>Feature sequence001 11928 9760 gene locus_tag LOCUS_00010 11928 9760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 12873 11968 gene locus_tag LOCUS_00020 12873 11968 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 protein_id gnl|my_center|LOCUS_00020 13898 12876 gene locus_tag LOCUS_00030 13898 12876 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356840.1 protein_id gnl|my_center|LOCUS_00030 15757 13901 gene locus_tag LOCUS_00040 15757 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 18766 15860 gene locus_tag LOCUS_00050 18766 15860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 19812 18763 gene locus_tag LOCUS_00060 19812 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 23413 19829 gene locus_tag LOCUS_00070 23413 19829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 24637 23813 gene locus_tag LOCUS_00080 24637 23813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 25474 24644 gene locus_tag LOCUS_00090 25474 24644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 26483 25650 gene locus_tag LOCUS_00100 26483 25650 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804051.1 protein_id gnl|my_center|LOCUS_00100 27333 26485 gene locus_tag LOCUS_00110 27333 26485 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00110 28565 27498 gene locus_tag LOCUS_00120 28565 27498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 29870 28596 gene locus_tag LOCUS_00130 29870 28596 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227019.1 protein_id gnl|my_center|LOCUS_00130 32089 29882 gene locus_tag LOCUS_00140 32089 29882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 33754 32192 gene locus_tag LOCUS_00150 33754 32192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 34720 33755 gene locus_tag LOCUS_00160 34720 33755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 36906 34717 gene locus_tag LOCUS_00170 36906 34717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 38676 37183 gene locus_tag LOCUS_00180 38676 37183 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243920.1 protein_id gnl|my_center|LOCUS_00180 40922 38700 gene locus_tag LOCUS_00190 40922 38700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 41990 40941 gene locus_tag LOCUS_00200 41990 40941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_00200 44212 42035 gene locus_tag LOCUS_00210 44212 42035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 44799 44224 gene locus_tag LOCUS_00220 44799 44224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 46383 44815 gene locus_tag LOCUS_00230 46383 44815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 47137 46397 gene locus_tag LOCUS_00240 47137 46397 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242715.1 protein_id gnl|my_center|LOCUS_00240 48243 47290 gene locus_tag LOCUS_00250 48243 47290 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776887.1 protein_id gnl|my_center|LOCUS_00250 49569 48271 gene locus_tag LOCUS_00260 49569 48271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 49771 49544 gene locus_tag LOCUS_00270 49771 49544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 50979 49993 gene locus_tag LOCUS_00280 50979 49993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 51155 52366 gene locus_tag LOCUS_00290 51155 52366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 52447 53226 gene locus_tag LOCUS_00300 gene sigG 52447 53226 CDS product RNA polymerase sporulation sigma factor SigG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986856.1 protein_id gnl|my_center|LOCUS_00300 54657 53332 gene locus_tag LOCUS_00310 54657 53332 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_00310 55979 54900 gene locus_tag LOCUS_00320 55979 54900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 >Feature sequence002 1721 372 gene locus_tag LOCUS_00330 gene dnaA 1721 372 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_00330 1875 2960 gene locus_tag LOCUS_00340 gene recF 1875 2960 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963333.1 protein_id gnl|my_center|LOCUS_00340 3033 4571 gene locus_tag LOCUS_00350 3033 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 4498 5676 gene locus_tag LOCUS_00360 4498 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_00360 5939 6319 gene locus_tag LOCUS_00370 5939 6319 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004298733.1 protein_id gnl|my_center|LOCUS_00370 6291 6638 gene locus_tag LOCUS_00380 6291 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 6799 8181 gene locus_tag LOCUS_00390 gene asnS 6799 8181 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_00390 9134 8913 gene locus_tag LOCUS_00400 9134 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 9436 9215 gene locus_tag LOCUS_00410 9436 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 9521 9985 gene locus_tag LOCUS_00420 9521 9985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 12011 10119 gene locus_tag LOCUS_00430 12011 10119 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379727.1 protein_id gnl|my_center|LOCUS_00430 12010 12168 gene locus_tag LOCUS_00440 12010 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 13040 12165 gene locus_tag LOCUS_00450 13040 12165 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_00450 13162 14325 gene locus_tag LOCUS_00460 gene metK 13162 14325 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947992.1 protein_id gnl|my_center|LOCUS_00460 14510 15244 gene locus_tag LOCUS_00470 14510 15244 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541081.1 protein_id gnl|my_center|LOCUS_00470 15364 18219 gene locus_tag LOCUS_00480 gene secA 15364 18219 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220108.1 protein_id gnl|my_center|LOCUS_00480 18507 19619 gene locus_tag LOCUS_00490 gene prfB 18507 19619 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_00490 19657 20298 gene locus_tag LOCUS_00500 19657 20298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 20417 21472 gene locus_tag LOCUS_00510 gene tsaD 20417 21472 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_00510 22311 22745 gene locus_tag LOCUS_00520 22311 22745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 22823 23485 gene locus_tag LOCUS_00530 22823 23485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 23652 25091 gene locus_tag LOCUS_00540 23652 25091 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892302.1 protein_id gnl|my_center|LOCUS_00540 25497 25300 gene locus_tag LOCUS_00550 25497 25300 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966813.1 protein_id gnl|my_center|LOCUS_00550 26219 25509 gene locus_tag LOCUS_00560 26219 25509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 26439 26693 gene locus_tag LOCUS_00570 26439 26693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 26690 27604 gene locus_tag LOCUS_00580 26690 27604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 27707 28669 gene locus_tag LOCUS_00590 27707 28669 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_00590 28641 30146 gene locus_tag LOCUS_00600 28641 30146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 30133 30606 gene locus_tag LOCUS_00610 gene ybeY 30133 30606 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964605.1 protein_id gnl|my_center|LOCUS_00610 30603 31496 gene locus_tag LOCUS_00620 gene era 30603 31496 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047995.1 protein_id gnl|my_center|LOCUS_00620 31524 31676 gene locus_tag LOCUS_00630 31524 31676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 31735 32457 gene locus_tag LOCUS_00640 gene recO 31735 32457 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_00640 32719 36318 gene locus_tag LOCUS_00650 32719 36318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 36542 39187 gene locus_tag LOCUS_00660 gene ppdK 36542 39187 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047993.1 protein_id gnl|my_center|LOCUS_00660 39321 40004 gene locus_tag LOCUS_00670 39321 40004 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966072.1 protein_id gnl|my_center|LOCUS_00670 40159 41283 gene locus_tag LOCUS_00680 40159 41283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 41753 42784 gene locus_tag LOCUS_00690 gene dcm 41753 42784 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690264.1 protein_id gnl|my_center|LOCUS_00690 42777 43805 gene locus_tag LOCUS_00700 gene dcm 42777 43805 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690264.1 protein_id gnl|my_center|LOCUS_00700 44474 44953 gene locus_tag LOCUS_00710 44474 44953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 46018 45194 gene locus_tag LOCUS_00720 46018 45194 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107810.1 protein_id gnl|my_center|LOCUS_00720 46525 46127 gene locus_tag LOCUS_00730 46525 46127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 >Feature sequence003 3 347 gene locus_tag LOCUS_00740 3 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 1458 619 gene locus_tag LOCUS_00750 gene rsmA 1458 619 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294004.1 protein_id gnl|my_center|LOCUS_00750 2236 1634 gene locus_tag LOCUS_00760 2236 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00760 3029 2223 gene locus_tag LOCUS_00770 3029 2223 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391597.1 protein_id gnl|my_center|LOCUS_00770 5082 3097 gene locus_tag LOCUS_00780 gene metG 5082 3097 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966273.1 protein_id gnl|my_center|LOCUS_00780 5259 5819 gene locus_tag LOCUS_00790 5259 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 5816 6322 gene locus_tag LOCUS_00800 5816 6322 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946311.1 protein_id gnl|my_center|LOCUS_00800 9126 6784 gene locus_tag LOCUS_00810 9126 6784 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949155.1 protein_id gnl|my_center|LOCUS_00810 10056 9181 gene locus_tag LOCUS_00820 gene metF 10056 9181 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_00820 10207 10971 gene locus_tag LOCUS_00830 10207 10971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 10955 11830 gene locus_tag LOCUS_00840 gene spoIVFB 10955 11830 CDS product stage IV sporulation intramembrane metalloprotease SpoIVFB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599075.1 protein_id gnl|my_center|LOCUS_00840 12012 13472 gene locus_tag LOCUS_00850 12012 13472 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028844369.1 protein_id gnl|my_center|LOCUS_00850 13552 14415 gene locus_tag LOCUS_00860 13552 14415 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803903.1 protein_id gnl|my_center|LOCUS_00860 15187 19173 gene locus_tag LOCUS_00870 gene cas9 15187 19173 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681289.1 protein_id gnl|my_center|LOCUS_00870 19170 20033 gene locus_tag LOCUS_00880 gene cas1 19170 20033 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681291.1 protein_id gnl|my_center|LOCUS_00880 20038 20343 gene locus_tag LOCUS_00890 gene cas2 20038 20343 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666293.1 protein_id gnl|my_center|LOCUS_00890 20340 21008 gene locus_tag LOCUS_00900 gene csn2 20340 21008 CDS product type II-A CRISPR-associated protein Csn2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681294.1 protein_id gnl|my_center|LOCUS_00900 21100 21597 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttgagtatggtgttatcttgaacggtagtgaaac 22749 21916 gene locus_tag LOCUS_00910 22749 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 22939 23508 gene locus_tag LOCUS_00920 22939 23508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 23495 24457 gene locus_tag LOCUS_00930 23495 24457 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658092.1 protein_id gnl|my_center|LOCUS_00930 24444 25466 gene locus_tag LOCUS_00940 24444 25466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 26653 25499 gene locus_tag LOCUS_00950 26653 25499 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_00950 27323 26643 gene locus_tag LOCUS_00960 27323 26643 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_00960 27526 29031 gene locus_tag LOCUS_00970 27526 29031 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906329.1 protein_id gnl|my_center|LOCUS_00970 29104 30987 gene locus_tag LOCUS_00980 29104 30987 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475586.1 protein_id gnl|my_center|LOCUS_00980 30989 31720 gene locus_tag LOCUS_00990 30989 31720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 31739 32842 gene locus_tag LOCUS_01000 31739 32842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 33190 33621 gene locus_tag LOCUS_01010 gene rplM 33190 33621 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966379.1 protein_id gnl|my_center|LOCUS_01010 33634 34047 gene locus_tag LOCUS_01020 gene rpsI 33634 34047 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357662.1 protein_id gnl|my_center|LOCUS_01020 34307 34113 gene locus_tag LOCUS_01030 34307 34113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 34584 36674 gene locus_tag LOCUS_01040 34584 36674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 37056 37541 gene locus_tag LOCUS_01050 37056 37541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 37845 37588 gene locus_tag LOCUS_01060 37845 37588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 37966 39486 gene locus_tag LOCUS_01070 37966 39486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 39801 40736 gene locus_tag LOCUS_01080 gene ispE 39801 40736 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_01080 40766 41647 gene locus_tag LOCUS_01090 40766 41647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence004 483 169 gene locus_tag LOCUS_01100 483 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 843 565 gene locus_tag LOCUS_01110 843 565 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022232.1 protein_id gnl|my_center|LOCUS_01110 1807 950 gene locus_tag LOCUS_01120 gene rfbD 1807 950 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_01120 2462 1815 gene locus_tag LOCUS_01130 2462 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 3199 2459 gene locus_tag LOCUS_01140 3199 2459 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706700.1 protein_id gnl|my_center|LOCUS_01140 3992 3207 gene locus_tag LOCUS_01150 3992 3207 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857646.1 protein_id gnl|my_center|LOCUS_01150 4944 4021 gene locus_tag LOCUS_01160 4944 4021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 5944 4928 gene locus_tag LOCUS_01170 gene rfbB 5944 4928 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461013.1 protein_id gnl|my_center|LOCUS_01170 6502 5957 gene locus_tag LOCUS_01180 gene rfbC 6502 5957 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356893.1 protein_id gnl|my_center|LOCUS_01180 7396 6512 gene locus_tag LOCUS_01190 gene rfbA 7396 6512 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112125.1 protein_id gnl|my_center|LOCUS_01190 7743 8432 gene locus_tag LOCUS_01200 7743 8432 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_01200 8439 9554 gene locus_tag LOCUS_01210 8439 9554 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228257.1 protein_id gnl|my_center|LOCUS_01210 11223 9712 gene locus_tag LOCUS_01220 11223 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 12012 11383 gene locus_tag LOCUS_01230 12012 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 15483 12118 gene locus_tag LOCUS_01240 15483 12118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 18647 15480 gene locus_tag LOCUS_01250 18647 15480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 19012 20082 gene locus_tag LOCUS_01260 19012 20082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 21750 20215 gene locus_tag LOCUS_01270 21750 20215 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202403.1 protein_id gnl|my_center|LOCUS_01270 22820 21747 gene locus_tag LOCUS_01280 22820 21747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062194302.1 protein_id gnl|my_center|LOCUS_01280 24880 22817 gene locus_tag LOCUS_01290 24880 22817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 28316 24945 gene locus_tag LOCUS_01300 28316 24945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 31018 28331 gene locus_tag LOCUS_01310 31018 28331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 32794 31028 gene locus_tag LOCUS_01320 32794 31028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 33695 32817 gene locus_tag LOCUS_01330 33695 32817 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027282.1 protein_id gnl|my_center|LOCUS_01330 34696 33707 gene locus_tag LOCUS_01340 34696 33707 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803821.1 protein_id gnl|my_center|LOCUS_01340 35023 35949 gene locus_tag LOCUS_01350 35023 35949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 37195 36047 gene locus_tag LOCUS_01360 gene fucO 37195 36047 CDS product lactaldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005051592.1 protein_id gnl|my_center|LOCUS_01360 38157 37216 gene locus_tag LOCUS_01370 38157 37216 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715519.1 protein_id gnl|my_center|LOCUS_01370 39085 38480 gene locus_tag LOCUS_01380 39085 38480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence005 306 1136 gene locus_tag LOCUS_01390 306 1136 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_01390 1194 1703 gene locus_tag LOCUS_01400 1194 1703 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946061.1 protein_id gnl|my_center|LOCUS_01400 1709 2623 gene locus_tag LOCUS_01410 1709 2623 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004846624.1 protein_id gnl|my_center|LOCUS_01410 2620 3393 gene locus_tag LOCUS_01420 2620 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 3600 4028 gene locus_tag LOCUS_01430 3600 4028 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 protein_id gnl|my_center|LOCUS_01430 4704 4081 gene locus_tag LOCUS_01440 4704 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 4857 5105 gene locus_tag LOCUS_01450 4857 5105 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_01450 5162 6199 gene locus_tag LOCUS_01460 5162 6199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 6207 6995 gene locus_tag LOCUS_01470 6207 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 6992 7672 gene locus_tag LOCUS_01480 6992 7672 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944870.1 protein_id gnl|my_center|LOCUS_01480 7815 8642 gene locus_tag LOCUS_01490 7815 8642 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966224.1 protein_id gnl|my_center|LOCUS_01490 8657 9238 gene locus_tag LOCUS_01500 gene mscL 8657 9238 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258546.1 protein_id gnl|my_center|LOCUS_01500 9896 9594 gene locus_tag LOCUS_01510 9896 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 9964 10461 gene locus_tag LOCUS_01520 gene purE 9964 10461 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_01520 10494 11204 gene locus_tag LOCUS_01530 10494 11204 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047943.1 protein_id gnl|my_center|LOCUS_01530 11286 12314 gene locus_tag LOCUS_01540 gene purM 11286 12314 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262435.1 protein_id gnl|my_center|LOCUS_01540 12311 12925 gene locus_tag LOCUS_01550 gene purN 12311 12925 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964703.1 protein_id gnl|my_center|LOCUS_01550 12953 13675 gene locus_tag LOCUS_01560 12953 13675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 13688 14872 gene locus_tag LOCUS_01570 13688 14872 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765038.1 protein_id gnl|my_center|LOCUS_01570 15025 16305 gene locus_tag LOCUS_01580 gene purD 15025 16305 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436062.1 protein_id gnl|my_center|LOCUS_01580 16318 20016 gene locus_tag LOCUS_01590 16318 20016 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_01590 21994 20177 gene locus_tag LOCUS_01600 21994 20177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 22423 22016 gene locus_tag LOCUS_01610 22423 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 22548 22754 gene locus_tag LOCUS_01620 22548 22754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 22929 23414 gene locus_tag LOCUS_01630 gene nrdR 22929 23414 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965005.1 protein_id gnl|my_center|LOCUS_01630 23446 24489 gene locus_tag LOCUS_01640 gene ispG 23446 24489 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_01640 24493 26022 gene locus_tag LOCUS_01650 24493 26022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 26135 26608 gene locus_tag LOCUS_01660 gene rimP 26135 26608 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288499.1 protein_id gnl|my_center|LOCUS_01660 26652 27785 gene locus_tag LOCUS_01670 gene nusA 26652 27785 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774493.1 protein_id gnl|my_center|LOCUS_01670 27801 28070 gene locus_tag LOCUS_01680 27801 28070 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388362.1 protein_id gnl|my_center|LOCUS_01680 28057 28383 gene locus_tag LOCUS_01690 28057 28383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 28376 31072 gene locus_tag LOCUS_01700 28376 31072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 31203 31580 gene locus_tag LOCUS_01710 gene rbfA 31203 31580 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000776437.1 protein_id gnl|my_center|LOCUS_01710 31577 32533 gene locus_tag LOCUS_01720 31577 32533 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_01720 32549 33400 gene locus_tag LOCUS_01730 gene truB 32549 33400 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_01730 33391 34266 gene locus_tag LOCUS_01740 gene ribF 33391 34266 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102619.1 protein_id gnl|my_center|LOCUS_01740 34263 35108 gene locus_tag LOCUS_01750 34263 35108 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_01750 35222 36274 gene locus_tag LOCUS_01760 35222 36274 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286665.1 protein_id gnl|my_center|LOCUS_01760 36346 36903 gene locus_tag LOCUS_01770 gene efp 36346 36903 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358905.1 protein_id gnl|my_center|LOCUS_01770 37110 37547 gene locus_tag LOCUS_01780 gene dtd 37110 37547 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_01780 37561 38400 gene locus_tag LOCUS_01790 37561 38400 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence006 1483 1163 gene locus_tag LOCUS_01800 1483 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 1599 2528 gene locus_tag LOCUS_01810 1599 2528 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053995180.1 protein_id gnl|my_center|LOCUS_01810 4334 2640 gene locus_tag LOCUS_01820 4334 2640 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817202.1 protein_id gnl|my_center|LOCUS_01820 4823 4398 gene locus_tag LOCUS_01830 4823 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5204 4902 gene locus_tag LOCUS_01840 5204 4902 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583423.1 protein_id gnl|my_center|LOCUS_01840 6082 5201 gene locus_tag LOCUS_01850 gene yecC 6082 5201 CDS product L-cystine ABC transporter ATP-binding protein YecC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273000.1 protein_id gnl|my_center|LOCUS_01850 6728 6087 gene locus_tag LOCUS_01860 6728 6087 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722217.1 protein_id gnl|my_center|LOCUS_01860 7584 6787 gene locus_tag LOCUS_01870 7584 6787 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024379094.1 protein_id gnl|my_center|LOCUS_01870 9888 7936 gene locus_tag LOCUS_01880 9888 7936 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964880.1 protein_id gnl|my_center|LOCUS_01880 10538 10029 gene locus_tag LOCUS_01890 10538 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 11214 10552 gene locus_tag LOCUS_01900 11214 10552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 11882 14272 gene locus_tag LOCUS_01910 11882 14272 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964652.1 protein_id gnl|my_center|LOCUS_01910 16442 14376 gene locus_tag LOCUS_01920 16442 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 18461 16443 gene locus_tag LOCUS_01930 18461 16443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 19679 18477 gene locus_tag LOCUS_01940 19679 18477 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_01940 20046 20894 gene locus_tag LOCUS_01950 20046 20894 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_01950 21501 21079 gene locus_tag LOCUS_01960 21501 21079 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_01960 22926 21613 gene locus_tag