>Feature sequence001 481 951 gene locus_tag LOCUS_00010 481 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1241 2779 gene locus_tag LOCUS_00020 1241 2779 CDS product DUF853 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704217.1 protein_id gnl|my_center|LOCUS_00020 4902 2929 gene locus_tag LOCUS_00030 4902 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5610 4918 gene locus_tag LOCUS_00040 5610 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6154 5597 gene locus_tag LOCUS_00050 6154 5597 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_00050 8692 6470 gene locus_tag LOCUS_00060 8692 6470 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765057.1 protein_id gnl|my_center|LOCUS_00060 10022 8790 gene locus_tag LOCUS_00070 10022 8790 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788259.1 protein_id gnl|my_center|LOCUS_00070 10927 10106 gene locus_tag LOCUS_00080 gene dapF 10927 10106 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202959.1 protein_id gnl|my_center|LOCUS_00080 12272 10920 gene locus_tag LOCUS_00090 12272 10920 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763133.1 protein_id gnl|my_center|LOCUS_00090 16741 12302 gene locus_tag LOCUS_00100 gene gltB 16741 12302 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107318.1 protein_id gnl|my_center|LOCUS_00100 17122 18501 gene locus_tag LOCUS_00110 17122 18501 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_00110 18524 20137 gene locus_tag LOCUS_00120 18524 20137 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763175.1 protein_id gnl|my_center|LOCUS_00120 20118 21851 gene locus_tag LOCUS_00130 20118 21851 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765068.1 protein_id gnl|my_center|LOCUS_00130 22135 23820 gene locus_tag LOCUS_00140 gene asnB 22135 23820 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_00140 23884 24705 gene locus_tag LOCUS_00150 23884 24705 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_00150 25673 24972 gene locus_tag LOCUS_00160 25673 24972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 26380 25922 gene locus_tag LOCUS_00170 26380 25922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 >Feature sequence002 2614 206 gene locus_tag LOCUS_00180 2614 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 4746 2791 gene locus_tag LOCUS_00190 4746 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764386.1 protein_id gnl|my_center|LOCUS_00190 4847 5047 gene locus_tag LOCUS_00200 4847 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 8218 4967 gene locus_tag LOCUS_00210 8218 4967 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764385.1 protein_id gnl|my_center|LOCUS_00210 10140 8251 gene locus_tag LOCUS_00220 10140 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764384.1 protein_id gnl|my_center|LOCUS_00220 11991 10156 gene locus_tag LOCUS_00230 11991 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 13660 12065 gene locus_tag LOCUS_00240 13660 12065 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840505.1 protein_id gnl|my_center|LOCUS_00240 17006 13689 gene locus_tag LOCUS_00250 17006 13689 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764381.1 protein_id gnl|my_center|LOCUS_00250 19528 17042 gene locus_tag LOCUS_00260 19528 17042 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109148.1 protein_id gnl|my_center|LOCUS_00260 20126 19911 gene locus_tag LOCUS_00270 20126 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 22420 20354 gene locus_tag LOCUS_00280 22420 20354 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_00280 25724 22497 gene locus_tag LOCUS_00290 25724 22497 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109108.1 protein_id gnl|my_center|LOCUS_00290 >Feature sequence003 70 249 gene locus_tag LOCUS_00300 70 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 1440 160 gene locus_tag LOCUS_00310 gene hemL 1440 160 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140075.1 protein_id gnl|my_center|LOCUS_00310 2402 1431 gene locus_tag LOCUS_00320 gene hemB 2402 1431 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_00320 3024 2416 gene locus_tag LOCUS_00330 3024 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 4547 3021 gene locus_tag LOCUS_00340 4547 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 5431 4547 gene locus_tag LOCUS_00350 gene hemE 5431 4547 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957475.1 protein_id gnl|my_center|LOCUS_00350 6946 5573 gene locus_tag LOCUS_00360 gene hemG 6946 5573 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202640.1 protein_id gnl|my_center|LOCUS_00360 8291 6954 gene locus_tag LOCUS_00370 gene hemN 8291 6954 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202641.1 protein_id gnl|my_center|LOCUS_00370 9203 8472 gene locus_tag LOCUS_00380 gene fabG 9203 8472 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_00380 10959 9217 gene locus_tag LOCUS_00390 10959 9217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 12551 11115 gene locus_tag LOCUS_00400 12551 11115 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107572.1 protein_id gnl|my_center|LOCUS_00400 15003 12538 gene locus_tag LOCUS_00410 15003 12538 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_00410 15308 16471 gene locus_tag LOCUS_00420 15308 16471 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461650.1 protein_id gnl|my_center|LOCUS_00420 16624 17568 gene locus_tag LOCUS_00430 16624 17568 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762907.1 protein_id gnl|my_center|LOCUS_00430 17559 18173 gene locus_tag LOCUS_00440 gene nadD 17559 18173 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_00440 18330 19811 gene locus_tag LOCUS_00450 18330 19811 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_00450 19927 21243 gene locus_tag LOCUS_00460 gene xylA 19927 21243 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_00460 22309 21254 gene locus_tag LOCUS_00470 gene aroB 22309 21254 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784805.1 protein_id gnl|my_center|LOCUS_00470 23424 22510 gene locus_tag LOCUS_00480 23424 22510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 23702 24874 gene locus_tag LOCUS_00490 23702 24874 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_00490 >Feature sequence004 88 1653 gene locus_tag LOCUS_00500 88 1653 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763364.1 protein_id gnl|my_center|LOCUS_00500 1699 1845 gene locus_tag LOCUS_00510 1699 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 1842 2249 gene locus_tag LOCUS_00520 1842 2249 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_00520 2382 3176 gene locus_tag LOCUS_00530 2382 3176 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767986.1 protein_id gnl|my_center|LOCUS_00530 3208 4668 gene locus_tag LOCUS_00540 3208 4668 CDS product DUF4270 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202229.1 protein_id gnl|my_center|LOCUS_00540 4765 6735 gene locus_tag LOCUS_00550 gene thrS 4765 6735 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_00550 6811 8091 gene locus_tag LOCUS_00560 6811 8091 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_00560 8171 8962 gene locus_tag LOCUS_00570 gene map 8171 8962 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202916.1 protein_id gnl|my_center|LOCUS_00570 9081 10070 gene locus_tag LOCUS_00580 gene tsaD 9081 10070 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787941.1 protein_id gnl|my_center|LOCUS_00580 10080 10613 gene locus_tag LOCUS_00590 10080 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 10827 12584 gene locus_tag LOCUS_00600 gene ilvD 10827 12584 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203429.1 protein_id gnl|my_center|LOCUS_00600 12593 14302 gene locus_tag LOCUS_00610 gene ilvB 12593 14302 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761034.1 protein_id gnl|my_center|LOCUS_00610 14305 14856 gene locus_tag LOCUS_00620 gene ilvN 14305 14856 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_00620 16315 14966 gene locus_tag LOCUS_00630 16315 14966 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_00630 17519 16341 gene locus_tag LOCUS_00640 gene dnaJ 17519 16341 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_00640 18165 17557 gene locus_tag LOCUS_00650 18165 17557 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800555.1 protein_id gnl|my_center|LOCUS_00650 19854 18241 gene locus_tag LOCUS_00660 19854 18241 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763401.1 protein_id gnl|my_center|LOCUS_00660 20468 19860 gene locus_tag LOCUS_00670 20468 19860 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_00670 23841 20488 gene locus_tag LOCUS_00680 23841 20488 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783669.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence005 1166 24 gene locus_tag LOCUS_00690 1166 24 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768517.1 protein_id gnl|my_center|LOCUS_00690 2264 1206 gene locus_tag LOCUS_00700 2264 1206 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767048.1 protein_id gnl|my_center|LOCUS_00700 5789 2355 gene locus_tag LOCUS_00710 gene mfd 5789 2355 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766199.1 protein_id gnl|my_center|LOCUS_00710 5991 6752 gene locus_tag LOCUS_00720 5991 6752 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_00720 8211 6685 gene locus_tag LOCUS_00730 8211 6685 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_00730 8301 8744 gene locus_tag LOCUS_00740 8301 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 8751 9548 gene locus_tag LOCUS_00750 8751 9548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 9548 10108 gene locus_tag LOCUS_00760 9548 10108 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760894.1 protein_id gnl|my_center|LOCUS_00760 10828 10217 gene locus_tag LOCUS_00770 10828 10217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 11363 10962 gene locus_tag LOCUS_00780 11363 10962 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108802.1 protein_id gnl|my_center|LOCUS_00780 12418 11357 gene locus_tag LOCUS_00790 12418 11357 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_00790 12554 15058 gene locus_tag LOCUS_00800 gene rhgW 12554 15058 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_00800 15688 15167 gene locus_tag LOCUS_00810 15688 15167 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765423.1 protein_id gnl|my_center|LOCUS_00810 17102 15789 gene locus_tag LOCUS_00820 17102 15789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 17719 17099 gene locus_tag LOCUS_00830 17719 17099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 17887 18951 gene locus_tag LOCUS_00840 17887 18951 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_00840 18955 20067 gene locus_tag LOCUS_00850 gene meaB 18955 20067 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 protein_id gnl|my_center|LOCUS_00850 20095 22773 gene locus_tag LOCUS_00860 20095 22773 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_00860 22803 23573 gene locus_tag LOCUS_00870 22803 23573 CDS product DUF3316 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801667.1 protein_id gnl|my_center|LOCUS_00870 >Feature sequence006 779 1885 gene locus_tag LOCUS_00880 779 1885 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_00880 2402 1953 gene locus_tag LOCUS_00890 2402 1953 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546643.1 protein_id gnl|my_center|LOCUS_00890 3853 2501 gene locus_tag LOCUS_00900 3853 2501 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555756.1 protein_id gnl|my_center|LOCUS_00900 5262 3925 gene locus_tag LOCUS_00910 gene ftsZ 5262 3925 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783997.1 protein_id gnl|my_center|LOCUS_00910 6756 5299 gene locus_tag LOCUS_00920 gene ftsA 6756 5299 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783999.1 protein_id gnl|my_center|LOCUS_00920 7715 6759 gene locus_tag LOCUS_00930 7715 6759 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_00930 9101 7737 gene locus_tag LOCUS_00940 gene murC 9101 7737 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_00940 10245 9130 gene locus_tag LOCUS_00950 gene murG 10245 9130 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_00950 11549 10245 gene locus_tag LOCUS_00960 11549 10245 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784004.1 protein_id gnl|my_center|LOCUS_00960 13013 11667 gene locus_tag LOCUS_00970 gene murD 13013 11667 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010991956.1 protein_id gnl|my_center|LOCUS_00970 14519 13251 gene locus_tag LOCUS_00980 gene mraY 14519 13251 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796732.1 protein_id gnl|my_center|LOCUS_00980 16232 14778 gene locus_tag LOCUS_00990 16232 14778 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_00990 18468 16297 gene locus_tag LOCUS_01000 18468 16297 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108840.1 protein_id gnl|my_center|LOCUS_01000 19245 18637 gene locus_tag LOCUS_01010 19245 18637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 20166 19258 gene locus_tag LOCUS_01020 gene rsmH 20166 19258 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_01020 20737 20288 gene locus_tag LOCUS_01030 gene mraZ 20737 20288 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_01030 20959 22458 gene locus_tag LOCUS_01040 gene gpmI 20959 22458 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783975.1 protein_id gnl|my_center|LOCUS_01040 >Feature sequence007 550 1587 gene locus_tag LOCUS_01050 550 1587 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109063.1 protein_id gnl|my_center|LOCUS_01050 1584 5492 gene locus_tag LOCUS_01060 1584 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 5682 6617 gene locus_tag LOCUS_01070 gene nadA 5682 6617 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762783.1 protein_id gnl|my_center|LOCUS_01070 6830 7897 gene locus_tag LOCUS_01080 6830 7897 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202287.1 protein_id gnl|my_center|LOCUS_01080 8275 8553 gene locus_tag LOCUS_01090 gene vapD 8275 8553 CDS product endoribonuclease VapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271050.1 protein_id gnl|my_center|LOCUS_01090 8872 9081 gene locus_tag LOCUS_01100 8872 9081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 9111 10598 gene locus_tag LOCUS_01110 gene cysS 9111 10598 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_01110 10621 10776 gene locus_tag LOCUS_01120 10621 10776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 10923 11912 gene locus_tag LOCUS_01130 10923 11912 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_01130 11924 12985 gene locus_tag LOCUS_01140 11924 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 13008 14261 gene locus_tag LOCUS_01150 13008 14261 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108940.1 protein_id gnl|my_center|LOCUS_01150 14267 14962 gene locus_tag LOCUS_01160 14267 14962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 15049 16341 gene locus_tag LOCUS_01170 15049 16341 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_01170 16411 16833 gene locus_tag LOCUS_01180 16411 16833 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_01180 16850 20887 gene locus_tag LOCUS_01190 16850 20887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 20974 21903 gene locus_tag LOCUS_01200 20974 21903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 >Feature sequence008 338 1351 gene locus_tag LOCUS_01210 gene dusB 338 1351 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108618.1 protein_id gnl|my_center|LOCUS_01210 1918 1298 gene locus_tag LOCUS_01220 1918 1298 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_01220 3202 1937 gene locus_tag LOCUS_01230 3202 1937 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_01230 4944 3658 gene locus_tag LOCUS_01240 gene sufD 4944 3658 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201910.1 protein_id gnl|my_center|LOCUS_01240 5488 5174 gene locus_tag LOCUS_01250 5488 5174 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764355.1 protein_id gnl|my_center|LOCUS_01250 6360 5614 gene locus_tag LOCUS_01260 gene sufC 6360 5614 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_01260 7608 6469 gene locus_tag LOCUS_01270 7608 6469 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107381.1 protein_id gnl|my_center|LOCUS_01270 8333 7935 gene locus_tag LOCUS_01280 8333 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 10030 8576 gene locus_tag LOCUS_01290 gene sufB 10030 8576 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783924.1 protein_id gnl|my_center|LOCUS_01290 10379 10206 gene locus_tag LOCUS_01300 10379 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 15903 10396 gene locus_tag LOCUS_01310 15903 10396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 16720 15992 gene locus_tag LOCUS_01320 16720 15992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 16984 18099 gene locus_tag LOCUS_01330 16984 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 18359 19312 gene locus_tag LOCUS_01340 18359 19312 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_01340 19318 20451 gene locus_tag LOCUS_01350 gene dprA 19318 20451 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence009 79 309 gene locus_tag LOCUS_01360 79 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 443 889 gene locus_tag LOCUS_01370 443 889 CDS product D-Ala-D-Ala carboxypeptidase family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793703.1 protein_id gnl|my_center|LOCUS_01370 1130 1561 gene locus_tag LOCUS_01380 1130 1561 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107835.1 protein_id gnl|my_center|LOCUS_01380 4828 1913 gene locus_tag LOCUS_01390 gene leuS 4828 1913 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_01390 7617 4888 gene locus_tag LOCUS_01400 gene mutS 7617 4888 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_01400 8541 7657 gene locus_tag LOCUS_01410 gene lgt 8541 7657 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108644.1 protein_id gnl|my_center|LOCUS_01410 9714 8614 gene locus_tag LOCUS_01420 gene ychF 9714 8614 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_01420 10706 9777 gene locus_tag LOCUS_01430 10706 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 11682 10720 gene locus_tag LOCUS_01440 gene metF 11682 10720 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766920.1 protein_id gnl|my_center|LOCUS_01440 15960 11740 gene locus_tag LOCUS_01450 gene metH 15960 11740 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107153.1 protein_id gnl|my_center|LOCUS_01450 18462 16282 gene locus_tag LOCUS_01460 18462 16282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 20372 18621 gene locus_tag LOCUS_01470 20372 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence010 75 812 gene locus_tag LOCUS_01480 75 812 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761252.1 protein_id gnl|my_center|LOCUS_01480 1004 3703 gene locus_tag LOCUS_01490 1004 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 3807 5573 gene locus_tag LOCUS_01500 3807 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 5643 7700 gene locus_tag LOCUS_01510 5643 7700 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202217.1 protein_id gnl|my_center|LOCUS_01510 7770 8204 gene locus_tag LOCUS_01520 7770 8204 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_01520 8308 9255 gene locus_tag LOCUS_01530 8308 9255 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841461.1 protein_id gnl|my_center|LOCUS_01530 10451 9249 gene locus_tag LOCUS_01540 10451 9249 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815394.1 protein_id gnl|my_center|LOCUS_01540 11871 10468 gene locus_tag LOCUS_01550 11871 10468 CDS product glycoside hydrolase family 28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109132.1 protein_id gnl|my_center|LOCUS_01550 12417 15476 gene locus_tag LOCUS_01560 12417 15476 CDS product DUF4982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109155.1 protein_id gnl|my_center|LOCUS_01560 15872 18661 gene locus_tag LOCUS_01570 15872 18661 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_01570 18654 19670 gene locus_tag LOCUS_01580 18654 19670 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946819.1 protein_id gnl|my_center|LOCUS_01580 19675 20199 gene locus_tag LOCUS_01590 19675 20199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 >Feature sequence011 1542 685 gene locus_tag LOCUS_01600 1542 685 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964447.1 protein_id gnl|my_center|LOCUS_01600 1778 1539 gene locus_tag LOCUS_01610 1778 1539 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762818.1 protein_id gnl|my_center|LOCUS_01610 2706 1849 gene locus_tag LOCUS_01620 2706 1849 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_01620 2936 3388 gene locus_tag LOCUS_01630 gene dtd 2936 3388 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_01630 3906 4154 gene locus_tag LOCUS_01640 3906 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4213 5151 gene locus_tag LOCUS_01650 4213 5151 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202434.1 protein_id gnl|my_center|LOCUS_01650 5144 5908 gene locus_tag LOCUS_01660 gene lptB 5144 5908 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_01660 5953 7041 gene locus_tag LOCUS_01670 5953 7041 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_01670 7100 8254 gene locus_tag LOCUS_01680 7100 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_01680 10236 8338 gene locus_tag LOCUS_01690 10236 8338 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203426.1 protein_id gnl|my_center|LOCUS_01690 11270 10239 gene locus_tag LOCUS_01700 11270 10239 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_01700 11513 13474 gene locus_tag LOCUS_01710 11513 13474 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761752.1 protein_id gnl|my_center|LOCUS_01710 13570 14076 gene locus_tag LOCUS_01720 13570 14076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 16454 14814 gene locus_tag LOCUS_01730 16454 14814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 17329 16454 gene locus_tag LOCUS_01740 17329 16454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 19090 17372 gene locus_tag LOCUS_01750 19090 17372 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_01750 19559 19122 gene locus_tag LOCUS_01760 gene dut 19559 19122 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_01760 >Feature sequence012 1440 721 gene locus_tag LOCUS_01770 1440 721 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_01770 3121 1592 gene locus_tag LOCUS_01780 3121 1592 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790953.1 protein_id gnl|my_center|LOCUS_01780 4368 3934 gene locus_tag LOCUS_01790 4368 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 5290 4760 gene locus_tag LOCUS_01800 5290 4760 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787716.1 protein_id gnl|my_center|LOCUS_01800 6456 5287 gene locus_tag LOCUS_01810 6456 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 6611 7414 gene locus_tag LOCUS_01820 6611 7414 CDS product DUF4738 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787724.1 protein_id gnl|my_center|LOCUS_01820 7430 9388 gene locus_tag LOCUS_01830 7430 9388 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769535.1 protein_id gnl|my_center|LOCUS_01830 9385 10215 gene locus_tag LOCUS_01840 9385 10215 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784896.1 protein_id gnl|my_center|LOCUS_01840 10202 11197 gene locus_tag LOCUS_01850 10202 11197 CDS product DUF4435 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784898.1 protein_id gnl|my_center|LOCUS_01850 11184 12158 gene locus_tag LOCUS_01860 11184 12158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 12293 13012 gene locus_tag LOCUS_01870 12293 13012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 13018 14598 gene locus_tag LOCUS_01880 13018 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 14620 15021 gene locus_tag LOCUS_01890 gene csm2 14620 15021 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256464.1 protein_id gnl|my_center|LOCUS_01890 15034 15711 gene locus_tag LOCUS_01900 gene csm3 15034 15711 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_01900 15698 16711 gene locus_tag LOCUS_01910 gene csm4 15698 16711 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021930.1 protein_id gnl|my_center|LOCUS_01910 16722 18377 gene locus_tag LOCUS_01920 16722 18377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 18567 19455 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttctacatcatttccattacaacaaggattaaaac >Feature sequence013 5622 316 gene locus_tag LOCUS_01930 5622 316 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072066367.1 protein_id gnl|my_center|LOCUS_01930 6790 5690 gene locus_tag LOCUS_01940 6790 5690 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764152.1 protein_id gnl|my_center|LOCUS_01940 7081 6881 gene locus_tag LOCUS_01950 7081 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 8351 7092 gene locus_tag LOCUS_01960 8351 7092 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203417.1 protein_id gnl|my_center|LOCUS_01960 10549 8366 gene locus_tag LOCUS_01970 gene recQ 10549 8366 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_01970 11784 10570 gene locus_tag LOCUS_01980 gene clpX 11784 10570 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_01980 12660 11986 gene locus_tag LOCUS_01990 gene clpP 12660 11986 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_01990 14233 12677 gene locus_tag LOCUS_02000 14233 12677 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_02000 15182 14523 gene locus_tag LOCUS_02010 15182 14523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 16242 15214 gene locus_tag LOCUS_02020 16242 15214 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_02020 16943 16377 gene locus_tag LOCUS_02030 16943 16377 CDS product DUF6048 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812917.