_12400 8307 9023 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812913.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence095 1661 591 gene locus_tag LOCUS_12410 1661 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3108 1741 gene locus_tag LOCUS_12420 3108 1741 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986686.1 protein_id gnl|my_center|LOCUS_12420 4844 3126 gene locus_tag LOCUS_12430 gene ade 4844 3126 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392001.1 protein_id gnl|my_center|LOCUS_12430 6440 4986 gene locus_tag LOCUS_12440 gene xylB 6440 4986 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083938.1 protein_id gnl|my_center|LOCUS_12440 7127 6444 gene locus_tag LOCUS_12450 7127 6444 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_12450 7249 8304 gene locus_tag LOCUS_12460 7249 8304 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168721.1 protein_id gnl|my_center|LOCUS_12460 8454 8894 gene locus_tag LOCUS_12470 8454 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence096 152 1174 gene locus_tag LOCUS_12480 152 1174 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_12480 1190 1693 gene locus_tag LOCUS_12490 gene dut 1190 1693 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390601.1 protein_id gnl|my_center|LOCUS_12490 3191 2031 gene locus_tag LOCUS_12500 3191 2031 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_12500 4140 3418 gene locus_tag LOCUS_12510 4140 3418 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860947.1 protein_id gnl|my_center|LOCUS_12510 4849 4127 gene locus_tag LOCUS_12520 4849 4127 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_12520 5871 4948 gene locus_tag LOCUS_12530 5871 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 6349 7191 gene locus_tag LOCUS_12540 6349 7191 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_12540 7193 8578 gene locus_tag LOCUS_12550 gene gltA 7193 8578 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420072.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence097 281 874 gene locus_tag LOCUS_12560 281 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1064 1564 gene locus_tag LOCUS_12570 gene ruvC 1064 1564 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_12570 1588 2178 gene locus_tag LOCUS_12580 gene ruvA 1588 2178 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707372.1 protein_id gnl|my_center|LOCUS_12580 2195 3229 gene locus_tag LOCUS_12590 gene ruvB 2195 3229 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_12590 3279 4121 gene locus_tag LOCUS_12600 3279 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4230 5672 gene locus_tag LOCUS_12610 gene proS 4230 5672 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_12610 5812 7230 gene locus_tag LOCUS_12620 5812 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence098 555 1 gene locus_tag LOCUS_12630 555 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1244 603 gene locus_tag LOCUS_12640 1244 603 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002381503.1 protein_id gnl|my_center|LOCUS_12640 1710 3050 gene locus_tag LOCUS_12650 gene ssnA 1710 3050 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_12650 3072 6041 gene locus_tag LOCUS_12660 gene ygfK 3072 6041 CDS product putative selenate reductase subunit YgfK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387142.1 protein_id gnl|my_center|LOCUS_12660 6148 8703 gene locus_tag LOCUS_12670 gene xdh 6148 8703 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence099 740 2953 gene locus_tag LOCUS_12680 gene pcrA 740 2953 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817187.1 protein_id gnl|my_center|LOCUS_12680 2979 4949 gene locus_tag LOCUS_12690 gene ligA 2979 4949 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_12690 5216 6094 gene locus_tag LOCUS_12700 5216 6094 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_12700 6301 6777 gene locus_tag LOCUS_12710 6301 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 6774 6974 gene locus_tag LOCUS_12720 6774 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 6976 8175 gene locus_tag LOCUS_12730 gene coaBC 6976 8175 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965027.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence100 451 891 gene locus_tag LOCUS_12740 451 891 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986477.1 protein_id gnl|my_center|LOCUS_12740 888 1988 gene locus_tag LOCUS_12750 888 1988 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972927.1 protein_id gnl|my_center|LOCUS_12750 2819 2286 gene locus_tag LOCUS_12760 2819 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3168 2836 gene locus_tag LOCUS_12770 3168 2836 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_12770 3374 3757 gene locus_tag LOCUS_12780 3374 3757 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949091.1 protein_id gnl|my_center|LOCUS_12780 4082 4294 gene locus_tag LOCUS_12790 4082 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4318 4539 gene locus_tag LOCUS_12800 4318 4539 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_12800 4628 6799 gene locus_tag LOCUS_12810 gene feoB 4628 6799 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460242.1 protein_id gnl|my_center|LOCUS_12810 7071 8453 gene locus_tag LOCUS_12820 7071 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence101 513 1016 gene locus_tag LOCUS_12830 513 1016 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359469.1 protein_id gnl|my_center|LOCUS_12830 1238 1435 gene locus_tag LOCUS_12840 1238 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 1458 3041 gene locus_tag LOCUS_12850 1458 3041 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_12850 3386 4408 gene locus_tag LOCUS_12860 gene pheS 3386 4408 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_12860 4427 6829 gene locus_tag LOCUS_12870 gene pheT 4427 6829 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_12870 6842 8017 gene locus_tag LOCUS_12880 6842 8017 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016536.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence102 77 2 gene locus_tag LOCUS_t00270 77 2 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1165 233 gene locus_tag LOCUS_12890 gene metA 1165 233 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_12890 2464 1181 gene locus_tag LOCUS_12900 2464 1181 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_12900 2701 3495 gene locus_tag LOCUS_12910 gene zupT 2701 3495 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262376.1 protein_id gnl|my_center|LOCUS_12910 5567 3768 gene locus_tag LOCUS_12920 5567 3768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083002.1 protein_id gnl|my_center|LOCUS_12920 7288 5564 gene locus_tag LOCUS_12930 7288 5564 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583011.1 protein_id gnl|my_center|LOCUS_12930 7713 7282 gene locus_tag LOCUS_12940 7713 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence103 1268 141 gene locus_tag LOCUS_12950 1268 141 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732062.1 protein_id gnl|my_center|LOCUS_12950 2971 1265 gene locus_tag LOCUS_12960 2971 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3873 2968 gene locus_tag LOCUS_12970 gene hslO 3873 2968 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_12970 4622 3882 gene locus_tag LOCUS_12980 4622 3882 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_12980 4962 6383 gene locus_tag LOCUS_12990 4962 6383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 6502 7038 gene locus_tag LOCUS_13000 6502 7038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 7403 7864 gene locus_tag LOCUS_13010 7403 7864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence104 549 172 gene locus_tag LOCUS_13020 549 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1125 2762 gene locus_tag LOCUS_13030 1125 2762 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_13030 2838 4400 gene locus_tag LOCUS_13040 2838 4400 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_13040 4487 6226 gene locus_tag LOCUS_13050 gene iorA 4487 6226 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_13050 6229 6801 gene locus_tag LOCUS_13060 6229 6801 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence105 3253 2156 gene locus_tag LOCUS_13070 gene pgsW 3253 2156 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124795016.1 protein_id gnl|my_center|LOCUS_13070 3685 3263 gene locus_tag LOCUS_13080 gene pgsC 3685 3263 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903745.1 protein_id gnl|my_center|LOCUS_13080 4667 3678 gene locus_tag LOCUS_13090 gene pgsB 4667 3678 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903746.1 protein_id gnl|my_center|LOCUS_13090 5173 6273 gene locus_tag LOCUS_13100 5173 6273 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898508.1 protein_id gnl|my_center|LOCUS_13100 6327 7721 gene locus_tag LOCUS_13110 6327 7721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13110 >Feature sequence106 538 338 gene locus_tag LOCUS_13120 538 338 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_13120 877 545 gene locus_tag LOCUS_13130 877 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1402 2748 gene locus_tag LOCUS_13140 gene gdhA 1402 2748 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020063.1 protein_id gnl|my_center|LOCUS_13140 4553 3192 gene locus_tag LOCUS_13150 4553 3192 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051187.1 protein_id gnl|my_center|LOCUS_13150 4681 5067 gene locus_tag LOCUS_13160 4681 5067 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782778.1 protein_id gnl|my_center|LOCUS_13160 5064 5897 gene locus_tag LOCUS_13170 5064 5897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_13170 5901 6518 gene locus_tag LOCUS_13180 5901 6518 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_13180 6564 6890 gene locus_tag LOCUS_13190 6564 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence107 1563 121 gene locus_tag LOCUS_13200 1563 121 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965348.1 protein_id gnl|my_center|LOCUS_13200 2343 1594 gene locus_tag LOCUS_13210 2343 1594 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002361352.1 protein_id gnl|my_center|LOCUS_13210 2998 2330 gene locus_tag LOCUS_13220 2998 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4088 3132 gene locus_tag LOCUS_13230 4088 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4954 4496 gene locus_tag LOCUS_13240 gene bcp 4954 4496 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439443.1 protein_id gnl|my_center|LOCUS_13240 5673 4948 gene locus_tag LOCUS_13250 gene yaaA 5673 4948 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100877.1 protein_id gnl|my_center|LOCUS_13250 6462 5734 gene locus_tag LOCUS_13260 6462 5734 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945134.1 protein_id gnl|my_center|LOCUS_13260 6825 7556 gene locus_tag LOCUS_13270 6825 7556 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016025.