LOCUS_01970 22926 21613 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_01970 23522 22950 gene locus_tag LOCUS_01980 23522 22950 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393759.1 protein_id gnl|my_center|LOCUS_01980 25239 23524 gene locus_tag LOCUS_01990 gene iorA 25239 23524 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_01990 26588 25290 gene locus_tag LOCUS_02000 26588 25290 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393761.1 protein_id gnl|my_center|LOCUS_02000 29113 26726 gene locus_tag LOCUS_02010 gene pheT 29113 26726 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357703.1 protein_id gnl|my_center|LOCUS_02010 30153 29131 gene locus_tag LOCUS_02020 gene pheS 30153 29131 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_02020 31254 30562 gene locus_tag LOCUS_02030 gene yunB 31254 30562 CDS product sporulation protein YunB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418439.1 protein_id gnl|my_center|LOCUS_02030 >Feature sequence007 653 578 gene locus_tag LOCUS_t00010 653 578 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1843 932 gene locus_tag LOCUS_02040 1843 932 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814621.1 protein_id gnl|my_center|LOCUS_02040 2130 2510 gene locus_tag LOCUS_02050 2130 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2620 4392 gene locus_tag LOCUS_02060 2620 4392 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000196552.1 protein_id gnl|my_center|LOCUS_02060 4698 5990 gene locus_tag LOCUS_02070 4698 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 6105 6806 gene locus_tag LOCUS_02080 gene rfbF 6105 6806 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816687.1 protein_id gnl|my_center|LOCUS_02080 6917 7966 gene locus_tag LOCUS_02090 gene rfbG 6917 7966 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174704169.1 protein_id gnl|my_center|LOCUS_02090 7942 8457 gene locus_tag LOCUS_02100 7942 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 8459 9784 gene locus_tag LOCUS_02110 gene rfbH 8459 9784 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_02110 9831 11114 gene locus_tag LOCUS_02120 9831 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 11125 12723 gene locus_tag LOCUS_02130 11125 12723 CDS product aldolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461003.1 protein_id gnl|my_center|LOCUS_02130 12727 14523 gene locus_tag LOCUS_02140 gene ilvB 12727 14523 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938671.1 protein_id gnl|my_center|LOCUS_02140 14529 15449 gene locus_tag LOCUS_02150 14529 15449 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545190.1 protein_id gnl|my_center|LOCUS_02150 15446 16375 gene locus_tag LOCUS_02160 15446 16375 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_02160 16582 17673 gene locus_tag LOCUS_02170 16582 17673 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_02170 18078 18512 gene locus_tag LOCUS_02180 18078 18512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 18509 20230 gene locus_tag LOCUS_02190 18509 20230 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966556.1 protein_id gnl|my_center|LOCUS_02190 20217 21989 gene locus_tag LOCUS_02200 20217 21989 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_02200 22014 22694 gene locus_tag LOCUS_02210 22014 22694 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000668240.1 protein_id gnl|my_center|LOCUS_02210 23338 22697 gene locus_tag LOCUS_02220 gene mutM 23338 22697 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_02220 24480 23353 gene locus_tag LOCUS_02230 24480 23353 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814554.1 protein_id gnl|my_center|LOCUS_02230 25271 24537 gene locus_tag LOCUS_02240 25271 24537 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891802.1 protein_id gnl|my_center|LOCUS_02240 25411 26253 gene locus_tag LOCUS_02250 25411 26253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 26250 27938 gene locus_tag LOCUS_02260 26250 27938 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080425.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence008 1696 665 gene locus_tag LOCUS_02270 1696 665 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_02270 2675 1962 gene locus_tag LOCUS_02280 gene fabG 2675 1962 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_02280 3184 2672 gene locus_tag LOCUS_02290 3184 2672 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_02290 3597 3181 gene locus_tag LOCUS_02300 gene aroQ 3597 3181 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_02300 4395 3598 gene locus_tag LOCUS_02310 gene aroE 4395 3598 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439416.1 protein_id gnl|my_center|LOCUS_02310 5663 4425 gene locus_tag LOCUS_02320 gene aroA 5663 4425 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460209.1 protein_id gnl|my_center|LOCUS_02320 6715 5660 gene locus_tag LOCUS_02330 gene aroB 6715 5660 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690567.1 protein_id gnl|my_center|LOCUS_02330 7856 6726 gene locus_tag LOCUS_02340 gene aroC 7856 6726 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_02340 8992 7877 gene locus_tag LOCUS_02350 8992 7877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 9759 9016 gene locus_tag LOCUS_02360 9759 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 10717 9761 gene locus_tag LOCUS_02370 10717 9761 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392351.1 protein_id gnl|my_center|LOCUS_02370 12202 10724 gene locus_tag LOCUS_02380 gene rho 12202 10724 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947979.1 protein_id gnl|my_center|LOCUS_02380 12830 12195 gene locus_tag LOCUS_02390 12830 12195 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_02390 13240 12827 gene locus_tag LOCUS_02400 13240 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 14144 13320 gene locus_tag LOCUS_02410 14144 13320 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_02410 14375 14749 gene locus_tag LOCUS_tm00010 14375 14749 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 15752 14901 gene locus_tag LOCUS_02420 15752 14901 CDS product protein-ADP-ribose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449069.1 protein_id gnl|my_center|LOCUS_02420 18005 15777 gene locus_tag LOCUS_02430 18005 15777 CDS product hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461677.1 protein_id gnl|my_center|LOCUS_02430 19415 18111 gene locus_tag LOCUS_02440 19415 18111 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272434.1 protein_id gnl|my_center|LOCUS_02440 20230 19442 gene locus_tag LOCUS_02450 20230 19442 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232221.1 protein_id gnl|my_center|LOCUS_02450 20262 21236 gene locus_tag LOCUS_02460 20262 21236 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438084.1 protein_id gnl|my_center|LOCUS_02460 22085 21288 gene locus_tag LOCUS_02470 22085 21288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 23125 22100 gene locus_tag LOCUS_02480 23125 22100 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816655.1 protein_id gnl|my_center|LOCUS_02480 23612 23118 gene locus_tag LOCUS_02490 gene coaD 23612 23118 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295492.1 protein_id gnl|my_center|LOCUS_02490 24157 23630 gene locus_tag LOCUS_02500 gene rsmD 24157 23630 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_02500 24777 24154 gene locus_tag LOCUS_02510 24777 24154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 25348 24788 gene locus_tag LOCUS_02520 25348 24788 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941797.1 protein_id gnl|my_center|LOCUS_02520 26067 25486 gene locus_tag LOCUS_02530 26067 25486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 26319 27059 gene locus_tag LOCUS_02540 26319 27059 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722821.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence009 <1 848 gene locus_tag LOCUS_02550 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812530.1:prolipoprotein diacylglyceryl transferase 851 2296 gene locus_tag LOCUS_02560 851 2296 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427657.1 protein_id gnl|my_center|LOCUS_02560 2289 2858 gene locus_tag LOCUS_02570 2289 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2874 3467 gene locus_tag LOCUS_02580 gene lspA 2874 3467 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454916.1 protein_id gnl|my_center|LOCUS_02580 3464 4384 gene locus_tag LOCUS_02590 3464 4384 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_02590 4412 5017 gene locus_tag LOCUS_02600 gene pyrR 4412 5017 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_02600 5045 5344 gene locus_tag LOCUS_02610 5045 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 5447 6778 gene locus_tag LOCUS_02620 gene der 5447 6778 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986848.1 protein_id gnl|my_center|LOCUS_02620 6788 7519 gene locus_tag LOCUS_02630 gene plsY 6788 7519 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081723.1 protein_id gnl|my_center|LOCUS_02630 7589 9064 gene locus_tag LOCUS_02640 gene spoIVA 7589 9064 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_02640 9279 10994 gene locus_tag LOCUS_02650 9279 10994 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294013.1 protein_id gnl|my_center|LOCUS_02650 10991 12799 gene locus_tag LOCUS_02660 10991 12799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_02660 13007 12876 gene locus_tag LOCUS_02670 13007 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 13124 14149 gene locus_tag LOCUS_02680 gene spoVAD 13124 14149 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392888.1 protein_id gnl|my_center|LOCUS_02680 14142 14522 gene locus_tag LOCUS_02690 gene spoVAE 14142 14522 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_02690 14702 17293 gene locus_tag LOCUS_02700 14702 17293 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966706.1 protein_id gnl|my_center|LOCUS_02700 17370 17954 gene locus_tag LOCUS_02710 17370 17954 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_02710 17947 18366 gene locus_tag LOCUS_02720 17947 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 19867 18704 gene locus_tag LOCUS_02730 19867 18704 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051205.1 protein_id gnl|my_center|LOCUS_02730 20531 19959 gene locus_tag LOCUS_02740 20531 19959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 20805 22817 gene locus_tag LOCUS_02750 20805 22817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 22821 23462 gene locus_tag LOCUS_02760 22821 23462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 23469 23915 gene locus_tag LOCUS_02770 23469 23915 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812737.1 protein_id gnl|my_center|LOCUS_02770 24112 25497 gene locus_tag LOCUS_02780 24112 25497 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931271.1 protein_id gnl|my_center|LOCUS_02780 25590 25823 gene locus_tag LOCUS_02790 25590 25823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 25994 26076 gene locus_tag LOCUS_t00020 25994 26076 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26546 26462 gene locus_tag LOCUS_t00030 26546 26462 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 2254 1031 gene locus_tag LOCUS_02800 2254 1031 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965154.1 protein_id gnl|my_center|LOCUS_02800 3749 2331 gene locus_tag LOCUS_02810 3749 2331 CDS product oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355994.1 protein_id gnl|my_center|LOCUS_02810 5287 3797 gene locus_tag LOCUS_02820 5287 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5654 5301 gene locus_tag LOCUS_02830 5654 5301 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566191.1 protein_id gnl|my_center|LOCUS_02830 6004 5666 gene locus_tag LOCUS_02840 6004 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 7394 6015 gene locus_tag LOCUS_02850 7394 6015 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444173.1 protein_id gnl|my_center|LOCUS_02850 8815 7658 gene locus_tag LOCUS_02860 gene thiI 8815 7658 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966254.1 protein_id gnl|my_center|LOCUS_02860 9955 8819 gene locus_tag LOCUS_02870 9955 8819 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895806.1 protein_id gnl|my_center|LOCUS_02870 10624 9998 gene locus_tag LOCUS_02880 10624 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 14672 10626 gene locus_tag LOCUS_02890 gene carB 14672 10626 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892173.1 protein_id gnl|my_center|LOCUS_02890 15744 14665 gene locus_tag LOCUS_02900 15744 14665 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232115.1 protein_id gnl|my_center|LOCUS_02900 16664 15762 gene locus_tag LOCUS_02910 gene argF 16664 15762 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_02910 17827 16661 gene locus_tag LOCUS_02920 17827 16661 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861434.1 protein_id gnl|my_center|LOCUS_02920 18802 17936 gene locus_tag LOCUS_02930 gene argB 18802 17936 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_02930 20027 18816 gene locus_tag LOCUS_02940 gene argJ 20027 18816 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_02940 20966 20031 gene locus_tag LOCUS_02950 gene argC 20966 20031 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523123.1 protein_id gnl|my_center|LOCUS_02950 22256 21036 gene locus_tag LOCUS_02960 22256 21036 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_02960 22871 22419 gene locus_tag LOCUS_02970 22871 22419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 23648 22995 gene locus_tag LOCUS_02980 23648 22995 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_02980 24375 23638 gene locus_tag LOCUS_02990 24375 23638 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048437.1 protein_id gnl|my_center|LOCUS_02990 24596 26392 gene locus_tag LOCUS_03000 24596 26392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence011 2411 1542 gene locus_tag LOCUS_03010 2411 1542 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_03010 2566 3909 gene locus_tag LOCUS_03020 2566 3909 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682344.1 protein_id gnl|my_center|LOCUS_03020 3909 5153 gene locus_tag LOCUS_03030 gene rmuC 3909 5153 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460041.1 protein_id gnl|my_center|LOCUS_03030 5205 5534 gene locus_tag LOCUS_03040 5205 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5550 8489 gene locus_tag LOCUS_03050 5550 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 8754 9038 gene locus_tag LOCUS_03060 gene rpsF 8754 9038 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023040534.1 protein_id gnl|my_center|LOCUS_03060 9057 9464 gene locus_tag LOCUS_03070 gene ssb 9057 9464 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905690.1 protein_id gnl|my_center|LOCUS_03070 9564 9809 gene locus_tag LOCUS_03080 gene rpsR 9564 9809 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391678.1 protein_id gnl|my_center|LOCUS_03080 11690 10113 gene locus_tag LOCUS_03090 11690 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 11977 12150 gene locus_tag LOCUS_03100 11977 12150 CDS product DUF4250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766883.1 protein_id gnl|my_center|LOCUS_03100 13073 12261 gene locus_tag LOCUS_03110 13073 12261 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640577.1 protein_id gnl|my_center|LOCUS_03110 13898 13134 gene locus_tag LOCUS_03120 13898 13134 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837453.1 protein_id gnl|my_center|LOCUS_03120 14785 13895 gene locus_tag LOCUS_03130 gene accD 14785 13895 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966832.1 protein_id gnl|my_center|LOCUS_03130 16194 14848 gene locus_tag LOCUS_03140 gene accC 16194 14848 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_03140 16677 16213 gene locus_tag LOCUS_03150 gene accB 16677 16213 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214627.1 protein_id gnl|my_center|LOCUS_03150 17984 16752 gene locus_tag LOCUS_03160 gene fabF 17984 16752 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_03160 18846 18109 gene locus_tag LOCUS_03170 gene fabG 18846 18109 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933770.1 protein_id gnl|my_center|LOCUS_03170 19779 18943 gene locus_tag LOCUS_03180 gene fabD 19779 18943 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262535.1 protein_id gnl|my_center|LOCUS_03180 20708 19767 gene locus_tag LOCUS_03190 gene fabK 20708 19767 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_03190 20945 20718 gene locus_tag LOCUS_03200 20945 20718 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002983328.1 protein_id gnl|my_center|LOCUS_03200 21926 20961 gene locus_tag LOCUS_03210 21926 20961 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_03210 22588 22172 gene locus_tag LOCUS_03220 gene fabZ 22588 22172 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356286.1 protein_id gnl|my_center|LOCUS_03220 23042 22608 gene locus_tag LOCUS_03230 23042 22608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 25091 23265 gene locus_tag LOCUS_03240 25091 23265 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679355.1 protein_id gnl|my_center|LOCUS_03240 <25828 25063 gene locus_tag LOCUS_03250 <25828 25063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069591551.1:serine O-acetyltransferase >Feature sequence012 <1 632 gene locus_tag LOCUS_03260 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390018.1:putative DNA binding domain-containing protein 858 1403 gene locus_tag LOCUS_03270 gene spoVT 858 1403 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_03270 2226 1354 gene locus_tag LOCUS_03280 2226 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 2358 3953 gene locus_tag LOCUS_03290 2358 3953 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425909.1 protein_id gnl|my_center|LOCUS_03290 3874 5304 gene locus_tag LOCUS_03300 gene mazG 3874 5304 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099544.1 protein_id gnl|my_center|LOCUS_03300 5276 6217 gene locus_tag LOCUS_03310 gene dusB 5276 6217 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966475.1 protein_id gnl|my_center|LOCUS_03310 6281 7240 gene locus_tag LOCUS_03320 6281 7240 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_03320 7256 8854 gene locus_tag LOCUS_03330 7256 8854 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414744.1 protein_id gnl|my_center|LOCUS_03330 8902 9348 gene locus_tag LOCUS_03340 8902 9348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 9364 9804 gene locus_tag LOCUS_03350 9364 9804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 9913 11250 gene locus_tag LOCUS_03360 gene mnmE 9913 11250 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_03360 11279 12169 gene locus_tag LOCUS_03370 11279 12169 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948557.1 protein_id gnl|my_center|LOCUS_03370 12999 12319 gene locus_tag LOCUS_03380 12999 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 13887 13135 gene locus_tag LOCUS_03390 gene dapB 13887 13135 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438808.1 protein_id gnl|my_center|LOCUS_03390 14842 13949 gene locus_tag LOCUS_03400 gene dapA 14842 13949 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422063.1 protein_id gnl|my_center|LOCUS_03400 15993 14914 gene locus_tag LOCUS_03410 gene asd 15993 14914 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_03410 16546 17829 gene locus_tag LOCUS_03420 16546 17829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 17826 18545 gene locus_tag LOCUS_03430 17826 18545 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_03430 18550 19434 gene locus_tag LOCUS_03440 gene hslO 18550 19434 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656366.1 protein_id gnl|my_center|LOCUS_03440 19450 21177 gene locus_tag LOCUS_03450 19450 21177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 21182 22009 gene locus_tag LOCUS_03460 21182 22009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 23176 22208 gene locus_tag LOCUS_03470 23176 22208 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964837.1 protein_id gnl|my_center|LOCUS_03470 23508 24041 gene locus_tag LOCUS_03480 gene rbr3B 23508 24041 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966861.1 protein_id gnl|my_center|LOCUS_03480 24611 24147 gene locus_tag LOCUS_03490 24611 24147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence013 1294 314 gene locus_tag LOCUS_03500 1294 314 CDS product diaminopimelate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808153.1 protein_id gnl|my_center|LOCUS_03500 1912 1376 gene locus_tag LOCUS_03510 gene yfcE 1912 1376 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966036.1 protein_id gnl|my_center|LOCUS_03510 2968 1919 gene locus_tag LOCUS_03520 2968 1919 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245976.1 protein_id gnl|my_center|LOCUS_03520 4247 3021 gene locus_tag LOCUS_03530 gene galK 4247 3021 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_03530 5733 4351 gene locus_tag LOCUS_03540 5733 4351 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_03540 6142 6825 gene locus_tag LOCUS_03550 6142 6825 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987079.1 protein_id gnl|my_center|LOCUS_03550 7831 6917 gene locus_tag LOCUS_03560 7831 6917 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_03560 8601 7831 gene locus_tag LOCUS_03570 8601 7831 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016380.1 protein_id gnl|my_center|LOCUS_03570 9565 8660 gene locus_tag LOCUS_03580 gene pyrF 9565 8660 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_03580 10233 9574 gene locus_tag LOCUS_03590 gene pyrE 10233 9574 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389897.1 protein_id gnl|my_center|LOCUS_03590 11558 10287 gene locus_tag LOCUS_03600 11558 10287 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_03600 12489 11551 gene locus_tag LOCUS_03610 12489 11551 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_03610 13056 12511 gene locus_tag LOCUS_03620 gene pyrR 13056 12511 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_03620 14008 13310 gene locus_tag LOCUS_03630 14008 13310 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427805.1 protein_id gnl|my_center|LOCUS_03630 14230 14054 gene locus_tag LOCUS_03640 14230 14054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 15128 14436 gene locus_tag LOCUS_03650 15128 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 15524 15213 gene locus_tag LOCUS_03660 15524 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15741 17243 gene locus_tag LOCUS_03670 15741 17243 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888874.1 protein_id gnl|my_center|LOCUS_03670 17766 17230 gene locus_tag LOCUS_03680 17766 17230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 18366 19052 gene locus_tag LOCUS_03690 18366 19052 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_03690 19046 19423 gene locus_tag LOCUS_03700 19046 19423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 22342 19517 gene locus_tag LOCUS_03710 gene uvrA 22342 19517 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_03710 <23292 22382 gene locus_tag LOCUS_03720 <23292 22382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391795.1:excinuclease ABC subunit UvrB >Feature sequence014 <1 863 gene locus_tag LOCUS_03730 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986379.