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02030 17301 16894 gene locus_tag LOCUS_02040 17301 16894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 18410 17451 gene locus_tag LOCUS_02050 18410 17451 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_02050 18994 18449 gene locus_tag LOCUS_02060 18994 18449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 >Feature sequence014 <1 952 gene locus_tag LOCUS_02070 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762581.1:aspartate-semialdehyde dehydrogenase 2330 1026 gene locus_tag LOCUS_02080 2330 1026 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303078.1 protein_id gnl|my_center|LOCUS_02080 4353 2395 gene locus_tag LOCUS_02090 4353 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 6959 4518 gene locus_tag LOCUS_02100 6959 4518 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767247.1 protein_id gnl|my_center|LOCUS_02100 8022 7015 gene locus_tag LOCUS_02110 8022 7015 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760929.1 protein_id gnl|my_center|LOCUS_02110 8152 8934 gene locus_tag LOCUS_02120 gene rsmA 8152 8934 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_02120 8980 9570 gene locus_tag LOCUS_02130 8980 9570 CDS product DUF4923 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765853.1 protein_id gnl|my_center|LOCUS_02130 11801 9813 gene locus_tag LOCUS_02140 11801 9813 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767043.1 protein_id gnl|my_center|LOCUS_02140 12314 11823 gene locus_tag LOCUS_02150 12314 11823 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766460.1 protein_id gnl|my_center|LOCUS_02150 14216 12327 gene locus_tag LOCUS_02160 gene mutL 14216 12327 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_02160 15855 14284 gene locus_tag LOCUS_02170 15855 14284 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_02170 17537 16152 gene locus_tag LOCUS_02180 17537 16152 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760775.1 protein_id gnl|my_center|LOCUS_02180 18967 17546 gene locus_tag LOCUS_02190 18967 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence015 1594 146 gene locus_tag LOCUS_02200 1594 146 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764329.1 protein_id gnl|my_center|LOCUS_02200 3118 1811 gene locus_tag LOCUS_02210 gene eno 3118 1811 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_02210 4863 3241 gene locus_tag LOCUS_02220 4863 3241 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813403.1 protein_id gnl|my_center|LOCUS_02220 5347 4886 gene locus_tag LOCUS_02230 gene ispF 5347 4886 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764145.1 protein_id gnl|my_center|LOCUS_02230 6099 5359 gene locus_tag LOCUS_02240 6099 5359 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_02240 6442 6981 gene locus_tag LOCUS_02250 6442 6981 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109023.1 protein_id gnl|my_center|LOCUS_02250 7078 8421 gene locus_tag LOCUS_02260 7078 8421 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100232.1 protein_id gnl|my_center|LOCUS_02260 8351 9103 gene locus_tag LOCUS_02270 gene tpiA 8351 9103 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791115.1 protein_id gnl|my_center|LOCUS_02270 9259 9915 gene locus_tag LOCUS_02280 9259 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 9999 10787 gene locus_tag LOCUS_02290 9999 10787 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963545.1 protein_id gnl|my_center|LOCUS_02290 10791 11210 gene locus_tag LOCUS_02300 10791 11210 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795574.1 protein_id gnl|my_center|LOCUS_02300 11239 12108 gene locus_tag LOCUS_02310 11239 12108 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_02310 12105 14126 gene locus_tag LOCUS_02320 12105 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 14132 15010 gene locus_tag LOCUS_02330 14132 15010 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 protein_id gnl|my_center|LOCUS_02330 15007 15984 gene locus_tag LOCUS_02340 15007 15984 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107643.1 protein_id gnl|my_center|LOCUS_02340 16788 15934 gene locus_tag LOCUS_02350 16788 15934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 17831 16785 gene locus_tag LOCUS_02360 17831 16785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 18930 17824 gene locus_tag LOCUS_02370 18930 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 >Feature sequence016 1389 196 gene locus_tag LOCUS_02380 1389 196 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_02380 3479 1566 gene locus_tag LOCUS_02390 3479 1566 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763745.1 protein_id gnl|my_center|LOCUS_02390 3661 3476 gene locus_tag LOCUS_02400 3661 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 5534 4263 gene locus_tag LOCUS_02410 5534 4263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6980 5628 gene locus_tag LOCUS_02420 6980 5628 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109152.1 protein_id gnl|my_center|LOCUS_02420 7980 7546 gene locus_tag LOCUS_02430 7980 7546 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_02430 10488 8020 gene locus_tag LOCUS_02440 10488 8020 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_02440 11246 10596 gene locus_tag LOCUS_02450 11246 10596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 12207 11509 gene locus_tag LOCUS_02460 12207 11509 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784739.1 protein_id gnl|my_center|LOCUS_02460 12423 16283 gene locus_tag LOCUS_02470 gene dnaE 12423 16283 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108183.1 protein_id gnl|my_center|LOCUS_02470 16315 17289 gene locus_tag LOCUS_02480 16315 17289 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851196.1 protein_id gnl|my_center|LOCUS_02480 17318 17779 gene locus_tag LOCUS_02490 gene tagD 17318 17779 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880882.1 protein_id gnl|my_center|LOCUS_02490 17787 18482 gene locus_tag LOCUS_02500 gene fabG 17787 18482 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694436.1 protein_id gnl|my_center|LOCUS_02500 >Feature sequence017 298 18576 gene locus_tag LOCUS_02510 298 18576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence018 <1 664 gene locus_tag LOCUS_02520 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005780311.1:NADH peroxidase 767 2029 gene locus_tag LOCUS_02530 767 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2791 2177 gene locus_tag LOCUS_02540 2791 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 4698 2788 gene locus_tag LOCUS_02550 4698 2788 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107261.1 protein_id gnl|my_center|LOCUS_02550 5327 4764 gene locus_tag LOCUS_02560 gene def 5327 4764 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786565.1 protein_id gnl|my_center|LOCUS_02560 5748 5332 gene locus_tag LOCUS_02570 gene ruvX 5748 5332 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_02570 6415 5753 gene locus_tag LOCUS_02580 6415 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 6601 6849 gene locus_tag LOCUS_02590 6601 6849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 6881 7288 gene locus_tag LOCUS_02600 6881 7288 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786515.1 protein_id gnl|my_center|LOCUS_02600 7227 7559 gene locus_tag LOCUS_02610 7227 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 8118 9128 gene locus_tag LOCUS_02620 8118 9128 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788563.1 protein_id gnl|my_center|LOCUS_02620 9152 9772 gene locus_tag LOCUS_02630 gene rsmG 9152 9772 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_02630 9799 10440 gene locus_tag LOCUS_02640 9799 10440 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763490.1 protein_id gnl|my_center|LOCUS_02640 10447 11007 gene locus_tag LOCUS_02650 gene ruvC 10447 11007 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199350787.1 protein_id gnl|my_center|LOCUS_02650 11037 12485 gene locus_tag LOCUS_02660 11037 12485 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107930.1 protein_id gnl|my_center|LOCUS_02660 12482 13729 gene locus_tag LOCUS_02670 12482 13729 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_02670 14611 13814 gene locus_tag LOCUS_02680 14611 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 15237 14647 gene locus_tag LOCUS_02690 15237 14647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 16674 15295 gene locus_tag LOCUS_02700 gene hisS 16674 15295 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_02700 17946 16675 gene locus_tag LOCUS_02710 17946 16675 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763215.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence019 <1 546 gene locus_tag LOCUS_02720 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787470.1:DUF4301 family protein 2894 702 gene locus_tag LOCUS_02730 2894 702 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787468.1 protein_id gnl|my_center|LOCUS_02730 3283 2891 gene locus_tag LOCUS_02740 3283 2891 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763504.1 protein_id gnl|my_center|LOCUS_02740 4136 3333 gene locus_tag LOCUS_02750 4136 3333 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787710.1 protein_id gnl|my_center|LOCUS_02750 4232 7474 gene locus_tag LOCUS_02760 4232 7474 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107599.1 protein_id gnl|my_center|LOCUS_02760 7471 10290 gene locus_tag LOCUS_02770 7471 10290 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202754.1 protein_id gnl|my_center|LOCUS_02770 12332 10287 gene locus_tag LOCUS_02780 12332 10287 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794862.1 protein_id gnl|my_center|LOCUS_02780 13458 12319 gene locus_tag LOCUS_02790 13458 12319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 14684 13461 gene locus_tag LOCUS_02800 14684 13461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 15943 14804 gene locus_tag LOCUS_02810 gene lysA 15943 14804 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_02810 17258 15945 gene locus_tag LOCUS_02820 17258 15945 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764912.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence020 62 1009 gene locus_tag LOCUS_02830 62 1009 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_02830 2962 1022 gene locus_tag LOCUS_02840 2962 1022 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_02840 5058 3013 gene locus_tag LOCUS_02850 5058 3013 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_02850 6035 5169 gene locus_tag LOCUS_02860 6035 5169 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_02860 8135 6168 gene locus_tag LOCUS_02870 gene ftsH 8135 6168 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_02870 8668 8306 gene locus_tag LOCUS_02880 gene rsfS 8668 8306 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764242.1 protein_id gnl|my_center|LOCUS_02880 10629 9304 gene locus_tag LOCUS_02890 10629 9304 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107343.1 protein_id gnl|my_center|LOCUS_02890 13347 10795 gene locus_tag LOCUS_02900 13347 10795 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_02900 14856 13687 gene locus_tag LOCUS_02910 14856 13687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109012.1 protein_id gnl|my_center|LOCUS_02910 16039 14900 gene locus_tag LOCUS_02920 16039 14900 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791708.1 protein_id gnl|my_center|LOCUS_02920 17028 16039 gene locus_tag LOCUS_02930 17028 16039 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799152.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence021 73 768 gene locus_tag LOCUS_02940 73 768 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987083.1 protein_id gnl|my_center|LOCUS_02940 937 1401 gene locus_tag LOCUS_02950 gene greA 937 1401 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_02950 1408 2070 gene locus_tag LOCUS_02960 1408 2070 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010537055.1 protein_id gnl|my_center|LOCUS_02960 2071 3183 gene locus_tag LOCUS_02970 2071 3183 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_02970 3261 3656 gene locus_tag LOCUS_02980 3261 3656 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948189.1 protein_id gnl|my_center|LOCUS_02980 3670 4866 gene locus_tag LOCUS_02990 gene coaBC 3670 4866 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861611.1 protein_id gnl|my_center|LOCUS_02990 4845 5609 gene locus_tag LOCUS_03000 4845 5609 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_03000 5613 6389 gene locus_tag LOCUS_03010 5613 6389 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_03010 6428 7978 gene locus_tag LOCUS_03020 6428 7978 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_03020 7980 8828 gene locus_tag LOCUS_03030 gene prmC 7980 8828 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766986.1 protein_id gnl|my_center|LOCUS_03030 8936 9805 gene locus_tag LOCUS_03040 8936 9805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 10362 9835 gene locus_tag LOCUS_03050 10362 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03050 10489 12072 gene locus_tag LOCUS_03060 10489 12072 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202072.1 protein_id gnl|my_center|LOCUS_03060 12158 14218 gene locus_tag LOCUS_03070 gene htpG 12158 14218 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 protein_id gnl|my_center|LOCUS_03070 14328 15554 gene locus_tag LOCUS_03080 14328 15554 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence022 3720 736 gene locus_tag LOCUS_03090 3720 736 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_03090 4470 3841 gene locus_tag LOCUS_03100 4470 3841 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_03100 5198 4716 gene locus_tag LOCUS_03110 5198 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5548 5201 gene locus_tag LOCUS_03120 5548 5201 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788198.1 protein_id gnl|my_center|LOCUS_03120 6419 5613 gene locus_tag LOCUS_03130 gene bamD 6419 5613 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763159.1 protein_id gnl|my_center|LOCUS_03130 6573 8597 gene locus_tag LOCUS_03140 gene uvrB 6573 8597 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763156.1 protein_id gnl|my_center|LOCUS_03140 8609 9307 gene locus_tag LOCUS_03150 8609 9307 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692148.1 protein_id gnl|my_center|LOCUS_03150 10139 11116 gene locus_tag LOCUS_03160 gene trpD 10139 11116 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763093.1 protein_id gnl|my_center|LOCUS_03160 11119 11910 gene locus_tag LOCUS_03170 gene trpC 11119 11910 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_03170 12058 12741 gene locus_tag LOCUS_03180 12058 12741 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_03180 12863 13639 gene locus_tag LOCUS_03190 gene trpA 12863 13639 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765046.1 protein_id gnl|my_center|LOCUS_03190 13793 14986 gene locus_tag LOCUS_03200 gene trpB 13793 14986 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788278.1 protein_id gnl|my_center|LOCUS_03200 15197 16606 gene locus_tag LOCUS_03210 15197 16606 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788280.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence023 1073 426 gene locus_tag LOCUS_03220 1073 426 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066430.1 protein_id gnl|my_center|LOCUS_03220 2445 2909 gene locus_tag LOCUS_03230 2445 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 2848 4167 gene locus_tag LOCUS_03240 2848 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4184 5110 gene locus_tag LOCUS_03250 4184 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 5475 6083 gene locus_tag LOCUS_03260 5475 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6877 7554 gene locus_tag LOCUS_03270 6877 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 7670 8149 gene locus_tag LOCUS_03280 7670 8149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 8209 9051 gene locus_tag LOCUS_03290 8209 9051 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_03290 9055 10140 gene locus_tag LOCUS_03300 9055 10140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 10159 10929 gene locus_tag LOCUS_03310 10159 10929 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_03310 10966 12816 gene locus_tag LOCUS_03320 10966 12816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 13017 14792 gene locus_tag LOCUS_03330 gene argS 13017 14792 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_03330 15109 15534 gene locus_tag LOCUS_03340 15109 15534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 15918 15547 gene locus_tag LOCUS_03350 15918 15547 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785723.1 protein_id gnl|my_center|LOCUS_03350 16077 16006 gene locus_tag LOCUS_t00010 16077 16006 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 <1 1605 gene locus_tag LOCUS_03360 <1 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107663.1:AMP-binding protein 1733 2269 gene locus_tag LOCUS_03370 1733 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 2349 2927 gene locus_tag LOCUS_03380 2349 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 2930 3646 gene locus_tag LOCUS_03390 2930 3646 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760001.1 protein_id gnl|my_center|LOCUS_03390 3714 5489 gene locus_tag LOCUS_03400 3714 5489 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_03400 5480 6481 gene locus_tag LOCUS_03410 5480 6481 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108287.1 protein_id gnl|my_center|LOCUS_03410 6485 7774 gene locus_tag LOCUS_03420 6485 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 7894 8163 gene locus_tag LOCUS_03430 7894 8163 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010539043.1 protein_id gnl|my_center|LOCUS_03430 8216 9847 gene locus_tag LOCUS_03440 gene groL 8216 9847 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789739.1 protein_id gnl|my_center|LOCUS_03440 10052 11014 gene locus_tag LOCUS_03450 10052 11014 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785156.1 protein_id gnl|my_center|LOCUS_03450 10989 11942 gene locus_tag LOCUS_03460 10989 11942 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785154.1 protein_id gnl|my_center|LOCUS_03460 11939 12679 gene locus_tag LOCUS_03470 gene ubiE 11939 12679 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785152.1 protein_id gnl|my_center|LOCUS_03470 12676 13419 gene locus_tag LOCUS_03480 12676 13419 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_03480 14499 13579 gene locus_tag LOCUS_03490 14499 13579 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_03490 15687 14620 gene locus_tag LOCUS_03500 gene serC 15687 14620 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763483.1 protein_id gnl|my_center|LOCUS_03500 >Feature sequence025 427 1575 gene locus_tag LOCUS_03510 427 1575 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_03510 1601 2935 gene locus_tag LOCUS_03520 1601 2935 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_03520 2932 3807 gene locus_tag LOCUS_03530 2932 3807 CDS product DUF4922 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784241.1 protein_id gnl|my_center|LOCUS_03530 3804 5063 gene locus_tag LOCUS_03540 3804 5063 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_03540 5213 6673 gene locus_tag LOCUS_03550 5213 6673 CDS product DUF6242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108950.1 protein_id gnl|my_center|LOCUS_03550 6734 7435 gene locus_tag LOCUS_03560 6734 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 7458 8201 gene locus_tag LOCUS_03570 7458 8201 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_03570 8252 10909 gene locus_tag LOCUS_03580 8252 10909 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108949.1 protein_id gnl|my_center|LOCUS_03580 11043 11549 gene locus_tag LOCUS_03590 11043 11549 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_03590 11673 12173 gene locus_tag LOCUS_03600 gene skp 11673 12173 CDS product molecular chaperone Skp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095660.1 protein_id gnl|my_center|LOCUS_03600 12208 12714 gene locus_tag LOCUS_03610 12208 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 12716 13528 gene locus_tag LOCUS_03620 gene murI 12716 13528 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202028.1 protein_id gnl|my_center|LOCUS_03620 14503 13796 gene locus_tag LOCUS_03630 14503 13796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 15326 14508 gene locus_tag LOCUS_03640 15326 14508 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence026 1804 362 gene locus_tag LOCUS_03650 gene lepB 1804 362 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_03650 2566 1811 gene locus_tag LOCUS_03660 gene dapB 2566 1811 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762922.1 protein_id gnl|my_center|LOCUS_03660 3815 2703 gene locus_tag LOCUS_03670 gene rnc 3815 2703 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291361.1 protein_id gnl|my_center|LOCUS_03670 5112 3853 gene locus_tag LOCUS_03680 gene fabF 5112 3853 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_03680 5565 5329 gene locus_tag LOCUS_03690 5565 5329 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_03690 7374 5752 gene locus_tag LOCUS_03700 7374 5752 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_03700 9611 7554 gene locus_tag LOCUS_03710 9611 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 11021 9771 gene locus_tag LOCUS_03720 11021 9771 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_03720 11629 11018 gene locus_tag LOCUS_03730 11629 11018 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_03730 12260 11631 gene locus_tag LOCUS_03740 12260 11631 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902949.1 protein_id gnl|my_center|LOCUS_03740 13030 12320 gene locus_tag LOCUS_03750 13030 12320 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766997.1 protein_id gnl|my_center|LOCUS_03750 14117 13119 gene locus_tag LOCUS_03760 gene kduI 14117 13119 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109101.1 protein_id gnl|my_center|LOCUS_03760 15574 14189 gene locus_tag LOCUS_03770 15574 14189 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109102.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence027 2392 476 gene locus_tag LOCUS_03780 2392 476 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_03780 2716 2396 gene locus_tag LOCUS_03790 2716 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 5603 2730 gene locus_tag LOCUS_03800 5603 2730 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766196.1 protein_id gnl|my_center|LOCUS_03800 6158 5613 gene locus_tag LOCUS_03810 6158 5613 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_03810 6434 6159 gene locus_tag LOCUS_03820 6434 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 6598 8076 gene locus_tag LOCUS_03830 gene proS 6598 8076 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107525.1 protein_id gnl|my_center|LOCUS_03830 8357 9046 gene locus_tag LOCUS_03840 8357 9046 CDS product MIP family channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032841205.1 protein_id gnl|my_center|LOCUS_03840 9244 10872 gene locus_tag LOCUS_03850 9244 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 10976 11743 gene locus_tag LOCUS_03860 10976 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 12824 11799 gene locus_tag LOCUS_03870 12824 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 13142 12837 gene locus_tag LOCUS_03880 13142 12837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 13896 13132 gene locus_tag LOCUS_03890 13896 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 15128 13881 gene locus_tag LOCUS_03900 15128 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 15318 15109 gene locus_tag LOCUS_03910 15318 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 >Feature sequence028 257 1417 gene locus_tag LOCUS_03920 gene galK 257 1417 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800633.1 protein_id gnl|my_center|LOCUS_03920 1517 2356 gene locus_tag LOCUS_03930 1517 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2376 3605 gene locus_tag LOCUS_03940 2376 3605 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785790.1 protein_id gnl|my_center|LOCUS_03940 3640 4653 gene locus_tag LOCUS_03950 gene recA 3640 4653 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_229032746.1 protein_id gnl|my_center|LOCUS_03950 4650 5882 gene locus_tag LOCUS_03960 gene pepT 4650 5882 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764742.1 protein_id gnl|my_center|LOCUS_03960 5889 8147 gene locus_tag LOCUS_03970 5889 8147 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764744.1 protein_id gnl|my_center|LOCUS_03970 8235 8582 gene locus_tag LOCUS_03980 8235 8582 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760912.1 protein_id gnl|my_center|LOCUS_03980 8795 9220 gene locus_tag LOCUS_03990 8795 9220 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004309783.1 protein_id gnl|my_center|LOCUS_03990 9262 10311 gene locus_tag LOCUS_04000 9262 10311 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760658.1 protein_id gnl|my_center|LOCUS_04000 10316 10711 gene locus_tag LOCUS_04010 10316 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 11918 10746 gene locus_tag LOCUS_04020 gene porV 11918 10746 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_04020 15147 11920 gene locus_tag LOCUS_04030 15147 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 >Feature sequence029 <1 1308 gene locus_tag LOCUS_04040 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785120.1:bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase 1391 2164 gene locus_tag LOCUS_04050 gene lpxA 1391 2164 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764415.1 protein_id gnl|my_center|LOCUS_04050 2161 3096 gene locus_tag LOCUS_04060 gene miaA 2161 3096 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_04060 3080 5581 gene locus_tag LOCUS_04070 3080 5581 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_04070 5740 7110 gene locus_tag LOCUS_04080 5740 7110 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767799.1 protein_id gnl|my_center|LOCUS_04080 8387 7338 gene locus_tag LOCUS_04090 8387 7338 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692555.1 protein_id gnl|my_center|LOCUS_04090 9283 8411 gene locus_tag LOCUS_04100 9283 8411 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_04100 9866 9405 gene locus_tag LOCUS_04110 gene queF 9866 9405 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786209.1 protein_id gnl|my_center|LOCUS_04110 10306 9863 gene locus_tag LOCUS_04120 10306 9863 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785768.1 protein_id gnl|my_center|LOCUS_04120 10900 10322 gene locus_tag LOCUS_04130 gene coaE 10900 10322 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_04130 11793 10897 gene locus_tag LOCUS_04140 11793 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 12168 11890 gene locus_tag LOCUS_04150 gene yajC 12168 11890 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 protein_id gnl|my_center|LOCUS_04150 13139 12192 gene locus_tag LOCUS_04160 gene nusB 13139 12192 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760339.1 protein_id gnl|my_center|LOCUS_04160 13399 14001 gene locus_tag LOCUS_04170 13399 14001 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_04170 14119 14682 gene locus_tag LOCUS_04180 gene pth 14119 14682 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_04180 14682 15161 gene locus_tag LOCUS_04190 14682 15161 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence030 1295 453 gene locus_tag LOCUS_04200 1295 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4147 1364 gene locus_tag LOCUS_04210 4147 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 6613 4415 gene locus_tag LOCUS_04220 6613 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9977 6672 gene locus_tag LOCUS_04230 9977 6672 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764385.1 protein_id gnl|my_center|LOCUS_04230 11925 10060 gene locus_tag LOCUS_04240 11925 10060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 14162 11976 gene locus_tag LOCUS_04250 14162 11976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 <15157 14204 gene locus_tag LOCUS_04260 <15157 14204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032840505.