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence108 1060 266 gene locus_tag LOCUS_13280 gene yqeB 1060 266 CDS product selenium-dependent molybdenum cofactor biosynthesis protein YqeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_13280 2043 1339 gene locus_tag LOCUS_13290 gene yqeC 2043 1339 CDS product selenium cofactor biosynthesis protein YqeC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459386.1 protein_id gnl|my_center|LOCUS_13290 2393 2040 gene locus_tag LOCUS_13300 2393 2040 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356595.1 protein_id gnl|my_center|LOCUS_13300 3255 2401 gene locus_tag LOCUS_13310 3255 2401 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966989.1 protein_id gnl|my_center|LOCUS_13310 4052 3270 gene locus_tag LOCUS_13320 4052 3270 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_13320 4853 5269 gene locus_tag LOCUS_13330 4853 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 5454 5795 gene locus_tag LOCUS_13340 5454 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5942 7093 gene locus_tag LOCUS_13350 5942 7093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence109 2884 2282 gene locus_tag LOCUS_13360 2884 2282 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_13360 3567 2881 gene locus_tag LOCUS_13370 gene cmk 3567 2881 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_13370 4808 3576 gene locus_tag LOCUS_13380 4808 3576 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_13380 5692 4805 gene locus_tag LOCUS_13390 5692 4805 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965155.1 protein_id gnl|my_center|LOCUS_13390 6488 5709 gene locus_tag LOCUS_13400 gene surE 6488 5709 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812070.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence110 936 181 gene locus_tag LOCUS_13410 936 181 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897033.1 protein_id gnl|my_center|LOCUS_13410 1877 933 gene locus_tag LOCUS_13420 1877 933 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080516.1 protein_id gnl|my_center|LOCUS_13420 2123 4879 gene locus_tag LOCUS_13430 gene secA 2123 4879 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_13430 4979 6016 gene locus_tag LOCUS_13440 gene prfB 4979 6016 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018379.1 protein_id gnl|my_center|LOCUS_13440 6258 6761 gene locus_tag LOCUS_13450 6258 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 6932 7429 gene locus_tag LOCUS_13460 6932 7429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence111 217 3246 gene locus_tag LOCUS_13470 217 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3291 3695 gene locus_tag LOCUS_13480 3291 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 4653 4108 gene locus_tag LOCUS_13490 gene spoVT 4653 4108 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966490.1 protein_id gnl|my_center|LOCUS_13490 6348 4852 gene locus_tag LOCUS_13500 6348 4852 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226385.1 protein_id gnl|my_center|LOCUS_13500 6729 6418 gene locus_tag LOCUS_13510 gene rhaM 6729 6418 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379067.1 protein_id gnl|my_center|LOCUS_13510 7531 6848 gene locus_tag LOCUS_13520 7531 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence112 <1 576 gene locus_tag LOCUS_13530 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802804.1:chromate transporter 578 1141 gene locus_tag LOCUS_13540 578 1141 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_13540 1156 1686 gene locus_tag LOCUS_13550 1156 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1786 2475 gene locus_tag LOCUS_13560 1786 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3741 2728 gene locus_tag LOCUS_13570 3741 2728 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462034.1 protein_id gnl|my_center|LOCUS_13570 4135 3821 gene locus_tag LOCUS_13580 4135 3821 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461958.1 protein_id gnl|my_center|LOCUS_13580 4377 4132 gene locus_tag LOCUS_13590 4377 4132 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292400.1 protein_id gnl|my_center|LOCUS_13590 5350 4409 gene locus_tag LOCUS_13600 5350 4409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 5631 7331 gene locus_tag LOCUS_13610 5631 7331 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681029.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence113 1604 2440 gene locus_tag LOCUS_13620 gene larE 1604 2440 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_13620 3195 3407 gene locus_tag LOCUS_13630 3195 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 4493 3780 gene locus_tag LOCUS_13640 4493 3780 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809641.1 protein_id gnl|my_center|LOCUS_13640 4630 5502 gene locus_tag LOCUS_13650 4630 5502 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808284.1 protein_id gnl|my_center|LOCUS_13650 5559 5867 gene locus_tag LOCUS_13660 5559 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 5980 6795 gene locus_tag LOCUS_13670 5980 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 6820 7281 gene locus_tag LOCUS_13680 6820 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 >Feature sequence114 4 2652 gene locus_tag LOCUS_13690 4 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2731 3108 gene locus_tag LOCUS_13700 gene gcvH 2731 3108 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811334.1 protein_id gnl|my_center|LOCUS_13700 3110 4426 gene locus_tag LOCUS_13710 gene gcvPA 3110 4426 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678346.1 protein_id gnl|my_center|LOCUS_13710 4423 5823 gene locus_tag LOCUS_13720 gene gcvPB 4423 5823 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence115 624 163 gene locus_tag LOCUS_13730 624 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3083 852 gene locus_tag LOCUS_13740 3083 852 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_13740 4091 3297 gene locus_tag LOCUS_13750 4091 3297 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104281.1 protein_id gnl|my_center|LOCUS_13750 4281 5180 gene locus_tag LOCUS_13760 4281 5180 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426922.1 protein_id gnl|my_center|LOCUS_13760 5241 6599 gene locus_tag LOCUS_13770 gene pepV 5241 6599 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459801.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence116 2178 1039 gene locus_tag LOCUS_13780 gene hemW 2178 1039 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_13780 3982 2180 gene locus_tag LOCUS_13790 gene lepA 3982 2180 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_13790 4180 4797 gene locus_tag LOCUS_13800 4180 4797 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583891.1 protein_id gnl|my_center|LOCUS_13800 4797 5051 gene locus_tag LOCUS_13810 4797 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5361 5113 gene locus_tag LOCUS_13820 5361 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 5565 6953 gene locus_tag LOCUS_13830 5565 6953 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence117 1398 139 gene locus_tag LOCUS_13840 1398 139 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582614.1 protein_id gnl|my_center|LOCUS_13840 1505 2491 gene locus_tag LOCUS_13850 1505 2491 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549977.1 protein_id gnl|my_center|LOCUS_13850 2908 2504 gene locus_tag LOCUS_13860 2908 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3621 2905 gene locus_tag LOCUS_13870 3621 2905 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948011.1 protein_id gnl|my_center|LOCUS_13870 4832 4759 gene locus_tag LOCUS_t00280 4832 4759 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4976 4892 gene locus_tag LOCUS_t00290 4976 4892 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5078 5003 gene locus_tag LOCUS_t00300 5078 5003 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5194 5120 gene locus_tag LOCUS_t00310 5194 5120 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5336 5259 gene locus_tag LOCUS_t00320 5336 5259 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5435 5359 gene locus_tag LOCUS_t00330 5435 5359 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5668 6588 gene locus_tag LOCUS_13880 5668 6588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence118 2547 1564 gene locus_tag LOCUS_13890 2547 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3371 2781 gene locus_tag LOCUS_13900 3371 2781 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947081.1 