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA 850 2070 gene locus_tag LOCUS_03740 850 2070 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460286.1 protein_id gnl|my_center|LOCUS_03740 2072 2602 gene locus_tag LOCUS_03750 2072 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4394 2769 gene locus_tag LOCUS_03760 gene groL 4394 2769 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817317.1 protein_id gnl|my_center|LOCUS_03760 4708 4424 gene locus_tag LOCUS_03770 4708 4424 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_03770 5019 5483 gene locus_tag LOCUS_03780 5019 5483 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942329.1 protein_id gnl|my_center|LOCUS_03780 5480 6007 gene locus_tag LOCUS_03790 5480 6007 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_03790 6533 6264 gene locus_tag LOCUS_03800 6533 6264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6415 7026 gene locus_tag LOCUS_03810 6415 7026 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294342.1 protein_id gnl|my_center|LOCUS_03810 7118 7978 gene locus_tag LOCUS_03820 7118 7978 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_03820 8159 11575 gene locus_tag LOCUS_03830 8159 11575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 11651 11884 gene locus_tag LOCUS_03840 11651 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 12126 12827 gene locus_tag LOCUS_03850 12126 12827 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721621.1 protein_id gnl|my_center|LOCUS_03850 12855 15446 gene locus_tag LOCUS_03860 12855 15446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 15478 15942 gene locus_tag LOCUS_03870 15478 15942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 15932 16291 gene locus_tag LOCUS_03880 15932 16291 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_03880 16439 17140 gene locus_tag LOCUS_03890 gene sigK 16439 17140 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_03890 17291 17782 gene locus_tag LOCUS_03900 17291 17782 CDS product UvrB/UvrC motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870146.1 protein_id gnl|my_center|LOCUS_03900 17775 18794 gene locus_tag LOCUS_03910 17775 18794 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048367.1 protein_id gnl|my_center|LOCUS_03910 18809 21289 gene locus_tag LOCUS_03920 18809 21289 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391709.1 protein_id gnl|my_center|LOCUS_03920 21308 21838 gene locus_tag LOCUS_03930 gene raiA 21308 21838 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence015 3 530 gene locus_tag LOCUS_03940 3 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2028 598 gene locus_tag LOCUS_03950 gene proS 2028 598 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895182.1 protein_id gnl|my_center|LOCUS_03950 3058 2168 gene locus_tag LOCUS_03960 3058 2168 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986891.1 protein_id gnl|my_center|LOCUS_03960 4040 3150 gene locus_tag LOCUS_03970 4040 3150 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948925.1 protein_id gnl|my_center|LOCUS_03970 4283 5800 gene locus_tag LOCUS_03980 4283 5800 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_03980 5819 7801 gene locus_tag LOCUS_03990 gene tkt 5819 7801 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964657.1 protein_id gnl|my_center|LOCUS_03990 7855 8664 gene locus_tag LOCUS_04000 7855 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9276 8797 gene locus_tag LOCUS_04010 9276 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 9333 10154 gene locus_tag LOCUS_04020 9333 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10462 10938 gene locus_tag LOCUS_04030 10462 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 11843 11010 gene locus_tag LOCUS_04040 gene deoC 11843 11010 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_04040 13145 11847 gene locus_tag LOCUS_04050 13145 11847 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_04050 13243 13512 gene locus_tag LOCUS_04060 13243 13512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 13870 13514 gene locus_tag LOCUS_04070 gene rsfS 13870 13514 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412394.1 protein_id gnl|my_center|LOCUS_04070 15000 13867 gene locus_tag LOCUS_04080 15000 13867 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183272.1 protein_id gnl|my_center|LOCUS_04080 15251 15997 gene locus_tag LOCUS_04090 15251 15997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 16665 16063 gene locus_tag LOCUS_04100 16665 16063 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_04100 16958 16668 gene locus_tag LOCUS_04110 gene yhbY 16958 16668 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955235.1 protein_id gnl|my_center|LOCUS_04110 18296 17022 gene locus_tag LOCUS_04120 gene obgE 18296 17022 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_04120 18937 18299 gene locus_tag LOCUS_04130 gene nth 18937 18299 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_04130 19271 19014 gene locus_tag LOCUS_04140 19271 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 19573 20718 gene locus_tag LOCUS_04150 19573 20718 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393701.1 protein_id gnl|my_center|LOCUS_04150 20965 20705 gene locus_tag LOCUS_04160 20965 20705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 21068 21421 gene locus_tag LOCUS_04170 21068 21421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 <22155 21529 gene locus_tag LOCUS_04180 <22155 21529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357628.1:S41 family peptidase >Feature sequence016 423 998 gene locus_tag LOCUS_04190 423 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 2443 1346 gene locus_tag LOCUS_04200 gene ychF 2443 1346 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949032.1 protein_id gnl|my_center|LOCUS_04200 2594 4279 gene locus_tag LOCUS_04210 gene argS 2594 4279 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436885.1 protein_id gnl|my_center|LOCUS_04210 4301 4957 gene locus_tag LOCUS_04220 4301 4957 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_04220 5108 5992 gene locus_tag LOCUS_04230 5108 5992 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_04230 6064 7128 gene locus_tag LOCUS_04240 6064 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 7125 7655 gene locus_tag LOCUS_04250 7125 7655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 7642 8457 gene locus_tag LOCUS_04260 gene hemC 7642 8457 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323398.1 protein_id gnl|my_center|LOCUS_04260 8454 9866 gene locus_tag LOCUS_04270 gene cobA 8454 9866 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392762.1 protein_id gnl|my_center|LOCUS_04270 9863 10846 gene locus_tag LOCUS_04280 gene hemB 9863 10846 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460178.1 protein_id gnl|my_center|LOCUS_04280 10843 12120 gene locus_tag LOCUS_04290 gene hemL 10843 12120 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167257.1 protein_id gnl|my_center|LOCUS_04290 12155 12559 gene locus_tag LOCUS_04300 12155 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04300 12563 13627 gene locus_tag LOCUS_04310 12563 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04310 13938 14705 gene locus_tag LOCUS_04320 13938 14705 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391588.1 protein_id gnl|my_center|LOCUS_04320 14750 15442 gene locus_tag LOCUS_04330 14750 15442 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048153.1 protein_id gnl|my_center|LOCUS_04330 15549 17099 gene locus_tag LOCUS_04340 gene abfA 15549 17099 CDS product alpha-L-arabinofuranosidase AbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398747.1 protein_id gnl|my_center|LOCUS_04340 17250 18023 gene locus_tag LOCUS_04350 gene minD 17250 18023 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_04350 18041 18268 gene locus_tag LOCUS_04360 18041 18268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 18406 20529 gene locus_tag LOCUS_04370 gene nrdD 18406 20529 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263171.1 protein_id gnl|my_center|LOCUS_04370 20648 21178 gene locus_tag LOCUS_04380 gene nrdG 20648 21178 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262378.1 protein_id gnl|my_center|LOCUS_04380 21221 21664 gene locus_tag LOCUS_04390 gene dut 21221 21664 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880090.1 protein_id gnl|my_center|LOCUS_04390 21751 21909 gene locus_tag LOCUS_04400 21751 21909 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence017 6678 6259 gene locus_tag LOCUS_04410 6678 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04410 7277 6645 gene locus_tag LOCUS_04420 7277 6645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04420 8641 7274 gene locus_tag LOCUS_04430 8641 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 9814 8648 gene locus_tag LOCUS_04440 9814 8648 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963502.1 protein_id gnl|my_center|LOCUS_04440 10826 9831 gene locus_tag LOCUS_04450 10826 9831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963501.1 protein_id gnl|my_center|LOCUS_04450 14003 11148 gene locus_tag LOCUS_04460 14003 11148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 15277 14072 gene locus_tag LOCUS_04470 15277 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 15551 15288 gene locus_tag LOCUS_04480 15551 15288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 19320 15574 gene locus_tag LOCUS_04490 19320 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 21024 19693 gene locus_tag LOCUS_04500 gene aspS 21024 19693 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948698.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence018 33 524 gene locus_tag LOCUS_04510 33 524 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860666.1 protein_id gnl|my_center|LOCUS_04510 1328 525 gene locus_tag LOCUS_04520 1328 525 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_04520 1779 1531 gene locus_tag LOCUS_04530 1779 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2666 2286 gene locus_tag LOCUS_04540 2666 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 3309 2659 gene locus_tag LOCUS_04550 3309 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6710 3309 gene locus_tag LOCUS_04560 6710 3309 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263812.1 protein_id gnl|my_center|LOCUS_04560 9191 6729 gene locus_tag LOCUS_04570 9191 6729 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002279797.1 protein_id gnl|my_center|LOCUS_04570 10040 9210 gene locus_tag LOCUS_04580 10040 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 11172 10132 gene locus_tag LOCUS_04590 11172 10132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 12240 11185 gene locus_tag LOCUS_04600 12240 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12832 12419 gene locus_tag LOCUS_04610 12832 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 13266 12847 gene locus_tag LOCUS_04620 13266 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 14096 13686 gene locus_tag LOCUS_04630 14096 13686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 15586 14852 gene locus_tag LOCUS_04640 15586 14852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963591.1 protein_id gnl|my_center|LOCUS_04640 15979 15611 gene locus_tag LOCUS_04650 15979 15611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 17490 15955 gene locus_tag LOCUS_04660 17490 15955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 18248 17490 gene locus_tag LOCUS_04670 18248 17490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 >Feature sequence019 659 1669 gene locus_tag LOCUS_04680 gene cytR 659 1669 CDS product DNA-binding transcriptional regulator CytR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224452.1 protein_id gnl|my_center|LOCUS_04680 1710 2681 gene locus_tag LOCUS_04690 1710 2681 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256388.1 protein_id gnl|my_center|LOCUS_04690 2684 3166 gene locus_tag LOCUS_04700 gene rpiB 2684 3166 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_04700 3171 4160 gene locus_tag LOCUS_04710 3171 4160 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975162.1 protein_id gnl|my_center|LOCUS_04710 4162 5457 gene locus_tag LOCUS_04720 4162 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 5510 6403 gene locus_tag LOCUS_04730 5510 6403 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722709.1 protein_id gnl|my_center|LOCUS_04730 7317 8414 gene locus_tag LOCUS_04740 7317 8414 CDS product muconate/chloromuconate family cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206897.1 protein_id gnl|my_center|LOCUS_04740 9397 10701 gene locus_tag LOCUS_04750 9397 10701 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894432.1 protein_id gnl|my_center|LOCUS_04750 10795 11700 gene locus_tag LOCUS_04760 10795 11700 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237985.1 protein_id gnl|my_center|LOCUS_04760 11917 11747 gene locus_tag LOCUS_04770 11917 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 12358 12191 gene locus_tag LOCUS_04780 12358 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 12557 13510 gene locus_tag LOCUS_04790 12557 13510 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048116.1 protein_id gnl|my_center|LOCUS_04790 13527 14876 gene locus_tag LOCUS_04800 gene ibeA 13527 14876 CDS product putative intracellular survival FAD-dependent oxidoreductase IbeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397942.1 protein_id gnl|my_center|LOCUS_04800 14894 15796 gene locus_tag LOCUS_04810 14894 15796 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015276.1 protein_id gnl|my_center|LOCUS_04810 15811 16818 gene locus_tag LOCUS_04820 15811 16818 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972764.1 protein_id gnl|my_center|LOCUS_04820 16888 17589 gene locus_tag LOCUS_04830 16888 17589 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063699495.1 protein_id gnl|my_center|LOCUS_04830 17601 18287 gene locus_tag LOCUS_04840 17601 18287 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830337.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence020 2905 2111 gene locus_tag LOCUS_04850 2905 2111 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_04850 4012 3101 gene locus_tag LOCUS_04860 4012 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5305 4016 gene locus_tag LOCUS_04870 gene dinB 5305 4016 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392743.1 protein_id gnl|my_center|LOCUS_04870 6504 5311 gene locus_tag LOCUS_04880 6504 5311 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438167.1 protein_id gnl|my_center|LOCUS_04880 7142 6510 gene locus_tag LOCUS_04890 7142 6510 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002989211.1 protein_id gnl|my_center|LOCUS_04890 9079 7139 gene locus_tag LOCUS_04900 9079 7139 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_04900 10996 9293 gene locus_tag LOCUS_04910 10996 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 11293 12366 gene locus_tag LOCUS_04920 gene serC 11293 12366 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_04920 12406 13563 gene locus_tag LOCUS_04930 12406 13563 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815835.1 protein_id gnl|my_center|LOCUS_04930 14658 13666 gene locus_tag LOCUS_04940 14658 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 14965 14816 gene locus_tag LOCUS_04950 14965 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 15798 15028 gene locus_tag LOCUS_04960 15798 15028 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941055.1 protein_id gnl|my_center|LOCUS_04960 16126 17409 gene locus_tag LOCUS_04970 16126 17409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 <18266 17488 gene locus_tag LOCUS_04980 <18266 17488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108622.1:glycoside hydrolase family 32 protein >Feature sequence021 1284 1787 gene locus_tag LOCUS_04990 gene nuoE 1284 1787 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_04990 1792 2343 gene locus_tag LOCUS_05000 1792 2343 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583282.1 protein_id gnl|my_center|LOCUS_05000 2340 2705 gene locus_tag LOCUS_05010 2340 2705 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_05010 2722 4512 gene locus_tag LOCUS_05020 gene nuoF 2722 4512 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_05020 4531 6264 gene locus_tag LOCUS_05030 4531 6264 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_05030 8239 6410 gene locus_tag LOCUS_05040 8239 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 8851 8258 gene locus_tag LOCUS_05050 8851 8258 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814370.1 protein_id gnl|my_center|LOCUS_05050 9218 10318 gene locus_tag LOCUS_05060 9218 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05060 10415 11011 gene locus_tag LOCUS_05070 10415 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05070 11008 12834 gene locus_tag LOCUS_05080 11008 12834 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461397.1 protein_id gnl|my_center|LOCUS_05080 13053 13775 gene locus_tag LOCUS_05090 13053 13775 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475579.1 protein_id gnl|my_center|LOCUS_05090 13815 14429 gene locus_tag LOCUS_05100 13815 14429 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_05100 15161 14658 gene locus_tag LOCUS_05110 15161 14658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 15340 15567 gene locus_tag LOCUS_05120 15340 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 15564 17582 gene locus_tag LOCUS_05130 gene feoB 15564 17582 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903695.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence022 366 1256 gene locus_tag LOCUS_05140 366 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2558 1572 gene locus_tag LOCUS_05150 2558 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2667 3293 gene locus_tag LOCUS_05160 2667 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3363 3551 gene locus_tag LOCUS_05170 3363 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3695 4537 gene locus_tag LOCUS_05180 3695 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 4527 5921 gene locus_tag LOCUS_05190 4527 5921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272444.1 protein_id gnl|my_center|LOCUS_05190 6224 9559 gene locus_tag LOCUS_05200 6224 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 9737 10174 gene locus_tag LOCUS_05210 gene ruvX 9737 10174 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964987.1 protein_id gnl|my_center|LOCUS_05210 10177 10581 gene locus_tag LOCUS_05220 10177 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 10847 11629 gene locus_tag LOCUS_05230 gene rpsB 10847 11629 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111483.1 protein_id gnl|my_center|LOCUS_05230 11679 12338 gene locus_tag LOCUS_05240 gene tsf 11679 12338 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_05240 12425 13147 gene locus_tag LOCUS_05250 gene pyrH 12425 13147 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_05250 13163 13735 gene locus_tag LOCUS_05260 gene frr 13163 13735 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000159519.1 protein_id gnl|my_center|LOCUS_05260 13748 14443 gene locus_tag LOCUS_05270 13748 14443 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_05270 14445 15350 gene locus_tag LOCUS_05280 14445 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 15443 16576 gene locus_tag LOCUS_05290 15443 16576 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392555.1 protein_id gnl|my_center|LOCUS_05290 16636 17760 gene locus_tag LOCUS_05300 gene rseP 16636 17760 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312540.1 protein_id gnl|my_center|LOCUS_05300 >Feature sequence023 1089 2042 gene locus_tag LOCUS_05310 gene argF 1089 2042 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393769.1 protein_id gnl|my_center|LOCUS_05310 4298 2382 gene locus_tag LOCUS_05320 4298 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5527 4394 gene locus_tag LOCUS_05330 5527 4394 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404923.1 protein_id gnl|my_center|LOCUS_05330 8101 6482 gene locus_tag LOCUS_05340 8101 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 8787 8128 gene locus_tag LOCUS_05350 8787 8128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 9307 8876 gene locus_tag LOCUS_05360 gene rimI 9307 8876 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001092461.1 protein_id gnl|my_center|LOCUS_05360 9934 9326 gene locus_tag LOCUS_05370 9934 9326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 10325 9927 gene locus_tag LOCUS_05380 gene tsaE 10325 9927 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_05380 11168 10398 gene locus_tag LOCUS_05390 11168 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 12678 11533 gene locus_tag LOCUS_05400 gene alr 12678 11533 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_05400 13367 12897 gene locus_tag LOCUS_05410 13367 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 14117 13368 gene locus_tag LOCUS_05420 14117 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 15321 14110 gene locus_tag LOCUS_05430 15321 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 17774 15309 gene locus_tag LOCUS_05440 17774 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence024 1665 208 gene locus_tag LOCUS_05450 gene araA 1665 208 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964655.1 protein_id gnl|my_center|LOCUS_05450 2427 1726 gene locus_tag LOCUS_05460 2427 1726 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129982.1 protein_id gnl|my_center|LOCUS_05460 4102 2507 gene locus_tag LOCUS_05470 4102 2507 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964653.1 protein_id gnl|my_center|LOCUS_05470 4519 4400 gene locus_tag LOCUS_05480 4519 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5121 4531 gene locus_tag LOCUS_05490 5121 4531 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426696.1 protein_id gnl|my_center|LOCUS_05490 5892 5302 gene locus_tag LOCUS_05500 5892 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7032 5932 gene locus_tag LOCUS_05510 7032 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 8806 7154 gene locus_tag LOCUS_05520 8806 7154 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615608.1 protein_id gnl|my_center|LOCUS_05520 10497 8848 gene locus_tag LOCUS_05530 10497 8848 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_05530 10970 10587 gene locus_tag LOCUS_05540 10970 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 10997 11845 gene locus_tag LOCUS_05550 10997 11845 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963925.1 protein_id gnl|my_center|LOCUS_05550 11972 13351 gene locus_tag LOCUS_05560 11972 13351 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_05560 14969 13569 gene locus_tag LOCUS_05570 gene gltA 14969 13569 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048248.1 protein_id gnl|my_center|LOCUS_05570 15892 15038 gene locus_tag LOCUS_05580 15892 15038 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_05580 17005 16025 gene locus_tag LOCUS_05590 17005 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence025 3621 1558 gene locus_tag LOCUS_05600 3621 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 5732 3696 gene locus_tag LOCUS_05610 5732 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 8687 5736 gene locus_tag LOCUS_05620 8687 5736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 9639 8707 gene locus_tag LOCUS_05630 9639 8707 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198405945.1 protein_id gnl|my_center|LOCUS_05630 10669 9641 gene locus_tag LOCUS_05640 10669 9641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 12436 10688 gene locus_tag LOCUS_05650 12436 10688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 15874 12452 gene locus_tag LOCUS_05660 15874 12452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 16793 15885 gene locus_tag LOCUS_05670 16793 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence026 4240 221 gene locus_tag LOCUS_05680 4240 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4680 4928 gene locus_tag LOCUS_05690 4680 4928 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_05690 4982 6115 gene locus_tag LOCUS_05700 4982 6115 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_05700 6231 7613 gene locus_tag LOCUS_05710 gene radA 6231 7613 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399687.1 protein_id gnl|my_center|LOCUS_05710 9115 7895 gene locus_tag LOCUS_05720 gene clpX 9115 7895 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357457.1 protein_id gnl|my_center|LOCUS_05720 9839 9240 gene locus_tag LOCUS_05730 gene clpP 9839 9240 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167636.1 protein_id gnl|my_center|LOCUS_05730 11381 9870 gene locus_tag LOCUS_05740 gene tig 11381 9870 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417090.1 protein_id gnl|my_center|LOCUS_05740 11624 13288 gene locus_tag LOCUS_05750 11624 13288 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863257.1 protein_id gnl|my_center|LOCUS_05750 14125 13430 gene locus_tag LOCUS_05760 14125 13430 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813444.1 protein_id gnl|my_center|LOCUS_05760 15019 14198 gene locus_tag LOCUS_05770 15019 14198 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_05770 16181 15045 gene locus_tag LOCUS_05780 16181 15045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence027 1106 3283 gene locus_tag LOCUS_05790 1106 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 3255 4268 gene locus_tag LOCUS_05800 gene holA 3255 4268 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_05800 4344 5180 gene locus_tag LOCUS_05810 gene cdaA 4344 5180 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420697.1 protein_id gnl|my_center|LOCUS_05810 5307 6506 gene locus_tag