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence031 75 377 gene locus_tag LOCUS_04270 75 377 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_04270 1235 441 gene locus_tag LOCUS_04280 1235 441 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791104.1 protein_id gnl|my_center|LOCUS_04280 2319 1255 gene locus_tag LOCUS_04290 2319 1255 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_04290 3524 2349 gene locus_tag LOCUS_04300 3524 2349 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760855.1 protein_id gnl|my_center|LOCUS_04300 4461 3631 gene locus_tag LOCUS_04310 4461 3631 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760856.1 protein_id gnl|my_center|LOCUS_04310 7271 4701 gene locus_tag LOCUS_04320 7271 4701 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786936.1 protein_id gnl|my_center|LOCUS_04320 8425 7454 gene locus_tag LOCUS_04330 8425 7454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 9087 8428 gene locus_tag LOCUS_04340 gene queC 9087 8428 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242065.1 protein_id gnl|my_center|LOCUS_04340 11485 9179 gene locus_tag LOCUS_04350 11485 9179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 11742 11485 gene locus_tag LOCUS_04360 11742 11485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 12402 11752 gene locus_tag LOCUS_04370 12402 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 13485 12589 gene locus_tag LOCUS_04380 13485 12589 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788072.1 protein_id gnl|my_center|LOCUS_04380 14930 13497 gene locus_tag LOCUS_04390 gene pyk 14930 13497 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791942.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence032 994 173 gene locus_tag LOCUS_04400 994 173 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762943.1 protein_id gnl|my_center|LOCUS_04400 3010 1037 gene locus_tag LOCUS_04410 3010 1037 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_04410 5115 3595 gene locus_tag LOCUS_04420 5115 3595 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767560.1 protein_id gnl|my_center|LOCUS_04420 5673 5173 gene locus_tag LOCUS_04430 5673 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 6828 5680 gene locus_tag LOCUS_04440 6828 5680 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259192.1 protein_id gnl|my_center|LOCUS_04440 9419 7350 gene locus_tag LOCUS_04450 9419 7350 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992104.1 protein_id gnl|my_center|LOCUS_04450 9544 11502 gene locus_tag LOCUS_04460 9544 11502 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_04460 13979 11622 gene locus_tag LOCUS_04470 gene feoB 13979 11622 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810412.1 protein_id gnl|my_center|LOCUS_04470 14245 14171 gene locus_tag LOCUS_t00020 14245 14171 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence033 246 1100 gene locus_tag LOCUS_04480 246 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 2512 1160 gene locus_tag LOCUS_04490 gene tig 2512 1160 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_04490 2736 4403 gene locus_tag LOCUS_04500 2736 4403 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107423.1 protein_id gnl|my_center|LOCUS_04500 4447 5286 gene locus_tag LOCUS_04510 4447 5286 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_04510 5697 8165 gene locus_tag LOCUS_04520 5697 8165 CDS product bifunctional fucokinase/fucose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202940.1 protein_id gnl|my_center|LOCUS_04520 8162 8953 gene locus_tag LOCUS_04530 8162 8953 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796048.1 protein_id gnl|my_center|LOCUS_04530 8941 9666 gene locus_tag LOCUS_04540 8941 9666 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016268654.1 protein_id gnl|my_center|LOCUS_04540 10870 9851 gene locus_tag LOCUS_04550 10870 9851 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549884.1 protein_id gnl|my_center|LOCUS_04550 11796 10867 gene locus_tag LOCUS_04560 11796 10867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 12773 11811 gene locus_tag LOCUS_04570 12773 11811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_04570 13737 12778 gene locus_tag LOCUS_04580 13737 12778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence034 <1 1261 gene locus_tag LOCUS_04590 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765038.1:phosphoribosylaminoimidazolecarboxamide formyltransferase 3588 1741 gene locus_tag LOCUS_04600 gene mrdA 3588 1741 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_04600 4005 3592 gene locus_tag LOCUS_04610 4005 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 4888 4097 gene locus_tag LOCUS_04620 gene mreC 4888 4097 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766925.1 protein_id gnl|my_center|LOCUS_04620 6044 5022 gene locus_tag LOCUS_04630 6044 5022 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_04630 6688 6089 gene locus_tag LOCUS_04640 6688 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 7684 6905 gene locus_tag LOCUS_04650 gene lpxA 7684 6905 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762937.1 protein_id gnl|my_center|LOCUS_04650 9106 7703 gene locus_tag LOCUS_04660 9106 7703 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783789.1 protein_id gnl|my_center|LOCUS_04660 12367 9125 gene locus_tag LOCUS_04670 12367 9125 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_04670 <13570 12502 gene locus_tag LOCUS_04680 <13570 12502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783796.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence035 935 2503 gene locus_tag LOCUS_04690 935 2503 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_04690 2535 3329 gene locus_tag LOCUS_04700 2535 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04700 3444 4607 gene locus_tag LOCUS_04710 3444 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04710 4614 5732 gene locus_tag LOCUS_04720 4614 5732 CDS product leucine-rich repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962345.1 protein_id gnl|my_center|LOCUS_04720 5722 7743 gene locus_tag LOCUS_04730 5722 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800687.1 protein_id gnl|my_center|LOCUS_04730 8060 8914 gene locus_tag LOCUS_04740 8060 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 9141 10622 gene locus_tag LOCUS_04750 9141 10622 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_04750 10906 12138 gene locus_tag LOCUS_04760 10906 12138 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_04760 13403 12267 gene locus_tag LOCUS_04770 13403 12267 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761538.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence036 1566 613 gene locus_tag LOCUS_04780 1566 613 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158246.1 protein_id gnl|my_center|LOCUS_04780 2095 1640 gene locus_tag LOCUS_04790 2095 1640 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728853.1 protein_id gnl|my_center|LOCUS_04790 4426 2312 gene locus_tag LOCUS_04800 gene clpB 4426 2312 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764749.1 protein_id gnl|my_center|LOCUS_04800 6317 4662 gene locus_tag LOCUS_04810 6317 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 6670 6969 gene locus_tag LOCUS_04820 6670 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 6976 8304 gene locus_tag LOCUS_04830 6976 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 8358 9629 gene locus_tag LOCUS_04840 8358 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 9682 9999 gene locus_tag LOCUS_04850 9682 9999 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779329.1 protein_id gnl|my_center|LOCUS_04850 13145 10077 gene locus_tag LOCUS_04860 13145 10077 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108634.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence037 341 754 gene locus_tag LOCUS_04870 341 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 772 1488 gene locus_tag LOCUS_04880 772 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 4052 1587 gene locus_tag LOCUS_04890 4052 1587 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785097.1 protein_id gnl|my_center|LOCUS_04890 4195 4049 gene locus_tag LOCUS_04900 4195 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 6568 4205 gene locus_tag LOCUS_04910 gene galB 6568 4205 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109366.1 protein_id gnl|my_center|LOCUS_04910 7862 6861 gene locus_tag LOCUS_04920 7862 6861 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_04920 8859 7870 gene locus_tag LOCUS_04930 8859 7870 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783520.1 protein_id gnl|my_center|LOCUS_04930 8998 10404 gene locus_tag LOCUS_04940 8998 10404 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262172.1 protein_id gnl|my_center|LOCUS_04940 11834 10860 gene locus_tag LOCUS_04950 11834 10860 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_04950 11990 12739 gene locus_tag LOCUS_04960 gene folP 11990 12739 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence038 174 713 gene locus_tag LOCUS_04970 174 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 721 1080 gene locus_tag LOCUS_04980 721 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1132 2691 gene locus_tag LOCUS_04990 1132 2691 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_04990 2720 3136 gene locus_tag LOCUS_05000 2720 3136 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767551.1 protein_id gnl|my_center|LOCUS_05000 3157 4446 gene locus_tag LOCUS_05010 3157 4446 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788204.1 protein_id gnl|my_center|LOCUS_05010 4450 5760 gene locus_tag LOCUS_05020 4450 5760 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763512.1 protein_id gnl|my_center|LOCUS_05020 5867 6640 gene locus_tag LOCUS_05030 5867 6640 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816946.1 protein_id gnl|my_center|LOCUS_05030 6701 7906 gene locus_tag LOCUS_05040 6701 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 8620 9216 gene locus_tag LOCUS_05050 8620 9216 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765761.1 protein_id gnl|my_center|LOCUS_05050 9514 9227 gene locus_tag LOCUS_05060 9514 9227 CDS product DUF4491 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767264.1 protein_id gnl|my_center|LOCUS_05060 11666 10092 gene locus_tag LOCUS_05070 11666 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 13121 11688 gene locus_tag LOCUS_05080 gene rlmD 13121 11688 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence039 971 105 gene locus_tag LOCUS_05090 971 105 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109238.1 protein_id gnl|my_center|LOCUS_05090 1169 2473 gene locus_tag LOCUS_05100 1169 2473 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_05100 2553 5894 gene locus_tag LOCUS_05110 2553 5894 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_05110 5891 7912 gene locus_tag LOCUS_05120 5891 7912 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109145.1 protein_id gnl|my_center|LOCUS_05120 7950 10640 gene locus_tag LOCUS_05130 7950 10640 CDS product beta-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109137.1 protein_id gnl|my_center|LOCUS_05130 12750 10654 gene locus_tag LOCUS_05140 gene recG 12750 10654 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791121.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence040 1 228 gene locus_tag LOCUS_05150 1 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 490 1818 gene locus_tag LOCUS_05160 490 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1818 4673 gene locus_tag LOCUS_05170 1818 4673 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_05170 6280 4754 gene locus_tag LOCUS_05180 gene dnaB 6280 4754 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_05180 7119 6298 gene locus_tag LOCUS_05190 gene ispE 7119 6298 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107363.1 protein_id gnl|my_center|LOCUS_05190 9065 7125 gene locus_tag LOCUS_05200 9065 7125 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107164.1 protein_id gnl|my_center|LOCUS_05200 10284 9067 gene locus_tag LOCUS_05210 10284 9067 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_05210 10988 10281 gene locus_tag LOCUS_05220 gene lpxF 10988 10281 CDS product lipid A 4'-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108022.1 protein_id gnl|my_center|LOCUS_05220 <12915 10985 gene locus_tag LOCUS_05230 <12915 10985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025814212.1:BatD family protein >Feature sequence041 1488 229 gene locus_tag LOCUS_05240 gene uxuA 1488 229 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766742.1 protein_id gnl|my_center|LOCUS_05240 1962 1543 gene locus_tag LOCUS_05250 1962 1543 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_05250 2799 1987 gene locus_tag LOCUS_05260 2799 1987 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783762.1 protein_id gnl|my_center|LOCUS_05260 2985 3257 gene locus_tag LOCUS_05270 2985 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3454 5949 gene locus_tag LOCUS_05280 3454 5949 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016714.1 protein_id gnl|my_center|LOCUS_05280 6767 8404 gene locus_tag LOCUS_05290 6767 8404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 8543 9658 gene locus_tag LOCUS_05300 8543 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 9767 10171 gene locus_tag LOCUS_05310 9767 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 10189 10755 gene locus_tag LOCUS_05320 10189 10755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 10832 11260 gene locus_tag LOCUS_05330 10832 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 11270 12226 gene locus_tag LOCUS_05340 11270 12226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence042 323 1009 gene locus_tag LOCUS_05350 323 1009 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_05350 1024 2586 gene locus_tag LOCUS_05360 1024 2586 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785050.1 protein_id gnl|my_center|LOCUS_05360 2638 3873 gene locus_tag LOCUS_05370 gene nuoH 2638 3873 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109091.1 protein_id gnl|my_center|LOCUS_05370 3904 4473 gene locus_tag LOCUS_05380 3904 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4479 5003 gene locus_tag LOCUS_05390 4479 5003 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764300.1 protein_id gnl|my_center|LOCUS_05390 5006 5314 gene locus_tag LOCUS_05400 gene nuoK 5006 5314 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392499.1 protein_id gnl|my_center|LOCUS_05400 5343 7355 gene locus_tag LOCUS_05410 gene nuoL 5343 7355 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_05410 7394 8893 gene locus_tag LOCUS_05420 7394 8893 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764298.1 protein_id gnl|my_center|LOCUS_05420 9020 10429 gene locus_tag LOCUS_05430 9020 10429 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_05430 10772 10698 gene locus_tag LOCUS_t00030 10772 10698 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10944 11720 gene locus_tag LOCUS_05440 10944 11720 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_05440 11762 12649 gene locus_tag LOCUS_05450 11762 12649 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence043 773 1195 gene locus_tag LOCUS_05460 773 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 1210 1494 gene locus_tag LOCUS_05470 1210 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2618 4918 gene locus_tag LOCUS_05480 2618 4918 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_05480 5855 4932 gene locus_tag LOCUS_05490 5855 4932 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_05490 6086 6637 gene locus_tag LOCUS_05500 6086 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 6698 7897 gene locus_tag LOCUS_05510 6698 7897 CDS product DUF2264 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767299.1 protein_id gnl|my_center|LOCUS_05510 8355 7978 gene locus_tag LOCUS_05520 8355 7978 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815873.1 protein_id gnl|my_center|LOCUS_05520 8494 10326 gene locus_tag LOCUS_05530 8494 10326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_05530 10540 12195 gene locus_tag LOCUS_05540 10540 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence044 752 90 gene locus_tag LOCUS_05550 752 90 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_05550 2328 742 gene locus_tag LOCUS_05560 2328 742 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_05560 4805 2343 gene locus_tag LOCUS_05570 gene galB 4805 2343 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039185.1 protein_id gnl|my_center|LOCUS_05570 5393 5028 gene locus_tag LOCUS_05580 5393 5028 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393711.1 protein_id gnl|my_center|LOCUS_05580 7138 5390 gene locus_tag LOCUS_05590 7138 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 8685 7135 gene locus_tag LOCUS_05600 8685 7135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 9557 8676 gene locus_tag LOCUS_05610 9557 8676 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_05610 9789 9547 gene locus_tag LOCUS_05620 9789 9547 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_05620 9939 11189 gene locus_tag LOCUS_05630 9939 11189 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_05630 11210 12022 gene locus_tag LOCUS_05640 11210 12022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence045 1468 170 gene locus_tag LOCUS_05650 gene tyrS 1468 170 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_05650 1850 1611 gene locus_tag LOCUS_05660 gene yidD 1850 1611 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_05660 2245 1847 gene locus_tag LOCUS_05670 gene rnpA 2245 1847 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783651.1 protein_id gnl|my_center|LOCUS_05670 3036 2287 gene locus_tag LOCUS_05680 3036 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3996 3046 gene locus_tag LOCUS_05690 3996 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5305 4040 gene locus_tag LOCUS_05700 gene metK 5305 4040 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_05700 5709 5440 gene locus_tag LOCUS_05710 gene rpsO 5709 5440 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791955.1 protein_id gnl|my_center|LOCUS_05710 6706 5933 gene locus_tag LOCUS_05720 6706 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7650 6874 gene locus_tag LOCUS_05730 gene proC 7650 6874 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762694.1 protein_id gnl|my_center|LOCUS_05730 8452 7901 gene locus_tag LOCUS_05740 8452 7901 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202636.1 protein_id gnl|my_center|LOCUS_05740 9698 8499 gene locus_tag LOCUS_05750 9698 8499 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017115.1 protein_id gnl|my_center|LOCUS_05750 11152 10001 gene locus_tag LOCUS_05760 11152 10001 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_05760 <12069 11334 gene locus_tag LOCUS_05770 <12069 11334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762696.1:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence046 48 1238 gene locus_tag LOCUS_05780 48 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1228 2508 gene locus_tag LOCUS_05790 1228 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 2519 3196 gene locus_tag LOCUS_05800 2519 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3201 4325 gene locus_tag LOCUS_05810 gene prfB 3201 4325 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161800204.1 protein_id gnl|my_center|LOCUS_05810 4478 4870 gene locus_tag LOCUS_05820 4478 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 5033 5176 gene locus_tag LOCUS_05830 5033 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 5233 5721 gene locus_tag LOCUS_05840 5233 5721 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_05840 5922 7394 gene locus_tag LOCUS_05850 5922 7394 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795325.1 protein_id gnl|my_center|LOCUS_05850 10144 7493 gene locus_tag LOCUS_05860 10144 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 10420 11229 gene locus_tag LOCUS_05870 gene argB 10420 11229 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence047 1143 937 gene locus_tag LOCUS_05880 1143 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1730 1224 gene locus_tag LOCUS_05890 gene purE 1730 1224 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_05890 2886 2269 gene locus_tag LOCUS_05900 2886 2269 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791307.1 protein_id gnl|my_center|LOCUS_05900 4400 2883 gene locus_tag LOCUS_05910 gene rpoN 4400 2883 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108333.1 protein_id gnl|my_center|LOCUS_05910 4590 8444 gene locus_tag LOCUS_05920 4590 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 8812 9390 gene locus_tag LOCUS_05930 8812 9390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 <11890 9501 gene locus_tag LOCUS_05940 <11890 9501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804126.1:DNA-directed RNA polymerase subunit beta' >Feature sequence048 478 1011 gene locus_tag LOCUS_05950 478 1011 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_05950 1146 1218 gene locus_tag LOCUS_t00040 1146 1218 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1938 1297 gene locus_tag LOCUS_05960 1938 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 2653 2420 gene locus_tag LOCUS_05970 2653 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 3146 2808 gene locus_tag LOCUS_05980 3146 2808 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004298733.1 protein_id gnl|my_center|LOCUS_05980 3582 3154 gene locus_tag LOCUS_05990 3582 3154 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004298733.1 protein_id gnl|my_center|LOCUS_05990 3930 3589 gene locus_tag LOCUS_06000 3930 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 6617 4164 gene locus_tag LOCUS_06010 6617 4164 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_06010 8190 6913 gene locus_tag LOCUS_06020 8190 6913 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762841.1 protein_id gnl|my_center|LOCUS_06020 9287 8169 gene locus_tag LOCUS_06030 9287 8169 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108504.1 protein_id gnl|my_center|LOCUS_06030 10231 9284 gene locus_tag LOCUS_06040 10231 9284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 10334 11671 gene locus_tag LOCUS_06050 gene miaB 10334 11671 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence049 64 1038 gene locus_tag LOCUS_06060 64 1038 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107917.1 protein_id gnl|my_center|LOCUS_06060 1101 2396 gene locus_tag LOCUS_06070 1101 2396 CDS product O-antigen polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203515.1 protein_id gnl|my_center|LOCUS_06070 2393 3547 gene locus_tag LOCUS_06080 2393 3547 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765277.1 protein_id gnl|my_center|LOCUS_06080 3632 4855 gene locus_tag LOCUS_06090 3632 4855 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_06090 4923 5672 gene locus_tag LOCUS_06100 4923 5672 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_06100 6845 5721 gene locus_tag LOCUS_06110 6845 5721 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_06110 7710 6856 gene locus_tag LOCUS_06120 7710 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763834.1 protein_id gnl|my_center|LOCUS_06120 8435 7815 gene locus_tag LOCUS_06130 8435 7815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 8977 8390 gene locus_tag LOCUS_06140 8977 8390 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840540.1 protein_id gnl|my_center|LOCUS_06140 9426 9094 gene locus_tag LOCUS_06150 9426 9094 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764612.