protein_id gnl|my_center|LOCUS_13900 3783 4970 gene locus_tag LOCUS_13910 3783 4970 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776609.1 protein_id gnl|my_center|LOCUS_13910 5132 6487 gene locus_tag LOCUS_13920 5132 6487 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence119 369 2462 gene locus_tag LOCUS_13930 gene pnp 369 2462 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438316.1 protein_id gnl|my_center|LOCUS_13930 2771 3445 gene locus_tag LOCUS_13940 2771 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3458 4726 gene locus_tag LOCUS_13950 3458 4726 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_13950 4817 6037 gene locus_tag LOCUS_13960 4817 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence120 3321 193 gene locus_tag LOCUS_13970 gene ileS 3321 193 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966319.1 protein_id gnl|my_center|LOCUS_13970 3587 5608 gene locus_tag LOCUS_13980 gene ftsH 3587 5608 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966478.1 protein_id gnl|my_center|LOCUS_13980 5859 5572 gene locus_tag LOCUS_13990 5859 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 5743 6555 gene locus_tag LOCUS_14000 5743 6555 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence121 1745 147 gene locus_tag LOCUS_14010 1745 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2786 4204 gene locus_tag LOCUS_14020 2786 4204 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986115.1 protein_id gnl|my_center|LOCUS_14020 4667 5332 gene locus_tag LOCUS_14030 gene udk 4667 5332 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293736.1 protein_id gnl|my_center|LOCUS_14030 5339 6454 gene locus_tag LOCUS_14040 5339 6454 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433873.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence122 2403 28 gene locus_tag LOCUS_14050 2403 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3740 2406 gene locus_tag LOCUS_14060 gene scfB 3740 2406 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_14060 4121 3978 gene locus_tag LOCUS_14070 gene scfA 4121 3978 CDS product six-cysteine ranthipeptide SCIFF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891067.1 protein_id gnl|my_center|LOCUS_14070 4608 4192 gene locus_tag LOCUS_14080 4608 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 5169 4837 gene locus_tag LOCUS_14090 5169 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 6233 5316 gene locus_tag LOCUS_14100 6233 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 >Feature sequence123 732 151 gene locus_tag LOCUS_14110 732 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1044 769 gene locus_tag LOCUS_14120 1044 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 2137 1142 gene locus_tag LOCUS_14130 2137 1142 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_14130 2845 2153 gene locus_tag LOCUS_14140 2845 2153 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_14140 3638 2964 gene locus_tag LOCUS_14150 3638 2964 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435276.1 protein_id gnl|my_center|LOCUS_14150 4525 3677 gene locus_tag LOCUS_14160 4525 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 6186 4903 gene locus_tag LOCUS_14170 6186 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence124 163 1953 gene locus_tag LOCUS_14180 163 1953 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_14180 2068 2793 gene locus_tag LOCUS_14190 2068 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 2817 3491 gene locus_tag LOCUS_14200 2817 3491 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680231.1 protein_id gnl|my_center|LOCUS_14200 4254 3724 gene locus_tag LOCUS_14210 4254 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 4503 5846 gene locus_tag LOCUS_14220 4503 5846 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920595.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence125 699 2024 gene locus_tag LOCUS_14230 699 2024 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_14230 2202 3731 gene locus_tag LOCUS_14240 2202 3731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_14240 3734 4840 gene locus_tag LOCUS_14250 3734 4840 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_14250 4837 5820 gene locus_tag LOCUS_14260 4837 5820 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence126 299 436 gene locus_tag LOCUS_14270 299 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 469 1983 gene locus_tag LOCUS_14280 469 1983 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861384.1 protein_id gnl|my_center|LOCUS_14280 2629 2021 gene locus_tag LOCUS_14290 2629 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2750 4960 gene locus_tag LOCUS_14300 2750 4960 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947993.1 protein_id gnl|my_center|LOCUS_14300 4957 5634 gene locus_tag LOCUS_14310 4957 5634 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_14310 5651 6307 gene locus_tag LOCUS_14320 5651 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence127 1296 532 gene locus_tag LOCUS_14330 1296 532 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836613.1 protein_id gnl|my_center|LOCUS_14330 2269 1367 gene locus_tag LOCUS_14340 2269 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4025 2892 gene locus_tag LOCUS_14350 4025 2892 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392932.1 protein_id gnl|my_center|LOCUS_14350 4336 5373 gene locus_tag LOCUS_14360 4336 5373 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460845.1 protein_id gnl|my_center|LOCUS_14360 5375 6175 gene locus_tag LOCUS_14370 5375 6175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965289.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence128 <1 1320 gene locus_tag LOCUS_14380 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940771.1:DNA polymerase III subunit gamma/tau 1421 1903 gene locus_tag LOCUS_14390 1421 1903 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436147.1 protein_id gnl|my_center|LOCUS_14390 1989 2291 gene locus_tag LOCUS_14400 1989 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2970 2479 gene locus_tag LOCUS_14410 2970 2479 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437963.1 protein_id gnl|my_center|LOCUS_14410 4392 2992 gene locus_tag LOCUS_14420 4392 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 5399 4473 gene locus_tag LOCUS_14430 5399 4473 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_14430 5532 5768 gene locus_tag LOCUS_14440 5532 5768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 <6386 5853 gene locus_tag LOCUS_14450 <6386 5853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918265.1:A/G-specific adenine glycosylase >Feature sequence129 118 1233 gene locus_tag LOCUS_14460 gene recF 118 1233 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_14460 1272 3206 gene locus_tag LOCUS_14470 gene gyrB 1272 3206 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947898.1 protein_id gnl|my_center|LOCUS_14470 3223 3438 gene locus_tag LOCUS_14480 3223 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3528 5981 gene locus_tag LOCUS_14490 gene gyrA 3528 5981 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282864.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence130 149 1537 gene locus_tag LOCUS_14500 gene hslU 149 1537 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_14500 1537 2778 gene locus_tag LOCUS_14510 1537 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3156 5561 gene locus_tag LOCUS_14520 3156 5561 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393425.1 protein_id gnl|my_center|LOCUS_14520 5610 6071 gene locus_tag LOCUS_14530 gene trmL 5610 6071 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence131 1515 355 gene locus_tag LOCUS_14540 1515 355 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459550.1 protein_id gnl|my_center|LOCUS_14540 1707 2537 gene locus_tag LOCUS_14550 1707 2537 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_14550 2521 3141 gene locus_tag LOCUS_14560 2521 3141 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_14560 3360 4637 gene locus_tag LOCUS_14570 3360 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 4832 5992 gene locus_tag LOCUS_14580 4832 5992 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901936.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence132 1236 703 gene locus_tag LOCUS_14590 1236 703 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_14590 1985 1233 gene locus_tag LOCUS_14600 1985 1233 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_14600 3070 1982 gene locus_tag LOCUS_14610 3070 1982 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432442.1 protein_id gnl|my_center|LOCUS_14610 3297 3067 gene locus_tag LOCUS_14620 3297 3067 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_14620 4086 3373 gene locus_tag LOCUS_14630 4086 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_14630 4401 4165 gene locus_tag LOCUS_14640 4401 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4736 5980 gene locus_tag LOCUS_14650 4736 5980 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence133 250 1824 gene locus_tag LOCUS_14660 gene pckA 250 1824 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_14660 2785 2159 gene locus_tag LOCUS_14670 gene catA 2785 2159 CDS product type A chloramphenicol O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775611.1 protein_id gnl|my_center|LOCUS_14670 4344 2929 gene locus_tag LOCUS_14680 gene purB 4344 2929 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_14680 5637 4363 gene locus_tag LOCUS_14690 5637 4363 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262728.1 protein_id gnl|my_center|LOCUS_14690 >Feature sequence134 373 1233 gene locus_tag LOCUS_14700 373 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1375 2682 gene locus_tag LOCUS_14710 1375 2682 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_14710 2679 4067 gene locus_tag LOCUS_14720 2679 4067 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891177.1 protein_id gnl|my_center|LOCUS_14720 4067 5401 gene locus_tag LOCUS_14730 4067 5401 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898040.1 protein_id gnl|my_center|LOCUS_14730 5558 6022 gene locus_tag LOCUS_14740 5558 6022 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence135 494 1768 gene locus_tag LOCUS_14750 494 1768 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929846.1 protein_id gnl|my_center|LOCUS_14750 1873 2121 gene locus_tag LOCUS_14760 1873 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948527.1 protein_id gnl|my_center|LOCUS_14760 2471 5101 gene locus_tag LOCUS_14770 2471 5101 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_14770 5130 5501 gene locus_tag LOCUS_14780 5130 5501 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462292.