LOCUS_05820 5307 6506 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_05820 6503 7828 gene locus_tag LOCUS_05830 6503 7828 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963601.1 protein_id gnl|my_center|LOCUS_05830 7859 10285 gene locus_tag LOCUS_05840 7859 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 10771 12606 gene locus_tag LOCUS_05850 10771 12606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721734.1 protein_id gnl|my_center|LOCUS_05850 12603 14387 gene locus_tag LOCUS_05860 12603 14387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732216.1 protein_id gnl|my_center|LOCUS_05860 14410 14646 gene locus_tag LOCUS_05870 14410 14646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 14659 15489 gene locus_tag LOCUS_05880 14659 15489 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence028 1632 658 gene locus_tag LOCUS_05890 1632 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3058 1811 gene locus_tag LOCUS_05900 3058 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 3178 3834 gene locus_tag LOCUS_05910 3178 3834 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416187.1 protein_id gnl|my_center|LOCUS_05910 3827 4267 gene locus_tag LOCUS_05920 3827 4267 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_05920 4272 4937 gene locus_tag LOCUS_05930 4272 4937 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416528.1 protein_id gnl|my_center|LOCUS_05930 5043 6254 gene locus_tag LOCUS_05940 5043 6254 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942463.1 protein_id gnl|my_center|LOCUS_05940 6364 6438 gene locus_tag LOCUS_t00040 6364 6438 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9092 6843 gene locus_tag LOCUS_05950 9092 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 12642 9223 gene locus_tag LOCUS_05960 gene mfd 12642 9223 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966492.1 protein_id gnl|my_center|LOCUS_05960 13231 12665 gene locus_tag LOCUS_05970 gene pth 13231 12665 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254063.1 protein_id gnl|my_center|LOCUS_05970 14452 13499 gene locus_tag LOCUS_05980 14452 13499 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359343.1 protein_id gnl|my_center|LOCUS_05980 15218 14751 gene locus_tag LOCUS_05990 gene tadA 15218 14751 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287154.1 protein_id gnl|my_center|LOCUS_05990 16021 15203 gene locus_tag LOCUS_06000 16021 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence029 152 2461 gene locus_tag LOCUS_06010 gene pcrA 152 2461 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836754.1 protein_id gnl|my_center|LOCUS_06010 2479 4440 gene locus_tag LOCUS_06020 gene ligA 2479 4440 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965961.1 protein_id gnl|my_center|LOCUS_06020 4530 5405 gene locus_tag LOCUS_06030 4530 5405 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_06030 5472 5693 gene locus_tag LOCUS_06040 5472 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5776 6384 gene locus_tag LOCUS_06050 5776 6384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06050 6400 7944 gene locus_tag LOCUS_06060 6400 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06060 7978 8436 gene locus_tag LOCUS_06070 gene def 7978 8436 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_06070 8444 9373 gene locus_tag LOCUS_06080 gene fmt 8444 9373 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768186.1 protein_id gnl|my_center|LOCUS_06080 9370 10617 gene locus_tag LOCUS_06090 gene rsmB 9370 10617 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733095.1 protein_id gnl|my_center|LOCUS_06090 10614 11666 gene locus_tag LOCUS_06100 gene rlmN 10614 11666 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_06100 11794 12453 gene locus_tag LOCUS_06110 gene rpe 11794 12453 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_06110 12470 13084 gene locus_tag LOCUS_06120 12470 13084 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_06120 13415 13957 gene locus_tag LOCUS_06130 13415 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 13957 14580 gene locus_tag LOCUS_06140 13957 14580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 14709 15215 gene locus_tag LOCUS_06150 14709 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence030 1322 675 gene locus_tag LOCUS_06160 1322 675 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963563.1 protein_id gnl|my_center|LOCUS_06160 2592 1294 gene locus_tag LOCUS_06170 gene yxjM 2592 1294 CDS product two-component system sensor histidine kinase YxjM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244524.1 protein_id gnl|my_center|LOCUS_06170 4028 2589 gene locus_tag LOCUS_06180 gene gltX 4028 2589 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_06180 4761 4015 gene locus_tag LOCUS_06190 gene radC 4761 4015 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385427.1 protein_id gnl|my_center|LOCUS_06190 4894 6159 gene locus_tag LOCUS_06200 gene pepV 4894 6159 CDS product dipeptidase PepV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048281.1 protein_id gnl|my_center|LOCUS_06200 7040 6210 gene locus_tag LOCUS_06210 7040 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 7747 7163 gene locus_tag LOCUS_06220 gene yfbR 7747 7163 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813857.1 protein_id gnl|my_center|LOCUS_06220 8094 9386 gene locus_tag LOCUS_06230 8094 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 11616 9493 gene locus_tag LOCUS_06240 11616 9493 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584017.1 protein_id gnl|my_center|LOCUS_06240 12069 11773 gene locus_tag LOCUS_06250 12069 11773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 12261 12070 gene locus_tag LOCUS_06260 12261 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 12941 13315 gene locus_tag LOCUS_06270 12941 13315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 13337 14056 gene locus_tag LOCUS_06280 13337 14056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 14382 14306 gene locus_tag LOCUS_t00050 14382 14306 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14847 15047 gene locus_tag LOCUS_06290 14847 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence031 1969 1202 gene locus_tag LOCUS_06300 1969 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2929 1982 gene locus_tag LOCUS_06310 gene rsmH 2929 1982 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_06310 3369 2926 gene locus_tag LOCUS_06320 3369 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4234 3503 gene locus_tag LOCUS_06330 gene murI 4234 3503 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662655.1 protein_id gnl|my_center|LOCUS_06330 4427 4720 gene locus_tag LOCUS_06340 gene rpsT 4427 4720 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964586.1 protein_id gnl|my_center|LOCUS_06340 5327 5860 gene locus_tag LOCUS_06350 5327 5860 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_06350 5908 7452 gene locus_tag LOCUS_06360 gene potA 5908 7452 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769055.1 protein_id gnl|my_center|LOCUS_06360 7449 8264 gene locus_tag LOCUS_06370 7449 8264 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778456.1 protein_id gnl|my_center|LOCUS_06370 8258 9049 gene locus_tag LOCUS_06380 8258 9049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762999.1 protein_id gnl|my_center|LOCUS_06380 9046 10551 gene locus_tag LOCUS_06390 9046 10551 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107690.1 protein_id gnl|my_center|LOCUS_06390 10579 11439 gene locus_tag LOCUS_06400 10579 11439 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_06400 12212 11541 gene locus_tag LOCUS_06410 gene pflA 12212 11541 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048195.1 protein_id gnl|my_center|LOCUS_06410 14521 12302 gene locus_tag LOCUS_06420 gene pflB 14521 12302 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437454.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence032 457 384 gene locus_tag LOCUS_t00060 457 384 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 535 461 gene locus_tag LOCUS_t00070 535 461 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1554 1405 gene locus_tag LOCUS_06430 1554 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1525 3156 gene locus_tag LOCUS_06440 1525 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 3489 3265 gene locus_tag LOCUS_06450 3489 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 3554 4138 gene locus_tag LOCUS_06460 3554 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5510 4191 gene locus_tag LOCUS_06470 5510 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 5684 6940 gene locus_tag LOCUS_06480 5684 6940 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067997.1 protein_id gnl|my_center|LOCUS_06480 7470 8591 gene locus_tag LOCUS_06490 7470 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 8606 9883 gene locus_tag LOCUS_06500 8606 9883 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225468.1 protein_id gnl|my_center|LOCUS_06500 10583 10852 gene locus_tag LOCUS_06510 10583 10852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 10997 11701 gene locus_tag LOCUS_06520 10997 11701 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819520.1 protein_id gnl|my_center|LOCUS_06520 11732 12688 gene locus_tag LOCUS_06530 11732 12688 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906252.1 protein_id gnl|my_center|LOCUS_06530 13037 12741 gene locus_tag LOCUS_06540 13037 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 13512 13132 gene locus_tag LOCUS_06550 13512 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 13917 14816 gene locus_tag LOCUS_06560 13917 14816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence033 580 179 gene locus_tag LOCUS_06570 gene rpsK 580 179 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421122.1 protein_id gnl|my_center|LOCUS_06570 967 599 gene locus_tag LOCUS_06580 gene rpsM 967 599 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393911.1 protein_id gnl|my_center|LOCUS_06580 1546 1325 gene locus_tag LOCUS_06590 gene infA 1546 1325 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357316.1 protein_id gnl|my_center|LOCUS_06590 1844 1563 gene locus_tag LOCUS_06600 1844 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2598 1855 gene locus_tag LOCUS_06610 gene map 2598 1855 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421130.1 protein_id gnl|my_center|LOCUS_06610 3232 2612 gene locus_tag LOCUS_06620 3232 2612 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860634.1 protein_id gnl|my_center|LOCUS_06620 4632 3307 gene locus_tag LOCUS_06630 gene secY 4632 3307 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_06630 5163 4717 gene locus_tag LOCUS_06640 gene rplO 5163 4717 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_06640 5356 5177 gene locus_tag LOCUS_06650 gene rpmD 5356 5177 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096577.1 protein_id gnl|my_center|LOCUS_06650 5891 5370 gene locus_tag LOCUS_06660 gene rpsE 5891 5370 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_06660 6274 5906 gene locus_tag LOCUS_06670 gene rplR 6274 5906 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225816.1 protein_id gnl|my_center|LOCUS_06670 6827 6288 gene locus_tag LOCUS_06680 gene rplF 6827 6288 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_06680 7233 6841 gene locus_tag LOCUS_06690 gene rpsH 7233 6841 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829768.1 protein_id gnl|my_center|LOCUS_06690 7430 7245 gene locus_tag LOCUS_06700 7430 7245 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357636.1 protein_id gnl|my_center|LOCUS_06700 8002 7445 gene locus_tag LOCUS_06710 gene rplE 8002 7445 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435673.1 protein_id gnl|my_center|LOCUS_06710 8453 8019 gene locus_tag LOCUS_06720 8453 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 8834 8466 gene locus_tag LOCUS_06730 gene rplN 8834 8466 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966402.1 protein_id gnl|my_center|LOCUS_06730 9111 8857 gene locus_tag LOCUS_06740 gene rpsQ 9111 8857 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393928.1 protein_id gnl|my_center|LOCUS_06740 9327 9127 gene locus_tag LOCUS_06750 gene rpmC 9327 9127 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_06750 9800 9327 gene locus_tag LOCUS_06760 gene rplP 9800 9327 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421160.1 protein_id gnl|my_center|LOCUS_06760 10459 9800 gene locus_tag LOCUS_06770 gene rpsC 10459 9800 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_06770 10865 10476 gene locus_tag LOCUS_06780 gene rplV 10865 10476 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854297.1 protein_id gnl|my_center|LOCUS_06780 11162 10881 gene locus_tag LOCUS_06790 gene rpsS 11162 10881 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810155.1 protein_id gnl|my_center|LOCUS_06790 12004 11177 gene locus_tag LOCUS_06800 gene rplB 12004 11177 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966409.1 protein_id gnl|my_center|LOCUS_06800 12324 12034 gene locus_tag LOCUS_06810 gene rplW 12324 12034 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435681.1 protein_id gnl|my_center|LOCUS_06810 12950 12324 gene locus_tag LOCUS_06820 gene rplD 12950 12324 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966411.1 protein_id gnl|my_center|LOCUS_06820 13600 12965 gene locus_tag LOCUS_06830 gene rplC 13600 12965 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048354.1 protein_id gnl|my_center|LOCUS_06830 13981 13682 gene locus_tag LOCUS_06840 gene rpsJ 13981 13682 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966413.1 protein_id gnl|my_center|LOCUS_06840 14842 14468 gene locus_tag LOCUS_06850 gene rplL 14842 14468 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence034 1182 595 gene locus_tag LOCUS_06860 gene sigH 1182 595 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357363.1 protein_id gnl|my_center|LOCUS_06860 1862 1179 gene locus_tag LOCUS_06870 gene rlmB 1862 1179 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966431.1 protein_id gnl|my_center|LOCUS_06870 2280 1879 gene locus_tag LOCUS_06880 2280 1879 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567914.1 protein_id gnl|my_center|LOCUS_06880 3034 2354 gene locus_tag LOCUS_06890 gene cwlD 3034 2354 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_06890 4064 3237 gene locus_tag LOCUS_06900 4064 3237 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362794.1 protein_id gnl|my_center|LOCUS_06900 4888 4064 gene locus_tag LOCUS_06910 4888 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 6342 5149 gene locus_tag LOCUS_06920 6342 5149 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966117.1 protein_id gnl|my_center|LOCUS_06920 6532 8268 gene locus_tag LOCUS_06930 gene mgtE 6532 8268 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898141.1 protein_id gnl|my_center|LOCUS_06930 9564 8338 gene locus_tag LOCUS_06940 9564 8338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 10539 9793 gene locus_tag LOCUS_06950 10539 9793 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966612.1 protein_id gnl|my_center|LOCUS_06950 11324 10761 gene locus_tag LOCUS_06960 11324 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 12138 11533 gene locus_tag LOCUS_06970 12138 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 12980 12135 gene locus_tag LOCUS_06980 12980 12135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_06980 13356 12970 gene locus_tag LOCUS_06990 13356 12970 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814465.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence035 2039 270 gene locus_tag LOCUS_07000 gene rlmD 2039 270 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963844.1 protein_id gnl|my_center|LOCUS_07000 2725 2036 gene locus_tag LOCUS_07010 2725 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 3365 2733 gene locus_tag LOCUS_07020 3365 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4263 3388 gene locus_tag LOCUS_07030 4263 3388 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435907.1 protein_id gnl|my_center|LOCUS_07030 5270 4266 gene locus_tag LOCUS_07040 gene trpS 5270 4266 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454934.1 protein_id gnl|my_center|LOCUS_07040 6447 5512 gene locus_tag LOCUS_07050 gene rbsK 6447 5512 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071105.1 protein_id gnl|my_center|LOCUS_07050 7582 6467 gene locus_tag LOCUS_07060 7582 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 8877 7579 gene locus_tag LOCUS_07070 8877 7579 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_07070 9834 8923 gene locus_tag LOCUS_07080 9834 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 10693 9827 gene locus_tag LOCUS_07090 10693 9827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 13266 10690 gene locus_tag LOCUS_07100 13266 10690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 <14320 13263 gene locus_tag LOCUS_07110 <14320 13263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389449.1:glycoside hydrolase N-terminal domain-containing protein >Feature sequence036 <1 568 gene locus_tag LOCUS_07120 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392702.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme 752 1219 gene locus_tag LOCUS_07130 gene greA 752 1219 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048372.1 protein_id gnl|my_center|LOCUS_07130 1273 2262 gene locus_tag LOCUS_07140 1273 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 2281 3648 gene locus_tag LOCUS_07150 2281 3648 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_07150 3645 4274 gene locus_tag LOCUS_07160 gene tmk 3645 4274 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254134.1 protein_id gnl|my_center|LOCUS_07160 4287 5219 gene locus_tag LOCUS_07170 gene holB 4287 5219 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583155.1 protein_id gnl|my_center|LOCUS_07170 5216 6082 gene locus_tag LOCUS_07180 5216 6082 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_07180 6226 6396 gene locus_tag LOCUS_07190 6226 6396 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003363046.1 protein_id gnl|my_center|LOCUS_07190 6493 6568 gene locus_tag LOCUS_t00080 6493 6568 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7201 6644 gene locus_tag LOCUS_07200 7201 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 7936 8925 gene locus_tag LOCUS_07210 gene ansA 7936 8925 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399032.1 protein_id gnl|my_center|LOCUS_07210 10955 9018 gene locus_tag LOCUS_07220 10955 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 11197 10979 gene locus_tag LOCUS_07230 11197 10979 CDS product heavy metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903516.1 protein_id gnl|my_center|LOCUS_07230 11607 11287 gene locus_tag LOCUS_07240 11607 11287 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_07240 13393 11834 gene locus_tag LOCUS_07250 gene cimA 13393 11834 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_07250 <14294 13493 gene locus_tag LOCUS_07260 <14294 13493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584102.1:dihydroxy-acid dehydratase >Feature sequence037 1357 2160 gene locus_tag LOCUS_07270 1357 2160 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721549.1 protein_id gnl|my_center|LOCUS_07270 3815 2235 gene locus_tag LOCUS_07280 3815 2235 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251419.1 protein_id gnl|my_center|LOCUS_07280 4703 3870 gene locus_tag LOCUS_07290 4703 3870 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390165.1 protein_id gnl|my_center|LOCUS_07290 5654 4824 gene locus_tag LOCUS_07300 5654 4824 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_07300 6381 5731 gene locus_tag LOCUS_07310 6381 5731 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966920.1 protein_id gnl|my_center|LOCUS_07310 7718 6420 gene locus_tag LOCUS_07320 7718 6420 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_07320 9756 7732 gene locus_tag LOCUS_07330 9756 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 10372 9770 gene locus_tag LOCUS_07340 10372 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 12365 10386 gene locus_tag LOCUS_07350 12365 10386 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582633.1 protein_id gnl|my_center|LOCUS_07350 13409 12576 gene locus_tag LOCUS_07360 13409 12576 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776771.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence038 1492 668 gene locus_tag LOCUS_07370 gene yidA 1492 668 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824472.1 protein_id gnl|my_center|LOCUS_07370 3297 1492 gene locus_tag LOCUS_07380 gene uvrC 3297 1492 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_07380 3727 3389 gene locus_tag LOCUS_07390 3727 3389 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459353.1 protein_id gnl|my_center|LOCUS_07390 6520 4013 gene locus_tag LOCUS_07400 6520 4013 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_07400 6710 7504 gene locus_tag LOCUS_07410 6710 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 7989 7804 gene locus_tag LOCUS_07420 gene rpmF 7989 7804 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965052.1 protein_id gnl|my_center|LOCUS_07420 9431 8055 gene locus_tag LOCUS_07430 9431 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 9954 9397 gene locus_tag LOCUS_07440 9954 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 11150 9954 gene locus_tag LOCUS_07450 11150 9954 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 protein_id gnl|my_center|LOCUS_07450 12254 11199 gene locus_tag LOCUS_07460 gene pta 12254 11199 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047869.1 protein_id gnl|my_center|LOCUS_07460 12396 13583 gene locus_tag LOCUS_07470 12396 13583 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388463.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence039 4306 4749 gene locus_tag LOCUS_07480 4306 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 5864 4845 gene locus_tag LOCUS_07490 5864 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6099 6626 gene locus_tag LOCUS_07500 6099 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 6623 7909 gene locus_tag LOCUS_07510 6623 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 10393 7994 gene locus_tag LOCUS_07520 10393 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 11091 10609 gene locus_tag LOCUS_07530 11091 10609 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896783.1 protein_id gnl|my_center|LOCUS_07530 11928 11176 gene locus_tag LOCUS_07540 11928 11176 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681345.1 protein_id gnl|my_center|LOCUS_07540 12753 11941 gene locus_tag LOCUS_07550 gene rsmI 12753 11941 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_07550 13543 12803 gene locus_tag LOCUS_07560 13543 12803 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390783.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence040 1 1188 gene locus_tag LOCUS_07570 1 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1214 2557 gene locus_tag LOCUS_07580 1214 2557 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198760.1 protein_id gnl|my_center|LOCUS_07580 3849 2839 gene locus_tag LOCUS_07590 3849 2839 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_07590 5027 4002 gene locus_tag LOCUS_07600 5027 4002 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_07600 5337 6359 gene locus_tag LOCUS_07610 5337 6359 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_07610 6712 7290 gene locus_tag LOCUS_07620 6712 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07620 7324 8997 gene locus_tag LOCUS_07630 7324 8997 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_07630 9016 10836 gene locus_tag LOCUS_07640 9016 10836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 10919 12280 gene locus_tag LOCUS_07650 10919 12280 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063445845.