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence050 3186 2878 gene locus_tag LOCUS_06160 3186 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 8281 3644 gene locus_tag LOCUS_06170 8281 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9788 8481 gene locus_tag LOCUS_06180 9788 8481 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109136.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence051 9575 120 gene locus_tag LOCUS_06190 9575 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 10225 10407 gene locus_tag LOCUS_06200 10225 10407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence052 2892 1537 gene locus_tag LOCUS_06210 2892 1537 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796577.1 protein_id gnl|my_center|LOCUS_06210 3034 3342 gene locus_tag LOCUS_06220 3034 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3339 4427 gene locus_tag LOCUS_06230 3339 4427 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203722.1 protein_id gnl|my_center|LOCUS_06230 4428 5891 gene locus_tag LOCUS_06240 4428 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5893 7242 gene locus_tag LOCUS_06250 5893 7242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 8701 7265 gene locus_tag LOCUS_06260 8701 7265 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108540.1 protein_id gnl|my_center|LOCUS_06260 9782 8694 gene locus_tag LOCUS_06270 9782 8694 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203058.1 protein_id gnl|my_center|LOCUS_06270 10855 9782 gene locus_tag LOCUS_06280 10855 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence053 2747 96 gene locus_tag LOCUS_06290 2747 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 4239 3103 gene locus_tag LOCUS_06300 gene nspC 4239 3103 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202909.1 protein_id gnl|my_center|LOCUS_06300 4419 5024 gene locus_tag LOCUS_06310 4419 5024 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761321.1 protein_id gnl|my_center|LOCUS_06310 5074 6009 gene locus_tag LOCUS_06320 5074 6009 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_06320 6113 6436 gene locus_tag LOCUS_06330 6113 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 6470 8254 gene locus_tag LOCUS_06340 gene lysS 6470 8254 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759776.1 protein_id gnl|my_center|LOCUS_06340 8259 9254 gene locus_tag LOCUS_06350 8259 9254 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781396.1 protein_id gnl|my_center|LOCUS_06350 9322 10278 gene locus_tag LOCUS_06360 9322 10278 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796125.1 protein_id gnl|my_center|LOCUS_06360 10275 10727 gene locus_tag LOCUS_06370 10275 10727 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793759.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence054 872 1345 gene locus_tag LOCUS_06380 872 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1378 2565 gene locus_tag LOCUS_06390 1378 2565 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_06390 2711 3178 gene locus_tag LOCUS_06400 gene rimP 2711 3178 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767604.1 protein_id gnl|my_center|LOCUS_06400 3266 4528 gene locus_tag LOCUS_06410 gene nusA 3266 4528 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_06410 4582 7467 gene locus_tag LOCUS_06420 gene infB 4582 7467 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108813.1 protein_id gnl|my_center|LOCUS_06420 8117 7923 gene locus_tag LOCUS_06430 8117 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 9474 8197 gene locus_tag LOCUS_06440 9474 8197 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108918.1 protein_id gnl|my_center|LOCUS_06440 10684 9512 gene locus_tag LOCUS_06450 10684 9512 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108943.1 protein_id gnl|my_center|LOCUS_06450 >Feature sequence055 125 661 gene locus_tag LOCUS_06460 125 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 722 2314 gene locus_tag LOCUS_06470 722 2314 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760641.1 protein_id gnl|my_center|LOCUS_06470 2419 3147 gene locus_tag LOCUS_06480 2419 3147 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764709.1 protein_id gnl|my_center|LOCUS_06480 3272 4456 gene locus_tag LOCUS_06490 3272 4456 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203237.1 protein_id gnl|my_center|LOCUS_06490 4501 8070 gene locus_tag LOCUS_06500 gene nifJ 4501 8070 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789619.1 protein_id gnl|my_center|LOCUS_06500 8241 8825 gene locus_tag LOCUS_06510 8241 8825 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_06510 >Feature sequence056 <1 2307 gene locus_tag LOCUS_06520 <1 2307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766293.1:NADP-dependent malic enzyme 2322 2897 gene locus_tag LOCUS_06530 2322 2897 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_06530 2897 3712 gene locus_tag LOCUS_06540 2897 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3717 5840 gene locus_tag LOCUS_06550 3717 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5930 8077 gene locus_tag LOCUS_06560 5930 8077 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790956.1 protein_id gnl|my_center|LOCUS_06560 9062 8088 gene locus_tag LOCUS_06570 9062 8088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 10049 9369 gene locus_tag LOCUS_06580 gene trmD 10049 9369 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_06580 10155 10874 gene locus_tag LOCUS_06590 10155 10874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 >Feature sequence057 6622 6005 gene locus_tag LOCUS_06600 gene ruvA 6622 6005 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_06600 8535 6781 gene locus_tag LOCUS_06610 8535 6781 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 protein_id gnl|my_center|LOCUS_06610 9805 9164 gene locus_tag LOCUS_06620 9805 9164 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763533.1 protein_id gnl|my_center|LOCUS_06620 10201 9821 gene locus_tag LOCUS_06630 10201 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 <10808 10204 gene locus_tag LOCUS_06640 <10808 10204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763546.1:energy transducer TonB >Feature sequence058 166 366 gene locus_tag LOCUS_06650 166 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 457 762 gene locus_tag LOCUS_06660 457 762 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932932.1 protein_id gnl|my_center|LOCUS_06660 2204 1164 gene locus_tag LOCUS_06670 gene hisC 2204 1164 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_06670 3521 2238 gene locus_tag LOCUS_06680 3521 2238 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764891.1 protein_id gnl|my_center|LOCUS_06680 4344 3496 gene locus_tag LOCUS_06690 4344 3496 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202730.1 protein_id gnl|my_center|LOCUS_06690 4491 5105 gene locus_tag LOCUS_06700 gene hisH 4491 5105 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_06700 5116 5841 gene locus_tag LOCUS_06710 gene hisA 5116 5841 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203120.1 protein_id gnl|my_center|LOCUS_06710 5933 6694 gene locus_tag LOCUS_06720 gene hisF 5933 6694 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762398.1 protein_id gnl|my_center|LOCUS_06720 6749 7174 gene locus_tag LOCUS_06730 6749 7174 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763158.1 protein_id gnl|my_center|LOCUS_06730 7253 8458 gene locus_tag LOCUS_06740 7253 8458 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814962.1 protein_id gnl|my_center|LOCUS_06740 8500 9411 gene locus_tag LOCUS_06750 8500 9411 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762864.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence059 1015 2232 gene locus_tag LOCUS_06760 1015 2232 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_06760 2256 2495 gene locus_tag LOCUS_06770 gene acpP 2256 2495 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025404.1 protein_id gnl|my_center|LOCUS_06770 2597 3007 gene locus_tag LOCUS_06780 2597 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3010 3375 gene locus_tag LOCUS_06790 3010 3375 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_06790 3408 5189 gene locus_tag LOCUS_06800 3408 5189 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_06800 6762 9191 gene locus_tag LOCUS_06810 6762 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 9295 10500 gene locus_tag LOCUS_06820 9295 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 >Feature sequence060 414 3140 gene locus_tag LOCUS_06830 414 3140 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_06830 4208 5278 gene locus_tag LOCUS_06840 gene hisB 4208 5278 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_06840 10089 5602 gene locus_tag LOCUS_06850 10089 5602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence061 1041 247 gene locus_tag LOCUS_06860 1041 247 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203420.1 protein_id gnl|my_center|LOCUS_06860 1615 1178 gene locus_tag LOCUS_06870 1615 1178 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761058.1 protein_id gnl|my_center|LOCUS_06870 2164 1679 gene locus_tag LOCUS_06880 2164 1679 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_06880 2477 2181 gene locus_tag LOCUS_06890 2477 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3312 2548 gene locus_tag LOCUS_06900 3312 2548 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_06900 3619 5910 gene locus_tag LOCUS_06910 3619 5910 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_06910 6394 6954 gene locus_tag LOCUS_06920 6394 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 7061 7321 gene locus_tag LOCUS_06930 7061 7321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 7318 7635 gene locus_tag LOCUS_06940 7318 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 7654 8970 gene locus_tag LOCUS_06950 gene serS 7654 8970 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_06950 8982 10256 gene locus_tag LOCUS_06960 8982 10256 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764994.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence062 65 697 gene locus_tag LOCUS_06970 65 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 861 2060 gene locus_tag LOCUS_06980 861 2060 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_06980 2089 3918 gene locus_tag LOCUS_06990 2089 3918 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109110.1 protein_id gnl|my_center|LOCUS_06990 3931 4947 gene locus_tag LOCUS_07000 3931 4947 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_07000 5150 5914 gene locus_tag LOCUS_07010 gene trmB 5150 5914 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791725.1 protein_id gnl|my_center|LOCUS_07010 6120 7217 gene locus_tag LOCUS_07020 gene mnmA 6120 7217 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107145.1 protein_id gnl|my_center|LOCUS_07020 7858 7319 gene locus_tag LOCUS_07030 7858 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 8548 7859 gene locus_tag LOCUS_07040 8548 7859 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 protein_id gnl|my_center|LOCUS_07040 10078 8627 gene locus_tag LOCUS_07050 10078 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence063 926 192 gene locus_tag LOCUS_07060 926 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 2728 923 gene locus_tag LOCUS_07070 2728 923 CDS product rhamnogalacturonan acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840507.1 protein_id gnl|my_center|LOCUS_07070 3436 2750 gene locus_tag LOCUS_07080 3436 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 4587 3460 gene locus_tag LOCUS_07090 4587 3460 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769686.1 protein_id gnl|my_center|LOCUS_07090 4985 4596 gene locus_tag LOCUS_07100 4985 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 5805 4990 gene locus_tag LOCUS_07110 5805 4990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785470.1 protein_id gnl|my_center|LOCUS_07110 6342 5821 gene locus_tag LOCUS_07120 6342 5821 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 protein_id gnl|my_center|LOCUS_07120 7511 6339 gene locus_tag LOCUS_07130 7511 6339 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_07130 8458 7547 gene locus_tag LOCUS_07140 8458 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 9350 8472 gene locus_tag LOCUS_07150 gene folD 9350 8472 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_07150 10142 9372 gene locus_tag LOCUS_07160 10142 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence064 148 1176 gene locus_tag LOCUS_07170 148 1176 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203112.1 protein_id gnl|my_center|LOCUS_07170 1173 2198 gene locus_tag LOCUS_07180 1173 2198 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_07180 2322 4229 gene locus_tag LOCUS_07190 2322 4229 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_07190 4216 6501 gene locus_tag LOCUS_07200 gene priA 4216 6501 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_07200 8661 6559 gene locus_tag LOCUS_07210 8661 6559 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_07210 9415 8636 gene locus_tag LOCUS_07220 9415 8636 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108111.1 protein_id gnl|my_center|LOCUS_07220 <10154 9461 gene locus_tag LOCUS_07230 <10154 9461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108113.1:polyprenyl synthetase family protein >Feature sequence065 1720 872 gene locus_tag LOCUS_07240 1720 872 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 protein_id gnl|my_center|LOCUS_07240 2568 1717 gene locus_tag LOCUS_07250 2568 1717 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546408.1 protein_id gnl|my_center|LOCUS_07250 2889 4262 gene locus_tag LOCUS_07260 2889 4262 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_07260 4318 5346 gene locus_tag LOCUS_07270 gene hisC 4318 5346 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399129.1 protein_id gnl|my_center|LOCUS_07270 5347 6081 gene locus_tag LOCUS_07280 5347 6081 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_07280 7582 6281 gene locus_tag LOCUS_07290 7582 6281 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_07290 7791 9368 gene locus_tag LOCUS_07300 7791 9368 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108511.1 protein_id gnl|my_center|LOCUS_07300 9374 9907 gene locus_tag LOCUS_07310 9374 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence066 413 4177 gene locus_tag LOCUS_07320 413 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 4286 5197 gene locus_tag LOCUS_07330 4286 5197 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893461.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence067 868 1731 gene locus_tag LOCUS_07340 868 1731 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764707.1 protein_id gnl|my_center|LOCUS_07340 2712 1882 gene locus_tag LOCUS_07350 2712 1882 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144000.1 protein_id gnl|my_center|LOCUS_07350 2994 5462 gene locus_tag LOCUS_07360 2994 5462 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_07360 5467 7221 gene locus_tag LOCUS_07370 5467 7221 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_07370 7229 8497 gene locus_tag LOCUS_07380 7229 8497 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_07380 9211 8498 gene locus_tag LOCUS_07390 9211 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 9795 9232 gene locus_tag LOCUS_07400 9795 9232 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence068 173 775 gene locus_tag LOCUS_07410 173 775 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698124.1 protein_id gnl|my_center|LOCUS_07410 2915 906 gene locus_tag LOCUS_07420 2915 906 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107215.1 protein_id gnl|my_center|LOCUS_07420 4824 2992 gene locus_tag LOCUS_07430 4824 2992 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107216.1 protein_id gnl|my_center|LOCUS_07430 8095 4886 gene locus_tag LOCUS_07440 8095 4886 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107217.1 protein_id gnl|my_center|LOCUS_07440 <9903 8123 gene locus_tag LOCUS_07450 <9903 8123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760650.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence069 1677 106 gene locus_tag LOCUS_07460 1677 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 4098 1786 gene locus_tag LOCUS_07470 4098 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6601 4103 gene locus_tag LOCUS_07480 6601 4103 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202561.1 protein_id gnl|my_center|LOCUS_07480 7274 6687 gene locus_tag LOCUS_07490 7274 6687 CDS product DUF3575 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107790.1 protein_id gnl|my_center|LOCUS_07490 8579 7311 gene locus_tag LOCUS_07500 8579 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 9666 8569 gene locus_tag LOCUS_07510 9666 8569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence070 559 83 gene locus_tag LOCUS_07520 559 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 980 600 gene locus_tag LOCUS_07530 980 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1596 1045 gene locus_tag LOCUS_07540 1596 1045 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_07540 1980 1660 gene locus_tag LOCUS_07550 1980 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2847 2080 gene locus_tag LOCUS_07560 2847 2080 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_07560 4709 2877 gene locus_tag LOCUS_07570 4709 2877 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_07570 5305 4712 gene locus_tag LOCUS_07580 gene yihA 5305 4712 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794469.1 protein_id gnl|my_center|LOCUS_07580 6992 5328 gene locus_tag LOCUS_07590 gene recN 6992 5328 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107738.1 protein_id gnl|my_center|LOCUS_07590 7913 7026 gene locus_tag LOCUS_07600 7913 7026 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_07600 8818 7949 gene locus_tag LOCUS_07610 8818 7949 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_07610 <9682 8824 gene locus_tag LOCUS_07620 <9682 8824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762412.1:DNA polymerase III subunit beta >Feature sequence071 3839 2496 gene locus_tag LOCUS_07630 gene trkA 3839 2496 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_07630 5863 3959 gene locus_tag LOCUS_07640 gene dxs 5863 3959 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_07640 6116 7117 gene locus_tag LOCUS_07650 6116 7117 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763359.1 protein_id gnl|my_center|LOCUS_07650 7241 7636 gene locus_tag LOCUS_07660 7241 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 8633 7578 gene locus_tag LOCUS_07670 8633 7578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 9544 8738 gene locus_tag LOCUS_07680 9544 8738 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761827.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence072 576 25 gene locus_tag LOCUS_07690 576 25 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762007.1 protein_id gnl|my_center|LOCUS_07690 1052 573 gene locus_tag LOCUS_07700 1052 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3040 1049 gene locus_tag LOCUS_07710 3040 1049 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_07710 3030 3221 gene locus_tag LOCUS_07720 3030 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3314 4831 gene locus_tag LOCUS_07730 gene gltX 3314 4831 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_07730 4828 6066 gene locus_tag LOCUS_07740 4828 6066 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_07740 6078 7355 gene locus_tag LOCUS_07750 6078 7355 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761151.1 protein_id gnl|my_center|LOCUS_07750 7390 8937 gene locus_tag LOCUS_07760 7390 8937 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_07760 8912 9094 gene locus_tag LOCUS_07770 8912 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence073 <1 568 gene locus_tag LOCUS_07780 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975137.1:NAD-dependent epimerase/dehydratase family protein 586 1623 gene locus_tag LOCUS_07790 586 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1627 2595 gene locus_tag LOCUS_07800 1627 2595 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446981.1 protein_id gnl|my_center|LOCUS_07800 2592 3401 gene locus_tag LOCUS_07810 2592 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 3401 4645 gene locus_tag LOCUS_07820 3401 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 4649 5242 gene locus_tag LOCUS_07830 4649 5242 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218919404.1 protein_id gnl|my_center|LOCUS_07830 5260 6120 gene locus_tag LOCUS_07840 5260 6120 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986978.1 protein_id gnl|my_center|LOCUS_07840 6735 7382 gene locus_tag LOCUS_07850 6735 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 7379 8284 gene locus_tag LOCUS_07860 7379 8284 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875987.1 protein_id gnl|my_center|LOCUS_07860 8308 9237 gene locus_tag LOCUS_07870 8308 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203513.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence074 769 1584 gene locus_tag LOCUS_07880 769 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 3394 1910 gene locus_tag LOCUS_07890 3394 1910 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765753.1 protein_id gnl|my_center|LOCUS_07890 5063 3582 gene locus_tag LOCUS_07900 5063 3582 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203639.1 protein_id gnl|my_center|LOCUS_07900 6076 5321 gene locus_tag LOCUS_07910 gene tatC 6076 5321 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801307.1 protein_id gnl|my_center|LOCUS_07910 6254 6069 gene locus_tag LOCUS_07920 gene tatA 6254 6069 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_07920 7377 6694 gene locus_tag LOCUS_07930 7377 6694 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791943.1 protein_id gnl|my_center|LOCUS_07930 7899 7483 gene locus_tag LOCUS_07940 gene aroQ 7899 7483 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761921.1 protein_id gnl|my_center|LOCUS_07940 8912 8208 gene locus_tag LOCUS_07950 8912 8208 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791915.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence075 289 3273 gene locus_tag LOCUS_07960 289 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3828 3334 gene locus_tag LOCUS_07970 3828 3334 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656744.1 protein_id gnl|my_center|LOCUS_07970 6723 3976 gene locus_tag LOCUS_07980 6723 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 8895 6805 gene locus_tag LOCUS_07990 8895 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9221 9054 gene locus_tag LOCUS_08000 9221 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence076 1490 2239 gene locus_tag LOCUS_08010 1490 2239 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_08010 2236 3000 gene locus_tag LOCUS_08020 2236 3000 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_08020 3031 3492 gene locus_tag LOCUS_08030 gene ndk 3031 3492 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_08030 3701 6685 gene locus_tag LOCUS_08040 3701 6685 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796251.1 protein_id gnl|my_center|LOCUS_08040 9254 6903 gene locus_tag LOCUS_08050 9254 6903 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence077 232 3303 gene locus_tag LOCUS_08060 232 3303 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036929.1 protein_id gnl|my_center|LOCUS_08060 4920 3535 gene locus_tag LOCUS_08070 4920 3535 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203594.1 protein_id gnl|my_center|LOCUS_08070 6169 5249 gene locus_tag LOCUS_08080 6169 5249 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763547.1 protein_id gnl|my_center|LOCUS_08080 7081 6245 gene locus_tag LOCUS_08090 7081 6245 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763546.1 protein_id gnl|my_center|LOCUS_08090 7789 7148 gene locus_tag LOCUS_08100 7789 7148 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792003.1 protein_id gnl|my_center|LOCUS_08100 8410 7793 gene locus_tag LOCUS_08110 8410 7793 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792004.1 protein_id gnl|my_center|LOCUS_08110 9269 8445 gene locus_tag LOCUS_08120 9269 8445 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763543.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence078 9030 181 gene locus_tag LOCUS_08130 9030 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence079 51 308 gene locus_tag LOCUS_08140 51 308 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785693.1 protein_id gnl|my_center|LOCUS_08140 343 576 gene locus_tag LOCUS_08150 343 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 593 1822 gene locus_tag LOCUS_08160 gene fucP 593 1822 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703668.1 protein_id gnl|my_center|LOCUS_08160 2970 2119 gene locus_tag LOCUS_08170 2970 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3768 3058 gene locus_tag LOCUS_08180 3768 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292634.1 protein_id gnl|my_center|LOCUS_08180 4246 4869 gene locus_tag LOCUS_08190 4246 4869 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986495.1 protein_id gnl|my_center|LOCUS_08190 5140 5421 gene locus_tag LOCUS_08200 5140 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08200 5544 5972 gene locus_tag LOCUS_08210 5544 5972 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262715.1 protein_id gnl|my_center|LOCUS_08210 6410 8746 gene locus_tag LOCUS_08220 6410 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence080 392 976 gene locus_tag LOCUS_08230 392 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1176 2057 gene locus_tag LOCUS_08240 1176 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3934 2174 gene locus_tag LOCUS_08250 gene rhgW 3934 2174 CDS product rhamnogalacturonan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886436.1 protein_id gnl|my_center|LOCUS_08250 4764 3961 gene locus_tag LOCUS_08260 4764 3961 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_08260 5945 5022 gene locus_tag LOCUS_08270 5945 5022 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 protein_id gnl|my_center|LOCUS_08270 7577 6165 gene locus_tag LOCUS_08280 gene dnaA 7577 6165 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798188.1 protein_id gnl|my_center|LOCUS_08280 8497 7577 gene locus_tag LOCUS_08290 8497 7577 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_08290 <9392 8494 gene locus_tag LOCUS_08300 <9392 8494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032840465.