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence136 70 1407 gene locus_tag LOCUS_14790 70 1407 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339065.1 protein_id gnl|my_center|LOCUS_14790 1409 2458 gene locus_tag LOCUS_14800 1409 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 2483 5965 gene locus_tag LOCUS_14810 2483 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence137 2176 635 gene locus_tag LOCUS_14820 gene cls 2176 635 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_14820 2468 2713 gene locus_tag LOCUS_14830 2468 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2773 2849 gene locus_tag LOCUS_t00340 2773 2849 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3013 3774 gene locus_tag LOCUS_14840 3013 3774 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965563.1 protein_id gnl|my_center|LOCUS_14840 3793 4254 gene locus_tag LOCUS_14850 3793 4254 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986910.1 protein_id gnl|my_center|LOCUS_14850 4468 4731 gene locus_tag LOCUS_14860 4468 4731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 4728 5609 gene locus_tag LOCUS_14870 4728 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 5652 5879 gene locus_tag LOCUS_14880 gene atpE 5652 5879 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356112.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence138 1179 1850 gene locus_tag LOCUS_14890 1179 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2830 3561 gene locus_tag LOCUS_14900 2830 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 4566 3769 gene locus_tag LOCUS_14910 4566 3769 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_14910 5731 4553 gene locus_tag LOCUS_14920 5731 4553 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence139 772 362 gene locus_tag LOCUS_14930 772 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1469 756 gene locus_tag LOCUS_14940 1469 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2473 1493 gene locus_tag LOCUS_14950 gene floA 2473 1493 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812222.1 protein_id gnl|my_center|LOCUS_14950 2735 2490 gene locus_tag LOCUS_14960 2735 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 3237 2737 gene locus_tag LOCUS_14970 3237 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 4121 3375 gene locus_tag LOCUS_14980 4121 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 4330 5283 gene locus_tag LOCUS_14990 gene spoIID 4330 5283 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393851.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence140 1497 1120 gene locus_tag LOCUS_15000 1497 1120 CDS product DUF4280 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089513.1 protein_id gnl|my_center|LOCUS_15000 2253 1501 gene locus_tag LOCUS_15010 2253 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2852 2250 gene locus_tag LOCUS_15020 2852 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 5376 2866 gene locus_tag LOCUS_15030 5376 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5606 5430 gene locus_tag LOCUS_15040 5606 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence141 <1 1163 gene locus_tag LOCUS_15050 <1 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454735.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 1206 1550 gene locus_tag LOCUS_15060 1206 1550 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_15060 1808 1641 gene locus_tag LOCUS_15070 1808 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2967 1828 gene locus_tag LOCUS_15080 gene dnaJ 2967 1828 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_15080 4992 3148 gene locus_tag LOCUS_15090 gene dnaK 4992 3148 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964594.1 protein_id gnl|my_center|LOCUS_15090 5702 5037 gene locus_tag LOCUS_15100 gene grpE 5702 5037 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence142 2181 934 gene locus_tag LOCUS_15110 gene glgC 2181 934 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_15110 4100 2178 gene locus_tag LOCUS_15120 gene glgB 4100 2178 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939518.1 protein_id gnl|my_center|LOCUS_15120 4321 5289 gene locus_tag LOCUS_15130 4321 5289 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_15130 5370 5543 gene locus_tag LOCUS_15140 5370 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence143 1226 561 gene locus_tag LOCUS_15150 1226 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 2165 1425 gene locus_tag LOCUS_15160 2165 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 2282 4129 gene locus_tag LOCUS_15170 2282 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 4350 5582 gene locus_tag LOCUS_15180 4350 5582 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359322.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence144 406 1044 gene locus_tag LOCUS_15190 406 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2295 1375 gene locus_tag LOCUS_15200 gene argF 2295 1375 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_15200 3461 2292 gene locus_tag LOCUS_15210 3461 2292 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_15210 4332 3472 gene locus_tag LOCUS_15220 gene argB 4332 3472 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_15220 5540 4329 gene locus_tag LOCUS_15230 gene argJ 5540 4329 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence145 1333 107 gene locus_tag LOCUS_15240 1333 107 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688344.1 protein_id gnl|my_center|LOCUS_15240 1822 2916 gene locus_tag LOCUS_15250 1822 2916 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286870.1 protein_id gnl|my_center|LOCUS_15250 3155 5122 gene locus_tag LOCUS_15260 gene tkt 3155 5122 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964262.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence146 3677 234 gene locus_tag LOCUS_15270 gene addA 3677 234 CDS product helicase-exonuclease AddAB subunit AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000572298.1 protein_id gnl|my_center|LOCUS_15270 <5599 3661 gene locus_tag LOCUS_15280 <5599 3661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_151864400.1:helicase-exonuclease AddAB subunit AddB >Feature sequence147 358 2622 gene locus_tag LOCUS_15290 358 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 2619 3221 gene locus_tag LOCUS_15300 2619 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 4121 4465 gene locus_tag LOCUS_15310 4121 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence148 <1 1017 gene locus_tag LOCUS_15320 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775711.1:trypsin-like peptidase domain-containing protein 1022 1345 gene locus_tag LOCUS_15330 1022 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1342 3609 gene locus_tag LOCUS_15340 1342 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3685 3996 gene locus_tag LOCUS_15350 3685 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5199 4627 gene locus_tag LOCUS_15360 gene plsY 5199 4627 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770791.1 protein_id gnl|my_center|LOCUS_15360 5119 5298 gene locus_tag LOCUS_15370 5119 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence149 1270 263 gene locus_tag LOCUS_15380 gene asnA 1270 263 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549578.1 protein_id gnl|my_center|LOCUS_15380 2724 1477 gene locus_tag LOCUS_15390 gene ftsZ 2724 1477 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890867.1 protein_id gnl|my_center|LOCUS_15390 3970 2774 gene locus_tag LOCUS_15400 gene ftsA 3970 2774 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216485.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence150 1 1764 gene locus_tag LOCUS_15410 1 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1817 2188 gene locus_tag LOCUS_15420 gene rbfA 1817 2188 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_15420 2193 3161 gene locus_tag LOCUS_15430 2193 3161 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_15430 3158 4060 gene locus_tag LOCUS_15440 gene truB 3158 4060 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_15440 4053 4799 gene locus_tag LOCUS_15450 4053 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4999 5256 gene locus_tag LOCUS_15460 gene rpsO 4999 5256 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence151 515 910 gene locus_tag LOCUS_15470 515 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 957 1649 gene locus_tag LOCUS_15480 957 1649 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228242.1 protein_id gnl|my_center|LOCUS_15480 1780 2583 gene locus_tag LOCUS_15490 1780 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3341 3802 gene locus_tag LOCUS_15500 3341 3802 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_15500 3807 4970 gene locus_tag LOCUS_15510 gene nifS 3807 4970 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_15510 4983 5378 gene locus_tag LOCUS_15520 gene nifU 4983 5378 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence152 397 852 gene locus_tag LOCUS_15530 397 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 863 1090 gene locus_tag LOCUS_15540 863 1090 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899126.1 protein_id gnl|my_center|LOCUS_15540 1071 2474 gene locus_tag LOCUS_15550 1071 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2620 4224 gene locus_tag LOCUS_15560 2620 4224 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141523.1 protein_id gnl|my_center|LOCUS_15560 4295 4774 gene locus_tag LOCUS_15570 gene tadA 4295 4774 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803986.