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence041 2282 1587 gene locus_tag LOCUS_07660 2282 1587 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861305.1 protein_id gnl|my_center|LOCUS_07660 2847 2308 gene locus_tag LOCUS_07670 2847 2308 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_07670 4157 2919 gene locus_tag LOCUS_07680 4157 2919 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986786.1 protein_id gnl|my_center|LOCUS_07680 4954 4250 gene locus_tag LOCUS_07690 4954 4250 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183748.1 protein_id gnl|my_center|LOCUS_07690 5797 5072 gene locus_tag LOCUS_07700 5797 5072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07700 7447 5861 gene locus_tag LOCUS_07710 7447 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07710 9683 7473 gene locus_tag LOCUS_07720 9683 7473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 11360 9849 gene locus_tag LOCUS_07730 11360 9849 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_07730 12897 11398 gene locus_tag LOCUS_07740 gene malQ 12897 11398 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence042 1887 2414 gene locus_tag LOCUS_07750 1887 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3088 2387 gene locus_tag LOCUS_07760 3088 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3199 4641 gene locus_tag LOCUS_07770 3199 4641 CDS product terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975977.1 protein_id gnl|my_center|LOCUS_07770 4634 4903 gene locus_tag LOCUS_07780 4634 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4893 6815 gene locus_tag LOCUS_07790 4893 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 6819 7286 gene locus_tag LOCUS_07800 6819 7286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 7338 8501 gene locus_tag LOCUS_07810 7338 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 8602 9150 gene locus_tag LOCUS_07820 8602 9150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 9147 10454 gene locus_tag LOCUS_07830 9147 10454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 10466 10939 gene locus_tag LOCUS_07840 10466 10939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 11156 11974 gene locus_tag LOCUS_07850 11156 11974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 11990 12964 gene locus_tag LOCUS_07860 11990 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 >Feature sequence043 3 1103 gene locus_tag LOCUS_07870 3 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 3830 1236 gene locus_tag LOCUS_07880 gene clpB 3830 1236 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365401.1 protein_id gnl|my_center|LOCUS_07880 4501 3983 gene locus_tag LOCUS_07890 4501 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4758 5174 gene locus_tag LOCUS_07900 4758 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 5195 7159 gene locus_tag LOCUS_07910 5195 7159 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116444.1 protein_id gnl|my_center|LOCUS_07910 9149 7374 gene locus_tag LOCUS_07920 9149 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 9283 10449 gene locus_tag LOCUS_07930 9283 10449 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437948.1 protein_id gnl|my_center|LOCUS_07930 10439 13108 gene locus_tag LOCUS_07940 10439 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence044 63 1931 gene locus_tag LOCUS_07950 gene mnmG 63 1931 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_07950 4453 2147 gene locus_tag LOCUS_07960 4453 2147 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920407.1 protein_id gnl|my_center|LOCUS_07960 4734 5261 gene locus_tag LOCUS_07970 4734 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 6802 5402 gene locus_tag LOCUS_07980 6802 5402 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666765.1 protein_id gnl|my_center|LOCUS_07980 7085 9382 gene locus_tag LOCUS_07990 7085 9382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9569 10072 gene locus_tag LOCUS_08000 9569 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 10143 11591 gene locus_tag LOCUS_08010 10143 11591 CDS product spore germination protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460073.1 protein_id gnl|my_center|LOCUS_08010 11595 12662 gene locus_tag LOCUS_08020 11595 12662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence045 1583 1035 gene locus_tag LOCUS_08030 gene grpE 1583 1035 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_08030 2637 1564 gene locus_tag LOCUS_08040 gene hrcA 2637 1564 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454754.1 protein_id gnl|my_center|LOCUS_08040 4264 2942 gene locus_tag LOCUS_08050 4264 2942 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003562821.1 protein_id gnl|my_center|LOCUS_08050 5212 4361 gene locus_tag LOCUS_08060 5212 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 5873 5268 gene locus_tag LOCUS_08070 gene yihA 5873 5268 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796925.1 protein_id gnl|my_center|LOCUS_08070 8191 5873 gene locus_tag LOCUS_08080 gene lon 8191 5873 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097289.1 protein_id gnl|my_center|LOCUS_08080 8515 8363 gene locus_tag LOCUS_08090 8515 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 10302 8503 gene locus_tag LOCUS_08100 10302 8503 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392453.1 protein_id gnl|my_center|LOCUS_08100 12424 10283 gene locus_tag LOCUS_08110 12424 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 12551 12414 gene locus_tag LOCUS_08120 12551 12414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence046 860 1201 gene locus_tag LOCUS_08130 860 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1235 2515 gene locus_tag LOCUS_08140 1235 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 2512 4437 gene locus_tag LOCUS_08150 2512 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4441 5745 gene locus_tag LOCUS_08160 4441 5745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 5742 8285 gene locus_tag LOCUS_08170 5742 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 8298 11951 gene locus_tag LOCUS_08180 8298 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 12215 11991 gene locus_tag LOCUS_08190 12215 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence047 23 745 gene locus_tag LOCUS_08200 23 745 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_08200 2156 1119 gene locus_tag LOCUS_08210 2156 1119 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037354.1 protein_id gnl|my_center|LOCUS_08210 2424 3362 gene locus_tag LOCUS_08220 2424 3362 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_08220 3377 4318 gene locus_tag LOCUS_08230 3377 4318 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_08230 4339 6018 gene locus_tag LOCUS_08240 4339 6018 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775818.1 protein_id gnl|my_center|LOCUS_08240 6044 7819 gene locus_tag LOCUS_08250 6044 7819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7893 9437 gene locus_tag LOCUS_08260 7893 9437 CDS product family 43 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296810.1 protein_id gnl|my_center|LOCUS_08260 9451 10455 gene locus_tag LOCUS_08270 9451 10455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 10461 11375 gene locus_tag LOCUS_08280 10461 11375 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066267.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence048 821 1096 gene locus_tag LOCUS_08290 821 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 2852 1386 gene locus_tag LOCUS_08300 2852 1386 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584076.1 protein_id gnl|my_center|LOCUS_08300 4987 3080 gene locus_tag LOCUS_08310 4987 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4947 5168 gene locus_tag LOCUS_08320 4947 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 6911 5169 gene locus_tag LOCUS_08330 6911 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 7945 6953 gene locus_tag LOCUS_08340 7945 6953 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776898.1 protein_id gnl|my_center|LOCUS_08340 8978 7947 gene locus_tag LOCUS_08350 8978 7947 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776897.1 protein_id gnl|my_center|LOCUS_08350 11681 9096 gene locus_tag LOCUS_08360 11681 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence049 3651 1972 gene locus_tag LOCUS_08370 3651 1972 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_08370 6387 3910 gene locus_tag LOCUS_08380 gene gyrA 6387 3910 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244540.1 protein_id gnl|my_center|LOCUS_08380 8370 6403 gene locus_tag LOCUS_08390 gene gyrB 8370 6403 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391556.1 protein_id gnl|my_center|LOCUS_08390 8727 8521 gene locus_tag LOCUS_08400 8727 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 9641 8724 gene locus_tag LOCUS_08410 9641 8724 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_08410 9950 10990 gene locus_tag LOCUS_08420 9950 10990 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965529.1 protein_id gnl|my_center|LOCUS_08420 <11978 11005 gene locus_tag LOCUS_08430 <11978 11005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389524.1:recombinase family protein >Feature sequence050 1163 141 gene locus_tag LOCUS_08440 gene queA 1163 141 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_08440 2279 1218 gene locus_tag LOCUS_08450 gene ruvB 2279 1218 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_08450 2420 2298 gene locus_tag LOCUS_08460 2420 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2891 2430 gene locus_tag LOCUS_08470 2891 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08470 3403 2909 gene locus_tag LOCUS_08480 gene ruvC 3403 2909 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_08480 3589 4971 gene locus_tag LOCUS_08490 gene argH 3589 4971 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393767.1 protein_id gnl|my_center|LOCUS_08490 6306 5155 gene locus_tag LOCUS_08500 6306 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 7106 6303 gene locus_tag LOCUS_08510 7106 6303 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325646.1 protein_id gnl|my_center|LOCUS_08510 8047 7394 gene locus_tag LOCUS_08520 8047 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 8714 8055 gene locus_tag LOCUS_08530 8714 8055 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027441.1 protein_id gnl|my_center|LOCUS_08530 10305 8707 gene locus_tag LOCUS_08540 10305 8707 CDS product aldolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461003.1 protein_id gnl|my_center|LOCUS_08540 11072 10317 gene locus_tag LOCUS_08550 gene kdsB 11072 10317 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_08550 11798 11118 gene locus_tag LOCUS_08560 11798 11118 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143764.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence051 1204 605 gene locus_tag LOCUS_08570 gene hisIE 1204 605 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131119.1 protein_id gnl|my_center|LOCUS_08570 1968 1207 gene locus_tag LOCUS_08580 gene hisF 1968 1207 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_08580 2703 1990 gene locus_tag LOCUS_08590 gene hisA 2703 1990 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393528.1 protein_id gnl|my_center|LOCUS_08590 3310 2723 gene locus_tag LOCUS_08600 gene hisH 3310 2723 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856473.1 protein_id gnl|my_center|LOCUS_08600 3887 3312 gene locus_tag LOCUS_08610 gene hisB 3887 3312 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537957.1 protein_id gnl|my_center|LOCUS_08610 5170 3884 gene locus_tag LOCUS_08620 gene hisD 5170 3884 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402931.1 protein_id gnl|my_center|LOCUS_08620 5799 5167 gene locus_tag LOCUS_08630 gene hisG 5799 5167 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244493.1 protein_id gnl|my_center|LOCUS_08630 6776 5793 gene locus_tag LOCUS_08640 6776 5793 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_08640 8936 6933 gene locus_tag LOCUS_08650 gene recG 8936 6933 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015732.1 protein_id gnl|my_center|LOCUS_08650 10654 9011 gene locus_tag LOCUS_08660 10654 9011 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454872.1 protein_id gnl|my_center|LOCUS_08660 11034 10684 gene locus_tag LOCUS_08670 11034 10684 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813375.1 protein_id gnl|my_center|LOCUS_08670 11263 11451 gene locus_tag LOCUS_08680 gene rpmB 11263 11451 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence052 <1 2144 gene locus_tag LOCUS_08690 <1 2144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048356.1:DNA-directed RNA polymerase subunit beta' 3082 2282 gene locus_tag LOCUS_08700 3082 2282 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963843.1 protein_id gnl|my_center|LOCUS_08700 4661 3114 gene locus_tag LOCUS_08710 gene cls 4661 3114 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461555.1 protein_id gnl|my_center|LOCUS_08710 5898 4879 gene locus_tag LOCUS_08720 5898 4879 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005667996.1 protein_id gnl|my_center|LOCUS_08720 6221 6424 gene locus_tag LOCUS_08730 gene rpmE 6221 6424 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814855.1 protein_id gnl|my_center|LOCUS_08730 6496 8340 gene locus_tag LOCUS_08740 6496 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 8347 9423 gene locus_tag LOCUS_08750 gene prfA 8347 9423 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887064.1 protein_id gnl|my_center|LOCUS_08750 9517 10707 gene locus_tag LOCUS_08760 9517 10707 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965125.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence053 863 363 gene locus_tag LOCUS_08770 863 363 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902015.1 protein_id gnl|my_center|LOCUS_08770 1120 1046 gene locus_tag LOCUS_t00090 1120 1046 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1200 2012 gene locus_tag LOCUS_08780 gene proC 1200 2012 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966526.1 protein_id gnl|my_center|LOCUS_08780 2023 2466 gene locus_tag LOCUS_08790 gene rnhA 2023 2466 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933276.1 protein_id gnl|my_center|LOCUS_08790 2575 3594 gene locus_tag LOCUS_08800 2575 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4173 3670 gene locus_tag LOCUS_08810 4173 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4331 5254 gene locus_tag LOCUS_08820 4331 5254 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903661.1 protein_id gnl|my_center|LOCUS_08820 5398 6978 gene locus_tag LOCUS_08830 5398 6978 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966231.1 protein_id gnl|my_center|LOCUS_08830 7042 7476 gene locus_tag LOCUS_08840 7042 7476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 7577 10132 gene locus_tag LOCUS_08850 gene polA 7577 10132 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000412819.1 protein_id gnl|my_center|LOCUS_08850 10119 10721 gene locus_tag LOCUS_08860 gene coaE 10119 10721 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932880.1 protein_id gnl|my_center|LOCUS_08860 10687 11235 gene locus_tag LOCUS_08870 10687 11235 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048036.1 protein_id gnl|my_center|LOCUS_08870 11277 11361 gene locus_tag LOCUS_t00100 11277 11361 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 258 1397 gene locus_tag LOCUS_08880 258 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1612 1451 gene locus_tag LOCUS_08890 1612 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1878 3785 gene locus_tag LOCUS_08900 gene gyrB 1878 3785 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_08900 3796 6393 gene locus_tag LOCUS_08910 gene gyrA 3796 6393 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815130.1 protein_id gnl|my_center|LOCUS_08910 9306 6667 gene locus_tag LOCUS_08920 9306 6667 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861289.1 protein_id gnl|my_center|LOCUS_08920 9528 10814 gene locus_tag LOCUS_08930 gene serS 9528 10814 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_08930 11327 11401 gene locus_tag LOCUS_t00110 11327 11401 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence055 1089 418 gene locus_tag LOCUS_08940 1089 418 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_08940 2018 1092 gene locus_tag LOCUS_08950 gene pfkB 2018 1092 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_08950 3204 2242 gene locus_tag LOCUS_08960 gene pfkA 3204 2242 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429132.1 protein_id gnl|my_center|LOCUS_08960 6989 3384 gene locus_tag LOCUS_08970 6989 3384 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_08970 7316 7062 gene locus_tag LOCUS_08980 7316 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 8281 7319 gene locus_tag LOCUS_08990 gene whiA 8281 7319 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_08990 9054 8278 gene locus_tag LOCUS_09000 9054 8278 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436256.1 protein_id gnl|my_center|LOCUS_09000 9945 9055 gene locus_tag LOCUS_09010 gene murB 9945 9055 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392364.1 protein_id gnl|my_center|LOCUS_09010 11018 9990 gene locus_tag LOCUS_09020 11018 9990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence056 506 1855 gene locus_tag LOCUS_09030 506 1855 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357775.1 protein_id gnl|my_center|LOCUS_09030 1852 2700 gene locus_tag LOCUS_09040 1852 2700 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837036.1 protein_id gnl|my_center|LOCUS_09040 2726 3526 gene locus_tag LOCUS_09050 2726 3526 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263714.1 protein_id gnl|my_center|LOCUS_09050 3541 4335 gene locus_tag LOCUS_09060 3541 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 4396 6675 gene locus_tag LOCUS_09070 4396 6675 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016705.1 protein_id gnl|my_center|LOCUS_09070 6665 7696 gene locus_tag LOCUS_09080 6665 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 8513 7869 gene locus_tag LOCUS_09090 8513 7869 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809652.1 protein_id gnl|my_center|LOCUS_09090 9923 8565 gene locus_tag LOCUS_09100 9923 8565 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_09100 10067 10741 gene locus_tag LOCUS_09110 10067 10741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence057 250 564 gene locus_tag LOCUS_09120 250 564 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963892.1 protein_id gnl|my_center|LOCUS_09120 561 1124 gene locus_tag LOCUS_09130 561 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1126 2100 gene locus_tag LOCUS_09140 1126 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3375 2461 gene locus_tag LOCUS_09150 3375 2461 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035213640.1 protein_id gnl|my_center|LOCUS_09150 3928 3386 gene locus_tag LOCUS_09160 3928 3386 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185961073.1 protein_id gnl|my_center|LOCUS_09160 4113 4649 gene locus_tag LOCUS_09170 4113 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4694 5551 gene locus_tag LOCUS_09180 4694 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 6409 6005 gene locus_tag LOCUS_09190 6409 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 7669 6419 gene locus_tag LOCUS_09200 7669 6419 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_09200 8244 7762 gene locus_tag LOCUS_09210 8244 7762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8750 8241 gene locus_tag LOCUS_09220 8750 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 9293 8979 gene locus_tag LOCUS_09230 gene trxA 9293 8979 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879633.1 protein_id gnl|my_center|LOCUS_09230 9723 9277 gene locus_tag LOCUS_09240 9723 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 10979 9720 gene locus_tag LOCUS_09250 gene hisS 10979 9720 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048076.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence058 3 164 gene locus_tag LOCUS_09260 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 166 1491 gene locus_tag LOCUS_09270 gene rimO 166 1491 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965119.1 protein_id gnl|my_center|LOCUS_09270 1488 2123 gene locus_tag LOCUS_09280 gene pgsA 1488 2123 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889106.1 protein_id gnl|my_center|LOCUS_09280 2120 3196 gene locus_tag LOCUS_09290 2120 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3251 4285 gene locus_tag LOCUS_09300 gene recA 3251 4285 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_09300 4296 6197 gene locus_tag LOCUS_09310 4296 6197 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203175.1 protein_id gnl|my_center|LOCUS_09310 6407 8020 gene locus_tag LOCUS_09320 gene rny 6407 8020 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_09320 8194 9096 gene locus_tag LOCUS_09330 gene spoIIIAA 8194 9096 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965393.1 protein_id gnl|my_center|LOCUS_09330 9093 9563 gene locus_tag LOCUS_09340 9093 9563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 9599 9796 gene locus_tag LOCUS_09350 gene spoIIIAC 9599 9796 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888937.1 protein_id gnl|my_center|LOCUS_09350 9800 10192 gene locus_tag LOCUS_09360 9800 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence059 1006 2265 gene locus_tag LOCUS_09370 1006 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2262 3506 gene locus_tag LOCUS_09380 2262 3506 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788846.1 protein_id gnl|my_center|LOCUS_09380 3511 4473 gene locus_tag LOCUS_09390 3511 4473 CDS product aminoimidazole riboside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057563589.1 protein_id gnl|my_center|LOCUS_09390 4560 5390 gene locus_tag LOCUS_09400 4560 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5395 6285 gene locus_tag LOCUS_09410 5395 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 7693 6689 gene locus_tag LOCUS_09420 7693 6689 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_09420 8410 7709 gene locus_tag LOCUS_09430 8410 7709 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_09430 8637 10661 gene locus_tag LOCUS_09440 8637 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence060 1245 343 gene locus_tag LOCUS_09450 1245 343 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667339.1 protein_id gnl|my_center|LOCUS_09450 2469 1318 gene locus_tag LOCUS_09460 2469 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2727 3827 gene locus_tag LOCUS_09470 2727 3827 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964085.1 protein_id gnl|my_center|LOCUS_09470 4719 4129 gene locus_tag LOCUS_09480 gene lexA 4719 4129 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392634.1 protein_id gnl|my_center|LOCUS_09480 4820 5005 gene locus_tag LOCUS_09490 4820 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 6499 5249 gene locus_tag LOCUS_09500 6499 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7580 6528 gene locus_tag LOCUS_09510 7580 6528 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435347.1 protein_id gnl|my_center|LOCUS_09510 8407 8201 gene locus_tag LOCUS_09520 8407 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 10401 8488 gene locus_tag LOCUS_09530 10401 8488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence061 792 3569 gene locus_tag LOCUS_09540 792 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3566 6454 gene locus_tag LOCUS_09550 3566 6454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 6533 9937 gene locus_tag LOCUS_09560 6533 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 10767 10171 gene locus_tag LOCUS_09570 10767 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence062 762 43 gene locus_tag LOCUS_09580 762 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1253 759 gene locus_tag LOCUS_09590 1253 759 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_09590 1377 1634 gene locus_tag LOCUS_09600 1377 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1732 2304 gene locus_tag LOCUS_09610 1732 2304 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392747.1 protein_id gnl|my_center|LOCUS_09610 3322 2369 gene locus_tag LOCUS_09620 3322 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4788 3688 gene locus_tag LOCUS_09630 gene mnmA 4788 3688 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089522426.1 protein_id gnl|my_center|LOCUS_09630 5492 4914 gene locus_tag LOCUS_09640 5492 4914 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203450.1 protein_id gnl|my_center|LOCUS_09640 5751 7097 gene locus_tag LOCUS_09650 5751 7097 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986630.1 protein_id gnl|my_center|LOCUS_09650 8167 7259 gene locus_tag LOCUS_09660 8167 7259 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094661859.1 protein_id gnl|my_center|LOCUS_09660 9019 8171 gene locus_tag LOCUS_09670 9019 8171 CDS product class II fructose-bisphosphate aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294699.1 protein_id gnl|my_center|LOCUS_09670 10420 9023 gene locus_tag LOCUS_09680 10420 9023 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080611.1 protein_id gnl|my_center|LOCUS_09680 <10945 10422 gene locus_tag LOCUS_09690 <10945 10422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392013.1:FGGY-family carbohydrate kinase >Feature sequence063 458 1312 gene locus_tag LOCUS_09700 458 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1309 2016 gene locus_tag LOCUS_09710 gene sigE 1309 2016 CDS product RNA polymerase sporulation sigma factor SigE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003221446.1 protein_id gnl|my_center|LOCUS_09710 2973 3776 gene locus_tag LOCUS_09720 2973 3776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4102 4806 gene locus_tag LOCUS_09730 4102 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 5031 6686 gene locus_tag LOCUS_09740 5031 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 6702 7262 gene locus_tag LOCUS_09750 6702 7262 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767792.1 protein_id gnl|my_center|LOCUS_09750 7231 8868 gene locus_tag LOCUS_09760 7231 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence064 920 204 gene locus_tag LOCUS_09770 gene tpiA 920 204 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948028.1 protein_id gnl|my_center|LOCUS_09770 2376 1057 gene locus_tag LOCUS_09780 2376 1057 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948027.1 protein_id gnl|my_center|LOCUS_09780 2969 2484 gene locus_tag LOCUS_09790 gene trmL 2969 2484 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_09790 6077 3453 gene locus_tag LOCUS_09800 6077 3453 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_09800 6403 7413 gene locus_tag LOCUS_09810 6403 7413 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963939.1 protein_id gnl|my_center|LOCUS_09810 7466 8236 gene locus_tag LOCUS_09820 7466 8236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461079.1 protein_id gnl|my_center|LOCUS_09820 8233 9036 gene locus_tag LOCUS_09830 8233 9036 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815800.1 protein_id gnl|my_center|LOCUS_09830 10019 8919 gene locus_tag LOCUS_09840 10019 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244712.