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence081 <1 1649 gene locus_tag LOCUS_08310 <1 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760913.1:RelA/SpoT family protein 1778 2299 gene locus_tag LOCUS_08320 1778 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2706 2323 gene locus_tag LOCUS_08330 2706 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 4216 2690 gene locus_tag LOCUS_08340 4216 2690 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786397.1 protein_id gnl|my_center|LOCUS_08340 4456 4301 gene locus_tag LOCUS_08350 4456 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 4831 4658 gene locus_tag LOCUS_08360 4831 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 6098 4833 gene locus_tag LOCUS_08370 6098 4833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 7333 6755 gene locus_tag LOCUS_08380 7333 6755 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760888.1 protein_id gnl|my_center|LOCUS_08380 7526 8470 gene locus_tag LOCUS_08390 7526 8470 CDS product pectinesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109103.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence082 289 1002 gene locus_tag LOCUS_08400 289 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763127.1 protein_id gnl|my_center|LOCUS_08400 1127 2275 gene locus_tag LOCUS_08410 1127 2275 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303089.1 protein_id gnl|my_center|LOCUS_08410 2724 2476 gene locus_tag LOCUS_08420 2724 2476 CDS product TIGR03905 family TSCPD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965683.1 protein_id gnl|my_center|LOCUS_08420 6515 2790 gene locus_tag LOCUS_08430 6515 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence083 163 465 gene locus_tag LOCUS_08440 gene rpsN 163 465 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762042.1 protein_id gnl|my_center|LOCUS_08440 629 1024 gene locus_tag LOCUS_08450 gene rpsH 629 1024 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_08450 1040 1606 gene locus_tag LOCUS_08460 gene rplF 1040 1606 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_08460 1625 1969 gene locus_tag LOCUS_08470 gene rplR 1625 1969 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_08470 1984 2487 gene locus_tag LOCUS_08480 gene rpsE 1984 2487 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_08480 2508 2684 gene locus_tag LOCUS_08490 gene rpmD 2508 2684 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_08490 2711 3157 gene locus_tag LOCUS_08500 gene rplO 2711 3157 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_08500 3215 4555 gene locus_tag LOCUS_08510 gene secY 3215 4555 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_08510 4584 5378 gene locus_tag LOCUS_08520 gene map 4584 5378 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_08520 5408 5626 gene locus_tag LOCUS_08530 gene infA 5408 5626 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_08530 5930 6310 gene locus_tag LOCUS_08540 gene rpsM 5930 6310 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_08540 6399 6788 gene locus_tag LOCUS_08550 gene rpsK 6399 6788 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_08550 6815 7420 gene locus_tag LOCUS_08560 gene rpsD 6815 7420 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_08560 7433 8425 gene locus_tag LOCUS_08570 7433 8425 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762051.1 protein_id gnl|my_center|LOCUS_08570 8519 8965 gene locus_tag LOCUS_08580 8519 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence084 375 160 gene locus_tag LOCUS_08590 375 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2723 396 gene locus_tag LOCUS_08600 2723 396 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202292.1 protein_id gnl|my_center|LOCUS_08600 4553 2727 gene locus_tag LOCUS_08610 4553 2727 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202294.1 protein_id gnl|my_center|LOCUS_08610 6236 5121 gene locus_tag LOCUS_08620 6236 5121 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_08620 7451 6687 gene locus_tag LOCUS_08630 7451 6687 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761029.1 protein_id gnl|my_center|LOCUS_08630 8562 7468 gene locus_tag LOCUS_08640 8562 7468 CDS product PCMD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798126.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence085 123 1340 gene locus_tag LOCUS_08650 123 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1375 1566 gene locus_tag LOCUS_08660 1375 1566 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767912.1 protein_id gnl|my_center|LOCUS_08660 1587 2057 gene locus_tag LOCUS_08670 1587 2057 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796501.1 protein_id gnl|my_center|LOCUS_08670 2059 2652 gene locus_tag LOCUS_08680 2059 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2798 2884 gene locus_tag LOCUS_t00050 2798 2884 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2919 3911 gene locus_tag LOCUS_08690 2919 3911 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765298.1 protein_id gnl|my_center|LOCUS_08690 3942 4601 gene locus_tag LOCUS_08700 3942 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 4586 5323 gene locus_tag LOCUS_08710 4586 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 7636 5540 gene locus_tag LOCUS_08720 7636 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 8217 7669 gene locus_tag LOCUS_08730 8217 7669 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005894834.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence086 547 26 gene locus_tag LOCUS_08740 547 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 822 553 gene locus_tag LOCUS_08750 822 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1216 824 gene locus_tag LOCUS_08760 1216 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2178 1306 gene locus_tag LOCUS_08770 2178 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039948.1 protein_id gnl|my_center|LOCUS_08770 2678 2175 gene locus_tag LOCUS_08780 2678 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 3328 2684 gene locus_tag LOCUS_08790 3328 2684 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062346.1 protein_id gnl|my_center|LOCUS_08790 4576 3350 gene locus_tag LOCUS_08800 gene cls 4576 3350 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766459.1 protein_id gnl|my_center|LOCUS_08800 6986 4638 gene locus_tag LOCUS_08810 6986 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 7789 7193 gene locus_tag LOCUS_08820 7789 7193 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099181.1 protein_id gnl|my_center|LOCUS_08820 8651 7770 gene locus_tag LOCUS_08830 gene mltG 8651 7770 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence087 165 3575 gene locus_tag LOCUS_08840 gene secA 165 3575 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764528.1 protein_id gnl|my_center|LOCUS_08840 3562 4011 gene locus_tag LOCUS_08850 3562 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785439.1 protein_id gnl|my_center|LOCUS_08850 8002 4352 gene locus_tag LOCUS_08860 8002 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 8331 8405 gene locus_tag LOCUS_t00060 8331 8405 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence088 330 1034 gene locus_tag LOCUS_08870 330 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence089 168 1508 gene locus_tag LOCUS_08880 168 1508 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993582.1 protein_id gnl|my_center|LOCUS_08880 1718 1545 gene locus_tag LOCUS_08890 1718 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2253 3710 gene locus_tag LOCUS_08900 2253 3710 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_08900 3872 5560 gene locus_tag LOCUS_08910 3872 5560 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766579.1 protein_id gnl|my_center|LOCUS_08910 5666 6091 gene locus_tag LOCUS_08920 5666 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 6105 6554 gene locus_tag LOCUS_08930 6105 6554 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_08930 6628 7779 gene locus_tag LOCUS_08940 6628 7779 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107939.1 protein_id gnl|my_center|LOCUS_08940 7828 8238 gene locus_tag LOCUS_08950 gene mce 7828 8238 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence090 1559 291 gene locus_tag LOCUS_08960 1559 291 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_08960 4133 1566 gene locus_tag LOCUS_08970 4133 1566 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109131.1 protein_id gnl|my_center|LOCUS_08970 4746 4255 gene locus_tag LOCUS_08980 gene rlmH 4746 4255 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786211.1 protein_id gnl|my_center|LOCUS_08980 4925 6667 gene locus_tag LOCUS_08990 4925 6667 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_08990 6905 7222 gene locus_tag LOCUS_09000 gene rplU 6905 7222 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775748.1 protein_id gnl|my_center|LOCUS_09000 7244 7504 gene locus_tag LOCUS_09010 gene rpmA 7244 7504 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_09010 7744 7818 gene locus_tag LOCUS_t00070 7744 7818 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7853 7927 gene locus_tag LOCUS_t00080 7853 7927 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence091 1063 77 gene locus_tag LOCUS_09020 1063 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1721 1056 gene locus_tag LOCUS_09030 1721 1056 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_09030 2555 2154 gene locus_tag LOCUS_09040 2555 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 3610 2588 gene locus_tag LOCUS_09050 3610 2588 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174705273.1 protein_id gnl|my_center|LOCUS_09050 4761 3637 gene locus_tag LOCUS_09060 4761 3637 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_09060 6652 4958 gene locus_tag LOCUS_09070 6652 4958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 7766 6708 gene locus_tag LOCUS_09080 7766 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence092 1434 715 gene locus_tag LOCUS_09090 1434 715 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_09090 4005 1468 gene locus_tag LOCUS_09100 4005 1468 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039946.1 protein_id gnl|my_center|LOCUS_09100 4686 4033 gene locus_tag LOCUS_09110 4686 4033 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009039947.1 protein_id gnl|my_center|LOCUS_09110 5494 4949 gene locus_tag LOCUS_09120 5494 4949 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_09120 7900 5525 gene locus_tag LOCUS_09130 7900 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence093 2483 105 gene locus_tag LOCUS_09140 2483 105 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108762.1 protein_id gnl|my_center|LOCUS_09140 2963 2649 gene locus_tag LOCUS_09150 gene trxA 2963 2649 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_09150 6556 2993 gene locus_tag LOCUS_09160 6556 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_09160 7822 6557 gene locus_tag LOCUS_09170 gene aroA 7822 6557 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202121.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence094 2111 1080 gene locus_tag LOCUS_09180 2111 1080 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203225.1 protein_id gnl|my_center|LOCUS_09180 3389 2163 gene locus_tag LOCUS_09190 3389 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 5823 3673 gene locus_tag LOCUS_09200 gene scpA 5823 3673 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790883.1 protein_id gnl|my_center|LOCUS_09200 7609 5828 gene locus_tag LOCUS_09210 gene mutA 7609 5828 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence095 368 655 gene locus_tag LOCUS_09220 368 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 909 1418 gene locus_tag LOCUS_09230 909 1418 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868449.1 protein_id gnl|my_center|LOCUS_09230 1705 2322 gene locus_tag LOCUS_09240 gene rplC 1705 2322 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_09240 2328 2957 gene locus_tag LOCUS_09250 gene rplD 2328 2957 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_09250 2981 3274 gene locus_tag LOCUS_09260 gene rplW 2981 3274 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_09260 3283 4110 gene locus_tag LOCUS_09270 gene rplB 3283 4110 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_09270 4134 4400 gene locus_tag LOCUS_09280 gene rpsS 4134 4400 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_09280 4436 4840 gene locus_tag LOCUS_09290 gene rplV 4436 4840 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_09290 4849 5577 gene locus_tag LOCUS_09300 gene rpsC 4849 5577 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_09300 5602 6030 gene locus_tag LOCUS_09310 gene rplP 5602 6030 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791549.1 protein_id gnl|my_center|LOCUS_09310 6034 6228 gene locus_tag LOCUS_09320 gene rpmC 6034 6228 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_09320 6231 6497 gene locus_tag LOCUS_09330 gene rpsQ 6231 6497 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_09330 6501 6866 gene locus_tag LOCUS_09340 gene rplN 6501 6866 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_09340 6896 7213 gene locus_tag LOCUS_09350 gene rplX 6896 7213 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence096 4395 2503 gene locus_tag LOCUS_09360 gene speA 4395 2503 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767598.1 protein_id gnl|my_center|LOCUS_09360 4956 4405 gene locus_tag LOCUS_09370 4956 4405 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_09370 7249 4967 gene locus_tag LOCUS_09380 gene topA 7249 4967 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence097 <1 1813 gene locus_tag LOCUS_09390 <1 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062175791.1:cell surface protein SprA 1932 3533 gene locus_tag LOCUS_09400 gene nadB 1932 3533 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_09400 3538 6537 gene locus_tag LOCUS_09410 3538 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 <7661 6816 gene locus_tag LOCUS_09420 <7661 6816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203408.1:diaminopimelate dehydrogenase >Feature sequence098 1425 121 gene locus_tag LOCUS_09430 gene thrC 1425 121 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_09430 2801 1557 gene locus_tag LOCUS_09440 2801 1557 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763759.1 protein_id gnl|my_center|LOCUS_09440 5295 2818 gene locus_tag LOCUS_09450 gene thrA 5295 2818 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_09450 6658 5486 gene locus_tag LOCUS_09460 6658 5486 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_09460 7611 6868 gene locus_tag LOCUS_09470 7611 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence099 584 30 gene locus_tag LOCUS_09480 584 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1144 590 gene locus_tag LOCUS_09490 1144 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1638 1183 gene locus_tag LOCUS_09500 1638 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2288 1641 gene locus_tag LOCUS_09510 2288 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2926 2285 gene locus_tag LOCUS_09520 2926 2285 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764600.1 protein_id gnl|my_center|LOCUS_09520 3503 2910 gene locus_tag LOCUS_09530 3503 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4067 3591 gene locus_tag LOCUS_09540 4067 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 5490 4138 gene locus_tag LOCUS_09550 5490 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence100 747 1922 gene locus_tag LOCUS_09560 747 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1965 2156 gene locus_tag LOCUS_09570 1965 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2161 2874 gene locus_tag LOCUS_09580 2161 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2990 5221 gene locus_tag LOCUS_09590 gene pnp 2990 5221 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765197.1 protein_id gnl|my_center|LOCUS_09590 7117 5303 gene locus_tag LOCUS_09600 7117 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 <7625 7114 gene locus_tag LOCUS_09610 <7625 7114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010993802.1:Lrp/AsnC ligand binding domain-containing protein >Feature sequence101 118 2145 gene locus_tag LOCUS_09620 118 2145 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_09620 2178 2609 gene locus_tag LOCUS_09630 gene rpiB 2178 2609 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_09630 2892 3626 gene locus_tag LOCUS_09640 2892 3626 CDS product DUF4348 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762407.1 protein_id gnl|my_center|LOCUS_09640 3692 4696 gene locus_tag LOCUS_09650 gene murB 3692 4696 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764915.1 protein_id gnl|my_center|LOCUS_09650 4837 5562 gene locus_tag LOCUS_09660 4837 5562 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107742.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence102 <1 2623 gene locus_tag LOCUS_09670 <1 2623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203455.1:putative LPS assembly protein LptD 4818 2692 gene locus_tag LOCUS_09680 4818 2692 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072067041.1 protein_id gnl|my_center|LOCUS_09680 5045 5848 gene locus_tag LOCUS_09690 gene hisG 5045 5848 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_09690 5877 7157 gene locus_tag LOCUS_09700 gene hisD 5877 7157 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766232.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence103 173 3460 gene locus_tag LOCUS_09710 173 3460 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_09710 3535 5283 gene locus_tag LOCUS_09720 3535 5283 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108167.1 protein_id gnl|my_center|LOCUS_09720 5307 5972 gene locus_tag LOCUS_09730 5307 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 6052 6960 gene locus_tag LOCUS_09740 6052 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 7173 7430 gene locus_tag LOCUS_09750 7173 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence104 986 147 gene locus_tag LOCUS_09760 986 147 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222589.1 protein_id gnl|my_center|LOCUS_09760 2262 3062 gene locus_tag LOCUS_09770 2262 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3200 3273 gene locus_tag LOCUS_t00090 3200 3273 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3326 3399 gene locus_tag LOCUS_t00100 3326 3399 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5965 3407 gene locus_tag LOCUS_09780 5965 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6728 5994 gene locus_tag LOCUS_09790 6728 5994 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788195.1 protein_id gnl|my_center|LOCUS_09790 7413 6730 gene locus_tag LOCUS_09800 7413 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence105 196 47 gene locus_tag LOCUS_09810 196 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1492 200 gene locus_tag LOCUS_09820 1492 200 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_09820 2190 1489 gene locus_tag LOCUS_09830 2190 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2449 2811 gene locus_tag LOCUS_09840 gene rplS 2449 2811 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_09840 4045 3749 gene locus_tag LOCUS_09850 4045 3749 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_09850 4181 4330 gene locus_tag LOCUS_09860 4181 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 4999 4427 gene locus_tag LOCUS_09870 4999 4427 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760056.1 protein_id gnl|my_center|LOCUS_09870 5606 5064 gene locus_tag LOCUS_09880 gene hpt 5606 5064 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_09880 5739 7265 gene locus_tag LOCUS_09890 5739 7265 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence106 1203 112 gene locus_tag LOCUS_09900 gene trpS 1203 112 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791788.1 protein_id gnl|my_center|LOCUS_09900 3115 1475 gene locus_tag LOCUS_09910 3115 1475 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765636.1 protein_id gnl|my_center|LOCUS_09910 5043 3226 gene locus_tag LOCUS_09920 5043 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 6106 5210 gene locus_tag LOCUS_09930 gene fabD 6106 5210 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_09930 6736 6212 gene locus_tag LOCUS_09940 gene rplI 6736 6212 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_09940 7028 6759 gene locus_tag LOCUS_09950 gene rpsR 7028 6759 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence107 1294 2406 gene locus_tag LOCUS_09960 1294 2406 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763566.1 protein_id gnl|my_center|LOCUS_09960 2409 3956 gene locus_tag LOCUS_09970 2409 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4837 4046 gene locus_tag LOCUS_09980 gene nagB 4837 4046 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_09980 6148 4955 gene locus_tag LOCUS_09990 6148 4955 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_09990 7198 6188 gene locus_tag LOCUS_10000 gene pta 7198 6188 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence108 202 1668 gene locus_tag LOCUS_10010 202 1668 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389785.1 protein_id gnl|my_center|LOCUS_10010 1809 2027 gene locus_tag LOCUS_10020 1809 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2020 3189 gene locus_tag LOCUS_10030 2020 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3202 4452 gene locus_tag LOCUS_10040 3202 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 4454 5662 gene locus_tag LOCUS_10050 4454 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 5684 6487 gene locus_tag LOCUS_10060 5684 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 6568 6861 gene locus_tag LOCUS_10070 6568 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 6851 7192 gene locus_tag LOCUS_10080 6851 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence109 64 1251 gene locus_tag LOCUS_10090 64 1251 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769170.1 protein_id gnl|my_center|LOCUS_10090 1256 2533 gene locus_tag LOCUS_10100 1256 2533 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_10100 2696 5218 gene locus_tag LOCUS_10110 2696 5218 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108580.1 protein_id gnl|my_center|LOCUS_10110 5221 6000 gene locus_tag LOCUS_10120 5221 6000 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108683.1 protein_id gnl|my_center|LOCUS_10120 6044 7162 gene locus_tag LOCUS_10130 6044 7162 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759848.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence110 4433 1011 gene locus_tag LOCUS_10140 4433 1011 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764381.1 protein_id gnl|my_center|LOCUS_10140 7305 4468 gene locus_tag LOCUS_10150 7305 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence111 77 964 gene locus_tag LOCUS_10160 77 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1036 1185 gene locus_tag LOCUS_10170 1036 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1224 3839 gene locus_tag LOCUS_10180 gene alaS 1224 3839 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_10180 7165 3992 gene locus_tag LOCUS_10190 7165 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence112 1883 2401 gene locus_tag LOCUS_10200 1883 2401 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203406.1 protein_id gnl|my_center|LOCUS_10200 2417 2647 gene locus_tag LOCUS_10210 2417 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10210 3414 3340 gene locus_tag LOCUS_t00110 3414 3340 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4489 3692 gene locus_tag LOCUS_10220 4489 3692 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025876514.1 protein_id gnl|my_center|LOCUS_10220 4907 4752 gene locus_tag LOCUS_10230 gene rpmH 4907 4752 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_10230 5575 6141 gene locus_tag LOCUS_10240 gene efp 5575 6141 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784338.1 protein_id gnl|my_center|LOCUS_10240 6144 7133 gene locus_tag LOCUS_10250 6144 7133 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784336.