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence153 343 1944 gene locus_tag LOCUS_15580 343 1944 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_15580 1941 2648 gene locus_tag LOCUS_15590 1941 2648 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811882.1 protein_id gnl|my_center|LOCUS_15590 2759 3835 gene locus_tag LOCUS_15600 2759 3835 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812249.1 protein_id gnl|my_center|LOCUS_15600 3861 4577 gene locus_tag LOCUS_15610 3861 4577 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812246.1 protein_id gnl|my_center|LOCUS_15610 4574 5161 gene locus_tag LOCUS_15620 4574 5161 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944116.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence154 2195 909 gene locus_tag LOCUS_15630 2195 909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943646.1 protein_id gnl|my_center|LOCUS_15630 2881 2195 gene locus_tag LOCUS_15640 2881 2195 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461247.1 protein_id gnl|my_center|LOCUS_15640 4871 2889 gene locus_tag LOCUS_15650 4871 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence155 1083 190 gene locus_tag LOCUS_15660 1083 190 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233894.1 protein_id gnl|my_center|LOCUS_15660 1841 1209 gene locus_tag LOCUS_15670 gene cysE 1841 1209 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000476500.1 protein_id gnl|my_center|LOCUS_15670 2760 1831 gene locus_tag LOCUS_15680 gene cysK 2760 1831 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108620.1 protein_id gnl|my_center|LOCUS_15680 3002 4000 gene locus_tag LOCUS_15690 3002 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3984 4766 gene locus_tag LOCUS_15700 3984 4766 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920153.1 protein_id gnl|my_center|LOCUS_15700 >Feature sequence156 1158 364 gene locus_tag LOCUS_15710 1158 364 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527743.1 protein_id gnl|my_center|LOCUS_15710 1671 5171 gene locus_tag LOCUS_15720 gene nifJ 1671 5171 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391612.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence157 904 158 gene locus_tag LOCUS_15730 904 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2435 906 gene locus_tag LOCUS_15740 2435 906 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_15740 2666 2866 gene locus_tag LOCUS_15750 2666 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2908 4980 gene locus_tag LOCUS_15760 gene fusA 2908 4980 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence158 1212 343 gene locus_tag LOCUS_15770 gene sdaAA 1212 343 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356262.1 protein_id gnl|my_center|LOCUS_15770 1905 1225 gene locus_tag LOCUS_15780 gene sdaAB 1905 1225 CDS product L-serine ammonia-lyase, iron-sulfur-dependent subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356598.1 protein_id gnl|my_center|LOCUS_15780 3246 1915 gene locus_tag LOCUS_15790 3246 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 4096 3248 gene locus_tag LOCUS_15800 4096 3248 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_15800 4895 4188 gene locus_tag LOCUS_15810 4895 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence159 295 222 gene locus_tag LOCUS_t00350 295 222 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 413 338 gene locus_tag LOCUS_t00360 413 338 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 491 416 gene locus_tag LOCUS_t00370 491 416 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 592 516 gene locus_tag LOCUS_t00380 592 516 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 673 598 gene locus_tag LOCUS_t00390 673 598 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1816 1004 gene locus_tag LOCUS_15820 1816 1004 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_15820 2405 1818 gene locus_tag LOCUS_15830 gene rsxA 2405 1818 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_15830 3040 2402 gene locus_tag LOCUS_15840 3040 2402 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948148.1 protein_id gnl|my_center|LOCUS_15840 3963 3043 gene locus_tag LOCUS_15850 3963 3043 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948146.1 protein_id gnl|my_center|LOCUS_15850 <5158 3965 gene locus_tag LOCUS_15860 <5158 3965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948145.1:electron transport complex subunit RsxC >Feature sequence160 50 472 gene locus_tag LOCUS_15870 50 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 642 2519 gene locus_tag LOCUS_15880 642 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2530 2958 gene locus_tag LOCUS_15890 2530 2958 CDS product Zn-finger containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964917.1 protein_id gnl|my_center|LOCUS_15890 3019 3222 gene locus_tag LOCUS_15900 3019 3222 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964076.1 protein_id gnl|my_center|LOCUS_15900 3516 4931 gene locus_tag LOCUS_15910 3516 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence161 524 1039 gene locus_tag LOCUS_15920 524 1039 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144704.1 protein_id gnl|my_center|LOCUS_15920 1060 2709 gene locus_tag LOCUS_15930 1060 2709 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428989.1 protein_id gnl|my_center|LOCUS_15930 2718 4163 gene locus_tag LOCUS_15940 gene gltX 2718 4163 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_15940 4519 4307 gene locus_tag LOCUS_15950 4519 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 4684 4872 gene locus_tag LOCUS_15960 4684 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence162 256 936 gene locus_tag LOCUS_15970 256 936 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861069.1 protein_id gnl|my_center|LOCUS_15970 963 1631 gene locus_tag LOCUS_15980 963 1631 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_15980 1656 3524 gene locus_tag LOCUS_15990 1656 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3636 4691 gene locus_tag LOCUS_16000 3636 4691 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136824.1 protein_id gnl|my_center|LOCUS_16000 4693 4896 gene locus_tag LOCUS_16010 4693 4896 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796544.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence163 2074 1214 gene locus_tag LOCUS_16020 gene ispE 2074 1214 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226742.1 protein_id gnl|my_center|LOCUS_16020 2173 2715 gene locus_tag LOCUS_16030 2173 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2699 3394 gene locus_tag LOCUS_16040 gene sleB 2699 3394 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_16040 3404 4765 gene locus_tag LOCUS_16050 gene ypeB 3404 4765 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391745.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence164 436 191 gene locus_tag LOCUS_16060 436 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 2105 789 gene locus_tag LOCUS_16070 2105 789 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_16070 2446 3027 gene locus_tag LOCUS_16080 2446 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 3024 4427 gene locus_tag LOCUS_16090 3024 4427 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence165 1914 826 gene locus_tag LOCUS_16100 gene serC 1914 826 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_16100 2661 2230 gene locus_tag LOCUS_16110 2661 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 3893 2832 gene locus_tag LOCUS_16120 3893 2832 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_16120 4131 4850 gene locus_tag LOCUS_16130 4131 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence166 1247 255 gene locus_tag LOCUS_16140 1247 255 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124123.1 protein_id gnl|my_center|LOCUS_16140 2788 1397 gene locus_tag LOCUS_16150 2788 1397 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_16150 2929 3246 gene locus_tag LOCUS_16160 2929 3246 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669619.1 protein_id gnl|my_center|LOCUS_16160 3239 3847 gene locus_tag LOCUS_16170 3239 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3844 4812 gene locus_tag LOCUS_16180 3844 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence167 2188 284 gene locus_tag LOCUS_16190 2188 284 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_16190 3940 2204 gene locus_tag LOCUS_16200 3940 2204 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462045.1 protein_id gnl|my_center|LOCUS_16200 4923 3937 gene locus_tag LOCUS_16210 4923 3937 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence168 938 183 gene locus_tag LOCUS_16220 938 183 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002901594.1 protein_id gnl|my_center|LOCUS_16220 1132 1779 gene locus_tag LOCUS_16230 1132 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16230 1686 2069 gene locus_tag LOCUS_16240 1686 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2100 4499 gene locus_tag LOCUS_16250 2100 4499 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101845.