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence065 254 1291 gene locus_tag LOCUS_09850 gene plsX 254 1291 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428446.1 protein_id gnl|my_center|LOCUS_09850 1275 1928 gene locus_tag LOCUS_09860 gene rnc 1275 1928 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971346.1 protein_id gnl|my_center|LOCUS_09860 1941 5537 gene locus_tag LOCUS_09870 gene smc 1941 5537 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047863.1 protein_id gnl|my_center|LOCUS_09870 5559 6482 gene locus_tag LOCUS_09880 5559 6482 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188032.1 protein_id gnl|my_center|LOCUS_09880 6523 7419 gene locus_tag LOCUS_09890 gene ftsY 6523 7419 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965059.1 protein_id gnl|my_center|LOCUS_09890 7445 8176 gene locus_tag LOCUS_09900 7445 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8253 8600 gene locus_tag LOCUS_09910 8253 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 8606 9922 gene locus_tag LOCUS_09920 gene ffh 8606 9922 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence066 537 316 gene locus_tag LOCUS_09930 537 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1478 909 gene locus_tag LOCUS_09940 1478 909 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868997.1 protein_id gnl|my_center|LOCUS_09940 2461 1496 gene locus_tag LOCUS_09950 2461 1496 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_09950 2616 3350 gene locus_tag LOCUS_09960 2616 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 5652 3607 gene locus_tag LOCUS_09970 5652 3607 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_09970 6637 5762 gene locus_tag LOCUS_09980 6637 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7985 6702 gene locus_tag LOCUS_09990 7985 6702 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986281.1 protein_id gnl|my_center|LOCUS_09990 8764 7982 gene locus_tag LOCUS_10000 8764 7982 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359441.1 protein_id gnl|my_center|LOCUS_10000 9428 8781 gene locus_tag LOCUS_10010 9428 8781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence067 3032 711 gene locus_tag LOCUS_10020 3032 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 4154 3105 gene locus_tag LOCUS_10030 4154 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 5637 4147 gene locus_tag LOCUS_10040 5637 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 7199 5871 gene locus_tag LOCUS_10050 gene scfB 7199 5871 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_10050 7475 7314 gene locus_tag LOCUS_10060 7475 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 8032 7658 gene locus_tag LOCUS_10070 8032 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 8519 8094 gene locus_tag LOCUS_10080 8519 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 9761 8631 gene locus_tag LOCUS_10090 gene tgt 9761 8631 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence068 221 2392 gene locus_tag LOCUS_10100 gene gnpA 221 2392 CDS product 1,3-beta-galactosyl-N-acetylhexosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389962.1 protein_id gnl|my_center|LOCUS_10100 2407 3564 gene locus_tag LOCUS_10110 2407 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3561 3791 gene locus_tag LOCUS_10120 3561 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3788 5776 gene locus_tag LOCUS_10130 3788 5776 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_10130 5808 7355 gene locus_tag LOCUS_10140 5808 7355 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399407.1 protein_id gnl|my_center|LOCUS_10140 7393 8028 gene locus_tag LOCUS_10150 7393 8028 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775976.1 protein_id gnl|my_center|LOCUS_10150 8295 8429 gene locus_tag LOCUS_10160 8295 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 8433 8873 gene locus_tag LOCUS_10170 8433 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 8883 9020 gene locus_tag LOCUS_10180 8883 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence069 591 998 gene locus_tag LOCUS_10190 591 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1088 2575 gene locus_tag LOCUS_10200 gene thrC 1088 2575 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434031.1 protein_id gnl|my_center|LOCUS_10200 2838 2748 gene locus_tag LOCUS_t00120 2838 2748 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3430 2906 gene locus_tag LOCUS_10210 3430 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 3517 3972 gene locus_tag LOCUS_10220 3517 3972 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_10220 4397 5296 gene locus_tag LOCUS_10230 gene nadA 4397 5296 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454668.1 protein_id gnl|my_center|LOCUS_10230 5304 6593 gene locus_tag LOCUS_10240 5304 6593 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016070.1 protein_id gnl|my_center|LOCUS_10240 6586 7476 gene locus_tag LOCUS_10250 gene nadC 6586 7476 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016071.1 protein_id gnl|my_center|LOCUS_10250 7478 8011 gene locus_tag LOCUS_10260 7478 8011 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016072.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence070 79 3 gene locus_tag LOCUS_t00130 79 3 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 300 2894 gene locus_tag LOCUS_10270 300 2894 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_10270 3434 2991 gene locus_tag LOCUS_10280 gene rplI 3434 2991 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815187.1 protein_id gnl|my_center|LOCUS_10280 3548 3703 gene locus_tag LOCUS_10290 3548 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 4240 3746 gene locus_tag LOCUS_10300 4240 3746 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262000.1 protein_id gnl|my_center|LOCUS_10300 5305 4430 gene locus_tag LOCUS_10310 5305 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5433 6122 gene locus_tag LOCUS_10320 5433 6122 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_10320 6136 7119 gene locus_tag LOCUS_10330 gene asnA 6136 7119 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903470.1 protein_id gnl|my_center|LOCUS_10330 8182 7208 gene locus_tag LOCUS_10340 8182 7208 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051219.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence071 <1 537 gene locus_tag LOCUS_10350 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761250.1:replicative DNA helicase 540 1541 gene locus_tag LOCUS_10360 540 1541 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009925391.1 protein_id gnl|my_center|LOCUS_10360 1604 2026 gene locus_tag LOCUS_10370 1604 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2050 2499 gene locus_tag LOCUS_10380 gene rpiB 2050 2499 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_10380 2533 3414 gene locus_tag LOCUS_10390 gene galU 2533 3414 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048121.1 protein_id gnl|my_center|LOCUS_10390 3420 4703 gene locus_tag LOCUS_10400 3420 4703 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_10400 4766 5626 gene locus_tag LOCUS_10410 gene mscS 4766 5626 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420749.1 protein_id gnl|my_center|LOCUS_10410 5623 6090 gene locus_tag LOCUS_10420 5623 6090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 6096 6806 gene locus_tag LOCUS_10430 6096 6806 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_10430 6839 6925 gene locus_tag LOCUS_t00140 6839 6925 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6956 7032 gene locus_tag LOCUS_t00150 6956 7032 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7318 7142 gene locus_tag LOCUS_10440 7318 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 <9283 7596 gene locus_tag LOCUS_10450 <9283 7596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963965.1:leucine--tRNA ligase >Feature sequence072 554 1960 gene locus_tag LOCUS_10460 gene pyk 554 1960 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436250.1 protein_id gnl|my_center|LOCUS_10460 3003 2098 gene locus_tag LOCUS_10470 gene metA 3003 2098 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965131.1 protein_id gnl|my_center|LOCUS_10470 4348 3077 gene locus_tag LOCUS_10480 4348 3077 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_10480 4860 4411 gene locus_tag LOCUS_10490 gene smpB 4860 4411 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356515.1 protein_id gnl|my_center|LOCUS_10490 5365 4865 gene locus_tag LOCUS_10500 5365 4865 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797556.1 protein_id gnl|my_center|LOCUS_10500 7469 5397 gene locus_tag LOCUS_10510 gene rnr 7469 5397 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434984.1 protein_id gnl|my_center|LOCUS_10510 7872 7555 gene locus_tag LOCUS_10520 7872 7555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 <8968 7982 gene locus_tag LOCUS_10530 <8968 7982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948029.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence073 633 10 gene locus_tag LOCUS_10540 633 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 839 1858 gene locus_tag LOCUS_10550 839 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2018 2290 gene locus_tag LOCUS_10560 2018 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2681 2445 gene locus_tag LOCUS_10570 2681 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5463 2761 gene locus_tag LOCUS_10580 5463 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5748 6446 gene locus_tag LOCUS_10590 5748 6446 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902398.1 protein_id gnl|my_center|LOCUS_10590 6446 7234 gene locus_tag LOCUS_10600 6446 7234 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088258909.1 protein_id gnl|my_center|LOCUS_10600 7227 7919 gene locus_tag LOCUS_10610 7227 7919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence074 4977 703 gene locus_tag LOCUS_10620 4977 703 CDS product DUF4011 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109210.1 protein_id gnl|my_center|LOCUS_10620 5832 5131 gene locus_tag LOCUS_10630 5832 5131 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003574153.1 protein_id gnl|my_center|LOCUS_10630 8209 5825 gene locus_tag LOCUS_10640 8209 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8695 8354 gene locus_tag LOCUS_10650 8695 8354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence075 403 2361 gene locus_tag LOCUS_10660 gene yesZ 403 2361 CDS product beta-galactosidase YesZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242572.1 protein_id gnl|my_center|LOCUS_10660 2533 3759 gene locus_tag LOCUS_10670 2533 3759 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 protein_id gnl|my_center|LOCUS_10670 3772 5016 gene locus_tag LOCUS_10680 3772 5016 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232341.1 protein_id gnl|my_center|LOCUS_10680 5356 5727 gene locus_tag LOCUS_10690 gene rpsL 5356 5727 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_10690 6182 6616 gene locus_tag LOCUS_10700 gene rpsG 6182 6616 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_10700 6634 8718 gene locus_tag LOCUS_10710 gene fusA 6634 8718 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence076 3687 1879 gene locus_tag LOCUS_10720 3687 1879 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_10720 4203 3754 gene locus_tag LOCUS_10730 4203 3754 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966683.1 protein_id gnl|my_center|LOCUS_10730 5526 4513 gene locus_tag LOCUS_10740 5526 4513 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080120.1 protein_id gnl|my_center|LOCUS_10740 6683 5829 gene locus_tag LOCUS_10750 6683 5829 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764890.1 protein_id gnl|my_center|LOCUS_10750 7472 6858 gene locus_tag LOCUS_10760 7472 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 7654 7998 gene locus_tag LOCUS_10770 7654 7998 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_10770 8018 8563 gene locus_tag LOCUS_10780 8018 8563 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence077 128 871 gene locus_tag LOCUS_10790 128 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10790 947 1204 gene locus_tag LOCUS_10800 947 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10800 1665 5114 gene locus_tag LOCUS_10810 1665 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5227 6066 gene locus_tag LOCUS_10820 5227 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 6067 6282 gene locus_tag LOCUS_10830 6067 6282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 6442 6912 gene locus_tag LOCUS_10840 6442 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence078 1158 151 gene locus_tag LOCUS_10850 gene spoIVB 1158 151 CDS product SpoIVB peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965372.1 protein_id gnl|my_center|LOCUS_10850 3069 1357 gene locus_tag LOCUS_10860 gene recN 3069 1357 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387037.1 protein_id gnl|my_center|LOCUS_10860 3526 3074 gene locus_tag LOCUS_10870 3526 3074 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965374.1 protein_id gnl|my_center|LOCUS_10870 4345 3539 gene locus_tag LOCUS_10880 4345 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 6516 4642 gene locus_tag LOCUS_10890 gene htpG 6516 4642 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_10890 8618 6573 gene locus_tag LOCUS_10900 8618 6573 CDS product bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965152.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence079 817 80 gene locus_tag LOCUS_10910 817 80 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338572.1 protein_id gnl|my_center|LOCUS_10910 1245 3050 gene locus_tag LOCUS_10920 gene lepA 1245 3050 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357725.1 protein_id gnl|my_center|LOCUS_10920 3112 3786 gene locus_tag LOCUS_10930 3112 3786 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968042.1 protein_id gnl|my_center|LOCUS_10930 3895 5007 gene locus_tag LOCUS_10940 gene hemW 3895 5007 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460876.1 protein_id gnl|my_center|LOCUS_10940 5827 5168 gene locus_tag LOCUS_10950 5827 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 6118 6798 gene locus_tag LOCUS_10960 6118 6798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 6848 8305 gene locus_tag LOCUS_10970 gene guaB 6848 8305 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048242.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence080 2596 392 gene locus_tag LOCUS_10980 2596 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2726 4051 gene locus_tag LOCUS_10990 gene miaB 2726 4051 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_10990 4064 6646 gene locus_tag LOCUS_11000 gene mutS 4064 6646 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047675.1 protein_id gnl|my_center|LOCUS_11000 6651 8603 gene locus_tag LOCUS_11010 gene mutL 6651 8603 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence081 >Feature sequence082 1837 548 gene locus_tag LOCUS_11020 1837 548 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016932.1 protein_id gnl|my_center|LOCUS_11020 4763 1824 gene locus_tag LOCUS_11030 4763 1824 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016931.1 protein_id gnl|my_center|LOCUS_11030 5208 4951 gene locus_tag LOCUS_11040 gene spoIIID 5208 4951 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014795808.1 protein_id gnl|my_center|LOCUS_11040 7399 5375 gene locus_tag LOCUS_11050 gene lysS 7399 5375 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558598.1 protein_id gnl|my_center|LOCUS_11050 8034 7576 gene locus_tag LOCUS_11060 gene spoVAC 8034 7576 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965602.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence083 977 714 gene locus_tag LOCUS_11070 977 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1592 1320 gene locus_tag LOCUS_11080 1592 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3492 1663 gene locus_tag LOCUS_11090 gene typA 3492 1663 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986883.1 protein_id gnl|my_center|LOCUS_11090 4747 3623 gene locus_tag LOCUS_11100 4747 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 5144 4740 gene locus_tag LOCUS_11110 5144 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 6956 5718 gene locus_tag LOCUS_11120 6956 5718 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966528.1 protein_id gnl|my_center|LOCUS_11120 7770 7030 gene locus_tag LOCUS_11130 7770 7030 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_11130 8544 7813 gene locus_tag LOCUS_11140 8544 7813 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808211.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence084 <1 1315 gene locus_tag LOCUS_11150 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965634.1:phospho-sugar mutase 1917 2930 gene locus_tag LOCUS_11160 1917 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 2993 3193 gene locus_tag LOCUS_11170 2993 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4169 3378 gene locus_tag LOCUS_11180 4169 3378 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098733.1 protein_id gnl|my_center|LOCUS_11180 4277 5338 gene locus_tag LOCUS_11190 4277 5338 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_11190 5428 6399 gene locus_tag LOCUS_11200 5428 6399 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_11200 6411 7139 gene locus_tag LOCUS_11210 6411 7139 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_11210 7170 8255 gene locus_tag LOCUS_11220 7170 8255 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989911.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence085 <1 869 gene locus_tag LOCUS_11230 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000264083.1:IMP dehydrogenase 945 2480 gene locus_tag LOCUS_11240 gene guaA 945 2480 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_11240 2526 3395 gene locus_tag LOCUS_11250 2526 3395 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679543.1 protein_id gnl|my_center|LOCUS_11250 3419 4399 gene locus_tag LOCUS_11260 3419 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 4583 6970 gene locus_tag LOCUS_11270 4583 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 6963 7661 gene locus_tag LOCUS_11280 6963 7661 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760196.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence086 1786 17 gene locus_tag LOCUS_11290 1786 17 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_11290 2069 3010 gene locus_tag LOCUS_11300 2069 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 3733 3194 gene locus_tag LOCUS_11310 gene hpt 3733 3194 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705261.1 protein_id gnl|my_center|LOCUS_11310 5069 3726 gene locus_tag LOCUS_11320 gene tilS 5069 3726 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243704.1 protein_id gnl|my_center|LOCUS_11320 6421 5138 gene locus_tag LOCUS_11330 6421 5138 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021362269.1 protein_id gnl|my_center|LOCUS_11330 6885 6418 gene locus_tag LOCUS_11340 gene ybaK 6885 6418 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244878.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence087 326 144 gene locus_tag LOCUS_11350 326 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 2017 329 gene locus_tag LOCUS_11360 2017 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1775 1853 gene locus_tag LOCUS_t00160 1775 1853 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2947 2039 gene locus_tag LOCUS_11370 2947 2039 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582718.1 protein_id gnl|my_center|LOCUS_11370 4449 2959 gene locus_tag LOCUS_11380 4449 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 5495 4467 gene locus_tag LOCUS_11390 5495 4467 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732008.1 protein_id gnl|my_center|LOCUS_11390 6151 7554 gene locus_tag LOCUS_11400 6151 7554 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence088 601 260 gene locus_tag LOCUS_11410 601 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1042 1914 gene locus_tag LOCUS_11420 1042 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2047 2640 gene locus_tag LOCUS_11430 2047 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2889 3848 gene locus_tag LOCUS_11440 2889 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 5077 3917 gene locus_tag LOCUS_11450 5077 3917 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426667.1 protein_id gnl|my_center|LOCUS_11450 5879 5214 gene locus_tag LOCUS_11460 5879 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5867 6604 gene locus_tag LOCUS_11470 5867 6604 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295857.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence089 243 1892 gene locus_tag LOCUS_11480 243 1892 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_11480 1974 2630 gene locus_tag LOCUS_11490 1974 2630 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938382.1 protein_id gnl|my_center|LOCUS_11490 2751 4412 gene locus_tag LOCUS_11500 2751 4412 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000162279.1 protein_id gnl|my_center|LOCUS_11500 4581 4871 gene locus_tag LOCUS_11510 4581 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 6013 5105 gene locus_tag LOCUS_11520 gene trxB 6013 5105 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434033.1 protein_id gnl|my_center|LOCUS_11520 7940 6015 gene locus_tag LOCUS_11530 7940 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence090 608 210 gene locus_tag LOCUS_11540 608 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 877 698 gene locus_tag LOCUS_11550 gene rpsU 877 698 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964600.1 protein_id gnl|my_center|LOCUS_11550 1358 1017 gene locus_tag LOCUS_11560 1358 1017 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022010.1 protein_id gnl|my_center|LOCUS_11560 2602 1373 gene locus_tag LOCUS_11570 gene mtaB 2602 1373 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108686.1 protein_id gnl|my_center|LOCUS_11570 3291 2599 gene locus_tag LOCUS_11580 3291 2599 CDS product RsmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460869.1 protein_id gnl|my_center|LOCUS_11580 4258 3314 gene locus_tag LOCUS_11590 gene prmA 4258 3314 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922698.1 protein_id gnl|my_center|LOCUS_11590 4876 4304 gene locus_tag LOCUS_11600 4876 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6607 5123 gene locus_tag LOCUS_11610 6607 5123 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_11610 7361 6714 gene locus_tag LOCUS_11620 7361 6714 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963498.