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence113 1456 2226 gene locus_tag LOCUS_10260 1456 2226 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083549713.1 protein_id gnl|my_center|LOCUS_10260 2243 5368 gene locus_tag LOCUS_10270 2243 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10270 5365 6606 gene locus_tag LOCUS_10280 5365 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence114 <1 1057 gene locus_tag LOCUS_10290 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946621.1:dicarboxylate/amino acid:cation symporter 1147 1794 gene locus_tag LOCUS_10300 1147 1794 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786122.1 protein_id gnl|my_center|LOCUS_10300 1869 3044 gene locus_tag LOCUS_10310 1869 3044 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202226.1 protein_id gnl|my_center|LOCUS_10310 3041 4237 gene locus_tag LOCUS_10320 3041 4237 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_10320 5082 4285 gene locus_tag LOCUS_10330 gene moeB 5082 4285 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460729.1 protein_id gnl|my_center|LOCUS_10330 6736 5093 gene locus_tag LOCUS_10340 gene thiC 6736 5093 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815685.1 protein_id gnl|my_center|LOCUS_10340 7129 6809 gene locus_tag LOCUS_10350 7129 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence115 1511 522 gene locus_tag LOCUS_10360 1511 522 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_10360 3794 1692 gene locus_tag LOCUS_10370 3794 1692 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_10370 5270 3960 gene locus_tag LOCUS_10380 5270 3960 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_10380 5801 5271 gene locus_tag LOCUS_10390 5801 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10390 <7172 5941 gene locus_tag LOCUS_10400 <7172 5941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760037.1:outer membrane protein transport protein >Feature sequence116 910 332 gene locus_tag LOCUS_10410 910 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1251 907 gene locus_tag LOCUS_10420 1251 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2520 1348 gene locus_tag LOCUS_10430 2520 1348 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949005.1 protein_id gnl|my_center|LOCUS_10430 2639 3487 gene locus_tag LOCUS_10440 2639 3487 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789684.1 protein_id gnl|my_center|LOCUS_10440 3562 5520 gene locus_tag LOCUS_10450 3562 5520 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765170.1 protein_id gnl|my_center|LOCUS_10450 5962 5564 gene locus_tag LOCUS_10460 5962 5564 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766716.1 protein_id gnl|my_center|LOCUS_10460 6587 6216 gene locus_tag LOCUS_10470 6587 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7092 6625 gene locus_tag LOCUS_10480 7092 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence117 142 678 gene locus_tag LOCUS_10490 142 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 784 1113 gene locus_tag LOCUS_10500 784 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1035 1259 gene locus_tag LOCUS_10510 1035 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1696 2847 gene locus_tag LOCUS_10520 1696 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 3126 3338 gene locus_tag LOCUS_10530 3126 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5437 3947 gene locus_tag LOCUS_10540 5437 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence118 930 2600 gene locus_tag LOCUS_10550 930 2600 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760612.1 protein_id gnl|my_center|LOCUS_10550 2737 3432 gene locus_tag LOCUS_10560 gene mtgA 2737 3432 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_10560 3429 5705 gene locus_tag LOCUS_10570 3429 5705 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_10570 5828 6781 gene locus_tag LOCUS_10580 5828 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6912 6840 gene locus_tag LOCUS_t00120 6912 6840 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence119 <1 1265 gene locus_tag LOCUS_10590 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109161.1:glycoside hydrolase family 28 protein 1271 2758 gene locus_tag LOCUS_10600 1271 2758 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_10600 4048 3056 gene locus_tag LOCUS_10610 4048 3056 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_10610 4921 4097 gene locus_tag LOCUS_10620 4921 4097 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_10620 5160 5327 gene locus_tag LOCUS_10630 5160 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6247 5330 gene locus_tag LOCUS_10640 6247 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6658 6936 gene locus_tag LOCUS_10650 6658 6936 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889719.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence120 <1 1020 gene locus_tag LOCUS_10660 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109367.1:glycosyl hydrolase 53 family protein 1017 1949 gene locus_tag LOCUS_10670 1017 1949 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993597.1 protein_id gnl|my_center|LOCUS_10670 2721 1873 gene locus_tag LOCUS_10680 2721 1873 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201882.1 protein_id gnl|my_center|LOCUS_10680 3423 2755 gene locus_tag LOCUS_10690 3423 2755 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896313.1 protein_id gnl|my_center|LOCUS_10690 4549 3479 gene locus_tag LOCUS_10700 4549 3479 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555689.1 protein_id gnl|my_center|LOCUS_10700 5562 4573 gene locus_tag LOCUS_10710 5562 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 5743 6942 gene locus_tag LOCUS_10720 5743 6942 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987112.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence121 1956 286 gene locus_tag LOCUS_10730 1956 286 CDS product DUF5114 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109368.1 protein_id gnl|my_center|LOCUS_10730 3628 2132 gene locus_tag LOCUS_10740 3628 2132 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109369.1 protein_id gnl|my_center|LOCUS_10740 6758 3810 gene locus_tag LOCUS_10750 6758 3810 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109370.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence122 1618 143 gene locus_tag LOCUS_10760 1618 143 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764161.1 protein_id gnl|my_center|LOCUS_10760 1824 2510 gene locus_tag LOCUS_10770 1824 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2533 3360 gene locus_tag LOCUS_10780 2533 3360 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764616.1 protein_id gnl|my_center|LOCUS_10780 3446 4201 gene locus_tag LOCUS_10790 gene tsaB 3446 4201 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_10790 4245 4844 gene locus_tag LOCUS_10800 4245 4844 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_10800 4904 6208 gene locus_tag LOCUS_10810 gene murA 4904 6208 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_10810 6231 6737 gene locus_tag LOCUS_10820 gene rimM 6231 6737 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761107.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence123 808 2 gene locus_tag LOCUS_10830 808 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2329 1115 gene locus_tag LOCUS_10840 2329 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 4840 2339 gene locus_tag LOCUS_10850 gene galB 4840 2339 CDS product beta-galactosidase GalB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107279.1 protein_id gnl|my_center|LOCUS_10850 6352 4853 gene locus_tag LOCUS_10860 6352 4853 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence124 214 474 gene locus_tag LOCUS_10870 214 474 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_10870 507 2009 gene locus_tag LOCUS_10880 507 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2000 4429 gene locus_tag LOCUS_10890 2000 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 4509 4727 gene locus_tag LOCUS_10900 4509 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 4941 4711 gene locus_tag LOCUS_10910 4941 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 5573 4872 gene locus_tag LOCUS_10920 5573 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 6493 5708 gene locus_tag LOCUS_10930 6493 5708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence125 489 1010 gene locus_tag LOCUS_10940 489 1010 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699994.1 protein_id gnl|my_center|LOCUS_10940 1750 1019 gene locus_tag LOCUS_10950 1750 1019 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_10950 1871 2071 gene locus_tag LOCUS_10960 1871 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2068 2313 gene locus_tag LOCUS_10970 2068 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2319 2852 gene locus_tag LOCUS_10980 2319 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 4854 3043 gene locus_tag LOCUS_10990 4854 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 5046 5567 gene locus_tag LOCUS_11000 5046 5567 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_11000 6664 5672 gene locus_tag LOCUS_11010 6664 5672 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence126 128 1294 gene locus_tag LOCUS_11020 128 1294 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_11020 1304 2476 gene locus_tag LOCUS_11030 1304 2476 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767015.1 protein_id gnl|my_center|LOCUS_11030 2499 4823 gene locus_tag LOCUS_11040 2499 4823 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 protein_id gnl|my_center|LOCUS_11040 4941 6356 gene locus_tag LOCUS_11050 gene uxaC 4941 6356 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_11050 6485 6558 gene locus_tag LOCUS_t00130 6485 6558 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 646 356 gene locus_tag LOCUS_11060 646 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1886 675 gene locus_tag LOCUS_11070 1886 675 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_11070 3595 1994 gene locus_tag LOCUS_11080 3595 1994 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661313.1 protein_id gnl|my_center|LOCUS_11080 4789 3836 gene locus_tag LOCUS_11090 4789 3836 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_11090 4935 5756 gene locus_tag LOCUS_11100 4935 5756 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence128 1114 176 gene locus_tag LOCUS_11110 1114 176 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762996.1 protein_id gnl|my_center|LOCUS_11110 1666 1391 gene locus_tag LOCUS_11120 1666 1391 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_11120 1899 1669 gene locus_tag LOCUS_11130 1899 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 2599 2324 gene locus_tag LOCUS_11140 2599 2324 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_11140 2856 2596 gene locus_tag LOCUS_11150 2856 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5044 3452 gene locus_tag LOCUS_11160 5044 3452 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_11160 5224 6555 gene locus_tag LOCUS_11170 gene xseA 5224 6555 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence129 767 384 gene locus_tag LOCUS_11180 767 384 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_11180 4236 787 gene locus_tag LOCUS_11190 gene ileS 4236 787 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107458.1 protein_id gnl|my_center|LOCUS_11190 5515 4247 gene locus_tag LOCUS_11200 5515 4247 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_11200 6630 5569 gene locus_tag LOCUS_11210 6630 5569 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107809.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence130 193 2100 gene locus_tag LOCUS_11220 193 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 2151 6107 gene locus_tag LOCUS_11230 2151 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence131 1345 215 gene locus_tag LOCUS_11240 1345 215 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763424.1 protein_id gnl|my_center|LOCUS_11240 2810 1572 gene locus_tag LOCUS_11250 2810 1572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763377.1 protein_id gnl|my_center|LOCUS_11250 2902 3459 gene locus_tag LOCUS_11260 2902 3459 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658777.1 protein_id gnl|my_center|LOCUS_11260 3522 5408 gene locus_tag LOCUS_11270 3522 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 5680 6279 gene locus_tag LOCUS_11280 5680 6279 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence132 <1 790 gene locus_tag LOCUS_11290 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798174.1:uracil-DNA glycosylase 2811 934 gene locus_tag LOCUS_11300 2811 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4679 2937 gene locus_tag LOCUS_11310 4679 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 5460 4741 gene locus_tag LOCUS_11320 5460 4741 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_11320 6343 5450 gene locus_tag LOCUS_11330 6343 5450 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763406.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence133 2629 146 gene locus_tag LOCUS_11340 gene pheT 2629 146 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_11340 3547 2870 gene locus_tag LOCUS_11350 3547 2870 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_11350 3963 3649 gene locus_tag LOCUS_11360 3963 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4295 4789 gene locus_tag LOCUS_11370 gene fldA 4295 4789 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855629.1 protein_id gnl|my_center|LOCUS_11370 4827 5249 gene locus_tag LOCUS_11380 4827 5249 CDS product DUF2023 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788315.1 protein_id gnl|my_center|LOCUS_11380 5438 5722 gene locus_tag LOCUS_11390 5438 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 5834 6088 gene locus_tag LOCUS_11400 5834 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6078 6398 gene locus_tag LOCUS_11410 6078 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence134 74 673 gene locus_tag LOCUS_11420 74 673 CDS product DUF4254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_11420 1792 785 gene locus_tag LOCUS_11430 1792 785 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108790.1 protein_id gnl|my_center|LOCUS_11430 3013 1913 gene locus_tag LOCUS_11440 3013 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6233 3186 gene locus_tag LOCUS_11450 6233 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence135 99 650 gene locus_tag LOCUS_11460 99 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 4911 601 gene locus_tag LOCUS_11470 4911 601 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_11470 5617 4955 gene locus_tag LOCUS_11480 5617 4955 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_11480 6174 5632 gene locus_tag LOCUS_11490 6174 5632 CDS product DUF4494 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762440.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence136 49 585 gene locus_tag LOCUS_11500 49 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 634 1746 gene locus_tag LOCUS_11510 gene gmd 634 1746 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107662.1 protein_id gnl|my_center|LOCUS_11510 1755 2714 gene locus_tag LOCUS_11520 1755 2714 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763623.1 protein_id gnl|my_center|LOCUS_11520 2735 3301 gene locus_tag LOCUS_11530 2735 3301 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109029.1 protein_id gnl|my_center|LOCUS_11530 3768 5084 gene locus_tag LOCUS_11540 3768 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 5103 6059 gene locus_tag LOCUS_11550 gene fmt 5103 6059 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence137 222 1409 gene locus_tag LOCUS_11560 222 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1835 1470 gene locus_tag LOCUS_11570 gene crcB 1835 1470 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_11570 2124 1873 gene locus_tag LOCUS_11580 2124 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 2439 2137 gene locus_tag LOCUS_11590 2439 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2972 2796 gene locus_tag LOCUS_11600 2972 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3095 4018 gene locus_tag LOCUS_11610 3095 4018 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227110.1 protein_id gnl|my_center|LOCUS_11610 4058 5131 gene locus_tag LOCUS_11620 4058 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 6050 5376 gene locus_tag LOCUS_11630 6050 5376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence138 70 687 gene locus_tag LOCUS_11640 70 687 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776695.1 protein_id gnl|my_center|LOCUS_11640 2042 798 gene locus_tag LOCUS_11650 2042 798 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_11650 2296 2814 gene locus_tag LOCUS_11660 2296 2814 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_11660 2839 3234 gene locus_tag LOCUS_11670 2839 3234 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783508.1 protein_id gnl|my_center|LOCUS_11670 3401 4939 gene locus_tag LOCUS_11680 3401 4939 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_11680 5085 4918 gene locus_tag LOCUS_11690 5085 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 5240 6145 gene locus_tag LOCUS_11700 5240 6145 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790916.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence139 423 4235 gene locus_tag LOCUS_11710 gene rpoB 423 4235 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791521.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence140 261 1271 gene locus_tag LOCUS_11720 gene galE 261 1271 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_11720 1309 2346 gene locus_tag LOCUS_11730 gene rlmN 1309 2346 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202252.1 protein_id gnl|my_center|LOCUS_11730 2346 4283 gene locus_tag LOCUS_11740 2346 4283 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_11740 4341 5264 gene locus_tag LOCUS_11750 gene metA 4341 5264 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_11750 5399 5474 gene locus_tag LOCUS_t00140 5399 5474 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6085 5534 gene locus_tag LOCUS_11760 6085 5534 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902348.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence141 <1 1445 gene locus_tag LOCUS_11770 <1 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767909.1:aminoacyl-histidine dipeptidase 1409 2212 gene locus_tag LOCUS_11780 1409 2212 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_11780 4221 2227 gene locus_tag LOCUS_11790 4221 2227 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108682.1 protein_id gnl|my_center|LOCUS_11790 5179 4334 gene locus_tag LOCUS_11800 gene panC 5179 4334 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966198.1 protein_id gnl|my_center|LOCUS_11800 5995 5201 gene locus_tag LOCUS_11810 gene panB 5995 5201 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966197.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence142 251 748 gene locus_tag LOCUS_11820 gene atpF 251 748 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_11820 781 1317 gene locus_tag LOCUS_11830 781 1317 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082066.1 protein_id gnl|my_center|LOCUS_11830 1324 2907 gene locus_tag LOCUS_11840 gene atpA 1324 2907 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_11840 3026 3919 gene locus_tag LOCUS_11850 3026 3919 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761394.1 protein_id gnl|my_center|LOCUS_11850 4068 5018 gene locus_tag LOCUS_11860 4068 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 5475 5059 gene locus_tag LOCUS_11870 5475 5059 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_11870 6071 5475 gene locus_tag LOCUS_11880 6071 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence143 998 81 gene locus_tag LOCUS_11890 gene xerD 998 81 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_11890 1331 1071 gene locus_tag LOCUS_11900 1331 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 2941 1568 gene locus_tag LOCUS_11910 gene pelB 2941 1568 CDS product exopolygalacturonase PelB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865120.1 protein_id gnl|my_center|LOCUS_11910 3133 3906 gene locus_tag LOCUS_11920 3133 3906 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791451.1 protein_id gnl|my_center|LOCUS_11920 4066 4464 gene locus_tag LOCUS_11930 4066 4464 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109028.1 protein_id gnl|my_center|LOCUS_11930 4458 6113 gene locus_tag LOCUS_11940 4458 6113 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762692.1 protein_id gnl|my_center|LOCUS_11940 >Feature sequence144 2967 2248 gene locus_tag LOCUS_11950 gene pgeF 2967 2248 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291723.1 protein_id gnl|my_center|LOCUS_11950 4251 3046 gene locus_tag LOCUS_11960 gene obgE 4251 3046 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785536.1 protein_id gnl|my_center|LOCUS_11960 6005 4548 gene locus_tag LOCUS_11970 gene rodA 6005 4548 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792061.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence145 52 1155 gene locus_tag LOCUS_11980 gene hemW 52 1155 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_11980 2508 1177 gene locus_tag LOCUS_11990 2508 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2750 2908 gene locus_tag LOCUS_12000 2750 2908 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933679.1 protein_id gnl|my_center|LOCUS_12000 3006 3980 gene locus_tag LOCUS_12010 3006 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4394 5644 gene locus_tag LOCUS_12020 4394 5644 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence146 264 764 gene locus_tag LOCUS_12030 264 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2261 933 gene locus_tag LOCUS_12040 2261 933 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068386.1 protein_id gnl|my_center|LOCUS_12040 3086 2526 gene locus_tag LOCUS_12050 3086 2526 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107336.1 protein_id gnl|my_center|LOCUS_12050 4355 3138 gene locus_tag LOCUS_12060 4355 3138 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040027.1 protein_id gnl|my_center|LOCUS_12060 5205 5942 gene locus_tag LOCUS_12070 5205 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence147 113 195 gene locus_tag LOCUS_t00150 113 195 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 817 263 gene locus_tag LOCUS_12080 817 263 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108149.1 protein_id gnl|my_center|LOCUS_12080 2475 829 gene locus_tag LOCUS_12090 2475 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2553 5861 gene locus_tag LOCUS_12100 2553 5861 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence148 1028 123 gene locus_tag LOCUS_12110 1028 123 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_12110 1524 1141 gene locus_tag LOCUS_12120 1524 1141 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804269.1 protein_id gnl|my_center|LOCUS_12120 2384 1509 gene locus_tag LOCUS_12130 2384 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3096 2398 gene locus_tag LOCUS_12140 3096 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4075 3257 gene locus_tag LOCUS_12150 4075 3257 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770315.1 protein_id gnl|my_center|LOCUS_12150 5106 5309 gene locus_tag LOCUS_12160 5106 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 5306 5599 gene locus_tag LOCUS_12170 5306 5599 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812628.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence149 819 304 gene locus_tag LOCUS_12180 819 304 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065697.1 protein_id gnl|my_center|LOCUS_12180 946 2322 gene locus_tag LOCUS_12190 946 2322 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766607.1 protein_id gnl|my_center|LOCUS_12190 2315 2938 gene locus_tag LOCUS_12200 2315 2938 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766580.1 protein_id gnl|my_center|LOCUS_12200 2942 3622 gene locus_tag LOCUS_12210 gene tsaA 2942 3622 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459538.1 protein_id gnl|my_center|LOCUS_12210 3692 3780 gene locus_tag LOCUS_t00160 3692 3780 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4139 4411 gene locus_tag LOCUS_12220 4139 4411 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_12220 4421 5794 gene locus_tag LOCUS_12230 4421 5794 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence150 <1 543 gene locus_tag LOCUS_12240 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814383.1:DUF177 domain-containing protein 587 772 gene locus_tag LOCUS_12250 gene rpmF 587 772 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002562387.1 protein_id gnl|my_center|LOCUS_12250 787 1785 gene locus_tag LOCUS_12260 787 1785 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760764.1 protein_id gnl|my_center|LOCUS_12260 1871 2755 gene locus_tag LOCUS_12270 gene era 1871 2755 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_12270 2918 4231 gene locus_tag LOCUS_12280 gene der 2918 4231 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782289.1 protein_id gnl|my_center|LOCUS_12280 5510 5316 gene locus_tag LOCUS_12290 5510 5316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence151 148 1245 gene locus_tag LOCUS_12300 148 1245 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461650.1 protein_id gnl|my_center|LOCUS_12300 1729 2994 gene locus_tag LOCUS_12310 gene ribD 1729 2994 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987156.1 protein_id gnl|my_center|LOCUS_12310 3055 3765 gene locus_tag LOCUS_12320 gene ribE 3055 3765 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000493840.1 protein_id gnl|my_center|LOCUS_12320 3931 5145 gene locus_tag LOCUS_12330 3931 5145 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456640.1 protein_id gnl|my_center|LOCUS_12330 5270 5731 gene locus_tag LOCUS_12340 gene ribE 5270 5731 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence152 3083 714 gene locus_tag LOCUS_12350 3083 714 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303124.1 protein_id gnl|my_center|LOCUS_12350 5150 3234 gene locus_tag LOCUS_12360 5150 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence153 1624 314 gene locus_tag LOCUS_12370 1624 314 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 protein_id gnl|my_center|LOCUS_12370 1787 3310 gene locus_tag LOCUS_12380 gene accC 1787 3310 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_12380 3345 3857 gene locus_tag LOCUS_12390 3345 3857 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790282.1 protein_id gnl|my_center|LOCUS_12390 3891 5333 gene locus_tag LOCUS_12400 3891 5333 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766267.1 protein_id gnl|my_center|LOCUS_12400 5655 5488 gene locus_tag LOCUS_12410 5655 5488 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence154 785 72 gene locus_tag LOCUS_12420 785 72 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003570151.1 protein_id gnl|my_center|LOCUS_12420 1433 789 gene locus_tag LOCUS_12430 1433 789 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 protein_id gnl|my_center|LOCUS_12430 3225 1465 gene locus_tag LOCUS_12440 3225 1465 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203603.1 protein_id gnl|my_center|LOCUS_12440 3548 3357 gene locus_tag LOCUS_12450 3548 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 <5677 3562 gene locus_tag LOCUS_12460 <5677 3562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107571.1:glycoside hydrolase family 88 protein >Feature sequence155 1940 159 gene locus_tag LOCUS_12470 gene lepA 1940 159 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_12470 2546 3028 gene locus_tag LOCUS_12480 2546 3028 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_12480 5580 3094 gene locus_tag LOCUS_12490 5580 3094 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803825.