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence169 1387 1064 gene locus_tag LOCUS_16260 1387 1064 CDS product YlxQ family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439520.1 protein_id gnl|my_center|LOCUS_16260 1649 1380 gene locus_tag LOCUS_16270 1649 1380 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_16270 2780 1668 gene locus_tag LOCUS_16280 gene nusA 2780 1668 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_16280 3282 2821 gene locus_tag LOCUS_16290 3282 2821 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_16290 <4859 3462 gene locus_tag LOCUS_16300 <4859 3462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986794.1:PolC-type DNA polymerase III >Feature sequence170 671 851 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq aagcgccccaaccggtcatcc 2167 1052 gene locus_tag LOCUS_16310 2167 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3069 2191 gene locus_tag LOCUS_16320 3069 2191 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_16320 3259 4095 gene locus_tag LOCUS_16330 gene dapF 3259 4095 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_16330 4255 4575 gene locus_tag LOCUS_16340 4255 4575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence171 1916 1224 gene locus_tag LOCUS_16350 1916 1224 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461250.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence172 1504 362 gene locus_tag LOCUS_16360 1504 362 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674788.1 protein_id gnl|my_center|LOCUS_16360 1658 3142 gene locus_tag LOCUS_16370 gene thrC 1658 3142 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_16370 3139 3588 gene locus_tag LOCUS_16380 3139 3588 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357848.1 protein_id gnl|my_center|LOCUS_16380 4554 4036 gene locus_tag LOCUS_16390 4554 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence173 789 118 gene locus_tag LOCUS_16400 789 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3399 982 gene locus_tag LOCUS_16410 gene leuS 3399 982 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285916.1 protein_id gnl|my_center|LOCUS_16410 3816 4595 gene locus_tag LOCUS_16420 3816 4595 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896027.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence174 2661 3761 gene locus_tag LOCUS_16430 2661 3761 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768275.1 protein_id gnl|my_center|LOCUS_16430 3761 4567 gene locus_tag LOCUS_16440 gene rsmA 3761 4567 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence175 1673 522 gene locus_tag LOCUS_16450 1673 522 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461367.1 protein_id gnl|my_center|LOCUS_16450 2545 1679 gene locus_tag LOCUS_16460 2545 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 2945 2556 gene locus_tag LOCUS_16470 2945 2556 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_16470 3859 2942 gene locus_tag LOCUS_16480 3859 2942 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384240.1 protein_id gnl|my_center|LOCUS_16480 4335 3841 gene locus_tag LOCUS_16490 4335 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence176 562 176 gene locus_tag LOCUS_16500 562 176 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721726.1 protein_id gnl|my_center|LOCUS_16500 2087 729 gene locus_tag LOCUS_16510 gene glmM 2087 729 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_16510 3351 2257 gene locus_tag LOCUS_16520 3351 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 4085 3690 gene locus_tag LOCUS_16530 gene rpsI 4085 3690 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966378.1 protein_id gnl|my_center|LOCUS_16530 4537 4106 gene locus_tag LOCUS_16540 gene rplM 4537 4106 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966379.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence177 1097 129 gene locus_tag LOCUS_16550 1097 129 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_16550 2458 1244 gene locus_tag LOCUS_16560 2458 1244 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_16560 3380 2673 gene locus_tag LOCUS_16570 3380 2673 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462080.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence178 84 413 gene locus_tag LOCUS_16580 84 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 447 1247 gene locus_tag LOCUS_16590 447 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1461 3281 gene locus_tag LOCUS_16600 1461 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 3295 4209 gene locus_tag LOCUS_16610 3295 4209 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence179 1831 293 gene locus_tag LOCUS_16620 1831 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2526 1828 gene locus_tag LOCUS_16630 2526 1828 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812153.1 protein_id gnl|my_center|LOCUS_16630 2806 3477 gene locus_tag LOCUS_16640 2806 3477 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_16640 3569 3943 gene locus_tag LOCUS_16650 3569 3943 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_16650 3962 4318 gene locus_tag LOCUS_16660 3962 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence180 253 2100 gene locus_tag LOCUS_16670 253 2100 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796568.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16670 3612 2206 gene locus_tag LOCUS_16680 3612 2206 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_16680 <4425 3605 gene locus_tag LOCUS_16690 <4425 3605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817208.1:FAD:protein FMN transferase >Feature sequence181 2475 517 gene locus_tag LOCUS_16700 2475 517 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_16700 3456 2512 gene locus_tag LOCUS_16710 3456 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence182 2186 1290 gene locus_tag LOCUS_16720 2186 1290 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388671.1 protein_id gnl|my_center|LOCUS_16720 <4368 2183 gene locus_tag LOCUS_16730 <4368 2183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000184871.1:formate C-acetyltransferase >Feature sequence183 38 961 gene locus_tag LOCUS_16740 gene gpr 38 961 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_16740 1841 966 gene locus_tag LOCUS_16750 1841 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2182 2688 gene locus_tag LOCUS_16760 2182 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 3069 4247 gene locus_tag LOCUS_16770 3069 4247 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence184 1369 218 gene locus_tag LOCUS_16780 1369 218 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680415.1 protein_id gnl|my_center|LOCUS_16780 1743 2807 gene locus_tag LOCUS_16790 gene yedE 1743 2807 CDS product YedE family putative selenium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680420.1 protein_id gnl|my_center|LOCUS_16790 2897 3103 gene locus_tag LOCUS_16800 2897 3103 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667494.1 protein_id gnl|my_center|LOCUS_16800 3111 3350 gene locus_tag LOCUS_16810 3111 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence185 403 1917 gene locus_tag LOCUS_16820 403 1917 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_16820 1914 2330 gene locus_tag LOCUS_16830 1914 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2730 3089 gene locus_tag LOCUS_16840 2730 3089 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393829.1 protein_id gnl|my_center|LOCUS_16840 3086 3532 gene locus_tag LOCUS_16850 3086 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3529 3969 gene locus_tag LOCUS_16860 3529 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence186 1106 309 gene locus_tag LOCUS_16870 1106 309 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_16870 2901 1273 gene locus_tag LOCUS_16880 gene groL 2901 1273 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243151.1 protein_id gnl|my_center|LOCUS_16880 3212 2928 gene locus_tag LOCUS_16890 3212 2928 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_16890 3730 4194 gene locus_tag LOCUS_16900 3730 4194 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_16900 >Feature sequence187 1045 32 gene locus_tag LOCUS_16910 1045 32 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459857.1 protein_id gnl|my_center|LOCUS_16910 1443 2117 gene locus_tag LOCUS_16920 1443 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2138 3313 gene locus_tag LOCUS_16930 2138 3313 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_16930 3326 4069 gene locus_tag LOCUS_16940 3326 4069 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836450.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence188 174 1979 gene locus_tag LOCUS_16950 174 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2173 2946 gene locus_tag LOCUS_16960 gene sigG 2173 2946 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965003.1 protein_id gnl|my_center|LOCUS_16960 3008 4144 gene locus_tag LOCUS_16970 gene mutY 3008 4144 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence189 1 1365 gene locus_tag LOCUS_16980 gene lpdA 1 1365 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108698.1 protein_id gnl|my_center|LOCUS_16980 1407 3875 gene locus_tag LOCUS_16990 1407 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence190 <1 3315 gene locus_tag LOCUS_17000 <1 3315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339463.1:glucoamylase family protein >Feature sequence191 3028 2675 gene locus_tag LOCUS_17010 3028 2675 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_17010 3669 3028 gene locus_tag LOCUS_17020 3669 3028 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944761.1 protein_id gnl|my_center|LOCUS_17020 4156 3650 gene locus_tag LOCUS_17030 4156 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence192 <1 786 gene locus_tag LOCUS_17040 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870103.1:nucleoside kinase 805 1338 gene locus_tag LOCUS_17050 805 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1652 1413 gene locus_tag LOCUS_17060 1652 1413 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_17060 2414 1668 gene locus_tag LOCUS_17070 2414 1668 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242836.1 protein_id gnl|my_center|LOCUS_17070 <4138 2430 gene locus_tag LOCUS_17080 <4138 2430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861762.