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence091 208 1023 gene locus_tag LOCUS_11630 208 1023 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_11630 1248 2396 gene locus_tag LOCUS_11640 gene dacF 1248 2396 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_11640 2401 2961 gene locus_tag LOCUS_11650 2401 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2912 3298 gene locus_tag LOCUS_11660 2912 3298 CDS product spore germination protein GerW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428254.1 protein_id gnl|my_center|LOCUS_11660 3291 4469 gene locus_tag LOCUS_11670 3291 4469 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_11670 4406 5110 gene locus_tag LOCUS_11680 4406 5110 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903490.1 protein_id gnl|my_center|LOCUS_11680 5345 6415 gene locus_tag LOCUS_11690 5345 6415 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201892.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence092 426 1595 gene locus_tag LOCUS_11700 426 1595 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679610.1 protein_id gnl|my_center|LOCUS_11700 1624 2091 gene locus_tag LOCUS_11710 1624 2091 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797562.1 protein_id gnl|my_center|LOCUS_11710 2095 2715 gene locus_tag LOCUS_11720 2095 2715 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_11720 4126 2954 gene locus_tag LOCUS_11730 4126 2954 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065790.1 protein_id gnl|my_center|LOCUS_11730 4425 4586 gene locus_tag LOCUS_11740 gene rpmG 4425 4586 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966428.1 protein_id gnl|my_center|LOCUS_11740 4623 4850 gene locus_tag LOCUS_11750 4623 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 4860 5423 gene locus_tag LOCUS_11760 gene nusG 4860 5423 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_11760 5517 5942 gene locus_tag LOCUS_11770 gene rplK 5517 5942 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421189.1 protein_id gnl|my_center|LOCUS_11770 6001 6690 gene locus_tag LOCUS_11780 gene rplA 6001 6690 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966424.1 protein_id gnl|my_center|LOCUS_11780 6909 7430 gene locus_tag LOCUS_11790 gene rplJ 6909 7430 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence093 1592 486 gene locus_tag LOCUS_11800 1592 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11800 2141 1626 gene locus_tag LOCUS_11810 2141 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11810 4737 2302 gene locus_tag LOCUS_11820 4737 2302 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_11820 6451 4760 gene locus_tag LOCUS_11830 gene glgA 6451 4760 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042515450.1 protein_id gnl|my_center|LOCUS_11830 7517 6483 gene locus_tag LOCUS_11840 gene glgD 7517 6483 CDS product glucose-1-phosphate adenylyltransferase subunit GlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082940.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence094 1788 3302 gene locus_tag LOCUS_11850 1788 3302 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_11850 3321 4388 gene locus_tag LOCUS_11860 gene dprA 3321 4388 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392539.1 protein_id gnl|my_center|LOCUS_11860 4442 6751 gene locus_tag LOCUS_11870 gene topA 4442 6751 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence095 1641 814 gene locus_tag LOCUS_11880 1641 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 2373 1651 gene locus_tag LOCUS_11890 gene nagB 2373 1651 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_11890 3408 2389 gene locus_tag LOCUS_11900 gene galE 3408 2389 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389959.1 protein_id gnl|my_center|LOCUS_11900 5485 3413 gene locus_tag LOCUS_11910 5485 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 6583 5489 gene locus_tag LOCUS_11920 6583 5489 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence096 728 1345 gene locus_tag LOCUS_11930 728 1345 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016449.1 protein_id gnl|my_center|LOCUS_11930 1758 2414 gene locus_tag LOCUS_11940 1758 2414 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669725.1 protein_id gnl|my_center|LOCUS_11940 2435 5035 gene locus_tag LOCUS_11950 gene adhE 2435 5035 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_11950 5051 5797 gene locus_tag LOCUS_11960 5051 5797 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242836.1 protein_id gnl|my_center|LOCUS_11960 6079 6336 gene locus_tag LOCUS_11970 6079 6336 CDS product pro-sigmaK processing inhibitor BofA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359493.1 protein_id gnl|my_center|LOCUS_11970 6639 6415 gene locus_tag LOCUS_11980 6639 6415 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965253.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence097 <1 2579 gene locus_tag LOCUS_11990 <1 2579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225532.1:glycosyl hydrolase 115 family protein 3297 4463 gene locus_tag LOCUS_12000 3297 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 4784 5194 gene locus_tag LOCUS_12010 4784 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence098 762 583 gene locus_tag LOCUS_12020 762 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3223 911 gene locus_tag LOCUS_12030 gene feoB 3223 911 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 protein_id gnl|my_center|LOCUS_12030 3454 3224 gene locus_tag LOCUS_12040 3454 3224 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460243.1 protein_id gnl|my_center|LOCUS_12040 4143 3682 gene locus_tag LOCUS_12050 4143 3682 CDS product SLOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004323417.1 protein_id gnl|my_center|LOCUS_12050 4829 4143 gene locus_tag LOCUS_12060 gene rsmG 4829 4143 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence099 1290 292 gene locus_tag LOCUS_12070 1290 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 2521 1283 gene locus_tag LOCUS_12080 2521 1283 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399531.1 protein_id gnl|my_center|LOCUS_12080 2863 3177 gene locus_tag LOCUS_12090 2863 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3322 4353 gene locus_tag LOCUS_12100 3322 4353 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582929.1 protein_id gnl|my_center|LOCUS_12100 4373 5209 gene locus_tag LOCUS_12110 4373 5209 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583026.1 protein_id gnl|my_center|LOCUS_12110 5437 6069 gene locus_tag LOCUS_12120 5437 6069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence100 606 839 gene locus_tag LOCUS_12130 606 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 2148 961 gene locus_tag LOCUS_12140 2148 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4657 2321 gene locus_tag LOCUS_12150 4657 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 5538 4687 gene locus_tag LOCUS_12160 5538 4687 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966734.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence101 492 701 gene locus_tag LOCUS_12170 492 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 701 1093 gene locus_tag LOCUS_12180 701 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 1233 2660 gene locus_tag LOCUS_12190 1233 2660 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_12190 2742 3749 gene locus_tag LOCUS_12200 2742 3749 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815913.1 protein_id gnl|my_center|LOCUS_12200 4191 6011 gene locus_tag LOCUS_12210 4191 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence102 1203 541 gene locus_tag LOCUS_12220 gene phoU 1203 541 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621378.1 protein_id gnl|my_center|LOCUS_12220 1981 1205 gene locus_tag LOCUS_12230 gene pstB 1981 1205 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041121.1 protein_id gnl|my_center|LOCUS_12230 2911 1985 gene locus_tag LOCUS_12240 gene pstA 2911 1985 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427927.1 protein_id gnl|my_center|LOCUS_12240 3835 2924 gene locus_tag LOCUS_12250 gene pstC 3835 2924 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814831.1 protein_id gnl|my_center|LOCUS_12250 4806 3922 gene locus_tag LOCUS_12260 4806 3922 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000716331.1 protein_id gnl|my_center|LOCUS_12260 6221 5076 gene locus_tag LOCUS_12270 6221 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence103 <1 1073 gene locus_tag LOCUS_12280 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438121.1:stage III sporulation protein AE 1076 1549 gene locus_tag LOCUS_12290 1076 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1542 2021 gene locus_tag LOCUS_12300 1542 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2050 2535 gene locus_tag LOCUS_12310 2050 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2601 2939 gene locus_tag LOCUS_12320 2601 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3007 3411 gene locus_tag LOCUS_12330 gene nusB 3007 3411 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722486.1 protein_id gnl|my_center|LOCUS_12330 3395 4240 gene locus_tag LOCUS_12340 gene folD 3395 4240 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_12340 4244 5128 gene locus_tag LOCUS_12350 4244 5128 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965380.1 protein_id gnl|my_center|LOCUS_12350 5130 5900 gene locus_tag LOCUS_12360 5130 5900 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810950.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence104 1191 124 gene locus_tag LOCUS_12370 gene hisC 1191 124 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390315.1 protein_id gnl|my_center|LOCUS_12370 2062 1370 gene locus_tag LOCUS_12380 2062 1370 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_12380 2562 2233 gene locus_tag LOCUS_12390 2562 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3797 2559 gene locus_tag LOCUS_12400 3797 2559 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_12400 4241 3822 gene locus_tag LOCUS_12410 4241 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4581 4243 gene locus_tag LOCUS_12420 4581 4243 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_12420 5656 4778 gene locus_tag LOCUS_12430 5656 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence105 <1 1299 gene locus_tag LOCUS_12440 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948145.1:electron transport complex subunit RsxC 1292 3091 gene locus_tag LOCUS_12450 1292 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3088 3627 gene locus_tag LOCUS_12460 3088 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 3620 4294 gene locus_tag LOCUS_12470 3620 4294 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_12470 4291 4875 gene locus_tag LOCUS_12480 4291 4875 CDS product RnfABCDGE type electron transport complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869099.1 protein_id gnl|my_center|LOCUS_12480 4886 5680 gene locus_tag LOCUS_12490 4886 5680 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence106 746 231 gene locus_tag LOCUS_12500 746 231 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_12500 1348 743 gene locus_tag LOCUS_12510 1348 743 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288769.1 protein_id gnl|my_center|LOCUS_12510 1881 1348 gene locus_tag LOCUS_12520 1881 1348 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_12520 2062 2152 gene locus_tag LOCUS_t00170 2062 2152 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2982 2560 gene locus_tag LOCUS_12530 2982 2560 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_12530 3091 4230 gene locus_tag LOCUS_12540 3091 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4241 5032 gene locus_tag LOCUS_12550 4241 5032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence107 447 94 gene locus_tag LOCUS_12560 gene rplT 447 94 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965656.1 protein_id gnl|my_center|LOCUS_12560 671 468 gene locus_tag LOCUS_12570 gene rpmI 671 468 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_12570 1210 743 gene locus_tag LOCUS_12580 gene infC 1210 743 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965658.1 protein_id gnl|my_center|LOCUS_12580 3419 1512 gene locus_tag LOCUS_12590 gene thrS 3419 1512 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888359.1 protein_id gnl|my_center|LOCUS_12590 4491 3784 gene locus_tag LOCUS_12600 4491 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4658 4897 gene locus_tag LOCUS_12610 4658 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence108 1327 932 gene locus_tag LOCUS_12620 1327 932 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948047.1 protein_id gnl|my_center|LOCUS_12620 2576 1407 gene locus_tag LOCUS_12630 2576 1407 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948019.1 protein_id gnl|my_center|LOCUS_12630 3627 2593 gene locus_tag LOCUS_12640 3627 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3943 5577 gene locus_tag LOCUS_12650 3943 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence109 1361 717 gene locus_tag LOCUS_12660 1361 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1551 2309 gene locus_tag LOCUS_12670 1551 2309 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288637.1 protein_id gnl|my_center|LOCUS_12670 3203 2565 gene locus_tag LOCUS_12680 3203 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 4140 3211 gene locus_tag LOCUS_12690 gene cysK 4140 3211 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965533.1 protein_id gnl|my_center|LOCUS_12690 5072 4137 gene locus_tag LOCUS_12700 5072 4137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014849.1 protein_id gnl|my_center|LOCUS_12700 <5937 5072 gene locus_tag LOCUS_12710 <5937 5072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812720.1:ATP-binding cassette domain-containing protein >Feature sequence110 76 855 gene locus_tag LOCUS_12720 gene atpB 76 855 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462234.1 protein_id gnl|my_center|LOCUS_12720 893 1147 gene locus_tag LOCUS_12730 893 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1175 1726 gene locus_tag LOCUS_12740 1175 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1719 1937 gene locus_tag LOCUS_12750 1719 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1953 3482 gene locus_tag LOCUS_12760 gene atpA 1953 3482 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966151.1 protein_id gnl|my_center|LOCUS_12760 3475 4344 gene locus_tag LOCUS_12770 gene atpG 3475 4344 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437835.1 protein_id gnl|my_center|LOCUS_12770 4351 5745 gene locus_tag LOCUS_12780 gene atpD 4351 5745 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence111 2438 369 gene locus_tag LOCUS_12790 gene fusA 2438 369 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048368.1 protein_id gnl|my_center|LOCUS_12790 2671 3369 gene locus_tag LOCUS_12800 2671 3369 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016610.1 protein_id gnl|my_center|LOCUS_12800 4200 3550 gene locus_tag LOCUS_12810 4200 3550 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_12810 4301 4780 gene locus_tag LOCUS_12820 4301 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 5437 4940 gene locus_tag LOCUS_12830 5437 4940 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060742.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence112 3253 146 gene locus_tag LOCUS_12840 3253 146 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_12840 4711 3362 gene locus_tag LOCUS_12850 4711 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5418 4711 gene locus_tag LOCUS_12860 5418 4711 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence113 2945 813 gene locus_tag LOCUS_12870 2945 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3832 3137 gene locus_tag LOCUS_12880 3832 3137 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892161.1 protein_id gnl|my_center|LOCUS_12880 4682 3825 gene locus_tag LOCUS_12890 4682 3825 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_12890 <5788 4695 gene locus_tag LOCUS_12900 <5788 4695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966319.1:isoleucine--tRNA ligase >Feature sequence114 <1 795 gene locus_tag LOCUS_12910 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000403746.1:ABC transporter ATP-binding protein 807 2051 gene locus_tag LOCUS_12920 807 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 3164 2229 gene locus_tag LOCUS_12930 gene fba 3164 2229 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939420.1 protein_id gnl|my_center|LOCUS_12930 3379 4494 gene locus_tag LOCUS_12940 3379 4494 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654739.1 protein_id gnl|my_center|LOCUS_12940 4685 5701 gene locus_tag LOCUS_12950 gene gap 4685 5701 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025408.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence115 1147 212 gene locus_tag LOCUS_12960 1147 212 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 protein_id gnl|my_center|LOCUS_12960 2056 1253 gene locus_tag LOCUS_12970 gene soj 2056 1253 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_12970 4390 2360 gene locus_tag LOCUS_12980 gene ftsH 4390 2360 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243881.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence116 923 291 gene locus_tag LOCUS_12990 923 291 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891568.1 protein_id gnl|my_center|LOCUS_12990 1991 960 gene locus_tag LOCUS_13000 1991 960 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202288.1 protein_id gnl|my_center|LOCUS_13000 3556 1976 gene locus_tag LOCUS_13010 3556 1976 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861369.1 protein_id gnl|my_center|LOCUS_13010 3800 4357 gene locus_tag LOCUS_13020 3800 4357 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296332.1 protein_id gnl|my_center|LOCUS_13020 4509 5474 gene locus_tag LOCUS_13030 4509 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence117 <1 1463 gene locus_tag LOCUS_13040 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458920.1:cation-translocating P-type ATPase 1625 2716 gene locus_tag LOCUS_13050 1625 2716 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681108.1 protein_id gnl|my_center|LOCUS_13050 4184 2769 gene locus_tag LOCUS_13060 4184 2769 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_13060 <5627 4399 gene locus_tag LOCUS_13070 <5627 4399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044971578.1:ATP-dependent RNA helicase >Feature sequence118 2073 1810 gene locus_tag LOCUS_13080 gene rpsO 2073 1810 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_13080 3603 2242 gene locus_tag LOCUS_13090 3603 2242 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965569.1 protein_id gnl|my_center|LOCUS_13090 4227 3625 gene locus_tag LOCUS_13100 4227 3625 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460349.1 protein_id gnl|my_center|LOCUS_13100 <5620 4240 gene locus_tag LOCUS_13110 <5620 4240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003422921.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence119 1606 374 gene locus_tag LOCUS_13120 gene fabF 1606 374 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099549.1 protein_id gnl|my_center|LOCUS_13120 2923 2183 gene locus_tag LOCUS_13130 gene fabG 2923 2183 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911782.1 protein_id gnl|my_center|LOCUS_13130 3832 2996 gene locus_tag LOCUS_13140 gene fabD 3832 2996 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262535.1 protein_id gnl|my_center|LOCUS_13140 4761 3820 gene locus_tag LOCUS_13150 gene fabK 4761 3820 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_13150 5004 4777 gene locus_tag LOCUS_13160 5004 4777 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257836.1 protein_id gnl|my_center|LOCUS_13160 <5573 5021 gene locus_tag LOCUS_13170 <5573 5021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947123.1:ketoacyl-ACP synthase III >Feature sequence120 4453 737 gene locus_tag LOCUS_13180 4453 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 4646 5008 gene locus_tag LOCUS_13190 4646 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 5051 5476 gene locus_tag LOCUS_13200 5051 5476 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437529.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence121 432 1448 gene locus_tag LOCUS_13210 432 1448 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086852489.1 protein_id gnl|my_center|LOCUS_13210 1935 3248 gene locus_tag LOCUS_13220 1935 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 3272 4324 gene locus_tag LOCUS_13230 3272 4324 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775954.1 protein_id gnl|my_center|LOCUS_13230 4321 5208 gene locus_tag LOCUS_13240 gene araQ 4321 5208 CDS product arabinose ABC transporter permease AraQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229508.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence122 307 615 gene locus_tag LOCUS_13250 gene spoIIAA 307 615 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357811.1 protein_id gnl|my_center|LOCUS_13250 628 1077 gene locus_tag LOCUS_13260 gene spoIIAB 628 1077 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230452.1 protein_id gnl|my_center|LOCUS_13260 1067 1789 gene locus_tag LOCUS_13270 gene sigF 1067 1789 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000350729.1 protein_id gnl|my_center|LOCUS_13270 3352 1877 gene locus_tag LOCUS_13280 3352 1877 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_13280 3845 5401 gene locus_tag LOCUS_13290 3845 5401 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262174.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence123 1087 1920 gene locus_tag LOCUS_13300 1087 1920 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966383.1 protein_id gnl|my_center|LOCUS_13300 1896 2771 gene locus_tag LOCUS_13310 1896 2771 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_13310 2761 3609 gene locus_tag LOCUS_13320 2761 3609 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_13320 3635 4414 gene locus_tag LOCUS_13330 gene truA 3635 4414 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435654.1 protein_id gnl|my_center|LOCUS_13330 4448 5266 gene locus_tag LOCUS_13340 4448 5266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence124 979 434 gene locus_tag LOCUS_13350 979 434 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_13350 1731 982 gene locus_tag LOCUS_13360 1731 982 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_13360 2814 1744 gene locus_tag LOCUS_13370 2814 1744 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_13370 3420 3214 gene locus_tag LOCUS_13380 3420 3214 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545602.1 protein_id gnl|my_center|LOCUS_13380 4306 3398 gene locus_tag LOCUS_13390 4306 3398 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965994.1 protein_id gnl|my_center|LOCUS_13390 4519 5028 gene locus_tag LOCUS_13400 4519 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence125 1215 889 gene locus_tag LOCUS_13410 1215 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2156 1212 gene locus_tag LOCUS_13420 2156 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 3212 2832 gene locus_tag LOCUS_13430 3212 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3703 3212 gene locus_tag LOCUS_13440 3703 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4342 3755 gene locus_tag LOCUS_13450 4342 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 4635 4363 gene locus_tag LOCUS_13460 4635 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 5148 4639 gene locus_tag LOCUS_13470 5148 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 5426 5148 gene locus_tag LOCUS_13480 5426 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence126 <1 1757 gene locus_tag LOCUS_13490 <1 1757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068264.1:calcium-translocating P-type ATPase, PMCA-type 2073 2318 gene locus_tag LOCUS_13500 2073 2318 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_13500 2337 4040 gene locus_tag LOCUS_13510 2337 4040 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396717.1 protein_id gnl|my_center|LOCUS_13510 4040 5200 gene locus_tag LOCUS_13520 4040 5200 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence127 115 40 gene locus_tag LOCUS_t00180 115 40 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 766 930 gene locus_tag LOCUS_13530 766 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1098 1022 gene locus_tag LOCUS_t00190 1098 1022 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1806 1150 gene locus_tag LOCUS_13540 1806 1150 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963522.1 protein_id gnl|my_center|LOCUS_13540 2172 1945 gene locus_tag LOCUS_13550 2172 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938911.1 protein_id gnl|my_center|LOCUS_13550 3759 2236 gene locus_tag LOCUS_13560 gene gpmI 3759 2236 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938910.1 protein_id gnl|my_center|LOCUS_13560 4151 3759 gene locus_tag LOCUS_13570 gene rsfS 4151 3759 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938909.1 protein_id gnl|my_center|LOCUS_13570 4303 4995 gene locus_tag LOCUS_13580 4303 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5067 5142 gene locus_tag LOCUS_t00200 5067 5142 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence128 691 470 gene locus_tag LOCUS_13590 691 470 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 protein_id gnl|my_center|LOCUS_13590 908 983 gene locus_tag LOCUS_t00210 908 983 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1332 1940 gene locus_tag LOCUS_13600 1332 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 3401 2076 gene locus_tag LOCUS_13610 gene lysA 3401 2076 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000280659.1 protein_id gnl|my_center|LOCUS_13610 <5141 3582 gene locus_tag LOCUS_13620 <5141 3582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000421678.1:polyphosphate kinase >Feature sequence129 944 741 gene locus_tag LOCUS_13630 944 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1786 941 gene locus_tag LOCUS_13640 1786 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 2235 3548 gene locus_tag LOCUS_13650 2235 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3675 4943 gene locus_tag LOCUS_13660 3675 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence130 1 621 gene locus_tag LOCUS_13670 1 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 734 1867 gene locus_tag LOCUS_13680 734 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 1919 2977 gene locus_tag LOCUS_13690 1919 2977 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_13690 2980 3879 gene locus_tag LOCUS_13700 2980 3879 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259249.