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence156 <1 2452 gene locus_tag LOCUS_12500 <1 2452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793926.1:endopeptidase La 2449 3576 gene locus_tag LOCUS_12510 gene tgt 2449 3576 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202814.1 protein_id gnl|my_center|LOCUS_12510 3969 4715 gene locus_tag LOCUS_12520 3969 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence157 622 1956 gene locus_tag LOCUS_12530 622 1956 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766603.1 protein_id gnl|my_center|LOCUS_12530 1967 3052 gene locus_tag LOCUS_12540 1967 3052 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203256.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence158 1387 443 gene locus_tag LOCUS_12550 1387 443 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785352.1 protein_id gnl|my_center|LOCUS_12550 2342 1380 gene locus_tag LOCUS_12560 gene miaA 2342 1380 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_12560 5422 2339 gene locus_tag LOCUS_12570 gene carB 5422 2339 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799108.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence159 213 836 gene locus_tag LOCUS_12580 213 836 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_12580 833 1702 gene locus_tag LOCUS_12590 833 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1699 3924 gene locus_tag LOCUS_12600 1699 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3932 4558 gene locus_tag LOCUS_12610 gene recR 3932 4558 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence160 956 327 gene locus_tag LOCUS_12620 956 327 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788593.1 protein_id gnl|my_center|LOCUS_12620 2200 956 gene locus_tag LOCUS_12630 2200 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 3964 2204 gene locus_tag LOCUS_12640 3964 2204 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107711.1 protein_id gnl|my_center|LOCUS_12640 4099 4992 gene locus_tag LOCUS_12650 4099 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence161 <1 748 gene locus_tag LOCUS_12660 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010536410.1:L-rhamnose isomerase 841 1875 gene locus_tag LOCUS_12670 gene rhaT 841 1875 CDS product L-rhamnose/proton symporter RhaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 protein_id gnl|my_center|LOCUS_12670 1764 1985 gene locus_tag LOCUS_12680 1764 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2060 2881 gene locus_tag LOCUS_12690 gene rhaD 2060 2881 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_12690 3004 3786 gene locus_tag LOCUS_12700 3004 3786 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_12700 3879 4922 gene locus_tag LOCUS_12710 gene ilvC 3879 4922 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence162 131 1000 gene locus_tag LOCUS_12720 131 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1007 1738 gene locus_tag LOCUS_12730 1007 1738 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_12730 2685 1774 gene locus_tag LOCUS_12740 2685 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 5138 2682 gene locus_tag LOCUS_12750 5138 2682 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108921.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence163 1989 40 gene locus_tag LOCUS_12760 1989 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3012 2014 gene locus_tag LOCUS_12770 3012 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4770 3103 gene locus_tag LOCUS_12780 4770 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence164 >Feature sequence165 4277 321 gene locus_tag LOCUS_12790 4277 321 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109153.1 protein_id gnl|my_center|LOCUS_12790 4501 5094 gene locus_tag LOCUS_12800 4501 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence166 <1 2584 gene locus_tag LOCUS_12810 <1 2584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789604.1:excinuclease ABC subunit UvrA 3630 2587 gene locus_tag LOCUS_12820 3630 2587 CDS product DUF4421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107781.1 protein_id gnl|my_center|LOCUS_12820 4684 3704 gene locus_tag LOCUS_12830 4684 3704 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_12830 5301 4681 gene locus_tag LOCUS_12840 5301 4681 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence167 3090 43 gene locus_tag LOCUS_12850 3090 43 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107218.1 protein_id gnl|my_center|LOCUS_12850 5323 3116 gene locus_tag LOCUS_12860 5323 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence168 <1 1303 gene locus_tag LOCUS_12870 <1 1303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966224.1:sodium:proton antiporter NhaD 1948 4920 gene locus_tag LOCUS_12880 1948 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4928 5245 gene locus_tag LOCUS_12890 4928 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence169 675 172 gene locus_tag LOCUS_12900 675 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1924 1184 gene locus_tag LOCUS_12910 1924 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 5105 2133 gene locus_tag LOCUS_12920 gene secDF 5105 2133 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_12920 5247 5074 gene locus_tag LOCUS_12930 5247 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence170 4839 340 gene locus_tag LOCUS_12940 4839 340 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203588.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence171 1729 320 gene locus_tag LOCUS_12950 gene rseP 1729 320 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203410.1 protein_id gnl|my_center|LOCUS_12950 2815 1919 gene locus_tag LOCUS_12960 2815 1919 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203118.1 protein_id gnl|my_center|LOCUS_12960 4164 3013 gene locus_tag LOCUS_12970 4164 3013 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766370.1 protein_id gnl|my_center|LOCUS_12970 4367 4296 gene locus_tag LOCUS_t00170 4367 4296 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4999 4571 gene locus_tag LOCUS_12980 4999 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence172 182 448 gene locus_tag LOCUS_12990 182 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 438 713 gene locus_tag LOCUS_13000 438 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1087 2061 gene locus_tag LOCUS_13010 1087 2061 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_13010 2909 2172 gene locus_tag LOCUS_13020 2909 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence173 625 206 gene locus_tag LOCUS_13030 gene tsaE 625 206 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_13030 2176 632 gene locus_tag LOCUS_13040 2176 632 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_13040 2650 2180 gene locus_tag LOCUS_13050 2650 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 3865 2651 gene locus_tag LOCUS_13060 3865 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5007 3898 gene locus_tag LOCUS_13070 5007 3898 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence174 2294 387 gene locus_tag LOCUS_13080 2294 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 2528 5005 gene locus_tag LOCUS_13090 2528 5005 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202242.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence175 107 961 gene locus_tag LOCUS_13100 gene nadC 107 961 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762206.1 protein_id gnl|my_center|LOCUS_13100 988 1872 gene locus_tag LOCUS_13110 gene rfbD 988 1872 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107282.1 protein_id gnl|my_center|LOCUS_13110 1899 2804 gene locus_tag LOCUS_13120 gene rfbA 1899 2804 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202141.1 protein_id gnl|my_center|LOCUS_13120 3185 3769 gene locus_tag LOCUS_13130 gene rfbC 3185 3769 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_13130 3776 4909 gene locus_tag LOCUS_13140 gene rfbB 3776 4909 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766020.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence176 407 2503 gene locus_tag LOCUS_13150 407 2503 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_13150 2510 3787 gene locus_tag LOCUS_13160 gene purD 2510 3787 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108718.1 protein_id gnl|my_center|LOCUS_13160 3789 4181 gene locus_tag LOCUS_13170 3789 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 4191 4661 gene locus_tag LOCUS_13180 4191 4661 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108716.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence177 86 1885 gene locus_tag LOCUS_13190 gene typA 86 1885 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_13190 1888 2460 gene locus_tag LOCUS_13200 1888 2460 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789600.1 protein_id gnl|my_center|LOCUS_13200 2472 2849 gene locus_tag LOCUS_13210 2472 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 3739 2954 gene locus_tag LOCUS_13220 3739 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4331 4462 gene locus_tag LOCUS_13230 4331 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence178 53 175 gene locus_tag LOCUS_13240 53 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 226 1917 gene locus_tag LOCUS_13250 226 1917 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055228983.1 protein_id gnl|my_center|LOCUS_13250 1959 2462 gene locus_tag LOCUS_13260 1959 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2571 2660 gene locus_tag LOCUS_t00180 2571 2660 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5134 2723 gene locus_tag LOCUS_13270 5134 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence179 220 624 gene locus_tag LOCUS_13280 220 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 636 1271 gene locus_tag LOCUS_13290 636 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1375 1995 gene locus_tag LOCUS_13300 1375 1995 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_13300 2504 2857 gene locus_tag LOCUS_13310 2504 2857 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813773.1 protein_id gnl|my_center|LOCUS_13310 3046 4977 gene locus_tag LOCUS_13320 3046 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence180 896 258 gene locus_tag LOCUS_13330 896 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1792 1034 gene locus_tag LOCUS_13340 1792 1034 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761731.1 protein_id gnl|my_center|LOCUS_13340 2136 1867 gene locus_tag LOCUS_13350 2136 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 4281 2302 gene locus_tag LOCUS_13360 4281 2302 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761732.1 protein_id gnl|my_center|LOCUS_13360 5068 4442 gene locus_tag LOCUS_13370 5068 4442 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783488.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence181 1257 370 gene locus_tag LOCUS_13380 1257 370 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_13380 2320 1265 gene locus_tag LOCUS_13390 2320 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 4087 2324 gene locus_tag LOCUS_13400 4087 2324 CDS product phosphoethanolamine transferase CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192092.1 protein_id gnl|my_center|LOCUS_13400 4911 4279 gene locus_tag LOCUS_13410 4911 4279 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence182 2497 503 gene locus_tag LOCUS_13420 gene ccsA 2497 503 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680415.1 protein_id gnl|my_center|LOCUS_13420 3642 2497 gene locus_tag LOCUS_13430 3642 2497 CDS product Rid family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005680414.1 protein_id gnl|my_center|LOCUS_13430 4296 3661 gene locus_tag LOCUS_13440 4296 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4978 4394 gene locus_tag LOCUS_13450 gene gmk 4978 4394 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence183 1287 253 gene locus_tag LOCUS_13460 1287 253 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_13460 2352 1294 gene locus_tag LOCUS_13470 2352 1294 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107326.1 protein_id gnl|my_center|LOCUS_13470 3904 2357 gene locus_tag LOCUS_13480 3904 2357 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107325.1 protein_id gnl|my_center|LOCUS_13480 4846 3959 gene locus_tag LOCUS_13490 4846 3959 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence184 1412 138 gene locus_tag LOCUS_13500 1412 138 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_13500 1574 2482 gene locus_tag LOCUS_13510 1574 2482 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107322.1 protein_id gnl|my_center|LOCUS_13510 3276 2944 gene locus_tag LOCUS_13520 3276 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 3906 3298 gene locus_tag LOCUS_13530 3906 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 4778 3918 gene locus_tag LOCUS_13540 4778 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence185 95 4855 gene locus_tag LOCUS_13550 95 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence186 <1 1315 gene locus_tag LOCUS_13560 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784384.1:argininosuccinate lyase 1391 3139 gene locus_tag LOCUS_13570 1391 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3189 3308 gene locus_tag LOCUS_13580 3189 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3506 4069 gene locus_tag LOCUS_13590 3506 4069 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940933.1 protein_id gnl|my_center|LOCUS_13590 4074 4775 gene locus_tag LOCUS_13600 gene aat 4074 4775 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546338.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence187 845 120 gene locus_tag LOCUS_13610 845 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2920 863 gene locus_tag LOCUS_13620 2920 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3637 4875 gene locus_tag LOCUS_13630 3637 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence188 255 512 gene locus_tag LOCUS_13640 255 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 433 1398 gene locus_tag LOCUS_13650 433 1398 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_13650 1499 2410 gene locus_tag LOCUS_13660 1499 2410 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_13660 2468 3427 gene locus_tag LOCUS_13670 2468 3427 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_13670 3588 4202 gene locus_tag LOCUS_13680 3588 4202 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461640.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence189 1086 25 gene locus_tag LOCUS_13690 1086 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2326 1181 gene locus_tag LOCUS_13700 2326 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 4981 2411 gene locus_tag LOCUS_13710 gene gyrA 4981 2411 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence190 <1 866 gene locus_tag LOCUS_13720 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005801668.1:S41 family peptidase 1522 815 gene locus_tag LOCUS_13730 1522 815 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_13730 2091 1531 gene locus_tag LOCUS_13740 2091 1531 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760842.1 protein_id gnl|my_center|LOCUS_13740 2175 3062 gene locus_tag LOCUS_13750 2175 3062 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760837.1 protein_id gnl|my_center|LOCUS_13750 3300 4928 gene locus_tag LOCUS_13760 3300 4928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107086.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence191 100 2037 gene locus_tag LOCUS_13770 gene dnaG 100 2037 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_13770 2294 3265 gene locus_tag LOCUS_13780 2294 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3335 3808 gene locus_tag LOCUS_13790 3335 3808 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203066.1 protein_id gnl|my_center|LOCUS_13790 3817 4767 gene locus_tag LOCUS_13800 gene trxB 3817 4767 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_13800 4881 4955 gene locus_tag LOCUS_t00190 4881 4955 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence192 1538 240 gene locus_tag LOCUS_13810 1538 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2763 1702 gene locus_tag LOCUS_13820 gene tilS 2763 1702 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202409.1 protein_id gnl|my_center|LOCUS_13820 4216 3041 gene locus_tag LOCUS_13830 4216 3041 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760004.1 protein_id gnl|my_center|LOCUS_13830 <4899 4191 gene locus_tag LOCUS_13840 <4899 4191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760005.1:3'-5' exonuclease >Feature sequence193 2367 112 gene locus_tag LOCUS_13850 2367 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2942 2364 gene locus_tag LOCUS_13860 2942 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4086 2962 gene locus_tag LOCUS_13870 4086 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence194 1246 416 gene locus_tag LOCUS_13880 1246 416 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044995.1 protein_id gnl|my_center|LOCUS_13880 1924 1274 gene locus_tag LOCUS_13890 1924 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942017.1 protein_id gnl|my_center|LOCUS_13890 2477 3121 gene locus_tag LOCUS_13900 2477 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3144 4217 gene locus_tag LOCUS_13910 3144 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence195 <1 1434 gene locus_tag LOCUS_13920 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763196.1:2-isopropylmalate synthase 1440 2837 gene locus_tag LOCUS_13930 gene leuC 1440 2837 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_13930 2853 3476 gene locus_tag LOCUS_13940 gene leuD 2853 3476 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence196 63 980 gene locus_tag LOCUS_13950 63 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1785 2780 gene locus_tag LOCUS_13960 1785 2780 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791345.1 protein_id gnl|my_center|LOCUS_13960 2812 3366 gene locus_tag LOCUS_13970 2812 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 3745 3464 gene locus_tag LOCUS_13980 3745 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4148 4402 gene locus_tag LOCUS_13990 4148 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4399 4581 gene locus_tag LOCUS_14000 4399 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence197 4268 3282 gene locus_tag LOCUS_14010 4268 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence198 <1 738 gene locus_tag LOCUS_14020 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288289.1:alpha/beta hydrolase 861 1874 gene locus_tag LOCUS_14030 861 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2388 3845 gene locus_tag LOCUS_14040 2388 3845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3848 4222 gene locus_tag LOCUS_14050 3848 4222 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477789.1 protein_id gnl|my_center|LOCUS_14050 4374 4301 gene locus_tag LOCUS_t00200 4374 4301 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence199 7 1398 gene locus_tag LOCUS_14060 7 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1528 2925 gene locus_tag LOCUS_14070 1528 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2983 3939 gene locus_tag LOCUS_14080 2983 3939 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_14080 <4664 4145 gene locus_tag LOCUS_14090 <4664 4145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791020.1:phosphoglucosamine mutase >Feature sequence200 2310 1471 gene locus_tag LOCUS_14100 2310 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963974.1 protein_id gnl|my_center|LOCUS_14100 4589 2472 gene locus_tag LOCUS_14110 gene rhgX 4589 2472 CDS product rhamnogalacturonan exolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886437.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence201 66 1454 gene locus_tag LOCUS_14120 66 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1657 2574 gene locus_tag LOCUS_14130 1657 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14130 3564 2686 gene locus_tag LOCUS_14140 3564 2686 CDS product glycosyl transferase family 90 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108791.1 protein_id gnl|my_center|LOCUS_14140 4564 3722 gene locus_tag LOCUS_14150 4564 3722 CDS product DUF4422 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476440.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence202 411 1841 gene locus_tag LOCUS_14160 411 1841 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130286390.1 protein_id gnl|my_center|LOCUS_14160 1838 2599 gene locus_tag LOCUS_14170 gene surE 1838 2599 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784852.1 protein_id gnl|my_center|LOCUS_14170 2596 3750 gene locus_tag LOCUS_14180 gene lpxB 2596 3750 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_14180 3757 4554 gene locus_tag LOCUS_14190 3757 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence203 225 794 gene locus_tag LOCUS_14200 225 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1759 1926 gene locus_tag LOCUS_14210 1759 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2083 2544 gene locus_tag LOCUS_14220 2083 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3012 4142 gene locus_tag LOCUS_14230 3012 4142 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005834079.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence204 1162 41 gene locus_tag LOCUS_14240 gene glf 1162 41 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922747.1 protein_id gnl|my_center|LOCUS_14240 2400 1159 gene locus_tag LOCUS_14250 2400 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence205 47 796 gene locus_tag LOCUS_14260 47 796 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_14260 818 1681 gene locus_tag LOCUS_14270 818 1681 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761810.1 protein_id gnl|my_center|LOCUS_14270 1790 2656 gene locus_tag LOCUS_14280 1790 2656 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761103.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence206 551 2398 gene locus_tag LOCUS_14290 551 2398 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108505.1 protein_id gnl|my_center|LOCUS_14290 2507 2890 gene locus_tag LOCUS_14300 2507 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2990 3994 gene locus_tag LOCUS_14310 2990 3994 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence207 2444 216 gene locus_tag LOCUS_14320 gene rnr 2444 216 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783524.1 protein_id gnl|my_center|LOCUS_14320 4292 2559 gene locus_tag LOCUS_14330 4292 2559 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence208 79 465 gene locus_tag LOCUS_14340 gene rpsK 79 465 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_14340 520 1125 gene locus_tag LOCUS_14350 gene rpsD 520 1125 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_14350 1137 2129 gene locus_tag LOCUS_14360 1137 2129 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_14360 2169 2654 gene locus_tag LOCUS_14370 2169 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 2776 3180 gene locus_tag LOCUS_14380 gene rplS 2776 3180 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675578.1 protein_id gnl|my_center|LOCUS_14380 4272 3529 gene locus_tag LOCUS_14390 4272 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence209 2474 2172 gene locus_tag LOCUS_14400 2474 2172 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258468.1 protein_id gnl|my_center|LOCUS_14400 3086 2487 gene locus_tag LOCUS_14410 3086 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 4226 3717 gene locus_tag LOCUS_14420 4226 3717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence210 >Feature sequence211 35 625 gene locus_tag LOCUS_14430 35 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 723 1199 gene locus_tag LOCUS_14440 gene argR 723 1199 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796492.1 protein_id gnl|my_center|LOCUS_14440 1294 1908 gene locus_tag LOCUS_14450 1294 1908 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 protein_id gnl|my_center|LOCUS_14450 2038 3231 gene locus_tag LOCUS_14460 2038 3231 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 protein_id gnl|my_center|LOCUS_14460 3400 3783 gene locus_tag LOCUS_14470 3400 3783 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687278.