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase >Feature sequence193 626 1852 gene locus_tag LOCUS_17090 626 1852 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_17090 1873 3243 gene locus_tag LOCUS_17100 gene argH 1873 3243 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_17100 >Feature sequence194 645 1070 gene locus_tag LOCUS_17110 645 1070 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_17110 1063 1827 gene locus_tag LOCUS_17120 gene thyX 1063 1827 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943727.1 protein_id gnl|my_center|LOCUS_17120 1855 2826 gene locus_tag LOCUS_17130 1855 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2827 3423 gene locus_tag LOCUS_17140 2827 3423 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence195 1123 380 gene locus_tag LOCUS_17150 1123 380 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965592.1 protein_id gnl|my_center|LOCUS_17150 1765 1193 gene locus_tag LOCUS_17160 1765 1193 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947937.1 protein_id gnl|my_center|LOCUS_17160 2694 1762 gene locus_tag LOCUS_17170 2694 1762 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387471.1 protein_id gnl|my_center|LOCUS_17170 2879 3784 gene locus_tag LOCUS_17180 2879 3784 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence196 2152 185 gene locus_tag LOCUS_17190 2152 185 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948262.1 protein_id gnl|my_center|LOCUS_17190 2475 3722 gene locus_tag LOCUS_17200 2475 3722 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence197 504 220 gene locus_tag LOCUS_17210 504 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 605 1135 gene locus_tag LOCUS_17220 605 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1288 3681 gene locus_tag LOCUS_17230 gene lon 1288 3681 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence198 1392 2594 gene locus_tag LOCUS_17240 1392 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 <3957 2989 gene locus_tag LOCUS_17250 <3957 2989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064637.1:TRAP transporter permease >Feature sequence199 2130 604 gene locus_tag LOCUS_17260 2130 604 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392536.1 protein_id gnl|my_center|LOCUS_17260 2564 2178 gene locus_tag LOCUS_17270 2564 2178 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_17270 <3892 2582 gene locus_tag LOCUS_17280 <3892 2582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730541.1:phospholipid carrier-dependent glycosyltransferase >Feature sequence200 22 1041 gene locus_tag LOCUS_17290 22 1041 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948644.1 protein_id gnl|my_center|LOCUS_17290 1075 1938 gene locus_tag LOCUS_17300 gene modA 1075 1938 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_17300 2059 2733 gene locus_tag LOCUS_17310 gene modB 2059 2733 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_17310 2734 3780 gene locus_tag LOCUS_17320 2734 3780 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888694.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence201 1 954 gene locus_tag LOCUS_17330 gene tdh 1 954 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478141.1 protein_id gnl|my_center|LOCUS_17330 970 2151 gene locus_tag LOCUS_17340 970 2151 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532322.1 protein_id gnl|my_center|LOCUS_17340 2275 2466 gene locus_tag LOCUS_17350 gene rpmB 2275 2466 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813371.1 protein_id gnl|my_center|LOCUS_17350 2582 3583 gene locus_tag LOCUS_17360 2582 3583 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_17360 3726 3845 gene locus_tag LOCUS_17370 3726 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence202 457 77 gene locus_tag LOCUS_17380 457 77 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925584.1 protein_id gnl|my_center|LOCUS_17380 971 489 gene locus_tag LOCUS_17390 gene rimI 971 489 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925883.1 protein_id gnl|my_center|LOCUS_17390 1606 968 gene locus_tag LOCUS_17400 gene tsaB 1606 968 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640977.1 protein_id gnl|my_center|LOCUS_17400 2064 1603 gene locus_tag LOCUS_17410 gene tsaE 2064 1603 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_17410 3188 2064 gene locus_tag LOCUS_17420 gene tgt 3188 2064 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_17420 3802 3197 gene locus_tag LOCUS_17430 3802 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence203 748 335 gene locus_tag LOCUS_17440 748 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_17440 2038 869 gene locus_tag LOCUS_17450 gene metK 2038 869 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_17450 2314 3105 gene locus_tag LOCUS_17460 2314 3105 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947991.1 protein_id gnl|my_center|LOCUS_17460 3080 3373 gene locus_tag LOCUS_17470 3080 3373 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986717.1 protein_id gnl|my_center|LOCUS_17470 3477 3552 gene locus_tag LOCUS_t00400 3477 3552 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence204 1873 644 gene locus_tag LOCUS_17480 1873 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence205 737 1576 gene locus_tag LOCUS_17490 737 1576 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_17490 1579 2625 gene locus_tag LOCUS_17500 1579 2625 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_17500 2610 3647 gene locus_tag LOCUS_17510 2610 3647 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence206 941 2356 gene locus_tag LOCUS_17520 941 2356 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100875.1 protein_id gnl|my_center|LOCUS_17520 2649 2416 gene locus_tag LOCUS_17530 2649 2416 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003063668.1 protein_id gnl|my_center|LOCUS_17530 3007 2636 gene locus_tag LOCUS_17540 3007 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 3507 3100 gene locus_tag LOCUS_17550 3507 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence207 486 1397 gene locus_tag LOCUS_17560 486 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1411 1941 gene locus_tag LOCUS_17570 1411 1941 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_17570 1969 3459 gene locus_tag LOCUS_17580 gene glpK 1969 3459 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence208 1138 350 gene locus_tag LOCUS_17590 1138 350 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480027.1 protein_id gnl|my_center|LOCUS_17590 1968 1252 gene locus_tag LOCUS_17600 1968 1252 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589527.1 protein_id gnl|my_center|LOCUS_17600 2298 3179 gene locus_tag LOCUS_17610 2298 3179 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966103.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence209 1338 487 gene locus_tag LOCUS_17620 1338 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1520 3349 gene locus_tag LOCUS_17630 gene ftsH 1520 3349 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272613.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence210 908 156 gene locus_tag LOCUS_17640 908 156 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861262.1 protein_id gnl|my_center|LOCUS_17640 1424 933 gene locus_tag LOCUS_17650 1424 933 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058223026.1 protein_id gnl|my_center|LOCUS_17650 2355 1435 gene locus_tag LOCUS_17660 2355 1435 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence211 231 884 gene locus_tag LOCUS_17670 231 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 908 1672 gene locus_tag LOCUS_17680 908 1672 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813026.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence212 >Feature sequence213 1810 83 gene locus_tag LOCUS_17690 1810 83 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679450.1 protein_id gnl|my_center|LOCUS_17690 2331 1969 gene locus_tag LOCUS_17700 2331 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 2698 3411 gene locus_tag LOCUS_17710 2698 3411 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221393.1 protein_id gnl|my_center|LOCUS_17710 >Feature sequence214 1061 213 gene locus_tag LOCUS_17720 1061 213 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219921.1 protein_id gnl|my_center|LOCUS_17720 1957 1085 gene locus_tag LOCUS_17730 1957 1085 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_17730 2612 2040 gene locus_tag LOCUS_17740 2612 2040 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047752.1 protein_id gnl|my_center|LOCUS_17740 2770 3390 gene locus_tag LOCUS_17750 2770 3390 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence215 860 120 gene locus_tag LOCUS_17760 gene rpsB 860 120 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003424537.1 protein_id gnl|my_center|LOCUS_17760 1369 2241 gene locus_tag LOCUS_17770 1369 2241 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_17770 2354 2911 gene locus_tag LOCUS_17780 gene efp 2354 2911 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889023.