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence131 2394 577 gene locus_tag LOCUS_13710 2394 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 4849 2414 gene locus_tag LOCUS_13720 4849 2414 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964971.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence132 1315 611 gene locus_tag LOCUS_13730 1315 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2111 1332 gene locus_tag LOCUS_13740 2111 1332 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902529.1 protein_id gnl|my_center|LOCUS_13740 2727 2077 gene locus_tag LOCUS_13750 2727 2077 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_13750 3809 2754 gene locus_tag LOCUS_13760 gene rpoD 3809 2754 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_13760 <4963 3841 gene locus_tag LOCUS_13770 <4963 3841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009896376.1:DNA primase >Feature sequence133 757 671 gene locus_tag LOCUS_t00220 757 671 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1622 852 gene locus_tag LOCUS_13780 gene spo0A 1622 852 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393014.1 protein_id gnl|my_center|LOCUS_13780 2798 1881 gene locus_tag LOCUS_13790 2798 1881 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435793.1 protein_id gnl|my_center|LOCUS_13790 3522 2791 gene locus_tag LOCUS_13800 3522 2791 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429190.1 protein_id gnl|my_center|LOCUS_13800 <4928 3661 gene locus_tag LOCUS_13810 <4928 3661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986778.1:adenylosuccinate lyase >Feature sequence134 <1 1090 gene locus_tag LOCUS_13820 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939525.1:AMP-binding protein 2219 1221 gene locus_tag LOCUS_13830 2219 1221 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_13830 2773 2216 gene locus_tag LOCUS_13840 2773 2216 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392072.1 protein_id gnl|my_center|LOCUS_13840 4341 2827 gene locus_tag LOCUS_13850 4341 2827 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814147.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence135 1382 279 gene locus_tag LOCUS_13860 1382 279 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459186.1 protein_id gnl|my_center|LOCUS_13860 3216 1549 gene locus_tag LOCUS_13870 3216 1549 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461751.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence136 2998 191 gene locus_tag LOCUS_13880 2998 191 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948591.1 protein_id gnl|my_center|LOCUS_13880 3526 3011 gene locus_tag LOCUS_13890 3526 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3916 3734 gene locus_tag LOCUS_13900 3916 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 4676 3918 gene locus_tag LOCUS_13910 4676 3918 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826913.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence137 965 615 gene locus_tag LOCUS_13920 965 615 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421356.1 protein_id gnl|my_center|LOCUS_13920 2708 1203 gene locus_tag LOCUS_13930 2708 1203 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865220.1 protein_id gnl|my_center|LOCUS_13930 3333 2719 gene locus_tag LOCUS_13940 3333 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3879 3550 gene locus_tag LOCUS_13950 3879 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 <4742 3891 gene locus_tag LOCUS_13960 <4742 3891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244231.1:branched-chain amino acid aminotransferase >Feature sequence138 2385 1381 gene locus_tag LOCUS_13970 gene ilvC 2385 1381 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963418.1 protein_id gnl|my_center|LOCUS_13970 2629 3834 gene locus_tag LOCUS_13980 2629 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4417 3884 gene locus_tag LOCUS_13990 4417 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence139 366 1436 gene locus_tag LOCUS_14000 gene cas7e 366 1436 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674072.1 protein_id gnl|my_center|LOCUS_14000 1979 2110 gene locus_tag LOCUS_14010 1979 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 2125 2781 gene locus_tag LOCUS_14020 gene cas6e 2125 2781 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674074.1 protein_id gnl|my_center|LOCUS_14020 2774 3724 gene locus_tag LOCUS_14030 gene cas1e 2774 3724 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674075.1 protein_id gnl|my_center|LOCUS_14030 3721 4611 gene locus_tag LOCUS_14040 gene cas2e 3721 4611 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674076.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence140 <1 953 gene locus_tag LOCUS_14050 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009902789.1:cation-translocating P-type ATPase 1223 996 gene locus_tag LOCUS_14060 1223 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1520 3607 gene locus_tag LOCUS_14070 1520 3607 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_14070 >Feature sequence141 1669 461 gene locus_tag LOCUS_14080 gene spoVE 1669 461 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_14080 3017 1641 gene locus_tag LOCUS_14090 gene murD 3017 1641 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_14090 3980 3030 gene locus_tag LOCUS_14100 gene mraY 3980 3030 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_14100 <4620 3973 gene locus_tag LOCUS_14110 <4620 3973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000768129.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence142 774 505 gene locus_tag LOCUS_14120 774 505 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963800.1 protein_id gnl|my_center|LOCUS_14120 1331 771 gene locus_tag LOCUS_14130 1331 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2203 1349 gene locus_tag LOCUS_14140 2203 1349 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_14140 2842 2252 gene locus_tag LOCUS_14150 gene lepB 2842 2252 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_14150 2985 2839 gene locus_tag LOCUS_14160 2985 2839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 4575 3049 gene locus_tag LOCUS_14170 4575 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence143 147 1604 gene locus_tag LOCUS_14180 147 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1622 2584 gene locus_tag LOCUS_14190 1622 2584 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226273.1 protein_id gnl|my_center|LOCUS_14190 2597 3517 gene locus_tag LOCUS_14200 2597 3517 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286786.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence144 <1 671 gene locus_tag LOCUS_14210 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231897.1:polyribonucleotide nucleotidyltransferase 1327 785 gene locus_tag LOCUS_14220 1327 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1764 2264 gene locus_tag LOCUS_14230 1764 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2280 2837 gene locus_tag LOCUS_14240 2280 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2972 3604 gene locus_tag LOCUS_14250 2972 3604 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence145 1005 481 gene locus_tag LOCUS_14260 1005 481 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948983.1 protein_id gnl|my_center|LOCUS_14260 1542 1018 gene locus_tag LOCUS_14270 1542 1018 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545215.1 protein_id gnl|my_center|LOCUS_14270 2436 1597 gene locus_tag LOCUS_14280 2436 1597 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 protein_id gnl|my_center|LOCUS_14280 2602 3507 gene locus_tag LOCUS_14290 2602 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 3510 3857 gene locus_tag LOCUS_14300 gene rlmH 3510 3857 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028058.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14300 >Feature sequence146 631 813 gene locus_tag LOCUS_14310 631 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 942 1802 gene locus_tag LOCUS_14320 942 1802 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_14320 2611 2685 gene locus_tag LOCUS_t00230 2611 2685 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3036 3560 gene locus_tag LOCUS_14330 3036 3560 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949081.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence147 <1 1569 gene locus_tag LOCUS_14340 <1 1569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947977.1:CTP synthase 1566 2747 gene locus_tag LOCUS_14350 1566 2747 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_14350 2888 3466 gene locus_tag LOCUS_14360 2888 3466 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_14360 3463 3678 gene locus_tag LOCUS_14370 3463 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4107 4180 gene locus_tag LOCUS_t00240 4107 4180 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence148 636 1301 gene locus_tag LOCUS_14380 636 1301 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_14380 1298 2740 gene locus_tag LOCUS_14390 1298 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence149 1380 2207 gene locus_tag LOCUS_14400 1380 2207 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387901.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence150 572 2455 gene locus_tag LOCUS_14410 gene glgB 572 2455 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880434.1 protein_id gnl|my_center|LOCUS_14410 2551 3753 gene locus_tag LOCUS_14420 gene glgC 2551 3753 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057611.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence151 810 1985 gene locus_tag LOCUS_14430 810 1985 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048436.1 protein_id gnl|my_center|LOCUS_14430 1972 3507 gene locus_tag LOCUS_14440 1972 3507 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861896.1 protein_id gnl|my_center|LOCUS_14440 3973 4060 gene locus_tag LOCUS_t00250 3973 4060 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence152 1291 2970 gene locus_tag LOCUS_14450 1291 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence153 1058 714 gene locus_tag LOCUS_14460 gene rplS 1058 714 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_14460 1569 1207 gene locus_tag LOCUS_14470 1569 1207 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_14470 2150 1503 gene locus_tag LOCUS_14480 2150 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3023 2160 gene locus_tag LOCUS_14490 gene ylqF 3023 2160 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460442.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence154 1363 503 gene locus_tag LOCUS_14500 1363 503 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837508.1 protein_id gnl|my_center|LOCUS_14500 2245 1433 gene locus_tag LOCUS_14510 2245 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2620 3513 gene locus_tag LOCUS_14520 2620 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence155 1958 189 gene locus_tag LOCUS_14530 gene glmS 1958 189 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393728.1 protein_id gnl|my_center|LOCUS_14530 3257 1962 gene locus_tag LOCUS_14540 gene glmM 3257 1962 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860638.1 protein_id gnl|my_center|LOCUS_14540 <3857 3250 gene locus_tag LOCUS_14550 <3857 3250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966498.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence156 <1 767 gene locus_tag LOCUS_14560 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003644095.1:FAD:protein FMN transferase 764 1201 gene locus_tag LOCUS_14570 764 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1198 1716 gene locus_tag LOCUS_14580 1198 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1779 1870 gene locus_tag LOCUS_t00260 1779 1870 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2307 2894 gene locus_tag LOCUS_14590 2307 2894 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965241.1 protein_id gnl|my_center|LOCUS_14590 <3779 3076 gene locus_tag LOCUS_14600 <3779 3076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795587.1:alcohol dehydrogenase >Feature sequence157 1861 716 gene locus_tag LOCUS_14610 1861 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 2804 1992 gene locus_tag LOCUS_14620 2804 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 <3751 2828 gene locus_tag LOCUS_14630 <3751 2828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943723.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence158 708 229 gene locus_tag LOCUS_14640 708 229 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021653.1 protein_id gnl|my_center|LOCUS_14640 2618 834 gene locus_tag LOCUS_14650 2618 834 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_14650 2958 2755 gene locus_tag LOCUS_14660 2958 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence159 2714 942 gene locus_tag LOCUS_14670 gene pepF 2714 942 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944353.1 protein_id gnl|my_center|LOCUS_14670 <3692 2732 gene locus_tag LOCUS_14680 <3692 2732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989505.1:PFL family protein >Feature sequence160 380 580 gene locus_tag LOCUS_14690 380 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1206 661 gene locus_tag LOCUS_14700 1206 661 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000067042.1 protein_id gnl|my_center|LOCUS_14700 1910 1203 gene locus_tag LOCUS_14710 1910 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2072 2296 gene locus_tag LOCUS_14720 2072 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2415 2939 gene locus_tag LOCUS_14730 2415 2939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2964 3230 gene locus_tag LOCUS_14740 2964 3230 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428433.1 protein_id gnl|my_center|LOCUS_14740 3683 3327 gene locus_tag LOCUS_14750 3683 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence161 1116 397 gene locus_tag LOCUS_14760 1116 397 CDS product DUF1266 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787146.1 protein_id gnl|my_center|LOCUS_14760 2173 1337 gene locus_tag LOCUS_14770 2173 1337 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_14770 2481 2242 gene locus_tag LOCUS_14780 2481 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 <3605 2491 gene locus_tag LOCUS_14790 <3605 2491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002360293.1:ABC transporter ATP-binding protein >Feature sequence162 1290 412 gene locus_tag LOCUS_14800 1290 412 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283172.1 protein_id gnl|my_center|LOCUS_14800 2137 1382 gene locus_tag LOCUS_14810 2137 1382 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020462.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence163 1943 1584 gene locus_tag LOCUS_14820 1943 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2324 1959 gene locus_tag LOCUS_14830 2324 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence164 397 891 gene locus_tag LOCUS_14840 gene leuD 397 891 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_14840 905 1987 gene locus_tag LOCUS_14850 gene leuB 905 1987 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861060.1 protein_id gnl|my_center|LOCUS_14850 2269 2958 gene locus_tag LOCUS_14860 2269 2958 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_14860 3038 3361 gene locus_tag LOCUS_14870 3038 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence165 2750 1062 gene locus_tag LOCUS_14880 2750 1062 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922389.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence166 206 132 gene locus_tag LOCUS_t00270 206 132 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 316 240 gene locus_tag LOCUS_t00280 316 240 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 633 557 gene locus_tag LOCUS_t00290 633 557 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 932 2578 gene locus_tag LOCUS_14890 gene ilvB 932 2578 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_14890 2593 3111 gene locus_tag LOCUS_14900 gene ilvN 2593 3111 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence167 412 858 gene locus_tag LOCUS_14910 412 858 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_14910 873 2075 gene locus_tag LOCUS_14920 gene nifS 873 2075 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence168 2220 1417 gene locus_tag LOCUS_14930 2220 1417 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_14930 <3265 2564 gene locus_tag LOCUS_14940 <3265 2564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978530.1:alkaline phosphatase family protein >Feature sequence169 331 663 gene locus_tag LOCUS_14950 331 663 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_14950 780 998 gene locus_tag LOCUS_14960 780 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14960 1024 2979 gene locus_tag LOCUS_14970 1024 2979 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796600.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14970 3232 3104 gene locus_tag LOCUS_14980 3232 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence170 57 278 gene locus_tag LOCUS_14990 57 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 587 2629 gene locus_tag LOCUS_15000 587 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence171 <1 793 gene locus_tag LOCUS_15010 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001991958.1:FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO 816 1352 gene locus_tag LOCUS_15020 gene hslV 816 1352 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724001.1 protein_id gnl|my_center|LOCUS_15020 1434 2738 gene locus_tag LOCUS_15030 gene hslU 1434 2738 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245556.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence172 <1 700 gene locus_tag LOCUS_15040 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964641.1:mannonate dehydratase 697 1317 gene locus_tag LOCUS_15050 697 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1314 2144 gene locus_tag LOCUS_15060 1314 2144 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047578.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence173 1078 452 gene locus_tag LOCUS_15070 1078 452 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721280.1 protein_id gnl|my_center|LOCUS_15070 2599 1103 gene locus_tag LOCUS_15080 2599 1103 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence174 <1 1242 gene locus_tag LOCUS_15090 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926807.1:putative DNA modification/repair radical SAM protein 1239 1988 gene locus_tag LOCUS_15100 1239 1988 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943941.1 protein_id gnl|my_center|LOCUS_15100 2593 2030 gene locus_tag LOCUS_15110 2593 2030 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_15110 2874 2593 gene locus_tag LOCUS_15120 2874 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence175 91 1491 gene locus_tag LOCUS_15130 91 1491 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_15130 1625 2836 gene locus_tag LOCUS_15140 1625 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence176 >Feature sequence177 1920 49 gene locus_tag LOCUS_15150 gene mnmG 1920 49 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_15150 2858 2061 gene locus_tag LOCUS_15160 2858 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15160 >Feature sequence178 254 811 gene locus_tag LOCUS_15170 254 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 996 2093 gene locus_tag LOCUS_15180 gene prfB 996 2093 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181244843.1 protein_id gnl|my_center|LOCUS_15180 2102 2755 gene locus_tag LOCUS_15190 2102 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence179 954 1577 gene locus_tag LOCUS_15200 954 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence180 <1 1336 gene locus_tag LOCUS_15210 <1 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048241.1:glutamine-hydrolyzing GMP synthase 1439 2419 gene locus_tag LOCUS_15220 1439 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence181 62 2089 gene locus_tag LOCUS_15230 gene lysS 62 2089 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558598.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence182 <1 548 gene locus_tag LOCUS_15240 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461751.1:2-isopropylmalate synthase 1404 658 gene locus_tag LOCUS_15250 1404 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence183 30 1484 gene locus_tag LOCUS_15260 30 1484 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_15260 1924 2100 gene locus_tag LOCUS_15270 1924 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence184 1270 2136 gene locus_tag LOCUS_15280 1270 2136 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944146.1 protein_id gnl|my_center|LOCUS_15280 2552 2626 gene locus_tag LOCUS_t00300 2552 2626 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence185 772 245 gene locus_tag LOCUS_15290 772 245 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814019.1 protein_id gnl|my_center|LOCUS_15290 1339 803 gene locus_tag LOCUS_15300 1339 803 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404734.1 protein_id gnl|my_center|LOCUS_15300 1707 1798 gene locus_tag LOCUS_t00310 1707 1798 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2025 2315 gene locus_tag LOCUS_15310 2025 2315 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666876.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence186 150 1664 gene locus_tag LOCUS_15320 150 1664 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014017276.1 protein_id gnl|my_center|LOCUS_15320 1648 2307 gene locus_tag LOCUS_15330 gene upp 1648 2307 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence187 2449 392 gene locus_tag LOCUS_15340 2449 392 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964743.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence188 1365 367 gene locus_tag LOCUS_15350 1365 367 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858849.1 protein_id gnl|my_center|LOCUS_15350 2275 1682 gene locus_tag LOCUS_15360 gene recR 2275 1682 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence189 603 1118 gene locus_tag LOCUS_15370 gene pyrR 603 1118 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_15370 1231 1527 gene locus_tag LOCUS_15380 1231 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence190 538 2040 gene locus_tag LOCUS_15390 538 2040 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965898.1 protein_id gnl|my_center|LOCUS_15390