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence212 1749 169 gene locus_tag LOCUS_14480 1749 169 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_14480 2594 1950 gene locus_tag LOCUS_14490 2594 1950 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788064.1 protein_id gnl|my_center|LOCUS_14490 3666 2653 gene locus_tag LOCUS_14500 3666 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence213 23 229 gene locus_tag LOCUS_14510 23 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 636 331 gene locus_tag LOCUS_14520 gene rpsJ 636 331 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_14520 2857 740 gene locus_tag LOCUS_14530 gene fusA 2857 740 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_14530 3358 2882 gene locus_tag LOCUS_14540 gene rpsG 3358 2882 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_14540 3879 3496 gene locus_tag LOCUS_14550 gene rpsL 3879 3496 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence214 383 1432 gene locus_tag LOCUS_14560 383 1432 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202849.1 protein_id gnl|my_center|LOCUS_14560 1461 2345 gene locus_tag LOCUS_14570 1461 2345 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660290.1 protein_id gnl|my_center|LOCUS_14570 2362 3414 gene locus_tag LOCUS_14580 gene holA 2362 3414 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence215 >Feature sequence216 764 1225 gene locus_tag LOCUS_14590 gene rplM 764 1225 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760800.1 protein_id gnl|my_center|LOCUS_14590 1244 1630 gene locus_tag LOCUS_14600 gene rpsI 1244 1630 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_14600 1756 2526 gene locus_tag LOCUS_14610 gene rpsB 1756 2526 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_14610 2569 3543 gene locus_tag LOCUS_14620 gene tsf 2569 3543 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791746.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence217 1090 515 gene locus_tag LOCUS_14630 1090 515 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_14630 2846 1209 gene locus_tag LOCUS_14640 2846 1209 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence218 183 1556 gene locus_tag LOCUS_14650 183 1556 CDS product NhaD family Na+:H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725372.1 protein_id gnl|my_center|LOCUS_14650 1584 2561 gene locus_tag LOCUS_14660 gene pfkA 1584 2561 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295279.1 protein_id gnl|my_center|LOCUS_14660 3647 2652 gene locus_tag LOCUS_14670 3647 2652 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107223.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence219 76 501 gene locus_tag LOCUS_14680 76 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1814 579 gene locus_tag LOCUS_14690 1814 579 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_14690 3865 1865 gene locus_tag LOCUS_14700 3865 1865 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence220 2909 1785 gene locus_tag LOCUS_14710 2909 1785 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203396.1 protein_id gnl|my_center|LOCUS_14710 3336 2914 gene locus_tag LOCUS_14720 3336 2914 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802402.1 protein_id gnl|my_center|LOCUS_14720 3730 3323 gene locus_tag LOCUS_14730 3730 3323 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802400.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence221 >Feature sequence222 144 3023 gene locus_tag LOCUS_14740 144 3023 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303123.1 protein_id gnl|my_center|LOCUS_14740 3109 3585 gene locus_tag LOCUS_14750 3109 3585 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766233.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence223 2044 494 gene locus_tag LOCUS_14760 2044 494 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767795.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence224 1555 863 gene locus_tag LOCUS_14770 1555 863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_14770 1688 3757 gene locus_tag LOCUS_14780 gene metG 1688 3757 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence225 1516 425 gene locus_tag LOCUS_14790 1516 425 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_14790 3008 1674 gene locus_tag LOCUS_14800 gene mtaB 3008 1674 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763943.1 protein_id gnl|my_center|LOCUS_14800 3389 3544 gene locus_tag LOCUS_14810 3389 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence226 342 728 gene locus_tag LOCUS_14820 342 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 691 1203 gene locus_tag LOCUS_14830 691 1203 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787274.1 protein_id gnl|my_center|LOCUS_14830 1264 2388 gene locus_tag LOCUS_14840 gene thiH 1264 2388 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107371.1 protein_id gnl|my_center|LOCUS_14840 2688 3107 gene locus_tag LOCUS_14850 2688 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3098 3832 gene locus_tag LOCUS_14860 gene thiD 3098 3832 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765649.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence227 476 961 gene locus_tag LOCUS_14870 476 961 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812910.1 protein_id gnl|my_center|LOCUS_14870 1078 2946 gene locus_tag LOCUS_14880 1078 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2967 3860 gene locus_tag LOCUS_14890 2967 3860 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108917.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence228 108 1031 gene locus_tag LOCUS_14900 108 1031 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 protein_id gnl|my_center|LOCUS_14900 1034 2077 gene locus_tag LOCUS_14910 1034 2077 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_14910 2088 2753 gene locus_tag LOCUS_14920 2088 2753 CDS product DUF4827 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657631.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence229 80 1453 gene locus_tag LOCUS_14930 gene gltA 80 1453 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393026.1 protein_id gnl|my_center|LOCUS_14930 2912 1455 gene locus_tag LOCUS_14940 2912 1455 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence230 475 110 gene locus_tag LOCUS_14950 475 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1058 699 gene locus_tag LOCUS_14960 1058 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1465 1689 gene locus_tag LOCUS_14970 1465 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1692 1967 gene locus_tag LOCUS_14980 1692 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1973 2221 gene locus_tag LOCUS_14990 1973 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 2245 3216 gene locus_tag LOCUS_15000 2245 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence231 1347 67 gene locus_tag LOCUS_15010 1347 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 2670 1624 gene locus_tag LOCUS_15020 2670 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 3756 2974 gene locus_tag LOCUS_15030 3756 2974 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence232 323 1120 gene locus_tag LOCUS_15040 323 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15040 1946 3409 gene locus_tag LOCUS_15050 1946 3409 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263383.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence233 100 1092 gene locus_tag LOCUS_15060 100 1092 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763609.1 protein_id gnl|my_center|LOCUS_15060 1633 1253 gene locus_tag LOCUS_15070 1633 1253 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668289.1 protein_id gnl|my_center|LOCUS_15070 3547 1913 gene locus_tag LOCUS_15080 3547 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence234 >Feature sequence235 >Feature sequence236 1266 220 gene locus_tag LOCUS_15090 gene atpB 1266 220 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107411.1 protein_id gnl|my_center|LOCUS_15090 1799 1545 gene locus_tag LOCUS_15100 gene atpC 1799 1545 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_15100 3350 1839 gene locus_tag LOCUS_15110 gene atpD 3350 1839 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787476.1 protein_id gnl|my_center|LOCUS_15110 >Feature sequence237 802 191 gene locus_tag LOCUS_15120 802 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3371 855 gene locus_tag LOCUS_15130 3371 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence238 379 3048 gene locus_tag LOCUS_15140 379 3048 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence239 270 1340 gene locus_tag LOCUS_15150 270 1340 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108203.1 protein_id gnl|my_center|LOCUS_15150 1883 1458 gene locus_tag LOCUS_15160 1883 1458 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763145.1 protein_id gnl|my_center|LOCUS_15160 3020 2085 gene locus_tag LOCUS_15170 3020 2085 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244055.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence240 1306 1554 gene locus_tag LOCUS_15180 1306 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174908.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence241 105 1037 gene locus_tag LOCUS_15190 105 1037 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_15190 1053 1643 gene locus_tag LOCUS_15200 1053 1643 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813361.1 protein_id gnl|my_center|LOCUS_15200 1665 1931 gene locus_tag LOCUS_15210 1665 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15210 1932 2249 gene locus_tag LOCUS_15220 1932 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15220 2285 2884 gene locus_tag LOCUS_15230 gene rsxA 2285 2884 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence242 3173 1233 gene locus_tag LOCUS_15240 3173 1233 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence243 2088 115 gene locus_tag LOCUS_15250 gene gyrB 2088 115 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_15250 2567 2313 gene locus_tag LOCUS_15260 gene rpsT 2567 2313 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_15260 2830 2758 gene locus_tag LOCUS_t00210 2830 2758 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence244 >Feature sequence245 459 887 gene locus_tag LOCUS_15270 459 887 CDS product PepSY-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788539.1 protein_id gnl|my_center|LOCUS_15270 1155 1472 gene locus_tag LOCUS_15280 gene rplU 1155 1472 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759984.1 protein_id gnl|my_center|LOCUS_15280 1492 1761 gene locus_tag LOCUS_15290 gene rpmA 1492 1761 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_15290 2345 2432 gene locus_tag LOCUS_t00220 2345 2432 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence246 2264 261 gene locus_tag LOCUS_15300 2264 261 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence247 2891 108 gene locus_tag LOCUS_15310 2891 108 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_15310 3402 3043 gene locus_tag LOCUS_15320 3402 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence248 585 457 gene locus_tag LOCUS_15330 585 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 695 2338 gene locus_tag LOCUS_15340 695 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3363 3028 gene locus_tag LOCUS_15350 gene rbfA 3363 3028 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence249 1240 2019 gene locus_tag LOCUS_15360 1240 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004322064.1 protein_id gnl|my_center|LOCUS_15360 2038 2772 gene locus_tag LOCUS_15370 2038 2772 CDS product DUF5045 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310178.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence250 136 1293 gene locus_tag LOCUS_15380 136 1293 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_15380 3400 1367 gene locus_tag LOCUS_15390 3400 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence251 510 1295 gene locus_tag LOCUS_15400 gene mazG 510 1295 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_15400 1302 1856 gene locus_tag LOCUS_15410 1302 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2017 3192 gene locus_tag LOCUS_15420 2017 3192 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107212.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence252 111 2231 gene locus_tag LOCUS_15430 111 2231 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201873.1 protein_id gnl|my_center|LOCUS_15430 3159 2365 gene locus_tag LOCUS_15440 3159 2365 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203662.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence253 204 350 gene locus_tag LOCUS_15450 204 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2136 640 gene locus_tag LOCUS_15460 2136 640 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763047.1 protein_id gnl|my_center|LOCUS_15460 3252 2182 gene locus_tag LOCUS_15470 3252 2182 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107293.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence254 65 655 gene locus_tag LOCUS_15480 65 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 680 1510 gene locus_tag LOCUS_15490 680 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2210 3208 gene locus_tag LOCUS_15500 2210 3208 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence255 1290 58 gene locus_tag LOCUS_15510 1290 58 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109160.1 protein_id gnl|my_center|LOCUS_15510 1703 1287 gene locus_tag LOCUS_15520 gene folK 1703 1287 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762823.1 protein_id gnl|my_center|LOCUS_15520 3172 1976 gene locus_tag LOCUS_15530 gene queA 3172 1976 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783637.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence256 >Feature sequence257 1719 589 gene locus_tag LOCUS_15540 1719 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 <3272 1826 gene locus_tag LOCUS_15550 <3272 1826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964075.1:gliding motility lipoprotein GldK >Feature sequence258 1024 116 gene locus_tag LOCUS_15560 1024 116 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020424.1 protein_id gnl|my_center|LOCUS_15560 2997 1180 gene locus_tag LOCUS_15570 2997 1180 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695098.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence259 1850 1683 gene locus_tag LOCUS_15580 1850 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3073 1853 gene locus_tag LOCUS_15590 3073 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence260 2146 422 gene locus_tag LOCUS_15600 gene recJ 2146 422 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760859.1 protein_id gnl|my_center|LOCUS_15600 3109 2159 gene locus_tag LOCUS_15610 3109 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence261 281 132 gene locus_tag LOCUS_15620 281 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3006 289 gene locus_tag LOCUS_15630 3006 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence262 259 1023 gene locus_tag LOCUS_15640 259 1023 CDS product DUF4369 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789092.1 protein_id gnl|my_center|LOCUS_15640 1030 2373 gene locus_tag LOCUS_15650 1030 2373 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766200.1 protein_id gnl|my_center|LOCUS_15650 2456 3094 gene locus_tag LOCUS_15660 2456 3094 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760542.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence263 81 617 gene locus_tag LOCUS_15670 81 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 3015 925 gene locus_tag LOCUS_15680 3015 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence264 <3177 440 gene locus_tag LOCUS_15690 <3177 440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202911.1:pyruvate, phosphate dikinase >Feature sequence265 1022 444 gene locus_tag LOCUS_15700 gene pdxT 1022 444 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113516.1 protein_id gnl|my_center|LOCUS_15700 1924 1040 gene locus_tag LOCUS_15710 gene pdxS 1924 1040 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813582.1 protein_id gnl|my_center|LOCUS_15710 2849 1953 gene locus_tag LOCUS_15720 2849 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence266 >Feature sequence267 92 343 gene locus_tag LOCUS_15730 92 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 461 2641 gene locus_tag LOCUS_15740 461 2641 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence268 1925 975 gene locus_tag LOCUS_15750 1925 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2946 1912 gene locus_tag LOCUS_15760 2946 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence269 >Feature sequence270 <1 1059 gene locus_tag LOCUS_15770 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763251.1:electron transfer flavoprotein subunit alpha/FixB family protein 1197 2951 gene locus_tag LOCUS_15780 1197 2951 CDS product Acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763249.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence271 2122 251 gene locus_tag LOCUS_15790 2122 251 CDS product DNA topoisomerase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 protein_id gnl|my_center|LOCUS_15790 2859 2170 gene locus_tag LOCUS_15800 gene cmk 2859 2170 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761050.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence272 169 1329 gene locus_tag LOCUS_15810 169 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 <2982 1517 gene locus_tag LOCUS_15820 <2982 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762675.1:SLC13 family permease >Feature sequence273 771 124 gene locus_tag LOCUS_15830 gene rpe 771 124 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109031.1 protein_id gnl|my_center|LOCUS_15830 1403 1059 gene locus_tag LOCUS_15840 gene rplT 1403 1059 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786577.1 protein_id gnl|my_center|LOCUS_15840 1644 1447 gene locus_tag LOCUS_15850 gene rpmI 1644 1447 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786574.1 protein_id gnl|my_center|LOCUS_15850 2416 1715 gene locus_tag LOCUS_15860 gene infC 2416 1715 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_15860 2647 2958 gene locus_tag LOCUS_15870 2647 2958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence274 205 1185 gene locus_tag LOCUS_15880 205 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1259 1804 gene locus_tag LOCUS_15890 1259 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1804 2526 gene locus_tag LOCUS_15900 1804 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence275 309 1172 gene locus_tag LOCUS_15910 309 1172 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_15910 1307 2776 gene locus_tag LOCUS_15920 1307 2776 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence276 514 5 gene locus_tag LOCUS_15930 514 5 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202319.1 protein_id gnl|my_center|LOCUS_15930 2646 709 gene locus_tag LOCUS_15940 gene dnaK 2646 709 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785809.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence277 1 636 gene locus_tag LOCUS_15950 1 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2827 845 gene locus_tag LOCUS_15960 2827 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence278 823 101 gene locus_tag LOCUS_15970 823 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1222 842 gene locus_tag LOCUS_15980 1222 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 2758 1838 gene locus_tag LOCUS_15990 2758 1838 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence279 1323 958 gene locus_tag LOCUS_16000 1323 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1703 1320 gene locus_tag LOCUS_16010 1703 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1984 2613 gene locus_tag LOCUS_16020 gene pyrE 1984 2613 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence280 913 368 gene locus_tag LOCUS_16030 913 368 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_16030 1305 982 gene locus_tag LOCUS_16040 1305 982 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764901.1 protein_id gnl|my_center|LOCUS_16040 2135 2449 gene locus_tag LOCUS_16050 2135 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16050 2456 2659 gene locus_tag LOCUS_16060 2456 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence281 413 1918 gene locus_tag LOCUS_16070 413 1918 CDS product acetyl-CoA hydrolase/transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767431.1 protein_id gnl|my_center|LOCUS_16070 1960 2430 gene locus_tag LOCUS_16080 1960 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16080 2455 2769 gene locus_tag LOCUS_16090 2455 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16090 >Feature sequence282 1367 657 gene locus_tag LOCUS_16100 1367 657 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766123.1 protein_id gnl|my_center|LOCUS_16100 <2844 1480 gene locus_tag LOCUS_16110 <2844 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005422351.1:sodium/sugar symporter >Feature sequence283 210 1853 gene locus_tag LOCUS_16120 210 1853 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788903.1 protein_id gnl|my_center|LOCUS_16120 1856 2680 gene locus_tag LOCUS_16130 1856 2680 CDS product glycoside hydrolase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788900.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence284 1786 320 gene locus_tag LOCUS_16140 gene asnS 1786 320 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_16140 <2833 1853 gene locus_tag LOCUS_16150 <2833 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760797.1:pseudouridine synthase >Feature sequence285 2333 24 gene locus_tag LOCUS_16160 2333 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2602 2432 gene locus_tag LOCUS_16170 2602 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence286 639 202 gene locus_tag LOCUS_16180 639 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 1736 636 gene locus_tag LOCUS_16190 1736 636 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261512.1 protein_id gnl|my_center|LOCUS_16190 1961 2233 gene locus_tag LOCUS_16200 1961 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence287 901 167 gene locus_tag LOCUS_16210 901 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1160 1828 gene locus_tag LOCUS_16220 1160 1828 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_16220 1828 2367 gene locus_tag LOCUS_16230 1828 2367 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence288 894 115 gene locus_tag LOCUS_16240 894 115 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_16240 1721 897 gene locus_tag LOCUS_16250 1721 897 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026184121.1 protein_id gnl|my_center|LOCUS_16250 2494 1712 gene locus_tag LOCUS_16260 2494 1712 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence289 905 714 gene locus_tag LOCUS_16270 905 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence290 1624 809 gene locus_tag LOCUS_16280 1624 809 CDS product phosphorylcholine transferase LicD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905211.1 protein_id gnl|my_center|LOCUS_16280 <2690 1681 gene locus_tag LOCUS_16290 <2690 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249414.1:ATP-binding protein >Feature sequence291 125 2317 gene locus_tag LOCUS_16300 gene recQ 125 2317 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229616.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence292 1306 2283 gene locus_tag LOCUS_16310 1306 2283 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108724.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence293 739 173 gene locus_tag LOCUS_16320 739 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760131.1 protein_id gnl|my_center|LOCUS_16320 1927 2373 gene locus_tag LOCUS_16330 1927 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence294 330 938 gene locus_tag LOCUS_16340 330 938 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761032.1 protein_id gnl|my_center|LOCUS_16340 963 2039 gene locus_tag LOCUS_16350 gene aroC 963 2039 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence295 209 691 gene locus_tag LOCUS_16360 209 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 727 2250 gene locus_tag LOCUS_16370 727 2250 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786530.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence296 2030 372 gene locus_tag LOCUS_16380 2030 372 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_16380 <2631 2066 gene locus_tag LOCUS_16390 <2631 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784714.1:UMP kinase >Feature sequence297 <1 610 gene locus_tag LOCUS_16400 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946538.1:sulfate permease 1774 1154 gene locus_tag LOCUS_16410 1774 1154 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_16410 2210 1800 gene locus_tag LOCUS_16420 2210 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence298 2279 1116 gene locus_tag LOCUS_16430 2279 1116 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence299 666 1859 gene locus_tag LOCUS_16440 gene lpxK 666 1859 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_16440 1774 2562 gene locus_tag LOCUS_16450 1774 2562 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence300 1328 984 gene locus_tag LOCUS_16460 gene rplT 1328 984 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786577.1 protein_id gnl|my_center|LOCUS_16460 1558 1361 gene locus_tag LOCUS_16470 gene rpmI 1558 1361 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_16470 2493 1804 gene locus_tag LOCUS_16480 gene infC 2493 1804 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695168.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence301 71 625 gene locus_tag LOCUS_16490 71 625 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203642.1 protein_id gnl|my_center|LOCUS_16490 622 978 gene locus_tag LOCUS_16500 gene crcB 622 978 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785744.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence302 129 1589 gene locus_tag LOCUS_16510 129 1589 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_16510 1657 1776 gene locus_tag LOCUS_16520 1657 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1767 2417 gene locus_tag LOCUS_16530 1767 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence303 2287 920 gene locus_tag LOCUS_16540 gene purB 2287 920 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_16540