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence216 1282 53 gene locus_tag LOCUS_17790 1282 53 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_17790 1492 2562 gene locus_tag LOCUS_17800 1492 2562 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815048.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence217 227 1117 gene locus_tag LOCUS_17810 227 1117 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542436.1 protein_id gnl|my_center|LOCUS_17810 1189 1989 gene locus_tag LOCUS_17820 1189 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17820 1980 2954 gene locus_tag LOCUS_17830 1980 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence218 940 110 gene locus_tag LOCUS_17840 940 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 1244 2290 gene locus_tag LOCUS_17850 1244 2290 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420729.1 protein_id gnl|my_center|LOCUS_17850 2476 3279 gene locus_tag LOCUS_17860 gene proC 2476 3279 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689711.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence219 352 2940 gene locus_tag LOCUS_17870 gene clpB 352 2940 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009165978.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence220 808 188 gene locus_tag LOCUS_17880 808 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 1063 2412 gene locus_tag LOCUS_17890 1063 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence221 216 1988 gene locus_tag LOCUS_17900 216 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1982 2485 gene locus_tag LOCUS_17910 1982 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 2543 2911 gene locus_tag LOCUS_17920 2543 2911 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002365398.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence222 1268 135 gene locus_tag LOCUS_17930 1268 135 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_17930 <3131 1464 gene locus_tag LOCUS_17940 <3131 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393219.1:NADH-dependent [FeFe] hydrogenase, group A6 >Feature sequence223 1055 159 gene locus_tag LOCUS_17950 1055 159 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112601.1 protein_id gnl|my_center|LOCUS_17950 1793 1131 gene locus_tag LOCUS_17960 1793 1131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388547.1 protein_id gnl|my_center|LOCUS_17960 2808 1786 gene locus_tag LOCUS_17970 2808 1786 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817222.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence224 2771 1344 gene locus_tag LOCUS_17980 2771 1344 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462079.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence225 327 1097 gene locus_tag LOCUS_17990 gene proB 327 1097 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_17990 1100 2356 gene locus_tag LOCUS_18000 1100 2356 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836905.1 protein_id gnl|my_center|LOCUS_18000 2353 2598 gene locus_tag LOCUS_18010 2353 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence226 268 101 gene locus_tag LOCUS_18020 268 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 803 1087 gene locus_tag LOCUS_18030 803 1087 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943600.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence227 1601 741 gene locus_tag LOCUS_18040 1601 741 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_18040 2365 1688 gene locus_tag LOCUS_18050 2365 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 2684 2358 gene locus_tag LOCUS_18060 2684 2358 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence228 <1 664 gene locus_tag LOCUS_18070 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023177.1:EamA family transporter 1840 848 gene locus_tag LOCUS_18080 gene holA 1840 848 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320835.1 protein_id gnl|my_center|LOCUS_18080 2927 1848 gene locus_tag LOCUS_18090 2927 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence229 1759 281 gene locus_tag LOCUS_18100 1759 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 2867 1752 gene locus_tag LOCUS_18110 2867 1752 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868878.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence230 1466 315 gene locus_tag LOCUS_18120 gene alr 1466 315 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_18120 1821 2219 gene locus_tag LOCUS_18130 1821 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2223 2693 gene locus_tag LOCUS_18140 gene ybaK 2223 2693 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence231 1324 314 gene locus_tag LOCUS_18150 1324 314 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392159.1 protein_id gnl|my_center|LOCUS_18150 2337 1549 gene locus_tag LOCUS_18160 2337 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence232 844 458 gene locus_tag LOCUS_18170 844 458 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_18170 1027 1569 gene locus_tag LOCUS_18180 1027 1569 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679463.1 protein_id gnl|my_center|LOCUS_18180 1566 2117 gene locus_tag LOCUS_18190 1566 2117 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679462.1 protein_id gnl|my_center|LOCUS_18190 >Feature sequence233 355 125 gene locus_tag LOCUS_18200 355 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1855 662 gene locus_tag LOCUS_18210 gene ygeW 1855 662 CDS product knotted carbamoyltransferase YgeW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379712.1 protein_id gnl|my_center|LOCUS_18210 2758 1886 gene locus_tag LOCUS_18220 2758 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence234 1579 311 gene locus_tag LOCUS_18230 1579 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1709 2611 gene locus_tag LOCUS_18240 1709 2611 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence235 <1 990 gene locus_tag LOCUS_18250 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009898858.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 983 1669 gene locus_tag LOCUS_18260 gene rsmG 983 1669 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462328.1 protein_id gnl|my_center|LOCUS_18260 1719 2561 gene locus_tag LOCUS_18270 gene noc 1719 2561 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966991.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence236 <1 1246 gene locus_tag LOCUS_18280 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964611.1:DNA primase 1286 2398 gene locus_tag LOCUS_18290 gene rpoD 1286 2398 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence237 710 210 gene locus_tag LOCUS_18300 710 210 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068139.1 protein_id gnl|my_center|LOCUS_18300 1391 720 gene locus_tag LOCUS_18310 1391 720 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010956859.1 protein_id gnl|my_center|LOCUS_18310 2209 1496 gene locus_tag LOCUS_18320 2209 1496 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393177.1 protein_id gnl|my_center|LOCUS_18320 2365 2541 gene locus_tag LOCUS_18330 2365 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence238 795 310 gene locus_tag LOCUS_18340 795 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 1152 823 gene locus_tag LOCUS_18350 1152 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1487 1140 gene locus_tag LOCUS_18360 1487 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1965 1480 gene locus_tag LOCUS_18370 1965 1480 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393839.1 protein_id gnl|my_center|LOCUS_18370 2175 2624 gene locus_tag LOCUS_18380 2175 2624 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124797437.1 protein_id gnl|my_center|LOCUS_18380 >Feature sequence239 1530 397 gene locus_tag LOCUS_18390 1530 397 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082494.1 protein_id gnl|my_center|LOCUS_18390 1815 2492 gene locus_tag LOCUS_18400 1815 2492 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence240 360 1316 gene locus_tag LOCUS_18410 360 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 1329 2126 gene locus_tag LOCUS_18420 1329 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 >Feature sequence241 2249 174 gene locus_tag LOCUS_18430 2249 174 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence242 30 743 gene locus_tag LOCUS_18440 30 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 736 2043 gene locus_tag LOCUS_18450 gene trmFO 736 2043 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547141.1 protein_id gnl|my_center|LOCUS_18450 >Feature sequence243 98 1063 gene locus_tag LOCUS_18460 98 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1207 2370 gene locus_tag LOCUS_18470 1207 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence244 837 136 gene locus_tag LOCUS_18480 gene dapD 837 136 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286875.1 protein_id gnl|my_center|LOCUS_18480 1556 834 gene locus_tag LOCUS_18490 gene dapB 1556 834 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286877.1 protein_id gnl|my_center|LOCUS_18490 2437 1553 gene locus_tag LOCUS_18500 gene dapA 2437 1553 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438799.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence245 340 1467 gene locus_tag LOCUS_18510 340 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437819.1 protein_id gnl|my_center|LOCUS_18510 >Feature sequence246 56 1417 gene locus_tag LOCUS_18520 56 1417 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107748.1 protein_id gnl|my_center|LOCUS_18520 <2518 1508 gene locus_tag LOCUS_18530 <2518 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121872.1:sodium:solute symporter family protein